Join the 200th Anniversary Celebration

Original Article

Rapid Molecular Detection of Tuberculosis and Rifampin Resistance

Catharina C. Boehme, M.D., Pamela Nabeta, M.D., Doris Hillemann, Ph.D., Mark P. Nicol, Ph.D., Shubhada Shenai, Ph.D., Fiorella Krapp, M.D., Jenny Allen, B.Tech., Rasim Tahirli, M.D., Robert Blakemore, B.S., Roxana Rustomjee, M.D., Ph.D., Ana Milovic, M.S., Martin Jones, Ph.D., Sean M. O'Brien, Ph.D., David H. Persing, M.D., Ph.D., Sabine Ruesch-Gerdes, M.D., Eduardo Gotuzzo, M.D., Camilla Rodrigues, M.D., David Alland, M.D., and Mark D. Perkins, M.D.

N Engl J Med 2010; 363:1005-1015September 9, 2010

Abstract

Background

Global control of tuberculosis is hampered by slow, insensitive diagnostic methods, particularly for the detection of drug-resistant forms and in patients with human immunodeficiency virus infection. Early detection is essential to reduce the death rate and interrupt transmission, but the complexity and infrastructure needs of sensitive methods limit their accessibility and effect.

Methods

We assessed the performance of Xpert MTB/RIF, an automated molecular test for Mycobacterium tuberculosis (MTB) and resistance to rifampin (RIF), with fully integrated sample processing in 1730 patients with suspected drug-sensitive or multidrug-resistant pulmonary tuberculosis. Eligible patients in Peru, Azerbaijan, South Africa, and India provided three sputum specimens each. Two specimens were processed with N-acetyl-L-cysteine and sodium hydroxide before microscopy, solid and liquid culture, and the MTB/RIF test, and one specimen was used for direct testing with microscopy and the MTB/RIF test.

Results

Among culture-positive patients, a single, direct MTB/RIF test identified 551 of 561 patients with smear-positive tuberculosis (98.2%) and 124 of 171 with smear-negative tuberculosis (72.5%). The test was specific in 604 of 609 patients without tuberculosis (99.2%). Among patients with smear-negative, culture-positive tuberculosis, the addition of a second MTB/RIF test increased sensitivity by 12.6 percentage points and a third by 5.1 percentage points, to a total of 90.2%. As compared with phenotypic drug-susceptibility testing, MTB/RIF testing correctly identified 200 of 205 patients (97.6%) with rifampin-resistant bacteria and 504 of 514 (98.1%) with rifampin-sensitive bacteria. Sequencing resolved all but two cases in favor of the MTB/RIF assay.

Conclusions

The MTB/RIF test provided sensitive detection of tuberculosis and rifampin resistance directly from untreated sputum in less than 2 hours with minimal hands-on time. (Funded by the Foundation for Innovative New Diagnostics.)

Media in This Article

Figure 1Enrollment and Outcomes.
Figure 2Assay Procedure for the MTB/RIF Test.
Article

Only a small fraction of the estimated 500,000 patients who have multidrug-resistant tuberculosis and 1.37 million patients who have coinfection with tuberculosis and the human immunodeficiency virus (HIV) worldwide each year have access to sufficiently sensitive case detection or drug-susceptibility testing.1 Diagnostic delay, aggravated by the disproportionate frequency of smear-negative disease in HIV-associated tuberculosis, is common.2-5 The failure to quickly recognize and treat affected patients leads to increased mortality, secondary resistance (including extensively drug-resistant tuberculosis), and ongoing transmission.6,7 The complexity of mycobacterial culture and current nucleic acid–amplification technologies for the detection of tuberculosis and multidrug-resistant tuberculosis8 and the need for the associated infrastructure restrict the use of such tests to reference laboratories.

To respond to the urgent need for simple and rapid diagnostic tools at the point of treatment in high-burden countries,9 a fully automated molecular test for tuberculosis case detection and drug-resistance testing was developed through collaboration in a public–private partnership. Xpert MTB/RIF, an automated molecular test for Mycobacterium tuberculosis (MTB) and resistance to rifampin (RIF), uses heminested real-time polymerase-chain-reaction (PCR) assay to amplify an MTB-specific sequence of the rpoB gene, which is probed with molecular beacons for mutations within the rifampin-resistance determining region.10,11 Testing is carried out on the MTB/RIF test platform (GeneXpert, Cepheid), which integrates sample processing and PCR in a disposable plastic cartridge containing all reagents required for bacterial lysis, nucleic acid extraction, amplification, and amplicon detection.12 The only manual step is the addition of a bactericidal buffer to sputum before transferring a defined volume to the cartridge. The MTB/RIF cartridge is then inserted into the GeneXpert device, which provides results within 2 hours.

In accordance with recommendations on design and conduct of diagnostic accuracy assessments,13 we undertook a multicenter, prospective evaluation of the MTB/RIF test to determine its sensitivity and specificity in the intended target population as compared with the best available reference standard.

Methods

Study Population

From July 2008 through March 2009, we conducted this study at five trial sites in Lima, Peru; Baku, Azerbaijan; Cape Town and Durban, South Africa; and Mumbai, India. We enrolled consecutive adults with symptoms suggestive of pulmonary tuberculosis or multidrug-resistant tuberculosis who were able to provide three sputum samples of at least 1.5 ml. Patients in the group at risk for pulmonary tuberculosis were eligible only if they had not received a tuberculosis medication within the past 60 days, whereas the group at risk for multidrug-resistant disease included patients who had undergone previous treatment, those with nonconverting pulmonary tuberculosis who were receiving therapy, and symptomatic contacts of patients with known multidrug-resistant disease. All patients were enrolled from populations that were selected for diversity in the prevalence of tuberculosis, HIV coinfection, and multidrug resistance. (For details regarding the sites, see the Supplementary Appendix, available with the full text of this article at NEJM.org.)

The study protocol was reviewed and approved by eight institutional review boards or technical committees at the ministerial level. The study was conducted in accordance with the protocol (available at NEJM.org). Written informed consent was obtained from all patients. Study participation did not alter the standard of care.

Study Design and Oversight

This study was designed and supervised by the sponsor, the Foundation for Innovative New Diagnostics (FIND). Additional development support was provided by the National Institutes of Health, Cepheid, and the Bill and Melinda Gates Foundation, none of which were involved in the design or conduct of the study. Data were collected by investigators at each study site, and statistical analyses were performed by a statistician who was not involved in data collection. FIND authors wrote the first draft of the manuscript. All authors vouch for the accuracy and completeness of the data reported.

Laboratory Methods

Patients meeting the clinical eligibility criteria were asked to provide three sputum specimens over a 2-day period (two spot samples and one obtained in the morning) (Figure 1Figure 1Enrollment and Outcomes.). In a random fashion, two of the three samples were processed with N-acetyl-L-cysteine and sodium hydroxide (NALC–NaOH),14 followed by centrifugation, and then were resuspended in 1.5 ml of phosphate buffer and subjected to microscopy with Ziehl–Neelsen staining, and cultivation on solid medium (egg-based Löwenstein–Jensen15 or 7H11,16 with the latter medium used only in Durban) and liquid medium (BACTEC MGIT [mycobacteria growth indicator tube] 960 culture; BD Microbiology Systems), and the MTB/RIF test. The third sputum sample was tested directly by Ziehl–Neelsen microscopy and the MTB/RIF test without NALC–NaOH decontamination.

