Original Article
K-ras Mutations and Benefit from Cetuximab in Advanced Colorectal Cancer
N Engl J Med 2008; 359:1757-1765October 23, 2008
- Abstract
Background
Treatment with cetuximab, a monoclonal antibody directed against the epidermal growth factor receptor, improves overall and progression-free survival and preserves the quality of life in patients with colorectal cancer that has not responded to chemotherapy. The mutation status of the K-ras gene in the tumor may affect the response to cetuximab and have treatment-independent prognostic value.
Methods
We analyzed tumor samples, obtained from 394 of 572 patients (68.9%) with colorectal cancer who were randomly assigned to receive cetuximab plus best supportive care or best supportive care alone, to look for activating mutations in exon 2 of the K-ras gene. We assessed whether the mutation status of the K-ras gene was associated with survival in the cetuximab and supportive-care groups.
Results
Of the tumors evaluated for K-ras mutations, 42.3% had at least one mutation in exon 2 of the gene. The effectiveness of cetuximab was significantly associated with K-ras mutation status (P=0.01 and P<0.001 for the interaction of K-ras mutation status with overall survival and progression-free survival, respectively). In patients with wild-type K-ras tumors, treatment with cetuximab as compared with supportive care alone significantly improved overall survival (median, 9.5 vs. 4.8 months; hazard ratio for death, 0.55; 95% confidence interval [CI], 0.41 to 0.74; P<0.001) and progression-free survival (median, 3.7 months vs. 1.9 months; hazard ratio for progression or death, 0.40; 95% CI, 0.30 to 0.54; P<0.001). Among patients with mutated K-ras tumors, there was no significant difference between those who were treated with cetuximab and those who received supportive care alone with respect to overall survival (hazard ratio, 0.98; P=0.89) or progression-free survival (hazard ratio, 0.99; P=0.96). In the group of patients receiving best supportive care alone, the mutation status of the K-ras gene was not significantly associated with overall survival (hazard ratio for death, 1.01; P=0.97).
Conclusions
Patients with a colorectal tumor bearing mutated K-ras did not benefit from cetuximab, whereas patients with a tumor bearing wild-type K-ras did benefit from cetuximab. The mutation status of the K-ras gene had no influence on survival among patients treated with best supportive care alone. (ClinicalTrials.gov number, NCT00079066.)
Media in This Article
Figure 1
Kaplan–Meier Curves for Overall Survival According to Treatment.Figure 2
Kaplan–Meier Curves for Progression-free Survival According to Treatment.Article Activity
- Article
A randomized trial (CO.17) conducted by the National Cancer Institute of Canada Clinical Trials Group (NCIC CTG) in collaboration with the Australasian Gastro-Intestinal Trials Group (AGITG) showed that among patients with colorectal cancer that had not responded to advanced chemotherapy, monotherapy with cetuximab, a monoclonal antibody directed against the epidermal growth factor receptor (EGFR), improved overall survival and progression-free survival and preserved the quality of life better than did best supportive care alone.1 However, resistance to cetuximab was common: at the first assessment of disease response, the disease had progressed in more than 50% of treated patients.
K-ras, a small G-protein downstream of EGFR and an essential component of the EGFR signaling cascade, can acquire activating mutations in exon 2, thus isolating the pathway from the effect of EGFR2 and rendering EGFR inhibitors ineffective.3-11
We undertook correlative analyses to determine whether the mutation status of the K-ras gene modified the effect of cetuximab on overall survival and progression-free survival in the CO.17 trial. We also assessed the association of K-ras mutation status with overall survival and progression-free survival among patients receiving best supportive care alone.
Methods
A protocol committee that included members of the NCIC CTG and the AGITG designed the study. The NCIC CTG collected and analyzed the data and maintained full, unrestricted rights to submit the study data for publication. One of the academic authors reviewed all the data, another conducted the statistical analyses, and a third wrote the first draft of the manuscript; these authors vouch for the completeness and accuracy of the data presented. The initial draft of the manuscript was reviewed and commented on by all the authors as well as by employees of Bristol-Myers Squibb, who did not make substantive changes. The relevant institutional review boards approved the study protocol, including the use of archived tumor tissue. Written informed consent for tumor tissue research was obtained from the majority of patients. For use of tissue from those in whom a clinical decline prevented consent, approval was granted by the ethics board at the patient's institution on the basis of the patient's consent to the original research.
Patients and Trial Design
The trial design and eligibility criteria have been reported previously.1 The primary objective of the phase 3 CO.17 study was to examine the effect of cetuximab on survival among patients with advanced colorectal cancer in whom all chemotherapy for colorectal cancer had failed and for whom no other standard anticancer therapy was available. Eligible patients were enrolled in the trial between December 2003 and August 2005. None of the patients had received previous therapy directed against EGFR. After enrollment, patients were randomly assigned to receive cetuximab plus supportive care or supportive care alone. Cetuximab was given as an intravenous loading dose of 400 mg per square meter of body-surface area, administered over a period of 120 minutes, on day 1 of treatment, followed by an infusion of 250 mg per square meter, administered over a period of 60 minutes, once a week. Patients in both groups were evaluated for tumor response or progression every 8 weeks by means of radiologic imaging. Cetuximab therapy was continued until the disease progressed or until the patient could not tolerate the toxic effects.
Tumor Collection and Processing
Formalin-fixed, paraffin-embedded samples of tumor tissue from archival specimens collected at the time of diagnosis were stored at a central tumor bank located at Queen's University in Kingston, Ontario, Canada. If tumor blocks were unavailable, unstained slides were retrieved. Assays of tissue samples for K-ras mutations were performed in a blinded fashion by members of the Department of Clinical Biomarkers–Oncology at Bristol-Myers Squibb, Hopewell, New Jersey. All available tissue samples were classified as having mutated or wild-type K-ras.
Nucleotide Sequence Analysis
Mutation analysis of K-ras was performed by extraction of genomic DNA from formalin-fixed, paraffin-embedded tissue slides or sections with the use of the QIAamp DNA Mini Kit (Qiagen). For K-ras analyses, the following nested primer sets for exon 2 were used: huKRAS2 ex2F, 5′GAATGGTCCTGCACCAGTAA3′; huKRAS2 ex2R, 5′GTGTGACATGTTCTAATATAGTCA3′; huKRAS ex2Fint, 5′GTCCTGCACCAGTAATATGC3′; and huKRAS2 ex2Rint, 5′ATGTTCTAATATAGTCACATTTTC3′. Each 25-μl polymerase-chain-reaction (PCR) cocktail contained at least 15 ng of genomic DNA, 2.5 mM magnesium chloride, 300 mM deoxynucleotide triphosphates, and 2.5 U of AmpliTaq Gold DNA Polymerase (Applied Biosystems). PCR conditions were as follows: 1 cycle at 94°C for 10 minutes; 45 cycles at 94°C for 30 seconds, 64°C for 30 seconds, and 72°C for 30 seconds; followed by 1 cycle at 72°C for 7 minutes. Primer extension sequencing was performed with the use of the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Reactions were run on a 3730x1 DNA Analyzer (Applied Biosystems). Analyses of the DNA sequences were performed with the use of Mutation Surveyor v2.61 (SoftGenetics), along with visual inspection of each sample trace in both forward and reverse directions. Appropriate positive and negative controls were included for K-ras. The persons who performed the mutation analyses had no knowledge of the clinical outcome.
Statistical Analysis
All statistical analyses were performed by the NCIC CTG in accordance with a protocol for statistical analysis that was written before the assessment of K-ras mutation was performed. All randomly assigned patients for whom data on K-ras mutation status were available were included in the analysis. Overall survival, the primary end point, was defined as the time from randomization until death from any cause. The secondary end points were progression-free survival, defined as the time from randomization until the first objective evidence of disease progression or death from any cause; response rates, defined according to the Response Evaluation Criteria in Solid Tumors (RECIST); and quality of life, assessed with the use of the European Organisation for Research and Treatment of Cancer (EORTC) quality-of-life questionnaire (QLQ-C30). Wilcoxon tests were used to compare the two treatment groups with respect to the mean change from baseline in scores on the global quality-of-life scale. A difference of more than 10 points was considered to indicate clinical significance.12
The survival of patients in each K-ras–mutation group and treatment group was summarized with the use of Kaplan–Meier curves, and the difference between these groups was compared with the use of the log-rank test, with the hazard ratio and its 95% confidence intervals calculated from a Cox regression model with a single covariate. To assess whether K-ras was an independent prognostic factor for patients receiving supportive care, a multivariate Cox regression model was fitted to data for patients receiving supportive care alone; it included the following covariates specified by the protocol: Eastern Cooperative Oncology Group (ECOG) performance status (0 or 1 vs. 2, on a scale of 0 to 5, with lower scores representing a higher level of functioning), sex (male vs. female), age (≥65 years vs. <65 years), baseline lactate dehydrogenase level (higher than the upper limit of the normal range vs. the upper limit or lower), baseline alkaline phosphatase level (higher than the upper limit of the normal range vs. the upper limit or lower), baseline hemoglobin (lower than the lower limit of the normal range vs. the lower limit or higher), number of disease sites (>2 vs. ≤2), number of previous chemotherapy drug classes (>2 vs. ≤2), primary tumor site (rectum only vs. colon), and presence of liver metastases (yes vs. no). We used the Cox model, with treatment, K-ras–mutation status, and their interaction as covariates, to assess the interaction between treatment and K-ras–mutation status. All reported P values are two-sided and were not adjusted for multiple testing.
Results
Characteristics of the Patients
Of 572 patients who underwent randomization, 287 were assigned to receive cetuximab plus supportive care, and 285 were assigned to receive supportive care alone. A total of 394 tumor specimens (198 from the cetuximab group and 196 from the supportive-care group) were examined for K-ras–mutation status (accounting for 68.9% of the total study population). Tumor specimens from the remaining patients could not be retrieved despite our best efforts; the most common reasons were lack of patient consent, insufficient tissue, and refusal or inability of the laboratory of origin to release the tissue for research. A K-ras mutation was detected in 40.9% of tumor specimens in the cetuximab group and in 42.3% of tumor specimens in the supportive-care group. Table 1Table 1
Distribution of K-ras Mutations According to Treatment Group. shows the K-ras mutations we identified and the distribution according to the treatment group. Table 2Table 2
Characteristics of Patients Included in the Analysis for K-ras Mutation. summarizes the baseline demographic and disease characteristics of the total study population and of the patients who were evaluated for the K-ras mutation. The group of patients with K-ras mutations and the group with wild-type K-ras were similar with respect to baseline characteristics, including ECOG performance status and the other variables associated with survival in the multivariate analysis. The distribution of these characteristics among the patients who were evaluated for K-ras mutations was similar to that in the total study population. In the supportive-care group, 13 patients had protocol violations and crossed over to cetuximab treatment. Four of them received cetuximab before progression of the disease, and nine received cetuximab after progression. All of the patients who had been assigned to the cetuximab group and who were included in the K-ras–mutation analysis did receive cetuximab.Overall Survival
Among patients with mutated K-ras tumors, the median overall survival was 4.5 months in the group receiving cetuximab and 4.6 months in the group receiving supportive care only, with 1-year overall survival rates of 13.2% and 19.6%, respectively (hazard ratio for death in the cetuximab group as compared with the supportive-care group, 0.98; 95% confidence interval [CI], 0.70 to 1.37; P=0.89) (Figure 1AFigure 1
Kaplan–Meier Curves for Overall Survival According to Treatment.). Among patients with wild-type K-ras tumors, the median overall survival was 9.5 months in the cetuximab group as compared with 4.8 months in the supportive-care group, with 1-year overall survival rates of 28.3% and 20.1%, respectively (hazard ratio, 0.55; 95% CI, 0.41 to 0.74; P<0.001). In a multivariate Cox regression model, this difference remained significant after adjustments for potential prognostic factors specified in the protocol (hazard ratio, 0.62; 95% CI, 0.44 to 0.87; P=0.006) (Figure 1B). The effect of cetuximab on overall survival was significantly greater among the patients with wild-type K-ras tumors than among those with mutated K-ras tumors (P=0.01 for the interaction between K-ras–mutation status and the assigned treatment).Progression-free Survival
Among patients with mutated K-ras tumors, the median progression-free survival was 1.8 months in both the cetuximab and supportive-care groups (hazard ratio for progression or death in the cetuximab group as compared with the supportive-care group, 0.99; 95% CI, 0.73 to 1.35; P=0.96) (Figure 2AFigure 2
Kaplan–Meier Curves for Progression-free Survival According to Treatment.). The precipitous drop in progression-free survival at 8 weeks was consistent with the tumor-imaging schedule mandated by the protocol. For patients with wild-type K-ras tumors, the median progression-free survival was 3.7 months in the cetuximab group and 1.9 months in the supportive-care group (hazard ratio for progression or death in the cetuximab group as compared with the supportive-care group, 0.40; 95% CI, 0.30 to 0.54; P<0.001) (Figure 2B). This difference remained significant after adjustment for potential prognostic factors specified in the protocol (adjusted hazard ratio, 0.42; 95% CI, 0.30 to 0.58; P<0.001). The effect of cetuximab on progression-free survival was significantly greater among the patients with wild-type K-ras tumors than among those with mutated K-ras tumors (P<0.001 for the interaction between K-ras–mutation status and the assigned treatment).Response to Treatment
None of the patients in the supportive-care group had an objective tumor response. In the cetuximab group, the response rate among patients with wild-type K-ras tumors was 12.8%, whereas only one patient with a mutated K-ras tumor (1.2%) had a response. Significantly more patients with wild-type K-ras tumors than patients with mutated K-ras tumors had a rash during cetuximab treatment or within 30 days after completion of the treatment (94.9% vs. 84.0%, P=0.02).
Quality of Life
Among patients with wild-type K-ras tumors, those in the cetuximab group had an improvement in global health status at 8 weeks, whereas those in the supportive-care group had a deterioration in global health status (mean change in score, 3.2 vs. −7.7 points; difference, 10.9; 95% CI, 4.2 to 17.6; P=0.002). The patients in the cetuximab group also had less deterioration at 16 weeks than did those in the supportive-care group (mean change in score, −0.2 vs. −18.1 points; difference, 17.9; 95% CI, 7.6 to 28.2; P<0.001). Among patients with mutated K-ras tumors, there was no significant difference in global health status between the cetuximab group and the supportive-care group at 8 weeks (mean change in score, −4.7 and −9.6 points, respectively; difference, 4.9; 95% CI, −4.2 to 14.0; P=0.53) or at 16 weeks (mean change in score, −9.5 and −13.9 points, respectively; difference, 4.4; 95% CI, −9.2 to 17.9; P=0.62).
Effect of Mutation Status in the Supportive-Care Group
In the supportive-care group, there was no significant difference in overall survival between patients with wild-type K-ras tumors and those with mutated K-ras tumors. As seen above, the median overall survival among the patients with mutated K-ras tumors was 4.6 months, as compared with 4.8 months among those with wild-type K-ras tumors, with 1-year overall survival rates of 19.6% and 20.1%, respectively (hazard ratio for death among patients with K-ras mutations, 1.01; 95% CI, 0.74 to 1.37; P=0.97) (Figure 3Figure 3
Kaplan–Meier Curves for Overall Survival According to K-ras–Mutation Status among Patients Receiving Supportive Care Alone.). The median progression-free survival was 1.8 months and 1.9 months for patients with mutated and wild-type K-ras tumors, respectively (hazard ratio for progression, 1.12; 95% CI, 0.84 to 1.49; P=0.46). The differences remained nonsignificant after adjustment for other factors specified by the protocol (adjusted hazard ratio for death, 1.33; 95% CI, 0.95 to 1.86; P=0.10; adjusted hazard ratio for progression, 1.24; 95% CI, 0.90 to 1.70; P=0.19).Discussion
Our findings show that the mutation status of the K-ras gene is associated with overall survival among patients with advanced colorectal cancer who are being treated with cetuximab after previous chemotherapy has failed. Treatment with cetuximab as compared with supportive care alone was associated with almost a doubling of the median overall and progression-free survival among patients with wild-type K-ras tumors. There was no significant survival benefit from cetuximab, however, among patients with tumors that had K-ras mutations. Several small, retrospective studies have shown an association between K-ras–mutation status and responsiveness of a colorectal tumor to cetuximab.5-7,13 Treatment with another monoclonal antibody directed against EGFR, panitumumab, has been compared with supportive care in a phase 3 trial.14 A K-ras analysis showed, as with our findings, that the benefit associated with panitumumab was limited to patients with wild-type K-ras tumors.3 The group with wild-type K-ras tumors had a progression-free survival benefit from treatment with panitumumab, although an overall survival benefit was not shown.
We also examined the treatment-independent effect of K-ras–mutation status. The clinical significance of K-ras mutations has varied in reported studies, most of which have been compromised by a small sample size. In the largest reported series, K-ras mutations, as compared with wild-type K-ras, were associated with a risk of death that was increased by 26%. In particular, a mutation in K-ras codon 12 with substitution of valine for glycine (G12V), which was found in 8.6% of all patients, had a significant effect on failure-free and overall survival.8,15 Mutations in K-ras, B-type Raf kinase (BRAF), or phosphatidylinositol 3-kinase (PI3K) genes were also significantly associated with shorter survival in another study, which involved 586 patients.16 Less favorable clinical outcomes, particularly shorter survival, have been associated with the presence of K-ras mutations at codon 13.11 No association with the outcome was found in a study of stage 3 colon cancer, but only 55 cases were examined.17 In the randomized trial of panitumumab therapy as compared with supportive care, multivariate analysis confirmed that wild-type K-ras was significantly associated with overall survival, but since most patients in the supportive-care group crossed over and received the monoclonal antibody when their disease progressed, the significance of K-ras–mutation status was ultimately uncertain.3
We examined the association of K-ras–mutation status with survival among patients in the supportive-care group, in whom no effect of cetuximab would be expected. Such an analysis represents the best method for evaluating the significance of a variable, since its potential predictive effect is not relevant. We did not observe a significant difference in survival according to K-ras–mutation status in the supportive-care group.
Although K-ras mutations may be a common genetic aberration involved in carcinogenesis, mutations of other genes, such as phosphatase and tensin homologue (PTEN), BRAF, or PI3K, that can lead to unrestricted growth of cancer cells may also be useful biomarkers. Loss of PTEN activity, for example, has been associated with lack of efficacy of cetuximab in 11 patients with colorectal cancer.7 Further upstream in the signaling pathway, high expression of EGFR ligands, particularly amphiregulin and epiregulin, has been observed in tumors that respond to cetuximab, and these ligands may be targets for new treatments.18 Immunohistochemical studies suggest that EGFR, the principal target of cetuximab, is not a useful predictive factor19-22; responses to cetuximab have been reported in patients with advanced colorectal cancers that do not have immunohistochemical evidence of EGFR expression.23,24 The problems with immunohistochemical assessment include inaccuracy of and variations in the procedure, heterogeneity of EGFR expression in the tumor, and variable affinity of EGFR for cetuximab.25,26 Assessment of the EGFR copy number may be more reliable, but the findings have been inconsistent.27-29 These discrepant results highlight the need for standardization of the measurement of EGFR expression and activity.
The inactivation of the effect of cetuximab by K-ras mutation is biologically plausible and is supported by previous studies. A lack of activity of therapy directed against EGFR, particular tyrosine kinase inhibitors, has also been shown in patients who have non–small-cell lung cancer with K-ras mutations.30-32 Our analysis was focused on K-ras and was based on a statistical plan that was specified before the assessment of K-ras status was performed. Evaluation of multiple correlative biomarkers was not performed.
Treatment with cetuximab, which is relatively expensive, would be most cost-effective if it were given to patients with the highest chance of benefiting from it. Our analysis identified a biomarker that would effectively exclude a clinically significant proportion of patients with colorectal cancer — those with tumors bearing K-ras mutations (42%) — from receipt of a therapy offering little prospect of a benefit. Nevertheless, there were also patients with wild-type K-ras tumors who did not have a response to cetuximab and in whom the tumor rapidly progressed. Additional reliable and easily measured biomarkers are clearly needed to improve the identification of patients who will benefit from treatment with cetuximab.
Supported by the National Cancer Institute of Canada, ImClone Systems, and Bristol-Myers Squibb.
Presented in part in abstract form at the World Congress on Gastrointestinal Cancer, Barcelona, June 25–28, 2008.