The first positive culture from each specimen underwent confirmation of M. tuberculosis species by MPT64 antigen detection (Capilia TB, Tauns Laboratories)17 and indirect drug-susceptibility testing with the proportion method on Löwenstein–Jensen medium (for sites in Lima, Durban, and Baku) or MGIT SIRE18 (for sites in Cape Town and Mumbai). For three sites, conventional nucleic acid–amplification testing was carried out on DNA that was extracted from the NALC–NaOH centrifugation pellet of the first sputum sample with the use of Cobas Amplicor MTB (Roche) (in Cape Town and Mumbai) or ProbeTec ET MTB Complex Direct Detection Assay (BD) (in Baku), according to the manufacturer's instructions. At three sites, drug-resistant genotyping was carried out by line-probe assay with the use of the Genotype MTBDRplus assay (Hain Lifescience) performed from culture isolates (in Baku) or from the NALC–NaOH pellet of the second sputum sample (in Cape Town and Durban), according to the manufacturer's instructions, except that smear-negative specimens were also tested.

All participating laboratories were quality-assured reference laboratories. Study laboratories for four sites were located within 5 km of the enrollment clinic and tested samples within 2 days after collection. Sputum samples from Baku were shipped to the German National Reference Laboratory in Borstel for testing 1 to 5 days after collection.

Repeat tuberculosis analyses (smear, culture, MTB/RIF test, radiography, and clinical workup) were performed in patients who had smear- and culture-negative samples if the MTB/RIF test or other nucleic acid–amplification test was positive or if the patient was selected by the central database as a random control for follow-up. The final diagnosis for patients undergoing repeat analyses was established on the basis of conventional laboratory results and clinical information by clinical review committees composed of three local tuberculosis clinicians. HIV results were obtained by review of clinical records and were available for only a subgroup of patients. Bias was minimized through blinding, since technicians performing molecular and reference tests were not aware of the results of other tests. The interpretation of data from MTB/RIF tests was software-based and independent of the user. Clinical teams and review committees did not have access to nucleic acid–amplification test results. All study coordinators received lists of patients for follow-up but not the reasons for follow-up.

Categories for Analysis

Patients were divided into four categories for analysis: those with smear- and culture-positive pulmonary tuberculosis; those with smear-negative, culture-positive pulmonary tuberculosis; those with no bacteriologic evidence of tuberculosis who had improvement without treatment (no tuberculosis); and those who were smear- and culture-negative for pulmonary tuberculosis who nonetheless were treated for tuberculosis on the basis of clinical and radiologic findings (clinical tuberculosis). A smear-positive case was defined as at least two smears of scanty grade (1 to 10 acid-fast bacilli per 100 fields) or one or more smears of 1+ or more (10 to 99 bacilli per 100 fields). A culture-positive case was defined as positive results on at least one of four culture vials. Because a clear final diagnosis was required, patients with an indeterminate diagnosis were excluded from the main analysis if there was a negative culture result while the patient was receiving tuberculosis treatment (for patients with suspected multidrug resistance), contamination of at least three of four cultures, growth of nontuberculous mycobacteria only, indeterminate phenotypic rifampin susceptibility, a negative culture with a positive sputum smear, or suspected cross-contamination of cultures (i.e., only one of four cultures had positive results after >28 days to growth in MGIT or <20 colonies in Löwenstein–Jensen medium) or if the patient died or was lost to follow-up.

MTB/RIF Test

The MTB/RIF test was performed as described previously19,20 (Figure 2Figure 2Assay Procedure for the MTB/RIF Test.). Two laboratory technicians were trained as operators and passed proficiency testing after four runs per person. Sample reagent was added in a 2:1 ratio to untreated sputum and in a 3:1 ratio to decontaminated sputum pellets. The additional sample reagent in pellets was necessary to meet the volume requirements for the assay sample. The closed sputum container was manually agitated twice during a 15-minute period at room temperature before 2 ml of the inactivated material was transferred to the test cartridge (equivalent to 0.7 ml of untreated sputum or 0.5 ml of decontaminated pellet). Cartridges were inserted into the test platform, which was located in the microscopy room or another general-purpose laboratory space. The electronic results were sent directly from the MTB/RIF test system to the central database.

Sequencing

Bidirectional sequencing was performed on the 81-bp rpoB core region of culture isolates in all rifampin-resistant and discordant strains with forward (CGTGGAGGCGATCACACCGCAGAC) and reverse (AGCTCCAGCCCGGCACGCTCACGT) primers with the use of the BigDye Terminator Cycle Sequencing kit, according to the manufacturer's recommendations, in a 3130xl Genetic Analyzer (Applied Biosystems). Traces were analyzed with ABI sequence-analysis software, version 5.2.0.

Statistical Analysis

Sensitivity and specificity for the MTB/RIF test were estimated for a single direct test, a single test on a pelleted sample, the combination of two tests (one direct and one pelleted), and the combination of three tests (one direct and two pelleted). Combinations were classified as positive if at least one of the component test results was positive. The indeterminate rate was the number of tests classified as “invalid,” “error,” or “no result” divided by the total number performed. When results were indeterminate and sufficient sample remained, the assay was repeated once, and the second result was used for analysis. For analyzing the single direct test and the combination of three tests, Wilson's binomial method was used to calculate 95% confidence intervals.21 For all other intrapatient MTB/RIF results, and for comparisons across subgroups and testing methods, generalized estimating equations were used for calculating confidence intervals to account for within-patient clustering.22

Results

Patients

Of the 1462 patients (4386 samples) included in the analysis, 567 (38.8%) had smear- and culture-positive tuberculosis; 174 (11.9%) had smear-negative, culture-positive tuberculosis; 105 (7.2%) had clinically defined tuberculosis; and 616 (42.1%) had no clinical evidence of tuberculosis (Table 1Table 1Demographic and Clinical Characteristics of the Patients, Diagnosis Group at Enrollment, and Distribution in Final Diagnostic Category.). Of patients with culture-positive samples, 207 of 741 (27.9%) were found to have multidrug resistance on conventional drug-susceptibility testing. A total of 113 patients were not eligible for testing because of an inadequate number of sputum samples (in 103 patients) or an inadequate volume of sputum samples (in 10). A total of 268 patients were excluded from the analysis for a variety of reasons, including 115 who had culture-negative samples but were receiving tuberculosis treatment at enrollment because of suspected multidrug resistance (Figure 1).

Sensitivity and Specificity

Case Detection

Among patients with culture-positive tuberculosis, the overall sensitivity of the MTB/RIF test was 97.6%. The sensitivity was 99.8% for smear- and culture-positive cases and 90.2% for smear-negative, culture-positive cases, with no significant variation in overall sensitivity across sites (P=0.24 by chi-square test) (Table 2Table 2Overall Sensitivity and Specificity of the MTB/RIF Test, According to the Number of Tests per Patient, as Compared with Three Smears and Four Cultures.). Testing of multiple specimens per patient had a modest effect over the yield of a single assay performed directly on sputum. The sensitivity of a single direct MTB/RIF test for culture-confirmed tuberculosis was 92.2% and rose to 96.0% with the additional testing of a pelleted sample. For the detection of smear-negative, culture-positive tuberculosis, the sensitivity of the assay was 72.5% for one test, 85.1% for two tests, and 90.2% for three tests. A single, direct MTB/RIF test identified a greater proportion of culture-positive patients than did a single Löwenstein–Jensen culture (Table 1 in the Supplementary Appendix). Among HIV-positive patients with pulmonary tuberculosis, the sensitivity of the MTB/RIF test was 93.9%, as compared with 98.4% in HIV-negative patients (P=0.02). There was no significant difference in sensitivity between tests on untreated sputum and those on decontaminated pellet (P=0.16).