Drs. Karapetis and Shapiro report receiving consulting fees from Merck Serono; Drs. Jonker and Au, receiving consulting fees from Bristol-Myers Squibb; Drs. O'Callaghan and Tu, being employees of the National Cancer Institute of Canada Clinical Trials Group, which has received grant support from Bristol-Myers Squibb and Amgen Canada; Drs. Langer and Khambata-Ford, owning equity in and being employees of Bristol-Myers Squibb; Dr. Zalcberg, receiving lecture and consulting fees from Amgen and ImClone; and Drs. Simes and Zalcberg, receiving research grants from Amgen, Merck Serono, Bristol-Myers Squibb, and Alphapharm (Australia). No other potential conflict of interest relevant to this article was reported.
Source Information
From Flinders Medical Centre and Flinders University, Adelaide, Australia (C.S.K.); Bristol-Myers Squibb Research and Development, Princeton, NJ (S.K.-F.); Ottawa Hospital Research Institute, University of Ottawa, Ottawa (D.J.J.); National Cancer Institute of Canada Clinical Trials Group, Kingston, ON (C.J.O., D.T., S.R., L.S.); Austin Health, Melbourne, Australia (N.C.T.); National Health and Medical Research Council Clinical Trials Centre, University of Sydney, Sydney (R.J.S.); Allan Blair Cancer Centre, Regina, SK, Canada (H.C.); Cabrini Hospital and Alfred Hospital, Melbourne, Australia (J.D.S.); Queen Elizabeth Hospital and University of Adelaide, Adelaide, Australia (T.J.P.); Cross Cancer Institute, Edmonton, AB, Canada (H.-J.A.); Bristol-Myers Squibb, Wallingford, CT (C.L.); Princess Margaret Hospital, Toronto (M.J.M.); and Peter MacCallum Cancer Centre and University of Melbourne, Melbourne, Australia (J.R.Z.).
Address reprint requests to Dr. Karapetis at the Department of Medical Oncology, Flinders Medical Centre, Flinders Dr., Bedford Park, SA 5042, Australia, or at c.karapetis@flinders.edu.au.
Other participants in the CO.17 trial from the National Cancer Institute of Canada Clinical Trials Group and the Australasian Gastro-Intestinal Trials Group are listed in the Supplementary Appendix, available with the full text of this article at www.nejm.org.
- References
References
1
Jonker DJ ,O'Callaghan CJ ,Karapetis CS , et al. Cetuximab for the treatment of colorectal cancer. N Engl J Med 2007;357:2040-2048
Full Text | Web of Science | Medline2
Baselga J . The EGFR as a target for anticancer therapy -- focus on cetuximab. Eur J Cancer 2001;37:Suppl 4:S16-S22
CrossRef | Web of Science | Medline3
Amado RG ,Wolf M ,Peeters M , et al. Wild-type KRAS is required for panitumumab efficacy in patients with metastatic colorectal cancer. J Clin Oncol 2008;26:1626-1634
CrossRef | Web of Science | Medline4
Fransen K ,Klintenas M ,Osterstrom A ,Dimberg J ,Monstein HJ ,Soderkvist P . Mutation analysis of the BRAF, ARAF and RAF-1 genes in human colorectal adenocarcinomas. Carcinogenesis 2004;25:527-533
CrossRef | Web of Science | Medline5
De Roock W ,Piessevaux H ,De Schutter J , et al. KRAS wild-type state predicts survival and is associated to early radiological response in metastatic colorectal cancer treated with cetuximab. Ann Oncol 2008;19:508-515
CrossRef | Web of Science | Medline6
Di Fiore F ,Blanchard F ,Charbonnier F , et al. Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by cetuximab plus chemotherapy. Br J Cancer 2007;96:1166-1169
CrossRef | Web of Science | Medline7
Frattini M ,Saletti P ,Romagnani E , et al. PTEN loss of expression predicts cetuximab efficacy in metastatic colorectal cancer patients. Br J Cancer 2007;97:1139-1145
CrossRef | Web of Science | Medline8
Andreyev HJ ,Ross PJ ,Cunningham D ,Clarke PA . Antisense treatment directed against mutated Ki-ras in human colorectal adenocarcinoma. Gut 2001;48:230-237
CrossRef | Web of Science | Medline9
Benvenuti S ,Sartore-Bianchi A ,Di Nicolantonio F , et al. Oncogenic activation of the RAS/RAF signaling pathway impairs the response of metastatic colorectal cancers to anti-epidermal growth factor receptor antibody therapies. Cancer Res 2007;67:2643-2648
CrossRef | Web of Science | Medline10
Esteller M ,Gonzalez S ,Risques RA , et al. K-ras and p16 aberrations confer poor prognosis in human colorectal cancer. J Clin Oncol 2001;19:299-304
Web of Science | Medline11
Bazan V ,Agnese V ,Corsale S , et al. Specific TP53 and/or Ki-ras mutations as independent predictors of clinical outcome in sporadic colorectal adenocarcinomas: results of a 5-year Gruppo Oncologico dell'Italia Meridionale (GOIM) prospective study. Ann Oncol 2005;16:Suppl 4:iv50-iv5
CrossRef | Web of Science | Medline12
Osoba D ,Rodrigues G ,Myles J ,Zee B ,Pater J . Interpreting the significance of changes in health-related quality-of-life scores. J Clin Oncol 1998;16:139-144
Web of Science | Medline13
Liavre A ,Bachet JB ,Boige V , et al. KRAS mutations as an independent prognostic factor in patients with advanced colorectal cancer treated with cetuximab. J Clin Oncol 2008;26:374-379
CrossRef | Web of Science | Medline14
Van Cutsem E ,Peeters M ,Siena S , et al. Open-label phase III trial of panitumumab plus best supportive care compared with best supportive care alone in patients with chemotherapy-refractory metastatic colorectal cancer. J Clin Oncol 2007;25:1658-1664
CrossRef | Web of Science | Medline15
Andreyev HJ ,Norman AR ,Cunningham D ,Oates JR ,Clarke PA . Kirsten ras mutations in patients with colorectal cancer: the multicenter “RASCAL” study. J Natl Cancer Inst 1998;90:675-684
CrossRef | Web of Science | Medline16
Barault L ,Veyrie N ,Jooste V , et al. Mutations in the RAS-MAPK, PI(3)K (phosphatidylinositol-3-OH kinase) signaling network correlate with poor survival in a population-based series of colon cancers. Int J Cancer 2008;122:2255-2259
CrossRef | Web of Science | Medline17
Bleeker WA ,Hayes VM ,Karrenbeld A , et al. Impact of KRAS and TP53 mutations on survival in patients with left- and right-sided Dukes' C colon cancer. Am J Gastroenterol 2000;95:2953-2957
CrossRef | Web of Science | Medline18
Khambata-Ford S ,Garrett CR ,Meropol NJ , et al. Expression of epiregulin and amphiregulin and K-ras mutation status predict disease control in metastatic colorectal cancer patients treated with cetuximab. J Clin Oncol 2007;25:3230-3237
CrossRef | Web of Science | Medline19
Cunningham D ,Humblet Y ,Siena S , et al. Cetuximab monotherapy and cetuximab plus irinotecan in irinotecan-refractory metastatic colorectal cancer. N Engl J Med 2004;351:337-345
Full Text | Web of Science | Medline20
Saltz LB ,Meropol NJ ,Loehrer PJ Sr ,Needle MN ,Kopit J ,Mayer RJ . Phase II trial of cetuximab in patients with refractory colorectal cancer that expresses the epidermal growth factor receptor. J Clin Oncol 2004;22:1201-1208
CrossRef | Web of Science | Medline21
Zhang W ,Gordon M ,Press OA , et al. Cyclin D1 and epidermal growth factor polymorphisms associated with survival in patients with advanced colorectal cancer treated with cetuximab. Pharmacogenet Genomics 2006;16:475-483
CrossRef | Web of Science | Medline22
Wierzbicki RD ,Jonker DJ ,Moore MJ , et al. A phase II multicenter study of cetuximab monotherapy in patients with EGFR-undetectable refractory metastatic colorectal carcinoma (mCRC). J Clin Oncol 2008;26:Suppl:15S-15S23
Hebbar M ,Wacrenier A ,Desauw C , et al. Lack of usefulness of epidermal growth factor receptor expression determination for cetuximab therapy in patients with colorectal cancer. Anticancer Drugs 2006;17:855-857
CrossRef | Web of Science | Medline24
Chung KY ,Shia J ,Kemeny NE , et al. Cetuximab shows activity in colorectal cancer patients with tumors that do not express the epidermal growth factor receptor by immunohistochemistry. J Clin Oncol 2005;23:1803-1810
CrossRef | Web of Science | Medline25
Penault-Llorca F ,Cayre A ,Arnould L , et al. Is there an immunohistochemical technique definitively valid in epidermal growth factor receptor assessment? Oncol Rep 2006;16:1173-1179
Web of Science | Medline26
Francoual M ,Etienne-Grimaldi MC ,Formento JL , et al. EGFR in colorectal cancer: more than a simple receptor. Ann Oncol 2006;17:962-967
CrossRef | Web of Science | Medline27
Lievre A ,Bachet JB ,Le Corre D , et al. KRAS mutation status is predictive of response to cetuximab therapy in colorectal cancer. Cancer Res 2006;66:3992-3995
CrossRef | Web of Science | Medline28
Moroni M ,Veronese S ,Benvenuti S , et al. Gene copy number for epidermal growth factor receptor (EGFR) and clinical response to antiEGFR treatment in colorectal cancer: a cohort study. Lancet Oncol 2005;6:279-286
CrossRef | Web of Science | Medline29
Lenz HJ ,Van Cutsem E ,Khambata-Ford S , et al. Multicenter phase II and translational study of cetuximab in metastatic colorectal carcinoma refractory to irinotecan, oxaliplatin, and fluoropyrimidines. J Clin Oncol 2006;24:4914-4921
CrossRef | Web of Science | Medline30
van Zandwijk N ,Mathy A ,Boerrigter L , et al. EGFR and KRAS mutations as criteria for treatment with tyrosine kinase inhibitors: retro- and prospective observations in non-small-cell lung cancer. Ann Oncol 2007;18:99-103
CrossRef | Web of Science | Medline31
Massarelli E ,Varella-Garcia M ,Tang X , et al. KRAS mutation is an important predictor of resistance to therapy with epidermal growth factor receptor tyrosine kinase inhibitors in non-small-cell lung cancer. Clin Cancer Res 2007;13:2890-2896
CrossRef | Web of Science | Medline32
Pao W ,Wang TY ,Riely GJ , et al. KRAS mutations and primary resistance of lung adenocarcinomas to gefitinib or erlotinib. PLoS Med 2005;2:e17-e17
CrossRef | Web of Science | Medline
- Citing Articles (511)
Citing Articles
1
Michel P. Bihl, Sylvia Hoeller, Maria Carla Andreozzi, Anja Foerster, Alexander Rufle, Luigi Tornillo, Luigi Terracciano. (2012) KRAS Mutation Testing in Colorectal Cancer. Diagnostic Molecular Pathology 21:1, 14-23
CrossRef2
Tracey Baas. (2012) Bringing on the BRAF. Science-Business eXchange 5:6,
CrossRef3
Alberto Bardelli, Pasi A Jänne. (2012) The road to resistance: EGFR mutation and cetuximab. Nature Medicine 18:2, 199-200
CrossRef4
M. S. Edwards, S. D. Chadda, Z. Zhao, B. L. Barber, D. P. Sykes. (2012) A systematic review of treatment guidelines for metastatic colorectal cancer. Colorectal Disease 14:2, e31-e47
CrossRef5
Shishir K. Maithel, Mithat Gönen, Hiromichi Ito, Ronald P. DeMatteo, Peter J. Allen, Yuman Fong, Leslie H. Blumgart, William R. Jarnagin, Michael I. D'Angelica. (2012) Improving the clinical risk score: An analysis of molecular biomarkers in the era of modern chemotherapy for resectable hepatic colorectal cancer metastases. Surgery 151:2, 162-170
CrossRef6
Q. Tian, N. D. Price, L. Hood. (2012) Systems cancer medicine: towards realization of predictive, preventive, personalized and participatory (P4) medicine. Journal of Internal Medicine 271:2, 111-121
CrossRef7
Lida Wang, Xuemei Chen, Wei Li, Zhixin Sheng. (2012) Antiepidermal growth factor receptor monoclonal antibody improves survival outcomes in the treatment of patients with metastatic colorectal cancer. Anti-Cancer Drugs 23:2, 155-160
CrossRef8
Terence C. Chua, Winston Liauw, Francis Chu, David L. Morris. (2012) Viewing Metastatic Colorectal Cancer as a Curable Chronic Disease. American Journal of Clinical Oncology 35:1, 77-80
CrossRef9
Efrat Dotan, Neal J. Meropol, Barbara Burtness, Crystal S. Denlinger, James Lee, David Mintzer, Fang Zhu, Karen Ruth, Holly Tuttle, Judi Sylvester, Steven J. Cohen. (2012) A Phase II Study of Capecitabine, Oxaliplatin, and Cetuximab with or Without Bevacizumab as Frontline Therapy for Metastatic Colorectal Cancer. A Fox Chase Extramural Research Study. Journal of Gastrointestinal Cancer
CrossRef10
Guoli Chen, Matthew Theodore Olson, Alan O'Neill, Alexis Norris, Katie Beierl, Shuko Harada, Marija Debeljak, Keila Rivera-Roman, Samantha Finley, Amanda Stafford, Christopher David Gocke, Ming-Tseh Lin, James Richard Eshleman. (2012) A Virtual Pyrogram Generator to Resolve Complex Pyrosequencing Results. The Journal of Molecular Diagnostics
CrossRef11
Florence Boissière-Michot, Evelyne Lopez-Crapez, Hélène Frugier, Marie-Laurence Berthe, Alexandre Ho-Pun-Cheung, Eric Assenat, Thierry Maudelonde, Pierre-Jean Lamy, Frédéric Bibeau. (2012) KRAS genotyping in rectal adenocarcinoma specimens with low tumor cellularity after neoadjuvant treatment. Modern Pathology
CrossRef12
Liang Cheng, Riley E Alexander, Gregory T MacLennan, Oscar W Cummings, Rodolfo Montironi, Antonio Lopez-Beltran, Harvey M Cramer, Darrell D Davidson, Shaobo Zhang. (2012) Molecular pathology of lung cancer: key to personalized medicine. Modern Pathology
CrossRef13
Anirudh Prahallad, Chong Sun, Sidong Huang, Federica Di Nicolantonio, Ramon Salazar, Davide Zecchin, Roderick L. Beijersbergen, Alberto Bardelli, René Bernards. (2012) Unresponsiveness of colon cancer to BRAF(V600E) inhibition through feedback activation of EGFR. Nature
CrossRef14
Clara Montagut, Alba Dalmases, Beatriz Bellosillo, Marta Crespo, Silvia Pairet, Mar Iglesias, Marta Salido, Manuel Gallen, Scot Marsters, Siao Ping Tsai, André Minoche, Seshagiri Somasekar, Sergi Serrano, Heinz Himmelbauer, Joaquim Bellmunt, Ana Rovira, Jeff Settleman, Francesc Bosch, Joan Albanell. (2012) Identification of a mutation in the extracellular domain of the Epidermal Growth Factor Receptor conferring cetuximab resistance in colorectal cancer. Nature Medicine
CrossRef15
Alexander Kühn, Hans Lehrach. (2012) The “Virtual Patient” system: modeling cancer using deep sequencing technologies for personalized cancer treatment. Journal für Verbraucherschutz und Lebensmittelsicherheit
CrossRef16
Bengt Glimelius, Nina Cavalli-Björkman. (2012) Metastatic colorectal cancer: current treatment and future options for improved survival. Scandinavian Journal of Gastroenterology1-19
CrossRef17
E Dotan, N J Meropol, F Zhu, F Zambito, B Bove, K Q Cai, A K Godwin, E A Golemis, I Astsaturov, S J Cohen. (2012) Relationship of increased aurora kinase A gene copy number, prognosis and response to chemotherapy in patients with metastatic colorectal cancer. British Journal of Cancer
CrossRef18
J Souglakos, N Ziras, S Kakolyris, I Boukovinas, N Kentepozidis, P Makrantonakis, S Xynogalos, Ch Christophyllakis, Ch Kouroussis, L Vamvakas, V Georgoulias, A Polyzos. (2012) Randomised phase-II trial of CAPIRI (capecitabine, irinotecan) plus bevacizumab vs FOLFIRI (folinic acid, 5-fluorouracil, irinotecan) plus bevacizumab as first-line treatment of patients with unresectable/metastatic colorectal cancer (mCRC). British Journal of Cancer
CrossRef19
P. Blinman, M. King, R. Norman, R. Viney, M. R. Stockler. (2012) Preferences for cancer treatments: an overview of methods and applications in oncology. Annals of Oncology
CrossRef20
George Poulogiannis, Feijun Luo, Mark J Arends. (2012) “RAS signalling in the colorectum in health and disease”. Cell Communication and Adhesion1-9
CrossRef21
Arthi Vijayaraghavan, Molly B. Efrusy, Burkhard Göke, Thomas Kirchner, Christopher C. Santas, Richard M. Goldberg. (2012) Cost-effectiveness of KRAS testing in metastatic colorectal cancer patients in the United States and Germany. International Journal of Cancern/a-n/a
CrossRef22
Suzanne Kamel-Reid, Tong Zhang, Diane L Persons, Marina N Nikiforova, Kevin C Halling. (2012) Validation of KRAS Testing for Anti-EGFR Therapeutic Decisions for Patients With Metastatic Colorectal Carcinoma. Archives of Pathology & Laboratory Medicine 136:1, 26-32
CrossRef23
Miew Keen Choong, Guy Tsafnat. (2012) Genetic and Epigenetic Biomarkers of Colorectal Cancer. Clinical Gastroenterology and Hepatology 10:1, 9-15
CrossRef24
G. Manceau, P. Laurent-Puig, H. Blons. (2012) Biologie moléculaire et prise en charge des cancers colorectaux. Oncologie 14:1, 45-51
CrossRef25
Neda Mosakhani, Virinder Kaur Sarhadi, Ioana Borze, Marja-Liisa Karjalainen-Lindsberg, Jari Sundström, Raija Ristamäki, Pia Österlund, Sakari Knuutila. (2012) MicroRNA profiling differentiates colorectal cancer according to KRAS status. Genes, Chromosomes and Cancer 51:1, 1-9
CrossRef26
Maximilian J Waldner, Markus F Neurath. (2012) Targeting the VEGF signaling pathway in cancer therapy. Expert Opinion on Therapeutic Targets 16:1, 5-13
CrossRef27
François Goldwasser. (2012) Traitement du cancer colorectal : des révolutions en marche. La Presse Médicale 41:1, 44-45
CrossRef28
François Goldwasser. (2012) Traitement du cancer colorectal métastatique : une illustration de l’évolution des concepts fondateurs de la cancérologie. La Presse Médicale 41:1, 46-50
CrossRef29
Corey J. Langer. (2012) Exploring biomarkers in head and neck cancer. Cancern/a-n/a
CrossRef30
Alexandra V. Lucs, Benjamin Saltman, Christine H. Chung, Bettie M. Steinberg, David L. Schwartz, Jeffrey N. Myers. (2012) Opportunities and challenges facing biomarker development for personalized head and neck cancer treatment. Head & Neckn/a-n/a
CrossRef31
Arjun Sood, Danielle McClain, Radhashree Maitra, Atrayee Basu-Mallick, Raviraja Seetharam, Andreas Kaubisch, Lakshmi Rajdev, John M. Mariadason, Kathryn Tanaka, Sanjay Goel. (2012) PTEN Gene Expression and Mutations in the PIK3CA Gene as Predictors of Clinical Benefit to Anti-Epidermal Growth Factor Receptor Antibody Therapy in Patients With KRAS Wild-Type Metastatic Colorectal Cancer. Clinical Colorectal Cancer
CrossRef32
Mladen Tzvetkov, Nicolas von Ahsen. (2012) Pharmacogenetic screening for drug therapy. Pathology1
CrossRef33
Ying Huang, Peter B. Gilbert, Holly Janes. (2012) Assessing Treatment-Selection Markers using a Potential Outcomes Framework. Biometricsno-no
CrossRef34
Dirk Arnold, Alexander Stein. (2012) Personalized Treatment of Colorectal Cancer. Onkologie 35:s1, 42-48
CrossRef35
T.J. Ettrich. (2012) KRAS und weitere Signalmoleküle für die Therapieentscheidung beim metastasierten Kolonkarzinom. Der Gastroenterologe 7:1, 24-29
CrossRef36
Toshikazu Moriwaki, Hideaki Bando, Atsuo Takashima, Kentaro Yamazaki, Taito Esaki, Keishi Yamashita, Mutsumi Fukunaga, Yasuhiro Miyake, Kenji Katsumata, Satoshi Kato, Taroh Satoh, Mitsuharu Ozeki, Eishi Baba, Shigemasa Yoshida, Narikazu Boku, Ichinosuke Hyodo. (2011) Bevacizumab in combination with irinotecan, 5-fluorouracil, and leucovorin (FOLFIRI) in patients with metastatic colorectal cancer who were previously treated with oxaliplatin-containing regimens: a multicenter observational cohort study (TCTG 2nd-BV study). Medical Oncology
CrossRef37
Loredana Vecchione, Zenia Saridaki, Sabine Tejpar. (2011) Clinical Implications and Quality Assurance of Molecular Testing for EGFR-Targeting Agents in Colorectal Cancer. Current Colorectal Cancer Reports
CrossRef38
A. Bottos, M. Martini, F. Di Nicolantonio, V. Comunanza, F. Maione, A. Minassi, G. Appendino, F. Bussolino, A. Bardelli. (2011) PNAS Plus: Targeting oncogenic serine/threonine-protein kinase BRAF in cancer cells inhibits angiogenesis and abrogates hypoxia. Proceedings of the National Academy of Sciences
CrossRef39
Qian Shi, Sumithra J. Mandrekar, Daniel J. Sargent. (2011) Predictive biomarkers in colorectal cancer: usage, validation, and design in clinical trials. Scandinavian Journal of Gastroenterology1-7
CrossRef40
Sung Lee, Victoria H. Brophy, Jianli Cao, Margot Velez, Corey Hoeppner, Stephen Soviero, H. Jeffrey Lawrence. (2011) Analytical performance of a PCR assay for the detection of KRAS mutations (codons 12/13 and 61) in formalin-fixed paraffin-embedded tissue samples of colorectal carcinoma. Virchows Archiv
CrossRef41
Hannes P. Neeff, Oliver Drognitz, Andrea Klock, Gerald Illerhaus, Oliver G. Opitz, Ulrich T. Hopt, Frank Makowiec. (2011) Impact of preoperative targeted therapy on postoperative complications after resection of colorectal liver metastases. International Journal of Colorectal Disease
CrossRef42
Jeffrey Deusen, David S. Hsu. (2011) Predictive and prognostic biomarkers in colorectal cancer. Frontiers in Biology 6:6, 482-489
CrossRef43
Sumithra J Mandrekar, Daniel J Sargent. (2011) Design of clinical trials for biomarker research in oncology. Clinical Investigation 1:12, 1627-1636
CrossRef44
Kohei Shitara, Takashi Ura, Keitaro Matsuo, Daisuke Takahari, Tomoya Yokota, Satoshi Yuki, Motoki Yoshida, Setsuo Utsunomiya, Yozo Sato, Hidekazu Yamaura, Mina Kato, Yoshitaka Inaba, Masahiro Tajika, Hiroki Kawai, Kentaro Yamazaki, Yoshito Komatsu, Kei Muro. (2011) Sensitivity to previous irinotecan treatment does not predict the efficacy of combination chemotherapy with cetuximab plus irinotecan for wild-type KRAS metastatic colorectal cancer. European Journal of Cancer 47:18, 2673-2680
CrossRef45
ABDUL MANNAN, VICTORIA HAHN-STRÖMBERG. (2011) K-ras mutations are correlated to lymph node metastasis and tumor stage, but not to the growth pattern of colon carcinoma. APMISno-no
CrossRef46
T. Bauernhofer. (2011) Epidermal growth factor receptor-targeted treatment strategies in advanced pancreatic cancer: Is K-RAS mutational testing ready for prime time?. memo - Magazine of European Medical Oncology 4:4, 257-259
CrossRef47
Fharat A. Raja, Jane M. Hook, Jonathan A. Ledermann. (2011) Biomarkers in the development of anti-angiogenic therapies for ovarian cancer. Cancer Treatment Reviews
CrossRef48
Leticia De Mattos-Arruda, Rodrigo Dienstmann, Josep Tabernero. (2011) Development of Molecular Biomarkers in Individualized Treatment of Colorectal Cancer. Clinical Colorectal Cancer 10:4, 279-289
CrossRef49
N. K. B. Pang, M. E. Nga, S. Y. Chin, T. M. Ismail, G. L. Lim, R. Soong, M. Salto-Tellez. (2011) KRAS and BRAF mutation analysis can be reliably performed on aspirated cytological specimens of metastatic colorectal carcinoma. Cytopathology 22:6, 358-364
CrossRef50
Eamon Berge, Chris Thompson, Wells Messersmith. (2011) Development of Novel Targeted Agents in the Treatment of Metastatic Colorectal Cancer. Clinical Colorectal Cancer 10:4, 266-278
CrossRef51
Alessandro Inno, Mariantonietta Di Salvatore, Tonia Cenci, Maurizio Martini, Armando Orlandi, Antonia Strippoli, Anna Maria Ferrara, Cinzia Bagalà, Alessandra Cassano, Luigi Maria Larocca, Carlo Barone. (2011) Is There a Role for IGF1R and c-MET Pathways in Resistance to Cetuximab in Metastatic Colorectal Cancer?. Clinical Colorectal Cancer 10:4, 325-332
CrossRef52
Vikram K. Jain, Eliza A. Hawkes, David Cunningham. (2011) Integration of Biologic Agents With Cytotoxic Chemotherapy in Metastatic Colorectal Cancer. Clinical Colorectal Cancer 10:4, 245-257
CrossRef53
Jing Gao, Ting-ting Wang, Jing-wei Yu, Yan-yan Li, Lin Shen. (2011) Wild-type KRAS and BRAF could predict response to Cetuximab in Chinese colorectal cancer patients. Chinese Journal of Cancer Research 23:4, 271-275
CrossRef54
Chia-Hsun Hsieh, John W. C. Chang, Jia-Juan Hsieh, Todd Hsu, Shiu-Feng Huang, Chun-Ta Liao, Hung-Ming Wang. (2011) Epidermal growth factor receptor mutations in patients with oral cavity cancer in a betel nut chewing-prevalent area. Head & Neck 33:12, 1758-1764
CrossRef55
Alexander Stein, Sonja Hiemer, Hans-Joachim Schmoll. (2011) Adjuvant Therapy for Early Colon Cancer. Drugs 71:17, 2257-2275
CrossRef56
Daniel Hochhauser, John A. Hartley. (2011) The interaction of EGFR and repair of DNA damage following chemotherapy and radiation. Drug Discovery Today: Disease Models
CrossRef57
Ashraf E K Ibrahim, Mark J Arends. (2011) Molecular typing of colorectal cancer: applications in diagnosis and treatment. Diagnostic Histopathology
CrossRef58
Robert Lowell Davis. (2011) The vaccine adverse event reporting system and vaccine safety research in the genomics era. Vaccine
CrossRef59
M Gobbo, G Ottaviani, G Mustacchi, R Di Lenarda, M Biasotto. (2011) Acneiform rash due to epidermal growth factor receptor inhibitors: high-level laser therapy as an innovative approach. Lasers in Medical Science
CrossRef60
N. Emami-Shahri, T. Hagemann. (2011) Resistance--the true face of biological defiance. Rheumatology
CrossRef61
Michael I. D’Angelica. (2011) Circulating CD133: A Promising Biomarker, but What Are We Measuring?. Annals of Surgical Oncology
CrossRef62
Miriam Martini, Loredana Vecchione, Salvatore Siena, Sabine Tejpar, Alberto Bardelli. (2011) Targeted therapies: how personal should we go?. Nature Reviews Clinical Oncology
CrossRef63
Giampietro Gasparini, Raffaele Longo. (2011) The paradigm of personalized therapy in oncology. Expert Opinion on Therapeutic Targets1-10
CrossRef64
L Bennett, Z Zhao, B Barber, X Zhou, M Peeters, J Zhang, F Xu, J Wiezorek, J-Y Douillard. (2011) Health-related quality of life in patients with metastatic colorectal cancer treated with panitumumab in first- or second-line treatment. British Journal of Cancer 105:10, 1495-1502
CrossRef65
A. Kay, J. Higgins, A. G. Day, R. M. Meyer, C. M. Booth. (2011) Randomized controlled trials in the era of molecular oncology: methodology, biomarkers, and end points. Annals of Oncology
CrossRef66
Dianne M. Heijink, Elisabeth G.E. de Vries, Jan J. Koornstra, Geke A.P. Hospers, Robert M.W. Hofstra, Marcel A.T.M. van Vugt, Steven de Jong, Jan H. Kleibeuker. (2011) Perspectives for tailored chemoprevention and treatment of colorectal cancer in Lynch syndrome. Critical Reviews in Oncology/Hematology 80:2, 264-277
CrossRef67
Y. Balagula, S. Wu, X. Su, M. E. Lacouture. (2011) The effect of cytotoxic chemotherapy on the risk of high-grade acneiform rash to cetuximab in cancer patients: a meta-analysis. Annals of Oncology 22:11, 2366-2374
CrossRef68
Richard L Schilsky. (2011) Drug approval challenges in the age of personalized cancer treatment. Personalized Medicine 8:6, 633-640
CrossRef69
Rena Hirani, Ashley R. Connolly, Lisa Putral, Alexander Dobrovic, Matt Trau. (2011) Sensitive Quantification of Somatic Mutations Using Molecular Inversion Probes. Analytical Chemistry 83:21, 8215-8221
CrossRef70
Alfonso De Stefano, Chiara Carlomagno, Stefano Pepe, Roberto Bianco, Sabino De Placido. (2011) Bevacizumab-related arterial hypertension as a predictive marker in metastatic colorectal cancer patients. Cancer Chemotherapy and Pharmacology 68:5, 1207-1213
CrossRef71
Liora Farber, Edna Efrati, Hela Elkin, Yehudit Peerless, Edmond Sabo, Ofer Ben-Izhak, Dov Hershkovitz. (2011) Molecular morphometric analysis shows relative intra-tumoural homogeneity for KRAS mutations in colorectal cancer. Virchows Archiv 459:5, 487-493
CrossRef72
Loredana Vecchione, Bart Jacobs, Nicola Normanno, Fortunato Ciardiello, Sabine Tejpar. (2011) EGFR-targeted therapy. Experimental Cell Research 317:19, 2765-2771
CrossRef73
Jen-Kou Lin, An-Jen Lin, Chun-Chi Lin, Yuan-Tzu Lan, Shung-Haur Yang, Anna Fen-Yau Li, Shih-Ching Chang. (2011) The status of EGFR-associated genes could predict the outcome and tumor response of chemo-refractory metastatic colorectal patients using cetuximab and chemotherapy. Journal of Surgical Oncology 104:6, 661-666
CrossRef74
Jung-min Lee, Jasmine J. Han, Gary Altwerger, Elise C. Kohn. (2011) Proteomics and biomarkers in clinical trials for drug development. Journal of Proteomics 74:12, 2632-2641
CrossRef75
Claire L. Vale, Jayne F. Tierney, David Fisher, Richard A. Adams, Richard Kaplan, Timothy S. Maughan, Mahesh K.B. Parmar, Angela M. Meade. (2011) Does anti-EGFR therapy improve outcome in advanced colorectal cancer? A systematic review and meta-analysis. Cancer Treatment Reviews
CrossRef76
J.M. Baas, L.L. Krens, H.-J. Guchelaar, J. Ouwerkerk, F.A de Jong, A.P.M. Lavrijsen, H. Gelderblom. (2011) Recommendations on management of EGFR inhibitor-induced skin toxicity: A systematic review. Cancer Treatment Reviews
CrossRef77
Vijay Agarwal, Michael J. Lind, Lynn Cawkwell. (2011) Targeted epidermal growth factor receptor therapy in malignant pleural mesothelioma: Where do we stand?. Cancer Treatment Reviews 37:7, 533-542
CrossRef78
Hiromichi Ebi, Ryan B. Corcoran, Anurag Singh, Zhao Chen, Youngchul Song, Eugene Lifshits, David P. Ryan, Jeffrey A. Meyerhardt, Cyril Benes, Jeffrey Settleman, Kwok-Kin Wong, Lewis C. Cantley, Jeffrey A. Engelman. (2011) Receptor tyrosine kinases exert dominant control over PI3K signaling in human KRAS mutant colorectal cancers. Journal of Clinical Investigation 121:11, 4311-4321
CrossRef79
Katharina Balschun, Ann-Kathrin Wenke, Christoph Röcken, Jochen Haag. (2011) Detection of KRAS and BRAF mutations in advanced colorectal cancer by allele-specific single-base primer extension. Expert Review of Molecular Diagnostics 11:8, 799-802
CrossRef80
G. Folprecht, W.O. Bechstein. (2011) Neoadjuvante Therapiekonzepte bei Lebermetastasen. Der Chirurg 82:11, 989-994
CrossRef81
C. Mao, Z. Y. Yang, X. F. Hu, Q. Chen, J. L. Tang. (2011) PIK3CA exon 20 mutations as a potential biomarker for resistance to anti-EGFR monoclonal antibodies in KRAS wild-type metastatic colorectal cancer: a systematic review and meta-analysis. Annals of Oncology
CrossRef82
A. A. Friedman, G. Tucker, R. Singh, D. Yan, A. Vinayagam, Y. Hu, R. Binari, P. Hong, X. Sun, M. Porto, S. Pacifico, T. Murali, R. L. Finley, J. M. Asara, B. Berger, N. Perrimon. (2011) Proteomic and Functional Genomic Landscape of Receptor Tyrosine Kinase and Ras to Extracellular Signal-Regulated Kinase Signaling. Science Signaling 4:196, rs10-rs10
CrossRef83
Birgit Hotz, Ulrich Keilholz, Alberto Fusi, Heinz J. Buhr, Hubert G. Hotz. (2011) In vitro and in vivo antitumor activity of cetuximab in human gastric cancer cell lines in relation to epidermal growth factor receptor (EGFR) expression and mutational phenotype. Gastric Cancer
CrossRef84
, Toshiaki Watanabe, Michio Itabashi, Yasuhiro Shimada, Shinji Tanaka, Yoshinori Ito, Yoichi Ajioka, Tetsuya Hamaguchi, Ichinosuke Hyodo, Masahiro Igarashi, Hideyuki Ishida, Megumi Ishiguro, Yukihide Kanemitsu, Norihiro Kokudo, Kei Muro, Atsushi Ochiai, Masahiko Oguchi, Yasuo Ohkura, Yutaka Saito, Yoshiharu Sakai, Hideki Ueno, Takayuki Yoshino, Takahiro Fujimori, Nobuo Koinuma, Takayuki Morita, Genichi Nishimura, Yuh Sakata, Keiichi Takahashi, Hiroya Takiuchi, Osamu Tsuruta, Toshiharu Yamaguchi, Masahiro Yoshida, Naohiko Yamaguchi, Kenjiro Kotake, Kenichi Sugihara. (2011) Japanese Society for Cancer of the Colon and Rectum (JSCCR) guidelines 2010 for the treatment of colorectal cancer. International Journal of Clinical Oncology
CrossRef85
Jayson Wang, James Hollingshead, Nabil El-Masry, Donna Horncastle, Ian Talbot, Ian Tomlinson, Malcolm R Alison, Mona El-Bahrawy. (2011) Expression of EGFR, HER2, Phosphorylated ERK and Phosphorylated MEK in Colonic Neoplasms of Familial Adenomatous Polyposis Patients. Journal of Gastrointestinal Cancer
CrossRef86
David B. Jackson, Anil K. Sood. (2011) Personalized cancer medicine—advances and socio-economic challenges. Nature Reviews Clinical Oncology 8:12, 735-741
CrossRef87
Satu Oltedal, Ole Gunnar Aasprong, Jannicke H. Møller, Hartwig Kørner, Bjørnar Gilje, Kjersti Tjensvoll, Elke M. Birkemeyer, Reino Heikkilä, Rune Smaaland, Oddmund Nordgård. (2011) Heterogeneous distribution of K-ras mutations in primary colon carcinomas: implications for EGFR-directed therapy. International Journal of Colorectal Disease 26:10, 1271-1277
CrossRef88
T. Soonthornthum, H. Arias-Pulido, N. Joste, L. Lomo, C. Muller, T. Rutledge, C. Verschraegen. (2011) Epidermal growth factor receptor as a biomarker for cervical cancer. Annals of Oncology 22:10, 2166-2178
CrossRef89
Mariana Petaccia Macedo, Louise De Brot Andrade, Renata Coudry, Rodrigo Crespo, Marina Gomes, Bianca Cristina Garcia Lisboa, Samuel Aguiar, Fernando Augusto Soares, Dirce Maria Carraro, Isabela Werneck Cunha. (2011) Multiple mutations in the Kras gene in colorectal cancer: review of the literature with two case reports. International Journal of Colorectal Disease 26:10, 1241-1248
CrossRef90
Dominik P. Modest, Sebastian Stintzing, Ruediger P. Laubender, Jens Neumann, Andreas Jung, Clemens Giessen, Michael Haas, Philipp Aubele, Christoph Schulz, Stefan Boeck, Hans-Joachim Stemmler, Thomas Kirchner, Volker Heinemann. (2011) Clinical characterization of patients with metastatic colorectal cancer depending on the KRAS status. Anti-Cancer Drugs 22:9, 913-918
CrossRef91
Xin Liu, Wei-Jian Guo, Xiao-Wei Zhang, Xu Cai, Shu Tian, Jin Li. (2011) Cetuximab enhances the activities of irinotecan on gastric cancer cell lines through downregulating the EGFR pathway upregulated by irinotecan. Cancer Chemotherapy and Pharmacology 68:4, 871-878
CrossRef92
Sara Rodríguez-Enríquez, Silvia Cecilia Pacheco-Velázquez, Juan Carlos Gallardo-Pérez, Alvaro Marín-Hernández, José Luis Aguilar-Ponce, Erika Ruiz-García, Luz María RuizGodoy-Rivera, Abelardo Meneses-García, Rafael Moreno-Sánchez. (2011) Multi-biomarker pattern for tumor identification and prognosis. Journal of Cellular Biochemistry 112:10, 2703-2715
CrossRef93
Seog Yun Park, Hee Jin Chang, Dae Yong Kim, Kyung Hae Jung, Sun Young Kim, Ji Won Park, Jae Hwan Oh, Seok-Byung Lim, Hyo Seong Choi, Seung-Yong Jeong. (2011) Is step section necessary for determination of complete pathological response in rectal cancer patients treated with preoperative chemoradiotherapy?. Histopathology 59:4, 650-659
CrossRef94
Peiju Qiu, Huashi Guan, Ping Dong, Shanshan Guo, Jinkai Zheng, Shiming Li, Yun Chen, Chi-Tang Ho, Min-Hsiung Pan, David Julian McClements, Hang Xiao. (2011) The inhibitory effects of 5-hydroxy-3,6,7,8,3′,4′-hexamethoxyflavone on human colon cancer cells. Molecular Nutrition & Food Research 55:10, 1523-1532
CrossRef95
Elena B. Elkin, Deborah A. Marshall, Nathalie A. Kulin, Ilia L. Ferrusi, Michael J. Hassett, Uri Ladabaum, Kathryn A. Phillips. (2011) Economic evaluation of targeted cancer interventions: Critical review and recommendations. Genetics in Medicine 13:10, 853-860
CrossRef96
Paul HS Shaw, Richard A Adams. (2011) Where now for anti-EGF receptor therapies in colorectal cancer?. Expert Review of Anticancer Therapy 11:10, 1543-1553
CrossRef97
Kit Man Wong, Thomas J. Hudson, John D. McPherson. (2011) Unraveling the Genetics of Cancer: Genome Sequencing and Beyond. Annual Review of Genomics and Human Genetics 12:1, 407-430
CrossRef98
Stuart Robinson, Douglas Hui, Nick Wadd, Derek M Manas, Steven A White, Stuart Robinson. 2011. Chemotherapy for downstaging unresectable liver metastases from colorectal cancer. .