The estimated specificity was 99.2% for a single direct MTB/RIF test, 98.6% for two MTB/RIF tests, and 98.1% for three MTB/RIF tests. At sites performing alternative nucleic acid–amplification testing, the sensitivity of the MTB/RIF test performed directly on sputum was higher than that of Amplicor (94.6% vs. 86.8%, P<0.01) and similar to that of ProbeTec (83.7% vs. 83.9%, P=0.96) performed on extracted DNA from sputum pellets. The specificity of the MTB/RIF test did not differ significantly from that of Amplicor or Probetec (Table 2 in the Supplementary Appendix).

Detection of Multidrug Resistance

Table 3Table 3Sensitivity and Specificity of the MTB/RIF Test for the Detection of Rifampin and Multidrug Resistance, as Compared with Phenotypic Drug-Susceptibility Testing Alone and in Combination with Sequencing of Discrepant Cases, According to Site. shows the sensitivity and specificity of the MTB/RIF test for the detection of rifampin and multidrug resistance (resistance to both rifampin and isoniazid). For 15 of 718 patients for whom results on the MTB/RIF test were discrepant on phenotypic testing, sequencing confirmed resistance-associated rpoB mutations in nine strains that were identified as rifampin-sensitive on drug-susceptibility testing, determined the presence of a wild-type allele in one strain deemed rifampin-resistant on drug-susceptibility testing, and identified 3 patients with mixed infection containing wild-type and mutant strains in the same culture. Taking sequencing results into account, the MTB/RIF test correctly detected rifampin resistance in 209 of 211 patients (99.1% sensitivity) and in all 506 patients with rifampin susceptibility (100% specificity).

The rpoB mutations found in this study were representative of the global situation: 16 different mutations were identified, but a limited number, notably in codons 516, 526 and 531, accounted for almost all resistant strains.

Using the South African samples, we compared the performance of the direct Genotype MTBDRplus assay with that of the MTB/RIF test. In smear-positive sputum samples, the MTBDRplus assay showed a sensitivity equivalent to that of the MTB/RIF test. However, in samples from smear-negative, culture-positive patients, for which the MTBDRplus assay is not indicated, the MTBDRplus assay provided a false negative result in 37 of 67 samples (55.2%).

In a subgroup of 115 patients with culture-negative tuberculosis who had suspected multidrug resistance and were receiving tuberculosis treatment (and who were excluded from the main analysis), 51 had positive results on the MTB/RIF test, and rifampin resistance was detected in 8. We observed that all 8 patients were later started on second-line therapy for treatment failure by physicians who were unaware of the results on MTB/RIF testing. In comparison, none of 8 randomly selected patients from the same cohort with positive results on MTB/RIF testing that did not detect rifampin resistance were given second-line tuberculosis treatment. Although the manufacturer currently recommends that the MTB/RIF test be used for patients with suspected tuberculosis who have not received treatment, our data provide a first indication that the test also detects multidrug-resistant tuberculosis in patients who are receiving therapy, even after culture conversion.

Indeterminate Rate

The MTB/RIF test was indeterminate in 192 of 5190 tests performed (3.7%), a rate that was lower than the overall culture-contamination rate (5.5%) in 381 of 6920 MGIT and Löwenstein–Jensen cultures (P<0.001). Allowing for one repeat test, the indeterminate rate dropped to 1.2% (63 of 5190 tests). Valid results were obtained in 129 of 139 repeat tests (92.8%). No patient had indeterminate results on all samples tested. A total of 20 of 2072 samples (1.0%) with positive results had an indeterminate result for rifampin resistance. These indeterminate rifampin results all occurred in smear-negative, culture-positive sputum samples with a very late cycle threshold (35 to 37 cycles) in the MTB/RIF test. A software change allowing the assay to analyze results for up to 40 cycles would have eliminated 19 of the 20 indeterminate results without affecting the specificity of the assay.

Discussion

In our study, an assay that was designed for point-of-treatment use in low-income countries accurately detected pulmonary tuberculosis and screened for rifampin resistance. This assay identified more than 97% of all patients with culture-confirmed tuberculosis who met the inclusion criteria, including more than 90% of patients with smear-negative disease. Performance both for case detection and discrimination of rifampin resistance was similar across diverse sites, suggesting that the findings are likely to be widely applicable. In view of the low sensitivity of smear microscopy for the diagnosis of tuberculosis in patients with HIV infection, the increased sensitivity of the MTB/RIF test — notably, among patients with smear-negative tuberculosis — at the two South African sites with 60 to 80% prevalence of HIV infection is encouraging.

There are several reasons why the findings of this study might not translate widely into improved care for patients with tuberculosis. First, only reference facilities were used in the study, and it is not certain that our findings would be replicated in microscopy centers, health posts, and other point-of-treatment settings where temperature and electricity supply will be more variable and training issues will be more relevant. However, qualitative questionnaires that were completed during the study suggested that users considered 2 to 3 days a sufficient duration of training for technicians without previous molecular experience (as compared with 2 weeks for Ziehl–Neelsen microscopy). The relative simplicity of the MTB/RIF test, plus its hands-on time of under 15 minutes and its unambiguous readout, is advantageous, whereas the need for annual calibration was identified as a challenge for implementation at peripheral laboratories, especially in rural areas. Large-scale projects to show the feasibility and effect of MTB/RIF testing at such sites are under way.

Second, to achieve great simplicity of use, the MTB/RIF test uses sophisticated technology, which is costly to manufacture. Although FIND has negotiated concessionary pricing for public-sector programs in low-income countries and is working to further lower the costs of testing, the costs of instruments and tests will still be considerably higher than those for microscopy, which is all that is currently available in peripheral health care settings in many countries. However, MTB/RIF testing could be less costly than implementation of culture and drug-susceptibility testing.

Globally, ineffective tuberculosis detection and the rise of multidrug resistance and extensively drug-resistant tuberculosis have led to calls for dramatic expansion of culture capability and drug-susceptibility testing in countries in which the disease is endemic.23 Unfortunately, the infrastructure and trained personnel required for such testing are not available except in a limited number of reference centers, and results of testing are often not available for at least 4 months, which dramatically reduces its clinical utility.24,25 The complexity of standard nucleic acid–amplification tests prevents the expansion of this method. The MTB/RIF test automates DNA extraction, amplification, and detection inside a test cartridge that is never reopened, with little chance of amplicon contamination. Specimen processing is simplified to a single nonprecise step that both liquefies and inactivates sputum, which results in a reduction in viable tubercle bacilli of 6 to 8 logs and eliminates the necessity for a biosafety cabinet. Data from a recent study confirm that the MTB/RIF assay generates no infectious aerosols.26 These features of simplicity and safety of use could allow for cost-effective and highly sensitive detection of tuberculosis and drug resistance outside reference centers, which would increase access to testing and decrease delays in diagnosis, without the need to build large numbers of laboratories equipped for advanced biosafety.

Supported by FIND (for clinical evaluation and assay development) and grants from the National Institutes of Health (AI52523), Cepheid, and the Bill and Melinda Gates Foundation (for assay development).

Disclosure forms provided by the authors are available with the full text of this article at NEJM.org.

This article (10.1056/NEJMoa0907847) was published on September 1, 2010, at NEJM.org.

We thank the clinical and laboratory teams at the partner sites for their efforts in the implementation, conduct, and timely completion of the study; Justine de Grandpré and Dr. Ranald Sutherland for their continuous technical support and project management during assay development; and FIND logistics officer Nora Champouillon and data manager Pierrick Gonnet for facilitating the project.

Source Information

From the Foundation for Innovative New Diagnostics, Geneva (C.C.B., P.N., M.D.P.); Forschungszentrum Borstel, Borstel, Germany (D.H., S.R.-G.); the Department of Clinical Laboratory Sciences, University of Cape Town, and National Health Laboratory Service, Cape Town (M.P.N., A.M.), and the Unit for Clinical and Biomedical TB Research, South African Medical Research Council, Durban (J.A., R.R.) — all in South Africa; P.D. Hinduja National Hospital and Medical Research Centre (Hinduja), Mumbai, India (S.S., C.R.); Instituto de Medicina Tropical Alexander von Humboldt, Universidad Peruana Cayetano Heredia, Lima, Peru (F.K., E.G.); Special Treatment Institution, Baku, Azerbaijan (R.T.); the Division of Infectious Diseases, New Jersey Medical School, University of Medicine and Dentistry of New Jersey, Newark (R.B., D.A.); Cepheid, Sunnyvale, CA (M.J., D.H.P.); and the Department of Biostatistics and Bioinformatics, Duke University Medical Center, Durham, NC (S.M.O.).

Address reprint requests to Dr. Boehme at the Foundation for Innovative New Diagnostics, Ave. de Budé 16, 1202 Geneva, Switzerland, or at .

References

References

  1. 1

    Global tuberculosis control — epidemiology, strategy, financing: WHO report. Geneva: World Health Organization, 2009. (WHO/HTM/TB/2009.411.)

  2. 2

    Perkins MD, Cunningham J. Facing the crisis: improving the diagnosis of tuberculosis in the HIV era. J Infect Dis 2007;196:Suppl 1:S15-S27
    CrossRef | Web of Science | Medline

  3. 3

    Getahun H, Harrington M, O'Brien R, Nunn P. Diagnosis of smear-negative pulmonary tuberculosis in people with HIV infection or AIDS in resource-constrained settings: informing urgent policy changes. Lancet 2007;369:2042-2049
    CrossRef | Web of Science | Medline

  4. 4

    Havlir DV, Getahun H, Sanne I, Nunn P. Opportunities and challenges for HIV care in overlapping HIV and TB epidemics. JAMA 2008;300:423-430
    CrossRef | Web of Science | Medline

  5. 5

    Uys PW, Warren RM, van Helden PD. A threshold value for the time delay to TB diagnosis. PLoS One 2007;2:e757-e757
    CrossRef | Web of Science | Medline

  6. 6

    Farmer P, Bayona J, Becerra M, et al. The dilemma of MDR-TB in the global era. Int J Tuberc Lung Dis 1998;2:869-876
    Web of Science | Medline

  7. 7

    Van Rie A, Enarson D. XDR tuberculosis: an indicator of public-health negligence. Lancet 2006;368:1554-1556
    CrossRef | Web of Science | Medline

  8. 8

    Palomino JC. Molecular detection, identification and drug resistance detection in Mycobacterium tuberculosis. FEMS Immunol Med Microbiol 2009;56:103-111
    CrossRef | Web of Science | Medline

  9. 9

    Urdea M, Penny LA, Olmsted SS, et al. Requirements for high impact diagnostics in the developing world. Nature 2006;444:Suppl 1:73-79
    CrossRef | Medline

  10. 10

    El-Hajj HH, Marras SA, Tyagi S, Kramer FR, Alland D. Detection of rifampin resistance in Mycobacterium tuberculosis in a single tube with molecular beacons. J Clin Microbiol 2001;39:4131-4137
    CrossRef | Web of Science | Medline

  11. 11

    Piatek AS, Tyagi S, Pol AC, et al. Molecular beacon sequence analysis for detecting drug resistance in Mycobacterium tuberculosis. Nat Biotechnol 1998;16:359-363
    CrossRef | Web of Science | Medline

  12. 12

    Raja S, Ching J, Xi L, et al. Technology for automated, rapid, and quantitative PCR or reverse transcription-PCR clinical testing. Clin Chem 2005;51:882-890
    CrossRef | Web of Science | Medline

  13. 13

    Bossuyt PM, Reitsma JB, Bruns DE, et al. Towards complete and accurate reporting of studies of diagnostic accuracy: the STARD initiative: Standards for Reporting of Diagnostic Accuracy. Clin Chem 2003;49:1-6
    CrossRef | Web of Science | Medline

  14. 14

    Kent PT, Kubica GP, eds. Public health mycobacteriology: a guide for the Level III laboratory. Atlanta: Centers for Disease Control, 1985.

  15. 15

    Laboratory services in tuberculosis control. Geneva: World Health Organization, 1998. (WHO/TB/98.258.)

  16. 16

    Cohn ML, Waggoner RF, McClatchy JK. The 7H11 medium for the cultivation of mycobacteria. Am Rev Respir Dis 1968;98:295-296
    Web of Science | Medline

  17. 17

    Hillemann D, Rusch-Gerdes S, Richter E. Application of the Capilia TB assay for culture confirmation of Mycobacterium tuberculosis complex isolates. Int J Tuberc Lung Dis 2005;9:1409-1411
    Web of Science | Medline

  18. 18

    Siddiqi SH, Ruesch-Gerdes S. MGIT procedure manual for BACTEC MGIT 960 TB System. Franklin Lakes, NJ: Beckton, Dickinson, July 2006.

  19. 19

    Helb D, Jones M, Story E, et al. Rapid detection of Mycobacterium tuberculosis and rifampin resistance by use of on-demand, near-patient technology. J Clin Microbiol 2010;48:229-237
    CrossRef | Web of Science | Medline

  20. 20

    Blakemore R, Story E, Helb D, et al. Evaluation of the analytical performance of the Xpert MTB/RIF Assay. J Clin Microbiol 2010;48:2495-2501
    CrossRef | Web of Science | Medline

  21. 21

    Agresti A, Coull B. Approximate is better than “exact” for interval estimation of binomial proportions. Am Stat 1998;52:119-126
    CrossRef | Web of Science

  22. 22

    Zeger SL, Liang KY. Longitudinal data analysis for discrete and continuous outcomes. Biometrics 1986;42:121-130
    CrossRef | Web of Science | Medline

  23. 23

    Stop TB Partnership: the global plan to stop TB 2006–2015. Geneva: World Health Organization, 2006.

  24. 24

    Yagui M, Perales MT, Asencios L, et al. Timely diagnosis of MDR-TB under program conditions: is rapid drug susceptibility testing sufficient? Int J Tuberc Lung Dis 2006;10:838-843
    Web of Science | Medline

  25. 25

    Urbanczik R, Rieder HL. Scaling up tuberculosis culture services: a precautionary note. Int J Tuberc Lung Dis 2009;13:799-800
    Web of Science | Medline

  26. 26

    Banada PP, Sivasubramani SK, Blakemore R, et al. Containment of bioaerosol infection risk by the Xpert MTB/RIF assay and its applicability to point-of-care settings. J Clin Microbiol 2010 August 18 (Epub ahead of print).