CrossRef99
K. Yonesaka, K. Zejnullahu, I. Okamoto, T. Satoh, F. Cappuzzo, J. Souglakos, D. Ercan, A. Rogers, M. Roncalli, M. Takeda, Y. Fujisaka, J. Philips, T. Shimizu, O. Maenishi, Y. Cho, J. Sun, A. Destro, K. Taira, K. Takeda, T. Okabe, J. Swanson, H. Itoh, M. Takada, E. Lifshits, K. Okuno, J. A. Engelman, R. A. Shivdasani, K. Nishio, M. Fukuoka, M. Varella-Garcia, K. Nakagawa, P. A. Janne. (2011) Activation of ERBB2 Signaling Causes Resistance to the EGFR-Directed Therapeutic Antibody Cetuximab. Science Translational Medicine 3:99, 99ra86-99ra86
CrossRef100
Shaorong Yu, Li Xie, Zhibo Hou, Xiaoping Qian, Lixia Yu, Jia Wei, Yitao Ding, Baorui Liu. (2011) Coamplification at lower denaturation temperature polymerase chain reaction enables selective identification of K-Ras mutations in formalin-fixed, paraffin-embedded tumor tissues without tumor-cell enrichment. Human Pathology 42:9, 1312-1318
CrossRef101
Rodrigo Dienstmann, Enriqueta Felip. (2011) Necitumumab in the treatment of advanced non-small cell lung cancer: translation from preclinical to clinical development. Expert Opinion on Biological Therapy 11:9, 1223-1231
CrossRef102
Marc Peeters, Timothy Price. (2011) Biologic therapies in the metastatic colorectal cancer treatment continuum – Applying current evidence to clinical practice. Cancer Treatment Reviews
CrossRef103
Jianmin Xu, Xinyu Qin, Jianping Wang, Suzhan Zhang, Yunshi Zhong, Li Ren, Ye Wei, Shaochong Zeng, Deseng Wan, Shu Zheng. (2011) Chinese guidelines for the diagnosis and comprehensive treatment of hepatic metastasis of colorectal cancer. Journal of Cancer Research and Clinical Oncology 137:9, 1379-1396
CrossRef104
Kathryn M. Field, John R. Zalcberg. (2011) Biological Markers in Patients with Early-Stage Colon Cancer: Consensus and Controversies. Current Colorectal Cancer Reports 7:3, 227-240
CrossRef105
Toshiaki Watanabe, Takashi Kobunai, Yoko Yamamoto, Keiji Matsuda, Soichiro Ishihara, Keijiro Nozawa, Hisae Iinuma, Hiroki Ikeuchi, Kiyoshi Eshima. (2011) Differential gene expression signatures between colorectal cancers with and without KRAS mutations: Crosstalk between the KRAS pathway and other signalling pathways. European Journal of Cancer 47:13, 1946-1954
CrossRef106
Peter P. Luk, Peter Galettis, Matthew Links. (2011) ERK phosphorylation predicts synergism between gemcitabine and the epidermal growth factor receptor inhibitor AG1478. Lung Cancer 73:3, 274-282
CrossRef107
Toshiaki Watanabe, Takashi Kobunai, Yoko Yamamoto, Keiji Matsuda, Soichiro Ishihara, Keijiro Nozawa, Hisae Iinuma, Hajime Shibuya, Kiyoshi Eshima. (2011) Heterogeneity of KRAS Status May Explain the Subset of Discordant KRAS Status Between Primary and Metastatic Colorectal Cancer. Diseases of the Colon & Rectum 54:9, 1170-1178
CrossRef108
Thomas De Raedt, Zandra Walton, Jessica L. Yecies, Danan Li, Yimei Chen, Clare F. Malone, Ophélia Maertens, Seung Min Jeong, Roderick T. Bronson, Valerie Lebleu, Raghu Kalluri, Emmanuel Normant, Marcia C. Haigis, Brendan D. Manning, Kwok-Kin Wong, Kay F. Macleod, Karen Cichowski. (2011) Exploiting Cancer Cell Vulnerabilities to Develop a Combination Therapy for Ras-Driven Tumors. Cancer Cell 20:3, 400-413
CrossRef109
Juan José Grau, Miguel Caballero, Andrea Tagliapetra. (2011) Nuevos fármacos antineoplásicos antidiana. Indicaciones clínicas en el tratamiento de tumores sólidos. Medicina Clínica 137:8, 370-376
CrossRef110
Vinochani Pillay, Hui K. Gan, Andrew M. Scott. (2011) Antibodies in oncology. New Biotechnology 28:5, 518-529
CrossRef111
Timothy S. Maughan. (2011) The treatment of patients with low tumour burden and/or slow growing disease. European Journal of Cancer 47, S67-S75
CrossRef112
Sandrine Magnin, Erika Viel, Alice Baraquin, Severine Valmary-Degano, Bernadette Kantelip, Jean-Luc Pretet, Christiane Mougin, Marthe Bigand, Benoît Girardo, Christophe Borg, Christophe Ferrand. (2011) A Multiplex SNaPshot Assay as a Rapid Method for Detecting KRAS and BRAF Mutations in Advanced Colorectal Cancers. The Journal of Molecular Diagnostics 13:5, 485-492
CrossRef113
Shoichi Matsukuma, Mitsuyo Yoshihara, Tetsuji Suda, Manabu Shiozawa, Makoto Akaike, Tomokazu Ishikawa, Shiro Koizume, Yuji Sakuma, Yohei Miyagi. (2011) Differential detection of KRAS mutations in codons 12 and 13 with a modified loop-hybrid (LH) mobility shift assay using an insert-type LH-generator. Clinica Chimica Acta 412:19-20, 1874-1878
CrossRef114
Wei Chua, Patricia S. Kho, Melissa M. Moore, Kellie A. Charles, Stephen J. Clarke. (2011) Clinical, laboratory and molecular factors predicting chemotherapy efficacy and toxicity in colorectal cancer. Critical Reviews in Oncology/Hematology 79:3, 224-250
CrossRef115
Fortunato Ciardiello, Sabine Tejpar, Nicola Normanno, Domenica Mercadante, Tracey Teague, Bruno Wohlschlegel, Eric Cutsem. (2011) Uptake of KRAS mutation testing in patients with metastatic colorectal cancer in Europe, Latin America and Asia. Targeted Oncology 6:3, 133-145
CrossRef116
Gunnar Folprecht. (2011) Neoadjuvant chemotherapy for non-/resectable metastases. European Journal of Cancer 47, S52-S60
CrossRef117
Marc Peeters, Allen Cohn, Claus-Henning Köhne, Jean-Yves Douillard. (2011) Panitumumab in Combination With Cytotoxic Chemotherapy for the Treatment of Metastatic Colorectal Carcinoma. Clinical Colorectal Cancer
CrossRef118
P H S Shaw, T S Maughan, A R Clarke. (2011) Dual inhibition of epidermal growth factor and insulin-like 1 growth factor receptors reduce intestinal adenoma burden in the Apcmin/+ mouse. British Journal of Cancer 105:5, 649-657
CrossRef119
Nicholas B. La Thangue, David J. Kerr. (2011) Predictive biomarkers: a paradigm shift towards personalized cancer medicine. Nature Reviews Clinical Oncology 8:10, 587-596
CrossRef120
G. Brandi, G. Biasco, S. Tavolari. (2011) Re: Effect of Simvastatin on Cetuximab Resistance in Human Colorectal Cancer With KRAS Mutations. JNCI Journal of the National Cancer Institute 103:16, 1278-1278
CrossRef121
Huankai Hu, Alyssa Krasinskas, Joseph Willis. (2011) Perspectives on Current Tumor-Node-Metastasis (TNM) Staging of Cancers of the Colon and Rectum. Seminars in Oncology 38:4, 500-510
CrossRef122
Myung Hee Chang, In Kyu Lee, Yoon Si, Kyu Sang Lee, In-Sook Woo, Jae Ho Byun. (2011) Clinical impact of K-ras mutation in colorectal cancer patients treated with adjuvant FOLFOX. Cancer Chemotherapy and Pharmacology 68:2, 317-323
CrossRef123
Linlin Zhang, Li Ma, Qinghua Zhou. (2011) Overall and KRAS-specific results of combined cetuximab treatment and chemotherapy for metastatic colorectal cancer: a meta-analysis. International Journal of Colorectal Disease 26:8, 1025-1033
CrossRef124
B. Glimelius, M. Lahn. (2011) Window-of-opportunity trials to evaluate clinical activity of new molecular entities in oncology. Annals of Oncology 22:8, 1717-1725
CrossRef125
Stephen J. Clarke, Sonia Yip, Chris Brown, Guy A. van Hazel, David T. Ransom, David Goldstein, G. Mark Jeffrey, Niall C. Tebbutt, Martin Buck, Raymond M. Lowenthal, Amy Boland, Val Gebski, John Zalcberg, R. John Simes. (2011) Single-agent irinotecan or 5-fluorouracil and leucovorin (FOLFIRI) as second-line chemotherapy for advanced colorectal cancer; results of a randomised phase II study (DaVINCI) and meta-analysis. European Journal of Cancer 47:12, 1826-1836
CrossRef126
Katrine R. Schoennemann, Jon K. Bjerregaard, Tine P. Hansen, Karin Stricker, Morten F. Gjerstorff, Helle A. Jensen, Lene W. Vestermark, Per Pfeiffer. (2011) Biweekly cetuximab and irinotecan as second-line therapy in patients with gastro-esophageal cancer previously treated with platinum. Gastric Cancer 14:3, 219-225
CrossRef127
Issam Zineh, Michael A Pacanowski. (2011) Pharmacogenomics in the Assessment of Therapeutic Risks versus Benefits: Inside the United States Food and Drug Administration. Pharmacotherapy 31:8, 729-735
CrossRef128
Pierre Bohanes, Melissa J. LaBonte, Thomas Winder, Heinz-Josef Lenz. (2011) Predictive Molecular Classifiers in Colorectal Cancer. Seminars in Oncology 38:4, 576-587
CrossRef129
Kenneth J O'Byrne, Ulrich Gatzemeier, Igor Bondarenko, Carlos Barrios, Corinna Eschbach, Uwe M Martens, Yevhen Hotko, Cornelius Kortsik, Luis Paz-Ares, Jose R Pereira, Joachim von Pawel, Rodryg Ramlau, Jae-Kyung Roh, Chih-Teng Yu, Christopher Stroh, Ilhan Celik, Armin Schueler, Robert Pirker. (2011) Molecular biomarkers in non-small-cell lung cancer: a retrospective analysis of data from the phase 3 FLEX study. The Lancet Oncology 12:8, 795-805
CrossRef130
Y. Takiguchi. (2011) Pushing an Old Issue Towards a New Front Line. Japanese Journal of Clinical Oncology 41:8, 935-936
CrossRef131
Virginia Arrazubi, Roberto Pazo, Dolores Isla, José Luis Pérez Gracia. (2011) SEOM clinical guidelines for using molecular markers in clinical practice. Clinical and Translational Oncology 13:8, 587-591
CrossRef132
Mitsukuni Suenaga, Satoshi Matsusaka, Masashi Ueno, Noriko Yamamoto, Eiji Shinozaki, Nobuyuki Mizunuma, Toshiharu Yamaguchi, Kiyohiko Hatake. (2011) Predictors of the efficacy of FOLFIRI plus bevacizumab as second-line treatment in metastatic colorectal cancer patients. Surgery Today 41:8, 1067-1074
CrossRef133
Kohei Shitara, Tomoya Yokota, Daisuke Takahari, Takashi Shibata, Takashi Ura, Setsuo Utsunomiya, Yoshitaka Inaba, Hidekazu Yamaura, Yozo Sato, Mina Najima, Hiroki Kawai, Masahiro Tajika, Akira Sawaki, Yasushi Yatabe, Kei Muro. (2011) Phase II study of combination chemotherapy with irinotecan and cetuximab for pretreated metastatic colorectal cancer harboring wild-type KRAS. Investigational New Drugs 29:4, 688-693
CrossRef134
H Bando, T Yoshino, K Tsuchihara, N Ogasawara, N Fuse, T Kojima, M Tahara, M Kojima, K Kaneko, T Doi, A Ochiai, H Esumi, A Ohtsu. (2011) KRAS mutations detected by the amplification refractory mutation system–Scorpion assays strongly correlate with therapeutic effect of cetuximab. British Journal of Cancer 105:3, 403-406
CrossRef135
S Weidlich, K Walsh, D Crowther, M E Burczynski, G Feuerstein, F A Carey, R J C Steele, C R Wolf, G Miele, G Smith. (2011) Pyrosequencing-based methods reveal marked inter-individual differences in oncogene mutation burden in human colorectal tumours. British Journal of Cancer 105:2, 246-254
CrossRef136
Katsumi Muramori, Syouhei Taguchi, Tomoaki Taguchi, Kenichi Kohashi, Keizo Furuya, Kiriko Tokuda, Eiichi Ishii. (2011) High Aromatase Activity and Overexpression of Epidermal Growth Factor Receptor in Fibrolamellar Hepatocellular Carcinoma in a Child. Journal of Pediatric Hematology/Oncology 33:5, e195-e197
CrossRef137
Fausto Petrelli, Karen Borgonovo, Mary Cabiddu, Mara Ghilardi, Sandro Barni. (2011) Cetuximab and panitumumab in KRAS wild-type colorectal cancer: a meta-analysis. International Journal of Colorectal Disease 26:7, 823-833
CrossRef138
Rodney B. Luwor, Yang Lu, Xinqun Li, Ke Liang, Zhen Fan. (2011) Constitutively active Harvey Ras confers resistance to epidermal growth factor receptor–targeted therapy with cetuximab and gefitinib. Cancer Letters 306:1, 85-91
CrossRef139
Alexander Picker, David B Jackson. (2011) Genetic determinants of anticancer drug activity: towards a global approach to personalized cancer medicine. Expert Review of Molecular Diagnostics 11:6, 567-577
CrossRef140
Christopher R Garrett, Cathy Eng. (2011) Cetuximab in the treatment of patients with colorectal cancer. Expert Opinion on Biological Therapy 11:7, 937-949
CrossRef141
Steven M Anderson. (2011) Laboratory methods for KRAS mutation analysis. Expert Review of Molecular Diagnostics 11:6, 635-642
CrossRef142
Glenn Liu, Yu-Hui Chen, Jill Kolesar, Wei Huang, Robert DiPaola, Michael Pins, Michael Carducci, Mark Stein, Glenn J. Bubley, George Wilding. (2011) Eastern Cooperative Oncology Group Phase II Trial of lapatinib in men with biochemically relapsed, androgen dependent prostate cancer,. Urologic Oncology: Seminars and Original Investigations
CrossRef143
Andrew V. Biankin, Thomas J. Hudson. (2011) Somatic variation and cancer: therapies lost in the mix. Human Genetics 130:1, 79-91
CrossRef144
C. Bokemeyer, I. Bondarenko, J. T. Hartmann, F. de Braud, G. Schuch, A. Zubel, I. Celik, M. Schlichting, P. Koralewski. (2011) Efficacy according to biomarker status of cetuximab plus FOLFOX-4 as first-line treatment for metastatic colorectal cancer: the OPUS study. Annals of Oncology 22:7, 1535-1546
CrossRef145
Katharina Balschun, Jochen Haag, Ann-Kathrin Wenke, Witigo von Schönfels, Nicolas T. Schwarz, Christoph Röcken. (2011) KRAS, NRAS, PIK3CA Exon 20, and BRAF Genotypes in Synchronous and Metachronous Primary Colorectal Cancers. The Journal of Molecular Diagnostics 13:4, 436-445
CrossRef146
Ilya Lipkovich, Alex Dmitrienko, Jonathan Denne, Gregory Enas. (2011) Subgroup identification based on differential effect search-A recursive partitioning method for establishing response to treatment in patient subpopulations. Statistics in Medicinen/a-n/a
CrossRef147
Katayoon Kasaian, Steven JM Jones. (2011) A new frontier in personalized cancer therapy: mapping molecular changes. Future Oncology 7:7, 873-894
CrossRef148
Scott D Patterson, Nadine Cohen, Maha Karnoub, Sharada Louis Truter, Eileen Emison, Shirin Khambata-Ford, Brian Spear, Ekopimo Ibia, Rizwana Sproule, Diane Barnes, Anahita Bhathena, Michael R Bristow, Chris Russell, Dai Wang, Amelia Warner, Agnes Westelinck, William Brian, Amir Snapir, Monique A Franc, Peggy Wong, Peter M Shaw. (2011) Prospective–retrospective biomarker analysis for regulatory consideration: white paper from the industry pharmacogenomics working group. Pharmacogenomics 12:7, 939-951
CrossRef149
C R Garrett, L L Siu, A El-Khoueiry, J Buter, C M Rocha-Lima, J Marshall, P LoRusso, P Major, J Chemidlin, O Mokliatchouk, L Velasquez, W Hayes, D Feltquate, S Syed, S Ford, G Kollia, S Galbraith, D S A Nuyten. (2011) Phase I dose-escalation study to determine the safety, pharmacokinetics and pharmacodynamics of brivanib alaninate in combination with full-dose cetuximab in patients with advanced gastrointestinal malignancies who have failed prior therapy. British Journal of Cancer 105:1, 44-52
CrossRef150
Myoung Joo Kang, Yong Sang Hong, Kyu-pyo Kim, Sun Young Kim, Ji Yeon Baek, Min-Hee Ryu, Jae-Lyun Lee, Heung Moon Chang, Mi-Jung Kim, Hee Jin Chang, Yoon-Koo Kang, Tae Won Kim. (2011) Biweekly cetuximab plus irinotecan as second-line chemotherapy for patients with irinotecan-refractory and KRAS wild-type metastatic colorectal cancer according to epidermal growth factor receptor expression status. Investigational New Drugs
CrossRef151
Jeffrey K. Lee, Andrew T. Chan. (2011) Molecular Prognostic and Predictive Markers in Colorectal Cancer: Current Status. Current Colorectal Cancer Reports 7:2, 136-144
CrossRef152
Hans Bösmüller, Wolfgang Kranewitter, Gerald Webersinke, Holger Rumpold, Margit Hackl, Falko Fend. (2011) Morphological and molecular heterogeneity in colorectal neoplasms with K-RAS mutation. A report of two cases. Pathology - Research and Practice 207:6, 399-402
CrossRef153
Jeffrey Meyer, Glen Balch, Christopher Willett, Brian Czito. (2011) Update on Treatment Advances in Combined-Modality Therapy for Anal and Rectal Carcinomas. Current Oncology Reports 13:3, 177-185
CrossRef154
Timothy S Maughan, Richard A Adams, Christopher G Smith, Angela M Meade, Matthew T Seymour, Richard H Wilson, Shelley Idziaszczyk, Rebecca Harris, David Fisher, Sarah L Kenny, Edward Kay, Jenna K Mitchell, Ayman Madi, Bharat Jasani, Michelle D James, John Bridgewater, M John Kennedy, Bart Claes, Diether Lambrechts, Richard Kaplan, Jeremy P Cheadle. (2011) Addition of cetuximab to oxaliplatin-based first-line combination chemotherapy for treatment of advanced colorectal cancer: results of the randomised phase 3 MRC COIN trial. The Lancet 377:9783, 2103-2114
CrossRef155
Barbara-Ann Adelstein, Timothy A. Dobbins, Carole A. Harris, Ian C. Marschner, Robyn L. Ward. (2011) A systematic review and meta-analysis of KRAS status as the determinant of response to anti-EGFR antibodies and the impact of partner chemotherapy in metastatic colorectal cancer. European Journal of Cancer 47:9, 1343-1354
CrossRef156
Qiang Zuo, Min Shi, Jinzhang Chen, Wangjun Liao. (2011) The Ras signaling pathway mediates cetuximab resistance in nasopharyngeal carcinoma. Biomedicine & Pharmacotherapy 65:3, 168-174
CrossRef157
O.M. Niemoeller, M. Li, K. Lauber, C. Belka. (2011) Molekular zielgerichtete Tumortherapie durch Eingriffe in die zelluläre Signaltransduktion. Der Onkologe 17:6, 520-527
CrossRef158
Lorenzo Fornaro, Giacomo Giulio Baldi, Gianluca Masi, Giacomo Allegrini, Fotios Loupakis, Enrico Vasile, Samanta Cupini, Irene Stasi, Lisa Salvatore, Chiara Cremolini, Bruno Vincenzi, Daniele Santini, Giuseppe Tonini, Francesco Graziano, Annamaria Ruzzo, Emanuele Canestrari, Mauro Magnani, Alfredo Falcone. (2011) Cetuximab plus irinotecan after irinotecan failure in elderly metastatic colorectal cancer patients: Clinical outcome according to KRAS and BRAF mutational status. Critical Reviews in Oncology/Hematology 78:3, 243-251
CrossRef159
Robin K. Kelley, Alan P. Venook. (2011) Prognostic and Predictive Markers in Stage II Colon Cancer: Is There a Role for Gene Expression Profiling?. Clinical Colorectal Cancer 10:2, 73-80
CrossRef160
S. Robinson, D.M. Manas, I. Pedley, D. Mann, S.A. White. (2011) Systemic chemotherapy and its implications for resection of colorectal liver metastasis. Surgical Oncology 20:2, 57-72
CrossRef161
Ben George, Scott Kopetz. (2011) Predictive and Prognostic Markers in Colorectal Cancer. Current Oncology Reports 13:3, 206-215
CrossRef162
Oliver Klein, Christopher Schmidt, Ashley Knights, Ian D Davis, Weisan Chen, Jonathan Cebon. (2011) Melanoma vaccines: developments over the past 10 years. Expert Review of Vaccines 10:6, 853-873
CrossRef163
U Wallin, B Glimelius, K Jirström, S Darmanis, R Y Nong, F Pontén, C Johansson, L Påhlman, H Birgisson. (2011) Growth differentiation factor 15: a prognostic marker for recurrence in colorectal cancer. British Journal of Cancer 104:10, 1619-1627
CrossRef164
Hui Chen, Joel A. Lefferts, Mary C. Schwab, Arief A. Suriawinata, Gregory J. Tsongalis. (2011) Correlation of polypoid colorectal adenocarcinoma with pre-existing adenomatous polyps and KRAS mutation. Cancer Genetics 204:5, 245-251
CrossRef165
E. Rodríguez-Murphy, S. Villanueva-Herraiz, M.P. Ortega-García, A. Pérez-Feliu, M.A. López-Montenegro Soria, C. Camps-Herrero. (2011) Toxicidad cutánea asociada a cetuximab en cáncer colorrectal metastásico. Farmacia Hospitalaria 35:3, 114-120
CrossRef166
W.A. Weber. (2011) Molekulare Bildgebung in der Tumortherapie. Der Onkologe 17:5, 395-404
CrossRef167
M. Nannini, M. A. Pantaleo, P. Paterini, G. Piazzi, C. Ceccarelli, S. La Rovere, A. Maleddu, G. Biasco. (2011) Molecular detection of epidermal growth factor receptor in colorectal cancer: does it still make sense?. Colorectal Disease 13:5, 542-548
CrossRef168
Augusto Villanueva, Josep M. Llovet. (2011) Targeted Therapies for Hepatocellular Carcinoma. Gastroenterology 140:5, 1410-1426
CrossRef169
Rebekka Krumbach, Julia Schüler, Michael Hofmann, Torsten Giesemann, Heinz-Herbert Fiebig, Thomas Beckers. (2011) Primary resistance to cetuximab in a panel of patient-derived tumour xenograft models: Activation of MET as one mechanism for drug resistance. European Journal of Cancer 47:8, 1231-1243
CrossRef170
Rebecca Y Kim, Hua Xu, Samuel Myllykangas, Hanlee Ji. (2011) Genetic-based biomarkers and next-generation sequencing: the future of personalized care in colorectal cancer. Personalized Medicine 8:3, 331-345
CrossRef171
Jeanne Tie, Peter Gibbs, Lara Lipton, Michael Christie, Robert N. Jorissen, Antony W. Burgess, Matthew Croxford, Ian Jones, Rachel Langland, Suzanne Kosmider, Daniel McKay, Gideon Bollag, Keith Nolop, Oliver M. Sieber, Jayesh Desai. (2011) Optimizing targeted therapeutic development: Analysis of a colorectal cancer patient population with the BRAFV600E mutation. International Journal of Cancer 128:9, 2075-2084
CrossRef172
Finn Ole Larsen, Per Pfeiffer, Dorte Nielsen, Kristin Skougaard, Camilla Qvortrup, Kirsten Vistisen, Anne-Lene Fromm, Trine L. Jørgensen, Jon K. Bjerregaard, Estrid Hoegdall, Benny V. Jensen. (2011) Bevacizumab in combination with cetuximab and irinotecan after failure of cetuximab and irinotecan in patients with metastatic colorectal cancer. Acta Oncologica 50:4, 574-577
CrossRef173
Ingrid Ljuslinder, Beatrice Melin, Maria L. Henriksson, Åke Öberg, Richard Palmqvist. (2011) Increased epidermal growth factor receptor expression at the invasive margin is a negative prognostic factor in colorectal cancer. International Journal of Cancer 128:9, 2031-2037
CrossRef174
Huidan Zhang, Xiaonan Wang, Qian Ma, Zhe Zhou, Jin Fang. (2011) Rapid detection of low-abundance K-ras mutation in stools of colorectal cancer patients using chip-based temperature gradient capillary electrophoresis. Laboratory Investigation 91:5, 788-798
CrossRef175
E. Rodríguez-Murphy, S. Villanueva-Herraiz, M.P. Ortega-García, A. Pérez-Feliu, M.A. López-Montenegro Soria, C. Camps-Herrero. (2011) Cutaneous Toxicity Associated With Cetuximab Treatment in Metastatic Colorectal Cancer. Farmacia Hospitalaria (English Edition) 35:3, 114-120
CrossRef176
J. Lee, I. Lee, B. Han, J. O. Park, J. Jang, C. Park, W. K. Kang. (2011) Effect of Simvastatin on Cetuximab Resistance in Human Colorectal Cancer With KRAS Mutations. JNCI Journal of the National Cancer Institute 103:8, 674-688
CrossRef177
Janna Paulsson, Maja Bradic Lindh, Malin Jarvius, Marjut Puputti, Monica Nistér, Nina N. Nupponen, Werner Paulus, Ola Söderberg, Gregor Dresemann, Andreas von Deimling, Heikki Joensuu, Arne Östman, Martin Hasselblatt. (2011) Prognostic but not predictive role of platelet-derived growth factor receptors in patients with recurrent glioblastoma. International Journal of Cancer 128:8, 1981-1988
CrossRef178
Alicia Okines, David Cunningham, Ian Chau. (2011) Targeting the human EGFR family in esophagogastric cancer. Nature Reviews Clinical Oncology 8:8, 492-503
CrossRef179
Fotios Loupakis, Chiara Cremolini, Marta Schirripa, Gianluca Masi, Alfredo Falcone. (2011) Cytotoxic triplets plus a biologic: state-of-the-art in maximizing the potential of up-front medical treatment of metastatic colorectal cancer. Expert Opinion on Biological Therapy 11:4, 519-531
CrossRef180
Adrian C. Begg, Fiona A. Stewart, Conchita Vens. (2011) Strategies to improve radiotherapy with targeted drugs. Nature Reviews Cancer 11:4, 239-253
CrossRef181
Liang Cheng, Shaobo Zhang, Riley Alexander, Yongxue Yao, Gregory T MacLennan, Chong-xian Pan, Jiaoti Huang, Mingsheng Wang, Rodolfo Montironi, Antonio Lopez-Beltran. (2011) The landscape of EGFR pathways and personalized management of non-small-cell lung cancer. Future Oncology 7:4, 519-541
CrossRef182
S. L. McDonald, A. R. Silver. (2011) On target? Strategies and progress in the development of therapies for colorectal cancer targeted against WNT signalling. Colorectal Disease 13:4, 360-369
CrossRef183
Ian D DAVIS. (2011) Update on monoclonal antibodies for the treatment of cancer. Asia-Pacific Journal of Clinical Oncology 7, 20-25
CrossRef184
Madhuri V Warren, WY Iris Chan, John M Ridley. (2011) Analysis of protein biomarkers in human clinical tumor samples: critical aspects to success from tissue acquisition to analysis. Biomarkers in Medicine 5:2, 227-248
CrossRef185
Karoliina Vuoriluoto, Gunilla Högnäs, Pipsa Meller, Kaisa Lehti, Johanna Ivaska. (2011) Syndecan-1 and -4 differentially regulate oncogenic K-ras dependent cell invasion into collagen through α2β1 integrin and MT1-MMP. Matrix Biology 30:3, 207-217
CrossRef186
Martha Nowosielski, Wolfgang Recheis, Georg Goebel, Özgür Güler, Gerd Tinkhauser, Herwig Kostron, Michael Schocke, Thaddaeus Gotwald, Günther Stockhammer, Markus Hutterer. (2011) ADC histograms predict response to anti-angiogenic therapy in patients with recurrent high-grade glioma. Neuroradiology 53:4, 291-302
CrossRef187
Antoine Brouquet, Philippe Taleb, Anne-Sophie Lot, Alain Beauchet, Catherine Julie, Gregoire Prevost, Bernard Nordlinger, Christophe Penna. (2011) A Model of Primary Culture of Colorectal Cancer and Liver Metastasis to Predict Chemosensitivity. Journal of Surgical Research 166:2, 247-254
CrossRef188
Noriko Tada, Tomohisa Horibe, Mari Haramoto, Koji Ohara, Masayuki Kohno, Koji Kawakami. (2011) A single replacement of histidine to arginine in EGFR-lytic hybrid peptide demonstrates the improved anticancer activity. Biochemical and Biophysical Research Communications 407:2, 383-388
CrossRef189
Xabier Garcia-Albeniz, Carles Pericay, Virginia Alonso-Espinaco, Vicente Alonso, Pilar Escudero, Carlos Fernández-Martos, Rosa Gallego, Pere Gascón, Sergi Castellví-Bel, Joan Maurel. (2011) Serum matrilysin correlates with poor survival independently of KRAS and BRAF status in refractory advanced colorectal cancer patients treated with irinotecan plus cetuximab. Tumor Biology 32:2, 417-424
CrossRef190
N Knijn, L J M Mekenkamp, M Klomp, M E Vink-Börger, J Tol, S Teerenstra, J W R Meijer, M Tebar, S Riemersma, J H J M van Krieken, C J A Punt, I D Nagtegaal. (2011) KRAS mutation analysis: a comparison between primary tumours and matched liver metastases in 305 colorectal cancer patients. British Journal of Cancer 104:6, 1020-1026
CrossRef191
S Rachagani, S Senapati, S Chakraborty, M P Ponnusamy, S Kumar, L M Smith, M Jain, S K Batra. (2011) Activated KrasG12D is associated with invasion and metastasis of pancreatic cancer cells through inhibition of E-cadherin. British Journal of Cancer 104:6, 1038-1048
CrossRef192
Arantza Fariña Sarasqueta, Elna Moerland, Hanneke de Bruyne, Henk de Graaf, Tamara Vrancken, Gesina van Lijnschoten, Adriaan J.C. van den Brule. (2011) SNaPshot and StripAssay as Valuable Alternatives to Direct Sequencing for KRAS Mutation Detection in Colon Cancer Routine Diagnostics. The Journal of Molecular Diagnostics 13:2, 199-205
CrossRef193
Valentina Fodale, Mariaelena Pierobon, Lance Liotta, Emanuel Petricoin. (2011) Mechanism of Cell Adaptation. The Cancer Journal 17:2, 89-95
CrossRef194
B. Bengsch, R. Thimme, H.E. Blum. (2011) Individualisierte Medizin 2011. Der Gastroenterologe 6:2, 106-111
CrossRef195
T Yokota, T Ura, N Shibata, D Takahari, K Shitara, M Nomura, C Kondo, A Mizota, S Utsunomiya, K Muro, Y Yatabe. (2011) BRAF mutation is a powerful prognostic factor in advanced and recurrent colorectal cancer. British Journal of Cancer 104:5, 856-862
CrossRef196
Ian J Majewski, René Bernards. (2011) Taming the dragon: genomic biomarkers to individualize the treatment of cancer. Nature Medicine304-312
CrossRef197
Rodrigo Dienstmann, Eduardo Vilar, Josep Tabernero. (2011) Molecular Predictors of Response to Chemotherapy in Colorectal Cancer. The Cancer Journal 17:2, 114-126
CrossRef198
Enrique Aranda, Albert Abad, Alfredo Carrato, Andrés Cervantes, Jesús García-Foncillas, Pilar García Alfonso, Rocío García Carbonero, Auxiliadora Gómez España, Josep M. Tabernero, Eduardo Díaz-Rubio. (2011) Treatment recommendations for metastatic colorectal cancer. Clinical and Translational Oncology 13:3, 162-178
CrossRef199
Christopher T Harbison, Christine E Horak, Shirin Khambata-Ford. (2011) The cetuximab experience: developing predictive biomarkers in oncology. Personalized Medicine 8:2, 149-159
CrossRef200
James J. Mezhir, Michael I. D’Angelica. (2011) Prognostic Markers and Staging Systems for Patients with Colorectal Liver Metastases. Journal of Gastrointestinal Surgery 15:3, 406-409
CrossRef201
Joseph Sung. (2011) Future role of gastroenterologists in digestive oncology in the Asia Pacific region: Panir Chelvam Memorial Lecture, Asian Pacific Digestive Week 2010. Journal of Gastroenterology and Hepatology 26:3, 432-436
CrossRef202
Christian Grimstein, Jane PF Bai. (2011) Individualizing therapy of monoclonal antibodies and fusion proteins: emerging potential in the age of personalized medicine. Therapeutic Delivery 2:3, 369-381
CrossRef203
Zenta Walther, Jeffrey Sklar. (2011) Molecular Tumor Profiling for Prediction of Response to Anticancer Therapies. The Cancer Journal 17:2, 71-79
CrossRef204
Roshawn G. Watson, Howard L. McLeod. (2011) Pharmacogenomic Contribution to Drug Response. The Cancer Journal 17:2, 80-88
CrossRef205
Marc Buyse, Stefan Michiels, Daniel J Sargent, Axel Grothey, Alastair Matheson, Aimery de Gramont. (2011) Integrating biomarkers in clinical trials. Expert Review of Molecular Diagnostics 11:2, 171-182
CrossRef206
Christian Ensinger. (2011) Models of partnership between the pharmaceutical and diagnostics industries around companion diagnostics for cancer and beyond. Expert Opinion on Medical Diagnostics 5:2, 91-94
CrossRef207
Sandra Van Schaeybroeck, Wendy L. Allen, Richard C. Turkington, Patrick G. Johnston. (2011) Implementing prognostic and predictive biomarkers in CRC clinical trials. Nature Reviews Clinical Oncology 8:4, 222-232
CrossRef208
E F Dunn, M Iida, R A Myers, D A Campbell, K A Hintz, E A Armstrong, C Li, D L Wheeler. (2011) Dasatinib sensitizes KRAS mutant colorectal tumors to cetuximab. Oncogene 30:5, 561-574
CrossRef209
Guoqiang Li, Xiaodi Luo, Jiaying He, Zeyao Zhu, Gang Yu, Huijuan Qin, Tao Zeng, Zhiming Liu, Shiyang Wu, Jiasen Xu, Lifen Ren-Heidenreich. (2011) A novel liquidchip platform for simultaneous detection of 70 alleles of DNA somatic mutations on EGFR, KRAS, BRAF and PIK3CA from formalin-fixed and paraffin-embedded slides containing tumor tissue. Clinical Chemistry and Laboratory Medicine 49:2, 191-195
CrossRef210
J B Baker, D Dutta, D Watson, T Maddala, B M Munneke, S Shak, E K Rowinsky, L-A Xu, C T Harbison, E A Clark, D J Mauro, S Khambata-Ford. (2011) Tumour gene expression predicts response to cetuximab in patients with KRAS wild-type metastatic colorectal cancer. British Journal of Cancer 104:3, 488-495
CrossRef211
Vincenzo Formica, Raffaele Palmirotta, Girolamo Monte, Annalisa Savonarola, Giorgia Ludovici, Maria Laura De Marchis, Italia Grenga, Michele Schirru, Fiorella Guadagni, Mario Roselli. (2011) Predictive value of VEGF gene polymorphisms for metastatic colorectal cancer patients receiving first-line treatment including fluorouracil, irinotecan, and bevacizumab. International Journal of Colorectal Disease 26:2, 143-151
CrossRef212
Rui Feng Xu, Ji Ping Sun, Shi Rong Zhang, Guan Shan Zhu, Li Bo Li, Yu Lin Liao, Jian Ming Xie, Wang Jun Liao. (2011) KRAS and PIK3CA but not BRAF genes are frequently mutated in Chinese cholangiocarcinoma patients. Biomedicine & Pharmacotherapy 65:1, 22-26
CrossRef213
T. Doi, M. Tahara, T. Yoshino, K. Yamazaki, T. Tamura, Y. Yamada, B.-B. Yang, K. S. Oliner, S. Otani, D. Asahi. (2011) Tumor KRAS Status Predicts Responsiveness to Panitumumab in Japanese Patients with Metastatic Colorectal Cancer. Japanese Journal of Clinical Oncology 41:2, 210-216
CrossRef214
N. Okayama, M. Nishioka, S. Hazama, K. Sakai, Y. Suehiro, M. Maekawa, J.-i. Sakamoto, S. Iwamoto, T. Kato, H. Mishima, M. Oka, Y. Hinoda. (2011) The Importance of Evaluation of DNA Amplificability in KRAS Mutation Testing with Dideoxy Sequencing using Formalin-fixed and Paraffin-embedded Colorectal Cancer Tissues. Japanese Journal of Clinical Oncology 41:2, 165-171
CrossRef215
Dawn Odom, Beth Barber, Lee Bennett, Marc Peeters, Zhongyun Zhao, James Kaye, Michael Wolf, Jeffrey Wiezorek. (2011) Health-related quality of life and colorectal cancer-specific symptoms in patients with chemotherapy-refractory metastatic disease treated with panitumumab. International Journal of Colorectal Disease 26:2, 173-181
CrossRef216
H. Bando, K. Tsuchihara, T. Yoshino, M. Kojima, N. Ogasawara, H. Fukushima, A. Ochiai, A. Ohtsu, H. Esumi. (2011) Biased Discordance of KRAS Mutation Detection in Archived Colorectal Cancer Specimens Between the ARMS-Scorpion Method and Direct Sequencing. Japanese Journal of Clinical Oncology 41:2, 239-244
CrossRef217
Asem Shalaby, Nadège Presneau, Hongtao Ye, Dina Halai, Fitim Berisha, Bernadine Idowu, Andreas Leithner, Bernadette Liegl, Timothy RW Briggs, Krisztian Bacsi, Lars-Gunnar Kindblom, Nicholas Athanasou, Maria Fernanda Amary, Pancras CW Hogendoorn, Roberto Tirabosco, Adrienne M Flanagan. (2011) The role of epidermal growth factor receptor in chordoma pathogenesis: a potential therapeutic target. The Journal of Pathology 223:3, 336-346
CrossRef218
Rafal Wierzbicki, Derek J. Jonker, Malcolm J. Moore, Scott R. Berry, Patrick J. Loehrer, Hagop Youssoufian, Eric K. Rowinsky. (2011) A phase II, multicenter study of cetuximab monotherapy in patients with refractory, metastatic colorectal carcinoma with absent epidermal growth factor receptor immunostaining. Investigational New Drugs 29:1, 167-174
CrossRef219
Robert O. Dillman. (2011) Cancer Immunotherapy. Cancer Biotherapy & Radiopharmaceuticals 26:1, 1-64
CrossRef220
Marwan G Fakih. (2011) Making sense of anti-EGFR plus oxaliplatin-based therapy in the first-line treatment of metastatic colorectal cancer. Future Oncology 7:2, 223-226
CrossRef221
James J. Mezhir. (2011) The Desmoid Tumor: Still an Enigma. Journal of Surgical Research
CrossRef222
V Pavet, M M Portal, J C Moulin, R Herbrecht, H Gronemeyer. (2011) Towards novel paradigms for cancer therapy. Oncogene 30:1, 1-20
CrossRef223
Pia Wegman, Cecilia Ahlin, Bengt Sorbe. (2011) Genetic Alterations in the K-Ras Gene Influence the Prognosis in Patients With Cervical Cancer Treated by Radiotherapy. International Journal of Gynecological Cancer 21:1, 86-91
CrossRef224
Brigitte Metzger, Laetitia Chambeau, Dominique Y Begon, Carlo Faber, Jacques Kayser, Guy Berchem, Marc Pauly, Jacques Boniver, Philippe Delvenne, Mario Dicato, Thomas Wenner. (2011) The human epidermal growth factor receptor (EGFR) gene in European patients with advanced colorectal cancer harbors infrequent mutations in its tyrosine kinase domain. BMC Medical Genetics 12:1, 144
CrossRef225
D.P. Modest, A. Jung, N. Moosmann, R.P. Laubender, C. Giessen, C. Schulz, M. Haas, J. Neumann, S. Boeck, T. Kirchner, V. Heinemann, S. Stintzing. (2011) The influence of KRAS and BRAF mutations on the efficacy of cetuximab-based first-line therapy of metastatic colorectal cancer: An analysis of the AIO KRK-0104-trial. International Journal of Cancern/a-n/a
CrossRef226
Alyssa M. Krasinskas. (2011) EGFR Signaling in Colorectal Carcinoma. Pathology Research International 2011, 1-6
CrossRef227
Anke Reinacher-Schick. (2011) Metastasiertes kolorektales Karzinom – State of the Art 2011. Viszeralmedizin 27:6, 445-453
CrossRef228
W. Zhang, T. Winder, Y. Ning, A. Pohl, D. Yang, M. Kahn, G. Lurje, M. J. LaBonte, P. M. Wilson, M. A. Gordon, S. Hu-Lieskovan, D. J. Mauro, C. Langer, E. K. Rowinsky, H.- J. Lenz. (2011) A let-7 microRNA-binding site polymorphism in 3'-untranslated region of KRAS gene predicts response in wild-type KRAS patients with metastatic colorectal cancer treated with cetuximab monotherapy. Annals of Oncology 22:1, 104-109
CrossRef229
Maria Arcila, Christopher Lau, Khedoudja Nafa, Marc Ladanyi. (2011) Detection of KRAS and BRAF Mutations in Colorectal Carcinoma. The Journal of Molecular Diagnostics 13:1, 64-73
CrossRef230
Kohei Shitara, Keitaro Matsuo, Chihiro Kondo, Daisuke Takahari, Takashi Ura, Yoshitaka Inaba, Hidekazu Yamaura, Yozo Sato, Mina Kato, Yukihide Kanemitsu, Koji Komori, Seiji Ishiguro, Tsuyoshi Sano, Yasuhiro Shimizu, Kei Muro. (2011) Prolonged Survival of Patients with Metastatic Colorectal Cancer following First-Line Oxaliplatin-Based Chemotherapy with Molecular Targeting Agents and Curative Surgery. Oncology 81:3-4, 167-174
CrossRef231
Alois H. Lang, Heinz Drexel, Simone Geller-Rhomberg, Nicole Stark, Thomas Winder, Kathrin Geiger, Axel Muendlein. (2011) Optimized Allele-Specific Real-Time PCR Assays for the Detection of Common Mutations in KRAS and BRAF. The Journal of Molecular Diagnostics 13:1, 23-28
CrossRef232