Citing Articles (109)

Citing Articles

  1. 1

    James A. Platts-Mills, Darwin J. Operario, Eric R. Houpt. (2012) Molecular Diagnosis of Diarrhea: Current Status and Future Potential. Current Infectious Disease Reports 14:1, 41-46
    CrossRef

  2. 2

    Hojoon Sohn, Madhukar Pai, Nandini Dendukuri, Lorie A Kloda, Catharina C Boehme, Karen R Steingart, Karen R Steingart. 2012. Xpert MTB/RIF test for detection of pulmonary tuberculosis and rifampicin resistance. .
    CrossRef

  3. 3

    Michelle L. Kovarik, Philip C. Gach, Douglas M. Ornoff, Yuli Wang, Joseph Balowski, Lila Farrag, Nancy L. Allbritton. (2012) Micro Total Analysis Systems for Cell Biology and Biochemical Assays. Analytical Chemistry 84:2, 516-540
    CrossRef

  4. 4

    A. V. Govindarajan, S. Ramachandran, G. D. Vigil, P. Yager, K. F. Böhringer. (2012) A low cost point-of-care viscous sample preparation device for molecular diagnosis in the developing world; an example of microfluidic origami. Lab on a Chip 12:1, 174
    CrossRef

  5. 5

    Andreas Müller. (2012) Klinische Aspekte der Tuberkulose. Pharmazie in unserer Zeit 41:1, 27-34
    CrossRef

  6. 6

    Eleanor R. Turnbull, Nzali G. Kancheya, Jennifer B. Harris, Stephanie M. Topp, German Henostroza, Stewart E. Reid. (2012) A Model of Tuberculosis Screening for Pregnant Women in Resource-Limited Settings Using Xpert MTB/RIF. Journal of Pregnancy 2012, 1-5
    CrossRef

  7. 7

    Bradley A. Patay, Eric J. Topol. (2012) The Unmet Need of Education in Genomic Medicine. The American Journal of Medicine 125:1, 5-6
    CrossRef

  8. 8

    Guanghou Shui, Anne K. Bendt, Ignasius A. Jappar, Hui Ming Lim, Marie Laneelle, Maxime Hervé, Laura E. Via, Gek Huey Chua, Martin W. Bratschi, Siti Zarina Zainul Rahim, Ang Lay Teng Michelle, Soo-Hee Hwang, Jong-Soek Lee, Seok-Yong Eum, Hyun-Kyung Kwak, Mamadou Daffé, Véronique Dartois, Gerd Michel, Clifton E. Barry, Markus R. Wenk. (2012) Mycolic acids as diagnostic markers for tuberculosis case detection in humans and drug efficacy in mice. EMBO Molecular Medicine 4:1, 27-37
    CrossRef

  9. 9

    Lancelot M. Pinto, Jasmine Grenier, Samuel G. Schumacher, Claudia M. Denkinger, Karen R. Steingart, Madhukar Pai. (2012) Immunodiagnosis of Tuberculosis: State of the Art. Medical Principles and Practice 21:1, 4-13
    CrossRef

  10. 10

    Elisabeth Sanchez-Padilla, Themba Dlamini, Alexandra Ascorra, Sabine Rüsch-Gerdes, Zerihun Demissie Tefera, Philippe Calain, Roberto de la Tour, Frauke Jochims, Elvira Richter, Maryline Bonnet. (2012) High Prevalence of Multidrug-Resistant Tuberculosis, Swaziland, 2009–2010. Emerging Infectious Diseases 18:1, 29-37
    CrossRef

  11. 11

    Aula Abbara, Robert N. Davidson. (2011) Etiology and management of genitourinary tuberculosis. Nature Reviews Urology 8:12, 678-688
    CrossRef

  12. 12

    M. Hatherill, S. Verver, H. Mahomed, . (2011) Consensus Statement on Diagnostic End Points for Infant Tuberculosis Vaccine Trials. Clinical Infectious Diseases
    CrossRef

  13. 13

    M. Bonnet. (2011) Les nouveaux tests diagnostiques de la tuberculose maladie : de la théorie à la pratique dans les pays du Sud. Revue des Maladies Respiratoires 28:10, 1310-1321
    CrossRef

  14. 14

    Paul H. Park, Cornelius Magut, Adrian Gardner, Dennis O. O’yiengo, Lydia Kamle, Bernard K. Langat, Nathan G. Buziba, E. Jane Carter. (2011) Increasing access to the MDR-TB surveillance programme through a collaborative model in western Kenya*. Tropical Medicine & International Healthno-no
    CrossRef

  15. 15

    S. Majumdar, D. O'Brien, N. Hurtado, C. Hewison, P. du Cros. (2011) The ‘frozen state’ of drug-resistant tuberculosis: notes from the field in Abkhazia. Internal Medicine Journal 41:12, 805-808
    CrossRef

  16. 16

    Brian McCall, Mark Pierce, Edward A. Graviss, Rebecca Richards-Kortum, Tomasz Tkaczyk. (2011) Toward a low-cost compact array microscopy platform for detection of tuberculosis. Tuberculosis 91, S54-S60
    CrossRef

  17. 17

    G. Theron, L. Pinto, J. Peter, H. K. Mishra, H. K. Mishra, R. van Zyl-Smit, S. K. Sharma, K. Dheda. (2011) The Use of An Automated Quantitative Polymerase Chain Reaction (Xpert MTB/RIF) to Predict the Sputum Smear Status of Tuberculosis Patients. Clinical Infectious Diseases
    CrossRef

  18. 18

    K. P. Fennelly. (2011) An eXpert AFB Smear?. Clinical Infectious Diseases
    CrossRef

  19. 19

    K. Weyer, S. Carai, P. Nunn. (2011) Viewpoint TB Diagnostics: What Does the World Really Need?. Journal of Infectious Diseases 204:suppl 4, S1196-S1202
    CrossRef

  20. 20

    J. M. Achkar, S. D. Lawn, M.-Y. S. Moosa, C. A. Wright, V. O. Kasprowicz. (2011) Adjunctive Tests for Diagnosis of Tuberculosis: Serology, ELISPOT for Site-Specific Lymphocytes, Urinary Lipoarabinomannan, String Test, and Fine Needle Aspiration. Journal of Infectious Diseases 204:suppl 4, S1130-S1141
    CrossRef

  21. 21

    S. D. Lawn, R. Wood. (2011) Tuberculosis in Antiretroviral Treatment Services in Resource-Limited Settings: Addressing the Challenges of Screening and Diagnosis. Journal of Infectious Diseases 204:suppl 4, S1159-S1167
    CrossRef

  22. 22

    T. G. Connell, H. J. Zar, M. P. Nicol. (2011) Advances in the Diagnosis of Pulmonary Tuberculosis in HIV-Infected and HIV-Uninfected Children. Journal of Infectious Diseases 204:suppl 4, S1151-S1158
    CrossRef

  23. 23

    P. Jain, D. S. Thaler, M. Maiga, G. S. Timmins, W. R. Bishai, G. F. Hatfull, M. H. Larsen, W. R. Jacobs. (2011) Reporter Phage and Breath Tests: Emerging Phenotypic Assays for Diagnosing Active Tuberculosis, Antibiotic Resistance, and Treatment Efficacy. Journal of Infectious Diseases 204:suppl 4, S1142-S1150
    CrossRef

  24. 24

    R. J. Lessells, G. S. Cooke, M.-L. Newell, P. Godfrey-Faussett. (2011) Evaluation of Tuberculosis Diagnostics: Establishing an Evidence Base Around the Public Health Impact. Journal of Infectious Diseases 204:suppl 4, S1187-S1195
    CrossRef

  25. 25

    D. A. J. Moore, N. S. Shah. (2011) Alternative Methods of Diagnosing Drug Resistance--What Can They Do for Me?. Journal of Infectious Diseases 204:suppl 4, S1110-S1119
    CrossRef

  26. 26

    Litao Li, Zehua Zhang, Fei Luo, Jianzhong Xu, Peng Cheng, Zheng Wu, Qiang Zhou, Qingyi He, Fei Dai, Jian Wang, Jinsong Zhang. (2011) Management of drug-resistant spinal tuberculosis with a combination of surgery and individualised chemotherapy: a retrospective analysis of thirty-five patients. International Orthopaedics
    CrossRef

  27. 27

    Eduardo Gotuzzo. (2011) Xpert MTB/RIF for diagnosis of pulmonary tuberculosis. The Lancet Infectious Diseases 11:11, 802-803
    CrossRef