Laurent Becquemont, Ana Alfirevic, Ursula Amstutz, Hiltrud Brauch, Evelyne Jacqz-Aigrain, Pierre Laurent-Puig, Miguel A Molina, Mikko Niemi, Matthias Schwab, Andrew A Somogyi, Eric Thervet, Anke-Hilse Maitland-van der Zee, André BP van Kuilenburg, Ron HN van Schaik, Céline Verstuyft, Mia Wadelius, Ann K Daly. (2011) Practical recommendations for pharmacogenomics-based prescription: 2010 ESF–UB Conference on Pharmacogenetics and Pharmacogenomics. Pharmacogenomics 12:1, 113-124
CrossRef233
Kevin M. Sullivan, Peter S. Kozuch. (2011) Impact of KRAS Mutations on Management of Colorectal Carcinoma. Pathology Research International 2011, 1-11
CrossRef234
Hye Jin Choi, Joo Hyuk Sohn, Chang Geol Lee, Hyo Sub Shim, Ik-Jae Lee, Woo Ick Yang, Ji Eun Kwon, Se Kyu Kim, Moo-Suk Park, Ju Hee Lee, Joo Hang Kim. (2011) A phase I study of nimotuzumab in combination with radiotherapy in stages IIB–IV non-small cell lung cancer unsuitable for radical therapy: Korean results. Lung Cancer 71:1, 55-59
CrossRef235
Jing Gao, Ming Lu, Jing-wei Yu, Yan-yan Li, Lin Shen. (2011) Thymidine Phosphorylase/β-tubulin III expressions predict the response in Chinese advanced gastric cancer patients receiving first-line capecitabine plus paclitaxel. BMC Cancer 11:1, 177
CrossRef236
Laetitia Dahan, Emmanuelle Norguet, Marie-Christine Etienne-Grimaldi, Jean-Louis Formento, Mohamed Gasmi, Isabelle Nanni, Jean Gaudart, Stéphane Garcia, L'Houcine Ouafik, Jean-François Seitz, Gérard Milano. (2011) Pharmacogenetic profiling and cetuximab outcome in patients with advanced colorectal cancer. BMC Cancer 11:1, 496
CrossRef237
Dongjun Jeong, Yujun Jeong, Jonghyun Lee, Moo-Jun Baek, Yongbae Kim, Ji-Hye Lee, Hyun-Deuk Cho, Mee-Hye Oh, Chang-Jin Kim. (2011) Rapid and Sensitive Detection of KRAS Mutation by Peptide Nucleic Acid-based Real-time PCR Clamping: A Comparison with Direct Sequencing between Fresh Tissue and Formalin-fixed and Paraffin Embedded Tissue of Colorectal Cancer. The Korean Journal of Pathology 45:2, 151
CrossRef238
K. Kato, Y. Inaba, Y. Tsuji, T. Esaki, A. Yoshioka, N. Mizunuma, T. Mizuno, H. Kusaba, H. Fujii, K. Muro, Y. Shimada, K. Shirao. (2011) A Multicenter Phase-II Study of 5-FU, Leucovorin and Oxaliplatin (FOLFOX6) in Patients with Pretreated Metastatic Colorectal Cancer. Japanese Journal of Clinical Oncology 41:1, 63-68
CrossRef239
N. Ogasawara, H. Bando, Y. Kawamoto, T. Yoshino, K. Tsuchihara, A. Ohtsu, H. Esumi. (2011) Feasibility and Robustness of Amplification Refractory Mutation System (ARMS)-based KRAS Testing Using Clinically Available Formalin-fixed, Paraffin-embedded Samples of Colorectal Cancers. Japanese Journal of Clinical Oncology 41:1, 52-56
CrossRef240
Yoshinori Hirashima, Yasuhide Yamada, Ukihide Tateishi, Ken Kato, Mototaka Miyake, Yosuke Horita, Kohei Akiyoshi, Atsuo Takashima, Natsuko Okita, Daisuke Takahari, Takako Nakajima, Tetsuya Hamaguchi, Yasuhiro Shimada, Kuniaki Shirao. (2011) Pharmacokinetic parameters from 3-Tesla DCE-MRI as surrogate biomarkers of antitumor effects of bevacizumab plus FOLFIRI in colorectal cancer with liver metastasis. International Journal of Cancern/a-n/a
CrossRef241
Stefania Marzinotto, Francesca Sessa, Alessandra Franzoni, Alessia Anselmi, Laura Rosa Gastaldo, Silvia Mason, Giuseppe Damante, Carlo Alberto Beltrami, Laura Mariuzzi. (2011) KRAS Codons 12 and 13 Mutation Analysis: A Comparative Study between Direct Sequencing and a New Sensitive Real-Time PCR Assay. Sequencing 2011, 1-7
CrossRef242
Stéphane Dalle, Luc Thomas, Neil H. Shear. (2011) How pharmacogenomics of biological response modifiers will influence clinical response and toxicity in dermatology. International Journal of Dermatology 50:1, 114-118
CrossRef243
T. R. Asmis, E. Powell, C. S. Karapetis, D. J. Jonker, D. Tu, M. Jeffery, N. Pavlakis, P. Gibbs, L. Zhu, D.- A. Dueck, R. Whittom, C. Langer, C. J. O'Callaghan. (2011) Comorbidity, age and overall survival in cetuximab-treated patients with advanced colorectal cancer (ACRC)--results from NCIC CTG CO.17: a phase III trial of cetuximab versus best supportive care. Annals of Oncology 22:1, 118-126
CrossRef244
Efsevia Vakiani, David B Solit. (2011) KRAS and BRAF: drug targets and predictive biomarkers. The Journal of Pathology 223:2, 220-230
CrossRef245
Pierre H Chapuis, Charles Chan, Owen F Dent. (2011) Clinicopathological staging of colorectal cancer: Evolution and consensus-an Australian perspective. Journal of Gastroenterology and Hepatology 26, 58-64
CrossRef246
Robert Königsberg, Wolfgang Hulla, Martin Klimpfinger, Angelika Reiner-Concin, Tanja Steininger, Wilfried Büchler, Robert Terkola, Christian Dittrich. (2011) Clinical and Economic Aspects of KRAS Mutational Status as Predictor for Epidermal Growth Factor Receptor Inhibitor Therapy in Metastatic Colorectal Cancer Patients. Oncology 81:5-6, 359-364
CrossRef247
P. Correale, C. Botta, M.G. Cusi, M.T. Del Vecchio, M.M. De Santi, G. Gori Savellini, E. Bestoso, S. Apollinari, S. Mannucci, M. Marra, A. Abbruzzese, A. Aquino, M. Turriziani, L. Bonmassar, M. Caraglia, P. Tagliaferri. (2011) Cetuximab ± chemotherapy enhances dendritic cell-mediated phagocytosis of colon cancer cells and ignites a highly efficient colon cancer antigen-specific cytotoxic T-cell response in vitro. International Journal of Cancern/a-n/a
CrossRef248
Hans Kristian Moen Vollan, Carlos Caldas. (2011) The breast cancer genome - a key for better oncology. BMC Cancer 11:1, 501
CrossRef249
Kohei Shitara, Satoshi Yuki, Motoki Yoshida, Daisuke Takahari, Setsuo Utsunomiya, Tomoya Yokota, Yozo Sato, Yoshitaka Inaba, Masahiro Tajika, Hiroki Kawai, Hidekazu Yamaura, Mina Kato, Kentaro Yamazaki, Yoshito Komatsu, Kei Muro. (2010) Phase II study of combination chemotherapy with biweekly cetuximab and irinotecan for wild-type KRAS metastatic colorectal cancer refractory to irinotecan, oxaliplatin, and fluoropyrimidines. Investigational New Drugs
CrossRef250
Cristina Oliveras-Ferraros, Anna Massaguer Vall-llovera, Dolors Carrion Salip, Alejandro Vazquez-Martin, Silvia Cufí, Bernardo Queralt, Begoña Martin-Castillo, Joan Brunet, Rafael Llorens, Javier A. Menendez. (2010) Evolution of the predictive markers amphiregulin and epiregulin mRNAs during long-term cetuximab treatment of KRAS wild-type tumor cells. Investigational New Drugs
CrossRef251
Ravit Geva, Hans Prenen, Baki Topal, Raymond Aerts, Jaarke Vannoote, Eric Van Cutsem. (2010) Biologic modulation of chemotherapy in patients with hepatic colorectal metastases: The role of anti-VEGF and anti-EGFR antibodies. Journal of Surgical Oncology 102:8, 937-945
CrossRef252
Gilda da Cunha Santos, Neesha Dhani, Dongsheng Tu, Kayu Chin, Olga Ludkovski, Suzanne Kamel-Reid, Jeremy Squire, Wendy Parulekar, Malcolm J. Moore, Ming Sound Tsao. (2010) Molecular predictors of outcome in a phase 3 study of gemcitabine and erlotinib therapy in patients with advanced pancreatic cancer. Cancer 116:24, 5599-5607
CrossRef253
F Di Fiore, R Sesboüé, P Michel, J C Sabourin, T Frebourg. (2010) Molecular determinants of anti-EGFR sensitivity and resistance in metastatic colorectal cancer. British Journal of Cancer 103:12, 1765-1772
CrossRef254
Uzma Asghar, Eliza Hawkes, David Cunningham. (2010) Predictive and Prognostic Biomarkers for Targeted Therapy in Metastatic Colorectal Cancer. Clinical Colorectal Cancer 9:5, 274-281
CrossRef255
Linda C Surh, Michael A Pacanowski, Susanne B Haga, Stuart Hobbs, Lawrence J Lesko, Scott Gottlieb, Marisa Papaluca-Amati, Scott D Patterson, Arlene R Hughes, Myong-Jin Kim, Sandra L Close, Michael Mosteller, Issam Zineh, Bryan Dechairo, Nadine A Cohen. (2010) Learning from product labels and label changes: how to build pharmacogenomics into drug-development programs. Pharmacogenomics 11:12, 1637-1647
CrossRef256
Maria Rosaria De Miglio, Antonica Mura, Maria Gabriela Uras, Alessandra Manca, Marcella Contini, Luciano Murgia, Angelo Zinellu, Salvatore Sotgia, Ciriaco Carru, Giovannino Massarelli, Paolo Cossu-Rocca. (2010) High Sensitivity of Reverse-hybridization Methodology in the Detection of KRAS Mutations from Formalin-fixed Paraffin-embedded Colorectal Cancer Samples. Diagnostic Molecular Pathology 19:4, 201-208
CrossRef257
Qing Huang, Gui-Yu Wang, Jun-Fu Huang, Bo Zhang, Wei-Ling Fu. (2010) High sensitive mutation analysis on KRAS gene using LNA/DNA chimeras as PCR amplification blockers of wild-type alleles. Molecular and Cellular Probes 24:6, 376-380
CrossRef258
J Woodcock. (2010) Assessing the Clinical Utility of Diagnostics Used in Drug Therapy. Clinical Pharmacology & Therapeutics 88:6, 765-773
CrossRef259
Gelareh Farshid, Jane E. Armes, Richard Bell, Margaret Cummings, Stephen Fox, Glenn Francis, Martin Haswell, Adrienne Morey, Glenda McCue, Wendy Raymond, Peter Robbins, Michael Bilous. (2010) Establishment of the Australian In Situ Hybridization Program for the Assessment of HER2 Amplification in Breast Cancer. Diagnostic Molecular Pathology 19:4, 187-193
CrossRef260
Ewa Anna Kosakowska, Rafał Stec, Radosław Charkiewicz, Marta Skoczek, Lech Chyczewski. (2010) Molecular differences in the <i>KRAS</i> gene mutation between a primary tumor and related metastatic sites - case report and a literature review. Folia Histochemica et Cytobiologica 48:4, 597-602
CrossRef261
Birgit Gruenberger, Johannes Schueller, Ute Heubrandtner, Fritz Wrba, Dietmar Tamandl, Klaus Kaczirek, Rudolf Roka, Sandra Freimann-Pircher, Thomas Gruenberger. (2010) Cetuximab, gemcitabine, and oxaliplatin in patients with unresectable advanced or metastatic biliary tract cancer: a phase 2 study. The Lancet Oncology 11:12, 1142-1148
CrossRef262
Eun Joo KANG, Yoon Ji CHOI, Jung Seon KIM, Seung Tae KIM, Kyong Hwa PARK, In Keun CHOI, Sang Chul OH, Jae Hong SEO, Sang Won SHIN, Jun Suk KIM, Yeul Hong KIM. (2010) Mitomycin-C, 5-fluorouracil, and leucovorin as a salvage therapy in patients with metastatic colorectal adenocarcinoma. Asia-Pacific Journal of Clinical Oncology 6:4, 286-291
CrossRef263
M. Pohl, A. Reinacher-Schick, W. Schmiegel. (2010) Palliative endoscopic and chemotherapeutic treatment. European Surgery 42:6, 287-298
CrossRef264
Srikala S. Sridhar, Sebastien J. Hotte, Joseph L. Chin, Gary R. Hudes, Richard Gregg, John Trachtenberg, Lisa Wang, Danh Tran-Thanh, Nhu-An Pham, Ming-Sound Tsao, David Hedley, Janet E. Dancey, Malcolm J. Moore. (2010) A Multicenter Phase II Clinical Trial of Lapatinib (GW572016) in Hormonally Untreated Advanced Prostate Cancer. American Journal of Clinical Oncology 33:6, 609-613
CrossRef265
Antonio C. Buzaid, Clarissa de Cerqueira Mathias, Florencia Perazzo, Sergio D. Simon, Luis Fein, Jorge Hidalgo, Andre M. Murad, Regina Esser, Stefanie Senger, Guillermo Lerzo. (2010) Cetuximab Plus Irinotecan in Pretreated Metastatic Colorectal Cancer Progressing on Irinotecan: The LABEL Study. Clinical Colorectal Cancer 9:5, 282-289
CrossRef266
Bernard Paule, Vincent Castagne, Véronique Picard, Raphaël Saffroy, René Adam, Catherine Guettier, Robert Farinotti, Laurence Bonhomme-Faivre. (2010) MDR1 polymorphism role in patients treated with cetuximab and irinotecan in irinotecan refractory colorectal cancer. Medical Oncology 27:4, 1066-1072
CrossRef267
Salih Ibrahem, Rashmi Seth, Brendan O’Sullivan, Wakkas Fadhil, Philippe Taniere, Mohammad Ilyas. (2010) Comparative analysis of pyrosequencing and QMC-PCR in conjunction with high resolution melting for KRAS/BRAF mutation detection. International Journal of Experimental Pathology 91:6, 500-505
CrossRef268
Allyson J. Ocean, Blase Polite, Paul Christos, Lisa Horvath, Anne Hamilton, Daniel Matulich, Helen X. Chen, Joseph A. Sparano, Hedy L. Kindler. (2010) Cetuximab is Associated With Excessive Toxicity When Combined With Bevacizumab Plus mFOLFOX6 in Metastatic Colorectal Carcinoma. Clinical Colorectal Cancer 9:5, 290-296
CrossRef269
Asunción Hervás Morón, María Luisa García de Paredes, Eduardo Lobo Martínez. (2010) Multidisciplinary management in rectal cancer. Clinical and Translational Oncology 12:12, 805-818
CrossRef270
Daniel T. Chang, Christopher H. Chapman, Jeffrey A. Norton, Brendan Visser, George A. Fisher, Pamela Kunz, James M. Ford, Albert C. Koong, Reetesh K. Pai. (2010) Expression of p16INK4A but not hypoxia markers or poly adenosine diphosphate-ribose polymerase is associated with improved survival in patients with pancreatic adenocarcinoma. Cancer 116:22, 5179-5187
CrossRef271
Jochen Gaedcke, Marian Grade, Klaus Jung, Jordi Camps, Peter Jo, Georg Emons, Anastasia Gehoff, Ulrich Sax, Markus Schirmer, Heinz Becker, Tim Beissbarth, Thomas Ried, B. Michael Ghadimi. (2010) Mutated KRAS results in overexpression of DUSP4, a MAP-kinase phosphatase, and SMYD3, a histone methyltransferase, in rectal carcinomas. Genes, Chromosomes and Cancer 49:11, 1024-1034
CrossRef272
Eliza Hawkes, David Cunningham. (2010) Are we ready to restrict EGFR therapy to quadruple-negative colorectal cancer?. The Lancet Oncology 11:11, 1020-1021
CrossRef273
Thomas Winder, Heinz-Josef Lenz. (2010) Molecular predictive and prognostic markers in colon cancer. Cancer Treatment Reviews 36:7, 550-556
CrossRef274
Sergio Rizzo, Giuseppe Bronte, Daniele Fanale, Lidia Corsini, Nicola Silvestris, Daniele Santini, Gaspare Gulotta, Viviana Bazan, Nicola Gebbia, Fabio Fulfaro, Antonio Russo. (2010) Prognostic vs predictive molecular biomarkers in colorectal cancer: is KRAS and BRAF wild type status required for anti-EGFR therapy?. Cancer Treatment Reviews 36, S56-S61
CrossRef275
V Goede, O Coutelle, J Neuneier, A Reinacher-Schick, R Schnell, T C Koslowsky, M R Weihrauch, B Cremer, H Kashkar, M Odenthal, H G Augustin, W Schmiegel, M Hallek, U T Hacker. (2010) Identification of serum angiopoietin-2 as a biomarker for clinical outcome of colorectal cancer patients treated with bevacizumab-containing therapy. British Journal of Cancer 103:9, 1407-1414
CrossRef276
J.- m. Lee, E. C. Kohn. (2010) Proteomics as a guiding tool for more effective personalized therapy. Annals of Oncology 21:Supplement 7, vii205-vii210
CrossRef277
Rizwan Sheikh, Naomi Walsh, Martin Clynes, Robert O’Connor, Ray McDermott. (2010) Challenges of drug resistance in the management of pancreatic cancer. Expert Review of Anticancer Therapy 10:10, 1647-1661
CrossRef278
Christos Katsios, Dimosthenis E Ziogas, Dimitrios H Roukos. (2010) Colorectal cancer: cetuximab, KRAS , BRAF , PIK3CA mutations and beyond. Expert Review of Gastroenterology & Hepatology 4:5, 525-529
CrossRef279
H. Senellart, S. Hiret, J. Bennouna. (2010) Cancer colorectal: stratégies thérapeutiques en situation métastatique. Oncologie 12:10, 593-600
CrossRef280
Qiang Zuo, Min Shi, Libo Li, Jinzhang Chen, Rongcheng Luo. (2010) Development of cetuximab-resistant human nasopharyngeal carcinoma cell lines and mechanisms of drug resistance. Biomedicine & Pharmacotherapy 64:8, 550-558
CrossRef281
Yixing Jiang, Heath Mackley, Hua Cheng, Jaffer A. Ajani. (2010) The Biology of K-Ras and B-Raf Mutations in Colorectal Cancer. Current Colorectal Cancer Reports 6:4, 206-211
CrossRef282
A. Lièvre. (2010) Vers un traitement personnalisé du cancer colorectal: facteurs pronostiques et prédictifs. Oncologie 12:10, 584-592
CrossRef283
Michele Visentin, Paola Biason, Giuseppe Toffoli. (2010) Drug interactions among the epidermal growth factor receptor inhibitors, other biologics and cytotoxic agents. Pharmacology & Therapeutics 128:1, 82-90
CrossRef284
Stephen Leong, S. Gail Eckhardt, Wells A. Messersmith. (2010) Management Strategies for Patients with KRAS Mutations. Current Colorectal Cancer Reports 6:4, 199-205
CrossRef285
Li-Xin Qiu, Chen Mao, Jian Zhang, Xiao-Dong Zhu, Ru-Yan Liao, Kai Xue, Jin Li, Qing Chen. (2010) Predictive and prognostic value of KRAS mutations in metastatic colorectal cancer patients treated with cetuximab: A meta-analysis of 22 studies. European Journal of Cancer 46:15, 2781-2787
CrossRef286
Armando Santoro, Lorenza Rimassa, Alberto F. Sobrero, Giovanni Citterio, Francesco Sclafani, Carlo Carnaghi, Anna Pessino, Francesco Caprioni, Valeria Andretta, Maria Chiara Tronconi, Giovanna Finocchiaro, Gloria Rossoni, Angela Zanoni, Chiara Miggiano, Gian-Paolo Rizzardi, Catia Traversari, Federico Caligaris-Cappio, Antonio Lambiase, Claudio Bordignon. (2010) Phase II study of NGR-hTNF, a selective vascular targeting agent, in patients with metastatic colorectal cancer after failure of standard therapy. European Journal of Cancer 46:15, 2746-2752
CrossRef287
Lori M. Minasian, William R. Carpenter, Bryan J. Weiner, Darrell E. Anderson, Worta McCaskill-Stevens, Stefanie Nelson, Cynthia Whitman, Joseph Kelaghan, Ann M. O'Mara, Arnold D. Kaluzny. (2010) Translating research into evidence-based practice. Cancer 116:19, 4440-4449
CrossRef288
Marta Batus, Mary Jo Fidler, Philip D Bonomi. (2010) Primary and secondary therapeutic strategies for EGF receptor pathway inhibition in non-small-cell lung cancer. Expert Review of Anticancer Therapy 10:10, 1589-1599
CrossRef289
Barbara L. Parsons, Meagan B. Myers, Fanxue Meng, Yiying Wang, Page B. McKinzie. (2010) Oncomutations as biomarkers of cancer risk. Environmental and Molecular Mutagenesis 51:8-9, 836-850
CrossRef290
J. S. de Bono, Alan Ashworth. (2010) Translating cancer research into targeted therapeutics. Nature 467:7315, 543-549
CrossRef291
Gianluca Masi, Fotios Loupakis, Lisa Salvatore, Lorenzo Fornaro, Chiara Cremolini, Samanta Cupini, Andrea Ciarlo, Francesca Del Monte, Enrico Cortesi, Domenico Amoroso, Cristina Granetto, Gabriella Fontanini, Elisa Sensi, Cristiana Lupi, Michele Andreuccetti, Alfredo Falcone. (2010) Bevacizumab with FOLFOXIRI (irinotecan, oxaliplatin, fluorouracil, and folinate) as first-line treatment for metastatic colorectal cancer: a phase 2 trial. The Lancet Oncology 11:9, 845-852
CrossRef292
Prue A. Cowin, Michael Anglesio, Dariush Etemadmoghadam, David D.L. Bowtell. (2010) Profiling the Cancer Genome. Annual Review of Genomics and Human Genetics 11:1, 133-159
CrossRef293
Richard Simon. (2010) Moving from correlative science to predictive oncology. The EPMA Journal 1:3, 377-387
CrossRef294
Cheng E. Chee, Frank A. Sinicrope. (2010) Targeted Therapeutic Agents for Colorectal Cancer. Gastroenterology Clinics of North America 39:3, 601-613
CrossRef295
Jan Ouwerkerk, Christine Boers-Doets. (2010) Best practices in the management of toxicities related to anti-EGFR agents for metastatic colorectal cancer. European Journal of Oncology Nursing 14:4, 337-349
CrossRef296
Deric L. Wheeler, Emily F. Dunn, Paul M. Harari. (2010) Understanding resistance to EGFR inhibitors—impact on future treatment strategies. Nature Reviews Clinical Oncology 7:9, 493-507
CrossRef297
Sebastian L. Ochenduszko, Krzysztof Krzemieniecki. (2010) Targeted therapy in advanced colorectal cancer: more data, more questions. Anti-Cancer Drugs 21:8, 737-748
CrossRef298
Jochen B. Geigl, Ellen Heitzer, Michael R. Speicher. (2010) Prädiktive und prognostische genetische Biomarker. Wiener klinische Wochenschrift Education 5:2, 49-71
CrossRef299
Geraldine Perkins, Astrid Lièvre, Carole Ramacci, Tchao Méatchi, Aurélien de Reynies, Jean-François Emile, Valérie Boige, Gorana Tomasic, Jean-Baptiste Bachet, Fréderic Bibeau, Olivier Bouché, Frédérique Penault-Llorca, Jean-Louis Merlin, Pierre Laurent-Puig. (2010) Additional value of EGFR downstream signaling phosphoprotein expression to KRAS status for response to anti-EGFR antibodies in colorectal cancer. International Journal of Cancer 127:6, 1321-1331
CrossRef300
Igor Puzanov, Keith T. Flaherty. (2010) Targeted Molecular Therapy in Melanoma. Seminars in Cutaneous Medicine and Surgery 29:3, 196-201
CrossRef301
J. Ciccolini. (2010) Le panitumumab (Vectibix®) en oncologie digestive: quel rationnel pharmacologique et pharmacocinétique ?. Oncologie 12:9, 565-571
CrossRef302
R. Glynne-Jones. (2010) UK Fourth National Colorectal Cancer Consensus Meeting 2009. Clinical Oncology 22:7, 533-537
CrossRef303
Hubert E. Blum. (2010) Individualized medicine 2010. Journal of Cellular and Molecular Medicine 14:9, 2257-2263
CrossRef304
Andreas H Marx, Margarete Zielinski, Charlotte-Marie Kowitz, Ana-Maria Dancau, Sabrina Thieltges, Ronald Simon, Matthias Choschzick, Emre Yekebas, Jussuf T Kaifi, Martina Mirlacher, Djordje Atanackovic, Tim H Brümmendorf, Walter Fiedler, Carsten Bokemeyer, Jakob R Izbicki, Guido Sauter. (2010) Homogeneous EGFR amplification defines a subset of aggressive Barrett’s adenocarcinomas with poor prognosis. Histopathology 57:3, 418-426
CrossRef305
D. Hagerstrand, M. B. Lindh, C. Pena, C. Garcia-Echeverria, M. Nister, F. Hofmann, A. Ostman. (2010) PI3K/PTEN/Akt pathway status affects the sensitivity of high-grade glioma cell cultures to the insulin-like growth factor-1 receptor inhibitor NVP-AEW541. Neuro-Oncology 12:9, 967-975
CrossRef306
Shiyang Wu, Zeyao Zhu, Jiaying He, Xiaodi Luo, Jiasen Xu, Lifen Ren-Heidenreich. (2010) A novel mutant-enriched liquidchip technology for the qualitative detection of somatic mutations in KRAS gene from both serum and tissue samples. Clinical Chemistry and Laboratory Medicine 48:8, 1103-1106
CrossRef307
Yixing Jiang, Heath Mackley, Hua Cheng, Jaffer A Ajani. (2010) Use of K-Ras as a predictive biomarker for selecting anti-EGF receptor/pathway treatment. Biomarkers in Medicine 4:4, 535-541
CrossRef308
Jesús García-Foncillas, Eduardo Díaz-Rubio. (2010) Progress in metastatic colorectal cancer: growing role of cetuximab to optimize clinical outcome. Clinical and Translational Oncology 12:8, 533-542
CrossRef309
W.A. Weber. (2010) Molekulare Bildgebung in der Tumortherapie. Bundesgesundheitsblatt - Gesundheitsforschung - Gesundheitsschutz 53:8, 810-817
CrossRef310
S. Gollins. (2010) Radiation, chemotherapy and biological therapy in the curative treatment of locally advanced rectal cancer. Colorectal Disease 12, 2-24
CrossRef311
Pietro Carotenuto, Cristin Roma, Anna Maria Rachiglio, Fabiana Tatangelo, Carmine Pinto, Fortunato Ciardiello, Oscar Nappi, Vincenzo Iaffaioli, Gerardo Botti, Nicola Normanno. (2010) Detection of KRAS mutations in colorectal carcinoma patients with an integrated PCR/sequencing and real-time PCR approach. Pharmacogenomics 11:8, 1169-1179
CrossRef312
Jolien Tol, Jeroen R. Dijkstra, Marianne E. Vink-Börger, Iris D. Nagtegaal, Cornelis J.A. Punt, Johan H.J.M. Van Krieken, Marjolijn J.L. Ligtenberg. (2010) High sensitivity of both sequencing and real-time PCR analysis of KRAS mutations in colorectal cancer tissue. Journal of Cellular and Molecular Medicine 14:8, 2122-2131
CrossRef313
Tomoya Yokota, Noriko Shibata, Takashi Ura, Daisuke Takahari, Kohei Shitara, Kei Muro, Yasushi Yatabe. (2010) Cycleave polymerase chain reaction method is practically applicable for V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS)/V-raf murine sarcoma viral oncogene homolog B1 (BRAF) genotyping in colorectal cancer. Translational Research 156:2, 98-105
CrossRef314
T J Harvey, D Burdon, L Steele, N Ingram, G D Hall, P J Selby, R G Vile, P A Cooper, S D Shnyder, J D Chester. (2010) Retargeted adenoviral cancer gene therapy for tumour cells overexpressing epidermal growth factor receptor or urokinase-type plasminogen activator receptor. Gene Therapy 17:8, 1000-1010
CrossRef315
T. Liersch, J. Gaedcke, M. Grade, T. Sprenger, L. Conradi, H. Becker, B.M. Ghadimi. (2010) Molekulare Marker zur Responseprädiktion beim lokal fortgeschrittenen Rektumkarzinom. Der Onkologe 16:8, 779-788
CrossRef316
Davide Tassinari, Paola Tombesi, Sergio Sartori. (2010) When More is Worse in Clinical Research and Clinical Practice. American Journal of Clinical Oncology 33:4, 424
CrossRef317
R. Adam, D. G. Haller, G. Poston, J.- L. Raoul, J.- P. Spano, J. Tabernero, E. Van Cutsem. (2010) Toward optimized front-line therapeutic strategies in patients with metastatic colorectal cancer--an expert review from the International Congress on Anti-Cancer Treatment (ICACT) 2009. Annals of Oncology 21:8, 1579-1584
CrossRef318
Raymond C. Wadlow, David P. Ryan. (2010) The role of targeted agents in preoperative chemoradiation for rectal cancer. Cancer 116:15, 3537-3548
CrossRef319
R. Lutterbuese, T. Raum, R. Kischel, P. Hoffmann, S. Mangold, B. Rattel, M. Friedrich, O. Thomas, G. Lorenczewski, D. Rau, E. Schaller, I. Herrmann, A. Wolf, T. Urbig, P. A. Baeuerle, P. Kufer. (2010) T cell-engaging BiTE antibodies specific for EGFR potently eliminate KRAS- and BRAF-mutated colorectal cancer cells. Proceedings of the National Academy of Sciences 107:28, 12605-12610
CrossRef320
Michael S. Braun, Matthew T. Seymour. (2010) Molecular Markers of Chemotherapy Response in Colorectal Cancer. Current Colorectal Cancer Reports 6:3, 118-125
CrossRef321
Stacey Stein, Deirdre J. Cohen, Howard S. Hochster. (2010) Treatment Paradigms With Epidermal Growth Factor Receptor–Targeted Therapies in Colorectal Cancer. Clinical Colorectal Cancer 9:0, S44-S50
CrossRef322
Ian Proctor, Kai Stoeber, Gareth H Williams. (2010) Biomarkers in bladder cancer. Histopathology 57:1, 1-13
CrossRef323
Michael Hölzel, Sidong Huang, Jan Koster, Ingrid Øra, Arjan Lakeman, Huib Caron, Wouter Nijkamp, Jing Xie, Tom Callens, Shahab Asgharzadeh, Robert C. Seeger, Ludwine Messiaen, Rogier Versteeg, René Bernards. (2010) NF1 Is a Tumor Suppressor in Neuroblastoma that Determines Retinoic Acid Response and Disease Outcome. Cell 142:2, 218-229
CrossRef324
Pasquale Comella, Rossana Casaretti, Antonio Avallone, Luca Franco. (2010) Optimizing the management of metastatic colorectal cancer. Critical Reviews in Oncology/Hematology 75:1, 15-26
CrossRef325
Athanasios C. Tsiatis, Alexis Norris-Kirby, Roy G. Rich, Michael J. Hafez, Christopher D. Gocke, James R. Eshleman, Kathleen M. Murphy. (2010) Comparison of Sanger Sequencing, Pyrosequencing, and Melting Curve Analysis for the Detection of KRAS Mutations. The Journal of Molecular Diagnostics 12:4, 425-432
CrossRef326
Shaheenah Dawood. (2010) Novel biomarkers of metastatic cancer. Expert Review of Molecular Diagnostics 10:5, 581-590
CrossRef327
Jan Pander, Hans Gelderblom, Ninja F. Antonini, Jolien Tol, Johan H.J.M. van Krieken, Tahar van der Straaten, Cornelis J.A. Punt, Henk-Jan Guchelaar. (2010) Correlation of FCGR3A and EGFR germline polymorphisms with the efficacy of cetuximab in KRAS wild-type metastatic colorectal cancer. European Journal of Cancer 46:10, 1829-1834
CrossRef328
Robert C. Doebele, Ana B. Oton, Nir Peled, D. Ross Camidge, Paul A. Bunn. (2010) New strategies to overcome limitations of reversible EGFR tyrosine kinase inhibitor therapy in non-small cell lung cancer. Lung Cancer 69:1, 1-12
CrossRef329
Jenn-Yu Wu, Chih-Hsin Yang, Ya-Chieh Hsu, Chong-Jen Yu, Shih-Han Chang, Jin-Yuan Shih, Pan-Chyr Yang. (2010) Use of Cetuximab After Failure of Gefitinib in Patients With Advanced Non–Small-Cell Lung Cancer. Clinical Lung Cancer 11:4, 257-263
CrossRef330
K. Shitara, T. Yokota, D. Takahari, T. Shibata, T. Ura, Y. Komatsu, S. Yuki, M. Yoshida, H. Takiuchi, S. Utsunomiya, Y. Yatabe, K. Muro. (2010) Phase II Study of Combination Chemotherapy with Biweekly Cetuximab and Irinotecan for Pre-treated Metastatic Colorectal Cancer Harboring Wild-type KRAS. Japanese Journal of Clinical Oncology 40:7, 699-701
CrossRef331
Jolien Tol, Jeroen R. Dijkstra, Marjolein Klomp, Steven Teerenstra, Martin Dommerholt, M. Elisa Vink-Börger, Patricia H. van Cleef, J. Han van Krieken, Cornelis J.A. Punt, Iris D. Nagtegaal. (2010) Markers for EGFR pathway activation as predictor of outcome in metastatic colorectal cancer patients treated with or without cetuximab. European Journal of Cancer 46:11, 1997-2009
CrossRef332
Patricia S Kho, Wei Chua, Melissa M Moore, Stephen J Clarke. (2010) Is it prime time for personalized medicine in cancer treatment?. Personalized Medicine 7:4, 387-397
CrossRef333
Peter M. Wilson, Heinz-Josef Lenz. (2010) Integrating Biomarkers Into Clinical Decision Making for Colorectal Cancer. Clinical Colorectal Cancer 9:0, S16-S27
CrossRef334
Lisanne L. Krens, Jara M. Baas, Hans Gelderblom, Henk-Jan Guchelaar. (2010) Therapeutic modulation of k-ras signaling in colorectal cancer. Drug Discovery Today 15:13-14, 502-516
CrossRef335
Dimitrios H Roukos, Christos Katsios, Theodore Liakakos. (2010) Genotype–phenotype map and molecular networks: a promising solution in overcoming colorectal cancer resistance to targeted treatment. Expert Review of Molecular Diagnostics 10:5, 541-545
CrossRef336
Abby B. Siegel, Sonja K. Olsen, Arthur Magun, Robert S. Brown. (2010) Sorafenib: Where do we go from here?. Hepatology 52:1, 360-369
CrossRef337
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Rosenberg, Eric S., Cort, Alice M., Ebeling, Sally H.Peters, Christine C., Ryan, David P., Engelman, Jeffrey A., Ferrone, Cristina R., Sahani, Dushyant V., Lisovsky, Mikhail, . (2010) Case 19-2010. New England Journal of Medicine 362:25, 2411-2419
Full Text338
Pierpaolo Correale, Monica Marra, Cinzia Remondo, Cristina Migali, Gabriella Misso, Felice Paolo Arcuri, Maria Teresa Del Vecchio, Antonietta Carducci, Lucia Loiacono, Pierfrancesco Tassone, Alberto Abbruzzese, Pierosandro Tagliaferri, Michele Caraglia. (2010) Cytotoxic drugs up-regulate epidermal growth factor receptor (EGFR) expression in colon cancer cells and enhance their susceptibility to EGFR-targeted antibody-dependent cell-mediated-cytotoxicity (ADCC). European Journal of Cancer 46:9, 1703-1711
CrossRef339
Saurabh Aggarwal. (2010) Targeted cancer therapies. Nature Reviews Drug Discovery 9:6, 427-428
CrossRef340
Satu Oltedal, Bjørnar Gilje, Hartwig Kørner, Ole Gunnar Aasprong, Kjersti Tjensvoll, Reino Heikkilä, Rune Smaaland, Oddmund Nordgård. (2010) Detection of Occult Metastases in Sentinel Lymph Nodes From Colon Cancer Patients by K-ras Mutation Peptide Nucleic Acid Clamp PCR. Annals of Surgery 251:6, 1087-1091
CrossRef341
G. Folprecht. (2010) Aktuelle medikamentöse Therapie des metastasierten Kolonkarzinoms. Der Chirurg 81:6, 507-515
CrossRef342
Javier Rodríguez, Antonio Viúdez, Mariano Ponz-Sarvisé, Isabel Gil-Aldea, Ana Chopitea, Jesús García-Foncillas, Ignacio Gil-Bazo. (2010) Improving disease control in advanced colorectal cancer: Panitumumab and cetuximab. Critical Reviews in Oncology/Hematology 74:3, 193-202
CrossRef343
E. Van Cutsem, M. Dicato, N. Arber, J. Berlin, A. Cervantes, F. Ciardiello, A. De Gramont, E. Diaz-Rubio, M. Ducreux, R. Geva, B. Glimelius, R. G. Jones, A. Grothey, T. Gruenberger, D. Haller, K. Haustermans, R. Labianca, H. J. Lenz, B. Minsky, B. Nordlinger, A. Ohtsu, N. Pavlidis, P. Rougier, W. Schmiegel, C. Van de Velde, H. J. Schmoll, A. Sobrero, J. Tabernero. (2010) Molecular markers and biological targeted therapies in metastatic colorectal cancer: expert opinion and recommendations derived from the 11th ESMO/World Congress on Gastrointestinal Cancer, Barcelona, 2009. Annals of Oncology 21:Supplement 6, vi1-vi10
CrossRef344
Ezzeldin M. Ibrahim, Jamal M. Zekri, Bakr M. Bin Sadiq. (2010) Cetuximab-based therapy for metastatic colorectal cancer: a meta-analysis of the effect of K-ras mutations. International Journal of Colorectal Disease 25:6, 713-721
CrossRef345
Derek G. Power, Manish A. Shah, Timothy R . Asmis, Joaquin J . Garcia, Nancy E. Kemeny. (2010) Safety and efficacy of panitumumab following cetuximab: retrospective review of the Memorial Sloan-Kettering experience. Investigational New Drugs 28:3, 353-360
CrossRef346
Geoffrey S. Ginsburg, Deepak Voora. (2010) The Long and Winding Road to Warfarin Pharmacogenetic Testing
Editorials published in the Journal of the American College of Cardiology reflect the views of the authors and do not necessarily represent the views of JACC or the American College of Cardiology.. Journal of the American College of Cardiology 55:25, 2813-2815
CrossRef347
Tara Gangadhar, Richard L. Schilsky. (2010) Molecular markers to individualize adjuvant therapy for colon cancer. Nature Reviews Clinical Oncology 7:6, 318-325
CrossRef348
Marc Buyse, Daniel J. Sargent, Axel Grothey, Alastair Matheson, Aimery de Gramont. (2010) Biomarkers and surrogate end points—the challenge of statistical validation. Nature Reviews Clinical Oncology 7:6, 309-317
CrossRef349
A Lièvre, H Blons, P Laurent-Puig. (2010) Oncogenic mutations as predictive factors in colorectal cancer. Oncogene 29:21, 3033-3043
CrossRef350
Ronald H. Gottlieb, Cheryl Raczyk, Timothy Hanna, Ahmad Fora, Wei Tan, Rahul Nayyar, Marwan Fakih. (2010) Quantitative methodology using CT for predicting survival in patients with metastatic colorectal carcinoma: a pilot study. Clinical Imaging 34:3, 196-202
CrossRef351
David R. Spigel, F. Anthony Greco, Dana S. Thompson, Charles Webb, James Rubinsak, Roger C. Inhorn, James Reeves ., Elizabeth R. Vazquez, Cassie M. Lane, Howard A. Burris, John D. Hainsworth. (2010) Phase II Study of Cetuximab, Docetaxel, and Gemcitabine in Patients With Previously Untreated Advanced Non–Small-Cell Lung Cancer. Clinical Lung Cancer 11:3, 198-203
CrossRef352
Martin Schlaeth, Sven Berger, Stefanie Derer, Katja Klausz, Stefan Lohse, Michael Dechant, Greg A. Lazar, Tanja Schneider-Merck, Matthias Peipp, Thomas Valerius. (2010) Fc-engineered EGF-R antibodies mediate improved antibody-dependent cellular cytotoxicity (ADCC) against KRAS -mutated tumor cells. Cancer Science 101:5, 1080-1088
CrossRef353
Timothy J. R. Harris, Frank McCormick. (2010) The molecular pathology of cancer. Nature Reviews Clinical Oncology 7:5, 251-265
CrossRef354
Joseph Herman, Wells Messersmith, W. Warren Suh, William Blackstock, Bard C. Cosman, Mohammed Mohiuddin, Matthew M. Poggi, William F. Regine, Leonard Saltz, William Small, Jennifer Zook, Andre A. Konski. (2010) ACR Appropriateness Criteria®: Rectal Cancer—Metastatic Disease at Presentation. Current Problems in Cancer 34:3, 201-210
CrossRef355
César Serrano, Ben Markman, Josep Tabernero. (2010) Integration of Anti-Epidermal Growth Factor Receptor Therapies With Cytotoxic Chemotherapy. The Cancer Journal 16:3, 226-234
CrossRef356
Deepa T. Patil, Cory R. Fraser, Thomas P. Plesec. (2010) KRAS Testing and Its Importance in Colorectal Cancer. Current Oncology Reports 12:3, 160-167
CrossRef357
Cynthia Shepherd, Igor Puzanov, Jeffrey A. Sosman. (2010) B-RAF Inhibitors: An Evolving Role in the Therapy of Malignant Melanoma. Current Oncology Reports 12:3, 146-152
CrossRef358
Richard L. Schilsky. (2010) Personalized medicine in oncology: the future is now. Nature Reviews Drug Discovery 9:5, 363-366
CrossRef359
Roberto Labianca, Giordano D. Beretta, Basem Kildani, Laura Milesi, Federica Merlin, Stefania Mosconi, M. Adelaide Pessi, Tiziana Prochilo, Antonello Quadri, Gemma Gatta, Filippo de Braud, Jacques Wils. (2010) Colon cancer. Critical Reviews in Oncology/Hematology 74:2, 106-133
CrossRef360
F. A. Amosenko, E. L. Korchagina, T. I. Matveeva, Yu. E. Vaganov, S. B. Vlasov, N. V. Poltavets, V. V. Veselov, R. F. Garkavtseva, A. V. Polyakov. (2010) Mutation analysis of K-ras protooncogene in colorectal adenocarcinomas and polyps in Russian patients. Russian Journal of Genetics 46:5, 617-624
CrossRef361
Jeffrey Meyer, Christopher Willett, Brian Czito. (2010) Current and Emerging Treatment Strategies for Anal Cancer. Current Oncology Reports 12:3, 168-174
CrossRef362
Bárbara Angulo, Elena García-García, Rebeca Martínez, Ana Suárez-Gauthier, Esther Conde, Manuel Hidalgo, Fernando López-Ríos. (2010) A Commercial Real-Time PCR Kit Provides Greater Sensitivity than Direct Sequencing to Detect KRAS Mutations. The Journal of Molecular Diagnostics 12:3, 292-299
CrossRef363
Stephen Leong, Wells A. Messersmith, Aik Choon Tan, S. Gail Eckhardt. (2010) Novel Agents in the Treatment of Metastatic Colorectal Cancer. The Cancer Journal 16:3, 273-282
CrossRef364
E. Van Cutsem, B. Nordlinger, A. Cervantes, . (2010) Advanced colorectal cancer: ESMO Clinical Practice Guidelines for treatment. Annals of Oncology 21:Supplement 5, v93-v97
CrossRef365
Mark A. Socinski. (2010) The Emerging Role of Biomarkers in Advanced Non–Small-Cell Lung Cancer. Clinical Lung Cancer 11:3, 149-159
CrossRef366
Atiqur Rahman, Francis Kalush. 2010. Safety and Effective Biomakers in Oncology. , 275-296.