  28. 28

    Mark P Nicol, Lesley Workman, Washiefa Isaacs, Jacinta Munro, Faye Black, Brian Eley, Catharina C Boehme, Widaad Zemanay, Heather J Zar. (2011) Accuracy of the Xpert MTB/RIF test for the diagnosis of pulmonary tuberculosis in children admitted to hospital in Cape Town, South Africa: a descriptive study. The Lancet Infectious Diseases 11:11, 819-824
    CrossRef

  29. 29

    Virginie Rozot, Matthieu Perreau, Alexandre Harari, Giuseppe Pantaleo. (2011) La signature immunologique. médecine/sciences 27:10, 808-811
    CrossRef

  30. 30

    J.-P. Zellweger. (2011) La tuberculose multirésistante : extension, menace et solutions. Revue des Maladies Respiratoires 28:8, 1025-1033
    CrossRef

  31. 31

    AL Pozniak, KM Coyne, RF Miller, MCI Lipman, AR Freedman, LP Ormerod, MA Johnson, S Collins, SB Lucas, . (2011) British HIV Association guidelines for the treatment of TB/HIV coinfection 2011. HIV Medicine 12:9, 517-524
    CrossRef

  32. 32

    Iñaki Comas, Sebastien Gagneux. (2011) A role for systems epidemiology in tuberculosis research. Trends in Microbiology 19:10, 492-500
    CrossRef

  33. 33

    F.-X. Blanc. (2011) Tuberculose: le réveil d’une belle endormie. Revue des Maladies Respiratoires Actualités 3:5, 532-537
    CrossRef

  34. 34

    Celine R Gounder, Tendesayi Kufa, Nikolas I Wada, Victor Mngomezulu, Salome Charalambous, Yasmeen Hanifa, Katherine Fielding, Alison Grant, Susan Dorman, Richard E Chaisson, Gavin J Churchyard. (2011) Diagnostic Accuracy of a Urine Lipoarabinomannan Enzyme-Linked Immunosorbent Assay for Screening Ambulatory HIV-Infected Persons for Tuberculosis. JAIDS Journal of Acquired Immune Deficiency Syndromes 58:2, 219-223
    CrossRef

  35. 35

    A. El Khéchine, M. Drancourt. (2011) Diagnosis of pulmonary tuberculosis in a microbiological laboratory. Médecine et Maladies Infectieuses 41:10, 509-517
    CrossRef

  36. 36

    Gregory J Fox, Claudia C Dobler, Guy B Marks, Gregory J Fox. 2011. Active case finding in contacts of people with tuberculosis. .
    CrossRef

  37. 37

    Stephen D Lawn, Mark P Nicol. (2011) Xpert ® MTB/RIF assay: development, evaluation and implementation of a new rapid molecular diagnostic for tuberculosis and rifampicin resistance. Future Microbiology 6:9, 1067-1082
    CrossRef

  38. 38

    Sampada A. Patwardhan, S. Joshi. (2011) Laboratory diagnosis of spinal tuberculosis: past and present. ArgoSpine News & Journal 23:3, 120-124
    CrossRef

  39. 39

    Amy Y. Vittor, Joseph M. Garland, David Schlossberg. (2011) Improving the Diagnosis of Tuberculosis: From QuantiFERON to New Techniques to Diagnose Tuberculosis Infections. Current HIV/AIDS Reports 8:3, 153-163
    CrossRef

  40. 40

    K. R. Jacobson, D. Theron, T. C. Victor, E. M. Streicher, R. M. Warren, M. B. Murray. (2011) Treatment Outcomes of Isoniazid-Resistant Tuberculosis Patients, Western Cape Province, South Africa. Clinical Infectious Diseases 53:4, 369-372
    CrossRef

  41. 41

    Tom Kotsimbos, Allen C. Cheng. (2011) Changing epidemiology of respiratory pathogens and the role of improved diagnostics. Respirology 16:6, 873-875
    CrossRef

  42. 42

    L. Lawson, M. A. Yassin, S. T. Abdurrahman, C. M. Parry, R. Dacombe, O. M. Sogaolu, J. N. Ebisike, G. N. Uzoewulu, L. O. Lawson, N. Emenyonu, J. O. Ouoha, J. S. David, P. D. O. Davies, L. E. Cuevas. (2011) Resistance to first-line tuberculosis drugs in three cities of Nigeria. Tropical Medicine & International Health 16:8, 974-980
    CrossRef

  43. 43

    Giovanni Ferrara, Justin O'Grady, Alimuddin Zumla, Markus Maeurer. (2011) Xpert MTB/RIF test for tuberculosis. The Lancet 378:9790, 482
    CrossRef

  44. 44

    Andrea Rojo, Maria A. Ibáñez, Carla A. Alonso, Maria E. Portillo, Javier Quintana, Jose Ramón Yuste, Jose L. Del Pozo. (2011) Multidrug-resistant tuberculosis presenting as a solitary splenic mass in an immunocompetent patient. Diagnostic Microbiology and Infectious Disease 70:4, 522-524
    CrossRef

  45. 45

    Anand A Date, Bess Miller. (2011) Antiretroviral Therapy and Tuberculosis: Whatʼs the Connection and Whatʼs the Way Forward?. JAIDS Journal of Acquired Immune Deficiency Syndromes 57:4, 255-257
    CrossRef

  46. 46

    Celine R Gounder, Nikolas I Wada, Caroline Kensler, Avy Violari, James McIntyre, Richard E Chaisson, Neil A Martinson. (2011) Active Tuberculosis Case-Finding Among Pregnant Women Presenting to Antenatal Clinics in Soweto, South Africa. JAIDS Journal of Acquired Immune Deficiency Syndromes 57:4, e77-e84
    CrossRef

  47. 47

    Fulvio Salvo, Tsetan Dorjee Sadutshang, Giovanni Battista Migliori, Alimuddin Zumla, Daniela Maria Cirillo. (2011) Xpert MTB/RIF test for tuberculosis. The Lancet 378:9790, 481-482
    CrossRef

  48. 48

    Jakko van Ingen, Wiel CM de Lange, Martin J Boeree, Michael D Iseman, Charles L Daley, Leonid B Heifets, Erik C Böttger, Dick van Soolingen. (2011) XDR tuberculosis. The Lancet Infectious Diseases 11:8, 585
    CrossRef

  49. 49

    Feero, W. Gregory, Guttmacher, Alan E., , Relman, David A., . (2011) Microbial Genomics and Infectious Diseases. New England Journal of Medicine 365:4, 347-357
    Full Text

  50. 50

    H. D. Geldenhuys, W. Kleynhans, N. Buckerfield, M. Tameris, Y. Gonzalez, H. Mahomed, G. Hussey, W. Hanekom, M. Hatherill. (2011) Safety and tolerability of sputum induction in adolescents and adults with suspected pulmonary tuberculosis. European Journal of Clinical Microbiology & Infectious Diseases
    CrossRef

  51. 51

    Michael J. Cima. (2011) Microsystem Technologies for Medical Applications. Annual Review of Chemical and Biomolecular Engineering 2:1, 355-378
    CrossRef

  52. 52

    Nardell, Edward, Churchyard, Gavin, . (2011) What Is Thwarting Tuberculosis Prevention in High-Burden Settings?. New England Journal of Medicine 365:1, 79-81
    Full Text

  53. 53

    Olivier Koole, Robert Colebunders. (2011) Reducing mortality from HIV infection and tuberculosis. The Lancet Infectious Diseases 11:7, 494-495
    CrossRef

  54. 54

    Peter Mwaba, Ruth McNerney, Martin Peter Grobusch, Justin O’Grady, Matthew Bates, Nathan Kapata, Markus Maeurer, Alimuddin Zumla. (2011) Achieving STOP TB Partnership goals: perspectives on development of new diagnostics, drugs and vaccines for tuberculosis. Tropical Medicine & International Health 16:7, 819-827
    CrossRef

  55. 55

    Timothy H Holtz, Gaëtan Kabera, Thuli Mthiyane, Tainos Zingoni, Sidhambaram Nadesan, Douglas Ross, Jennifer Allen, Sekai Chideya, Henry Sunpath, Roxana Rustomjee. (2011) Use of a WHO-recommended algorithm to reduce mortality in seriously ill patients with HIV infection and smear-negative pulmonary tuberculosis in South Africa: an observational cohort study. The Lancet Infectious Diseases 11:7, 533-540
    CrossRef

  56. 56

    Stephen D. Lawn, Anthony D. Harries. (2011) Reducing tuberculosis-associated early mortality in antiretroviral treatment programmes in sub-Saharan Africa. AIDS 25:12, 1554-1555
    CrossRef

  57. 57

    Stephen D Lawn, Alimuddin I Zumla. (2011) Tuberculosis. The Lancet 378:9785, 57-72
    CrossRef

  58. 58

    Vivek N. Iyer, A.Y. Joshi, T.G. Boyce, M.W. Brutinel, M.C. Scalcini, J.W. Wilson, Kevin McCoy, T.R. Aksamit. (2011) Bronchoscopy in suspected pulmonary TB with negative induced-sputum smear and MTD® Gen-probe testing. Respiratory Medicine 105:7, 1084-1090
    CrossRef

  59. 59

    Eun Young Kim, Moo Suk Park, Young Sam Kim, Se Kyu Kim, Joon Chang, Young Ae Kang. (2011) Risk factors for false-negative results of QuantiFERON-TB Gold In-Tube assay in non-HIV-infected patients with culture-confirmed tuberculosis. Diagnostic Microbiology and Infectious Disease 70:3, 324-329
    CrossRef

  60. 60

    S. D. Lawn, R. Wood. (2011) Poor Prognosis of HIV-Associated Tuberculous Meningitis Regardless of the Timing of Antiretroviral Therapy. Clinical Infectious Diseases 52:11, 1384-1387
    CrossRef

  61. 61

    B. Ninet, P. Roux-Lombard, J. Schrenzel, J.-P. Janssens. (2011) Nouveaux tests pour le diagnostic de la tuberculose. Revue des Maladies Respiratoires 28:6, 823-833
    CrossRef

  62. 62

    M. Drancourt. (2011) Tuberculosis: an unpredictable long-standing human companion still in need of rapid diagnostic tests. Clinical Microbiology and Infection 17:6, 799-799
    CrossRef

  63. 63

    Amitabha Chakroborty. (2011) Drug-resistant tuberculosis: an insurmountable epidemic?. Inflammopharmacology 19:3, 131-137
    CrossRef

  64. 64

    Neil A Martinson, Richard E Chaisson. (2011) Survival in XDR TB: Shifting the Curve and Shifting the Paradigm. JAIDS Journal of Acquired Immune Deficiency Syndromes 57:2, 89-91
    CrossRef

  65. 65

    Claudio U. Köser, Stefan Niemann, David K. Summers, John A.C. Archer. (2011) Overview of errors in the reference sequence and annotation of Mycobacterium tuberculosis H37Rv, and variation amongst its isolates. Infection, Genetics and Evolution
    CrossRef

  66. 66

    Kathleen E. Mach, Pak Kin Wong, Joseph C. Liao. (2011) Biosensor diagnosis of urinary tract infections: a path to better treatment?. Trends in Pharmacological Sciences 32:6, 330-336
    CrossRef

  67. 67

    Peter B. Luppa, Carolin Müller, Alice Schlichtiger, Harald Schlebusch. (2011) Point-of-care testing (POCT): Current techniques and future perspectives. TrAC Trends in Analytical Chemistry 30:6, 887-898
    CrossRef

  68. 68

    M. L. Wilson. (2011) Recent Advances in the Laboratory Detection of Mycobacterium tuberculosis Complex and Drug Resistance. Clinical Infectious Diseases 52:11, 1350-1355
    CrossRef

  69. 69

    E. Richter, S. Rüsch-Gerdes. (2011) Bakteriologische Diagnostik der Tuberkulose. Der Pneumologe 8:3, 145-150
    CrossRef

  70. 70

    Justin OʼGrady, Markus Maeurer, Peter Mwaba, Nathan Kapata, Matthew Bates, Michael Hoelscher, Alimuddin Zumla. (2011) New and improved diagnostics for detection of drug-resistant pulmonary tuberculosis. Current Opinion in Pulmonary Medicine 17:3, 134-141
    CrossRef

  71. 71

    F. C. Tenover. (2011) Developing Molecular Amplification Methods for Rapid Diagnosis of Respiratory Tract Infections Caused by Bacterial Pathogens. Clinical Infectious Diseases 52:Supplement 4, S338-S345
    CrossRef

  72. 72

    Gerhard Walzl, Katharina Ronacher, Willem Hanekom, Thomas J. Scriba, Alimuddin Zumla. (2011) Immunological biomarkers of tuberculosis. Nature Reviews Immunology 11:5, 343-354
    CrossRef

  73. 73

    K. Tayler-Smith, R. Zachariah, M. Manzi, W. Kizito, A. Vandenbulcke, S. Dunkley, D. von Rege, T. Reid, L. Arnould, A. Suleh, A. D. Harries. (2011) Demographic characteristics and opportunistic diseases associated with attrition during preparation for antiretroviral therapy in primary health centres in Kibera, Kenya. Tropical Medicine & International Health 16:5, 579-584
    CrossRef

  74. 74

    Angelika Niemz, Tanya M. Ferguson, David S. Boyle. (2011) Point-of-care nucleic acid testing for infectious diseases. Trends in Biotechnology 29:5, 240-250
    CrossRef

  75. 75

    Alimuddin Zumla. (2011) Pulmonary infections: ‘le terrain est tout, le microbe n’est rien’. Current Opinion in Pulmonary Medicine 17:3, 131-133
    CrossRef

  76. 76

    Irene G. Sia, Mark L. Wieland. (2011) Current Concepts in the Management of Tuberculosis. Mayo Clinic Proceedings 86:4, 348-361
    CrossRef

  77. 77

    Andrew D Kerkhoff, Robin Wood, Stephen D Lawn. (2011) Optimum time to start antiretroviral therapy in patients with HIV-associated tuberculosis: before or after tuberculosis diagnosis?. AIDS 25:7, 1003-1006
    CrossRef

  78. 78

    Katharina Kranzer. (2011) Improving tuberculosis diagnostics and treatment. The Lancet 377:9776, 1467-1468
    CrossRef

  79. 79

    Iruka N. Okeke, Rosanna W. Peeling, Herman Goossens, Raymond Auckenthaler, Stuart S. Olmsted, Jean-François de Lavison, Barbara L. Zimmer, Mark D. Perkins, Katarina Nordqvist. (2011) Diagnostics as essential tools for containing antibacterial resistance. Drug Resistance Updates 14:2, 95-106
    CrossRef

  80. 80

    Stephen D Lawn, Graeme Meintjes. (2011) Pathogenesis and prevention of immune reconstitution disease during antiretroviral therapy. Expert Review of Anti-infective Therapy 9:4, 415-430
    CrossRef

  81. 81

    M. Zignol, W. van Gemert, D. Falzon, E. Jaramillo, L. Blanc, M. Raviglione. (2011) Modernizing Surveillance of Antituberculosis Drug Resistance: From Special Surveys to Routine Testing. Clinical Infectious Diseases 52:7, 901-906
    CrossRef

  82. 82

    Luis E. Cuevas. (2011) The Urgent Need for New Diagnostics for Symptomatic Tuberculosis in Children. The Indian Journal of Pediatrics 78:4, 449-455
    CrossRef

  83. 83

    Novel N Chegou, Kim GP Hoek, Magdalena Kriel, Robin M Warren, Thomas C Victor, Gerhard Walzl. (2011) Tuberculosis assays: past, present and future. Expert Review of Anti-infective Therapy 9:4, 457-469
    CrossRef

  84. 84

    Catharina C Boehme, Mark P Nicol, Pamela Nabeta, Joy S Michael, Eduardo Gotuzzo, Rasim Tahirli, Ma Tarcela Gler, Robert Blakemore, William Worodria, Christen Gray, Laurence Huang, Tatiana Caceres, Rafail Mehdiyev, Lawrence Raymond, Andrew Whitelaw, Kalaiselvan Sagadevan, Heather Alexander, Heidi Albert, Frank Cobelens, Helen Cox, David Alland, Mark D Perkins. (2011) Feasibility, diagnostic accuracy, and effectiveness of decentralised use of the Xpert MTB/RIF test for diagnosis of tuberculosis and multidrug resistance: a multicentre implementation study. The Lancet 377:9776, 1495-1505
    CrossRef

  85. 85

    CHI CHIU LEUNG, DAVID FELLER-KOPMAN, MICHAEL S. NIEDERMAN, STEPHEN G. SPIRO. (2011) Year in review 2010: Tuberculosis, pleural diseases, respiratory infections. Respirology 16:3, 564-573
    CrossRef

  86. 86

    Jessica Minion, Madhukar Pai. (2011) Assays for drug resistant tuberculosis in high burden countries – Authors' reply. The Lancet Infectious Diseases 11:3, 162
    CrossRef

  87. 87

    (2011) Un test moléculaire rapide pour la tuberculose. Revue Francophone des Laboratoires 2011:430, 20
    CrossRef

  88. 88

    Fernando Alcaide, Pere Coll. (2011) Advances in rapid diagnosis of tuberculosis disease and anti-tuberculous drug resistance. Enfermedades Infecciosas y Microbiología Clínica 29, 34-40
    CrossRef

  89. 89

    Ruth McNerney, Peter Daley. (2011) Towards a point-of-care test for active tuberculosis: obstacles and opportunities. Nature Reviews Microbiology 9:3, 204-213
    CrossRef

  90. 90

    Stephen M. Graham. (2011) The Use of Diagnostic Systems for Tuberculosis in Children. The Indian Journal of Pediatrics 78:3, 334-339
    CrossRef

  91. 91

    Justin O’Grady, Michael Hoelscher, Rifat Atun, Matthew Bates, Peter Mwaba, Nathan Kapata, Giovanni Ferrara, Markus Maeurer, Alimuddin Zumla. (2011) Tuberculosis in prisons in sub-Saharan Africa – the need for improved health services, surveillance and control. Tuberculosis 91:2, 173-178
    CrossRef

  92. 92

    Yajnavalka Banerjee, Varna Taranikanti, Riad Bayoumi. (2011) Assays for drug resistant tuberculosis in high burden countries. The Lancet Infectious Diseases 11:3, 161-162
    CrossRef

  93. 93

    Agathe de Lauzanne, Catherine Doit, Stéphane Bonacorsi, Franck Fitoussi, Françoise Boman, Mathie Lorrot, Albert Faye, Edouard Bingen. (2011) Rapid Diagnosis of Smear-negative Tuberculous Osteoarthritis by Real-time Polymerase Chain Reaction on Bone Tissue. The Pediatric Infectious Disease Journal 30:2, 184
    CrossRef

  94. 94

    S. Abbes. (2011) Infectiologie respiratoire et poumon de l’allogreffé de moelle. Revue des Maladies Respiratoires Actualit&#xE9;s 3:1, 49-56
    CrossRef

  95. 95

    I. V. Bassett, J. Giddy, K. A. Freedberg. (2011) Reply to Lawn et al.. Clinical Infectious Diseases 52:2, 277-278
    CrossRef

  96. 96

    S. D. Lawn, R. Wood. (2011) Tuberculosis Screening in Patients Starting Antiretroviral Therapy in Sub-Saharan Africa: Stretching Diagnostics to the Limits. Clinical Infectious Diseases 52:2, 276-277
    CrossRef

  97. 97

    (2011) Rapid Molecular Detection of Tuberculosis. New England Journal of Medicine 364:2, 182-185
    Full Text

  98. 98

    B. Hauer, S. Castell, R. Loddenkemper. (2011) Resistente Tuberkulose. Der Pneumologe 8:1, 25-31
    CrossRef

  99. 99

    M. Luiza De Souza-Galvao, Miguel Ángel García-Martínez, Francisco Sanz, José Blanquer. (2011) Hot topics en infecciones respiratorias. Archivos de Bronconeumología 47, 41-45
    CrossRef

  100. 100

    Jae-Joon Yim. (2011) The Latest Achievements in Study of Tuberculosis. Tuberculosis and Respiratory Diseases 71:6, 395
    CrossRef

  101. 101

    Delphine Sculier, Haileyesus Getahun, Christian Lienhardt. (2011) Improving the prevention, diagnosis and treatment of TB among people living with HIV: the role of operational research. Journal of the International AIDS Society 14:Suppl 1, S5
    CrossRef

  102. 102

    CN Mnyani, JA McIntyre. (2011) Tuberculosis in pregnancy. BJOG: An International Journal of Obstetrics & Gynaecology 118:2, 226-231
    CrossRef

  103. 103

    K. Dalhoff, J. Rupp. (2011) Bedrohung durch die HIV/Tuberkulose-Koinfektion. Der Pneumologe 8:1, 32-39
    CrossRef

  104. 104

    Fred C. Tenover. (2010) Potential impact of rapid diagnostic tests on improving antimicrobial use. Annals of the New York Academy of Sciences 1213:1, 70-80
    CrossRef

  105. 105

    Jessica Minion, Erika Leung, Dick Menzies, Madhukar Pai. (2010) Microscopic-observation drug susceptibility and thin layer agar assays for the detection of drug resistant tuberculosis: a systematic review and meta-analysis. The Lancet Infectious Diseases 10:10, 688-698
    CrossRef

  106. 106

    Haileyesus Getahun, Mario Raviglione. (2010) Active case-finding for TB in the community: time to act. The Lancet 376:9748, 1205-1206
    CrossRef

  107. 107

    Annelies Van Rie, Liesl Page-Shipp, Lesley Scott, Ian Sanne, Wendy Stevens. (2010) Xpert ® MTB/RIF for point-of-care diagnosis of TB in high-HIV burden, resource-limited countries: hype or hope?. Expert Review of Molecular Diagnostics 10:7, 937-946
    CrossRef

  108. 108

    Small, Peter M., Pai, Madhukar, . (2010) Tuberculosis Diagnosis — Time for a Game Change. New England Journal of Medicine 363:11, 1070-1071
    Full Text

  109. 109

    Nathanson, Eva, Nunn, Paul, Uplekar, Mukund, Floyd, Katherine, Jaramillo, Ernesto, Lönnroth, Knut, Weil, Diana, Raviglione, Mario, . (2010) MDR Tuberculosis — Critical Steps for Prevention and Control. New England Journal of Medicine 363:11, 1050-1058
    Full Text

Letters