CrossRef367
A. Potti, R. L. Schilsky, J. R. Nevins. (2010) Refocusing the War on Cancer: The Critical Role of Personalized Treatment. Science Translational Medicine 2:28, 28cm13-28cm13
CrossRef368
Raffaele Addeo, Michele Caraglia, Domenico Cerbone, Nicola Frega, Gaetano Cimmino, Alberto Abbruzzese, Salvatore Del Prete. (2010) Panitumumab: a new frontier of target therapy for the treatment of metastatic colorectal cancer. Expert Review of Anticancer Therapy 10:4, 499-505
CrossRef369
Stergios J. Moschos, Cindy A. Sander, Wenjun Wang, Shelley L. Reppert, Laura M. Drogowski, Drazen M. Jukic, Uma N. M. Rao, Charalambos Athanassiou, Manuela Buzoianu, Maja Mandic, Laura Richman, LuAnn McKinney, Joel Leininger, David A. Tice, Luz Hammershaimb, John M. Kirkwood. (2010) Pharmacodynamic (Phase 0) Study Using Etaracizumab in Advanced Melanoma. Journal of Immunotherapy 33:3, 316-325
CrossRef370
Maximilian J. Waldner, Markus F. Neurath. (2010) The molecular therapy of colorectal cancer. Molecular Aspects of Medicine 31:2, 171-178
CrossRef371
Cristina Gravalos, Javier Cassinello, Pilar García-Alfonso, Antonio Jimeno. (2010) Integration of panitumumab into the treatment of colorectal cancer. Critical Reviews in Oncology/Hematology 74:1, 16-26
CrossRef372
Ulrich Keller, Nikolas Von Bubnoff, Christian Peschel, Justus Duyster. (2010) Oncologist’s/haematologist’s view on the roles of pathologists for molecular targeted cancer therapy. Journal of Cellular and Molecular Medicine 14:4, 805-817
CrossRef373
Heather-Jane Au, Jolie Ringash, Michael Brundage, Michael Palmer, Harriet Richardson, Ralph M Meyer. (2010) Added value of health-related quality of life measurement in cancer clinical trials: the experience of the NCIC CTG. Expert Review of Pharmacoeconomics & Outcomes Research 10:2, 119-128
CrossRef374
Lidan Liu, Yunfei Cao, Aihua Tan, Cun Liao, Feng Gao. (2010) Cetuximab-based therapy versus non-cetuximab therapy for advanced cancer: a meta-analysis of 17 randomized controlled trials. Cancer Chemotherapy and Pharmacology 65:5, 849-861
CrossRef375
Daniel Renouf, Malcolm Moore. (2010) Evolution of systemic therapy for advanced pancreatic cancer. Expert Review of Anticancer Therapy 10:4, 529-540
CrossRef376
Tim J. Kruser, Deric L. Wheeler. (2010) Mechanisms of resistance to HER family targeting antibodies. Experimental Cell Research 316:7, 1083-1100
CrossRef377
Ben Markman, Víctor Rodríguez-Freixinos, Josep Tabernero. (2010) Biomarkers in colorectal cancer. Clinical and Translational Oncology 12:4, 261-270
CrossRef378
Ahmad D. Siddiqui, Bilal Piperdi. (2010) KRAS Mutation in Colon Cancer: A Marker of Resistance to EGFR-I Therapy. Annals of Surgical Oncology 17:4, 1168-1176
CrossRef379
Takashi Kobunai, Toshiaki Watanabe, Yoko Yamamoto, Kiyoshi Eshima. (2010) The frequency of KRAS mutation detection in human colon carcinoma is influenced by the sensitivity of assay methodology: A comparison between direct sequencing and real-time PCR. Biochemical and Biophysical Research Communications 395:1, 158-162
CrossRef380
Liting Zhu, Xianming Tan, Dongsheng Tu. (2010) Testing the Homogeneity of Two Survival Functions Against a Mixture Alternative Based on Censored Data. Communications in Statistics - Simulation and Computation 39:4, 767-776
CrossRef381
C Montagut, M Iglesias, M Arumi, B Bellosillo, M Gallen, A Martinez-Fernandez, L Martinez-Aviles, I Cañadas, A Dalmases, E Moragon, L Lema, S Serrano, A Rovira, F Rojo, J Bellmunt, J Albanell. (2010) Mitogen-activated protein kinase phosphatase-1 (MKP-1) impairs the response to anti-epidermal growth factor receptor (EGFR) antibody cetuximab in metastatic colorectal cancer patients. British Journal of Cancer 102:7, 1137-1144
CrossRef382
Nicholas J. Schork, Eric J. Topol. (2010) Genotype-Based Risk and Pharmacogenetic Sampling in Clinical Trials. Journal of Biopharmaceutical Statistics 20:2, 315-333
CrossRef383
E Lopez-Crapez, L Mineur, H Emptas, P-J Lamy. (2010) KRAS status analysis and anti-EGFR therapies: is comprehensiveness a biologist's fancy or a clinical necessity?. British Journal of Cancer 102:6, 1074-1075
CrossRef384
M. Cardo-Vila, R. J. Giordano, R. L. Sidman, L. F. Bronk, Z. Fan, J. Mendelsohn, W. Arap, R. Pasqualini. (2010) From combinatorial peptide selection to drug prototype (II): Targeting the epidermal growth factor receptor pathway. Proceedings of the National Academy of Sciences 107:11, 5118-5123
CrossRef385
Jolien Tol, Cornelis J.A. Punt. (2010) Monoclonal antibodies in the treatment of metastatic colorectal cancer: A review. Clinical Therapeutics 32:3, 437-453
CrossRef386
Andrea Sartore-Bianchi, Katia Bencardino, Federica Di Nicolantonio, Federico Pozzi, Chiara Funaioli, Valentina Gambi, Sabrina Arena, Miriam Martini, Simona Lamba, Andrea Cassingena, Roberta Schiavo, Alberto Bardelli, Salvatore Siena. (2010) Integrated molecular dissection of the epidermal growth factor receptor (EFGR) oncogenic pathway to predict response to EGFR-targeted monoclonal antibodies in metastatic colorectal cancer. Targeted Oncology 5:1, 19-28
CrossRef387
Sae-Won Han, Do-Youn Oh, Seock-Ah Im, Sook Ryun Park, Keun-Wook Lee, Hong Suk Song, Nam-Su Lee, Kyung Hee Lee, In Sil Choi, Moon Hee Lee, Min A Kim, Woo Ho Kim, Yung-Jue Bang, Tae-You Kim. (2010) Epidermal growth factor receptor intron 1 CA dinucleotide repeat polymorphism and survival of advanced gastric cancer patients treated with cetuximab plus modified FOLFOX6. Cancer Science 101:3, 793-799
CrossRef388
David Cunningham, Wendy Atkin, Heinz-Josef Lenz, Henry T Lynch, Bruce Minsky, Bernard Nordlinger, Naureen Starling. (2010) Colorectal cancer. The Lancet 375:9719, 1030-1047
CrossRef389
Andrew Robinson, William F. Clark. (2010) A Case Report of Gemcitabine Treatment for Duodenal Cancer: The Good (A Sustained Response) and The Bad (Life Threatening Refractory Thrombotic Thrombocytopenic Purpura). Journal of Gastrointestinal Cancer 41:1, 71-74
CrossRef390
Nayef A. Alymani, Murray D. Smith, David J. Williams, Russell D. Petty. (2010) Predictive biomarkers for personalised anti-cancer drug use: Discovery to clinical implementation. European Journal of Cancer 46:5, 869-879
CrossRef391
David E. Gerber, Hak Choy. (2010) Cetuximab in combination therapy: from bench to clinic. Cancer and Metastasis Reviews 29:1, 171-180
CrossRef392
G Smith, R Bounds, H Wolf, R J C Steele, F A Carey, C R Wolf. (2010) Activating K-Ras mutations outwith ‘hotspot’ codons in sporadic colorectal tumours – implications for personalised cancer medicine. British Journal of Cancer 102:4, 693-703
CrossRef393
B. Freidlin, L. M. McShane, E. L. Korn. (2010) Randomized Clinical Trials With Biomarkers: Design Issues. JNCI Journal of the National Cancer Institute 102:3, 152-160
CrossRef394
F Lordick, B Luber, S Lorenzen, S Hegewisch-Becker, G Folprecht, E Wöll, T Decker, E Endlicher, N Röthling, T Schuster, G Keller, F Fend, C Peschel. (2010) Cetuximab plus oxaliplatin/leucovorin/5-fluorouracil in first-line metastatic gastric cancer: a phase II study of the Arbeitsgemeinschaft Internistische Onkologie (AIO). British Journal of Cancer 102:3, 500-505
CrossRef395
Daniel P. Petrylak, Catherine M. Tangen, Peter J. Van Veldhuizen, J. Wendall Goodwin, Przemyslaw W. Twardowski, James N. Atkins, Shaker R. Kakhil, Marianne K. Lange, Mahesh Mansukhani, E. David Crawford. (2010) Results of the Southwest Oncology Group phase II evaluation (study S0031) of ZD1839 for advanced transitional cell carcinoma of the urothelium. BJU International 105:3, 317-321
CrossRef396
Joseph M. Amann, Ju-Whei Lee, Heinrich Roder, Julie Brahmer, Adriana Gonzalez, Joan H. Schiller, David P. Carbone. (2010) Genetic and Proteomic Features Associated with Survival after Treatment with Erlotinib in First-Line Therapy of Non-small Cell Lung Cancer in Eastern Cooperative Oncology Group 3503. Journal of Thoracic Oncology 5:2, 169-178
CrossRef397
Augusto Villanueva, Beatriz Minguez, Alejandro Forner, Maria Reig, Josep M. Llovet. (2010) Hepatocellular Carcinoma: Novel Molecular Approaches for Diagnosis, Prognosis, and Therapy. Annual Review of Medicine 61:1, 317-328
CrossRef398
Ya-Sian Chang, Kun-Tu Yeh, Nicholas C. Hsu, Shu-Hui Lin, Tien-Jye Chang, Jan-Gowth Chang. (2010) Detection of N-, H-, and KRAS codons 12, 13, and 61 mutations with universal RAS primer multiplex PCR and N-, H-, and KRAS-specific primer extension. Clinical Biochemistry 43:3, 296-301
CrossRef399
Zachary A. Knight, Henry Lin, Kevan M. Shokat. (2010) Targeting the cancer kinome through polypharmacology. Nature Reviews Cancer 10:2, 130-137
CrossRef400
Olivier Bouché, Giordano Domenico Beretta, Pilar García Alfonso, Michael Geissler. (2010) The role of anti-epidermal growth factor receptor monoclonal antibody monotherapy in the treatment of metastatic colorectal cancer. Cancer Treatment Reviews 36, S1-S10
CrossRef401
Jamie F. Shapiro, Judy L. Chase, Robert A. Wolff, Laura A. Lambert, Paul F. Mansfield, Michael J. Overman, Aki Ohinata, Jun Liu, Xuemei Wang, Cathy Eng. (2010) Modern systemic chemotherapy in surgically unresectable neoplasms of appendiceal origin. Cancer 116:2, 316-322
CrossRef402
I Zlobec, F Molinari, M Kovac, M P Bihl, H J Altermatt, J Diebold, H Frick, M Germer, M Horcic, M Montani, G Singer, H Yurtsever, A Zettl, L Terracciano, L Mazzucchelli, P Saletti, M Frattini, K Heinimann, A Lugli. (2010) Prognostic and predictive value of TOPK stratified by KRAS and BRAF gene alterations in sporadic, hereditary and metastatic colorectal cancer patients. British Journal of Cancer 102:1, 151-161
CrossRef403
Ning Su, Xin-Yun Xu, Han Chen, Wen-Chao Gao, Can-Ping Ruan, Qiang Wang, Yan-Ping Sun. (2010) Increased Expression of Annexin A1 Is Correlated with K-Ras Mutation in Colorectal Cancer. The Tohoku Journal of Experimental Medicine 222:4, 243-250
CrossRef404
G. Rogler, H.-P. Wirth, P. Bauerfeind, B. Müllhaupt, T. Rösch, R. Schöfl, W. Schwizer, M. Fried. (2010) Gastro-Highlights 2009. Der Gastroenterologe 5:1, 72-75
CrossRef405
Shishir K. Maithel, Michael I. D'Angelica. (2010) An Update on Randomized Clinical Trials in Advanced and Metastatic Colorectal Carcinoma. Surgical Oncology Clinics of North America 19:1, 163-181
CrossRef406
Marwan M. Fakih. (2010) <i>KRAS</i> Mutation Screening in Colorectal Cancer: From Paper to Practice. Clinical Colorectal Cancer 9:1, 22-30
CrossRef407
Ganepola A. P. Ganepola, Robert M. Mazziotta, Dilendra Weeresinghe, Georgia A. Corner, Cheryl J. Parish, David H. Chang, Niall C. Tebbutt, Carmel Murone, Naseem Ahmed, Leonard H. Augenlicht, John M. Mariadason. (2010) Gene expression profiling of primary and metastatic colon cancers identifies a reduced proliferative rate in metastatic tumors. Clinical & Experimental Metastasis 27:1, 1-9
CrossRef408
Timothy J. Price, Niall C. Tebbutt, Christos S. Karapetis, Eva Segelov, Nick Pavlakis, David Cunningham, Alberto F. Sobrero, Daniel G. Haller, Jeremy D. Shapiro. (2010) Current Opinion on Optimal Treatment Choices in First-line Therapy for Advanced or Metastatic Colorectal Cancer: Report From the Adelaide Colorectal Tumour Group Meeting; Stockholm, Sweden; September 2008. Clinical Colorectal Cancer 9:1, 8-14
CrossRef409
Jochen Gaedcke, Marian Grade, Klaus Jung, Markus Schirmer, Peter Jo, Christoph Obermeyer, Hendrik A. Wolff, Markus K. Herrmann, Tim Beissbarth, Heinz Becker, Thomas Ried, Michael Ghadimi. (2010) KRAS and BRAF mutations in patients with rectal cancer treated with preoperative chemoradiotherapy. Radiotherapy and Oncology 94:1, 76-81
CrossRef410
Richard Simon. (2010) Clinical trial designs for evaluating the medical utility of prognostic and predictive biomarkers in oncology. Personalized Medicine 7:1, 33-47
CrossRef411
Takeo SHIMASAKI, Yasuhito ISHIGAKI, Toshinari MINAMOTO, Yoshiharu MOTOO. (2010) Application of molecular medicine to pancreatic cancer. Suizo 25:1, 35-45
CrossRef412
Marc Van den Eynde, Ahmad Awada, Alain Hendlisz. (2010) Is Tailored Adjuvant Treatment for Colon Cancer Possible?. Clinical Colorectal Cancer 9:1, 15-21
CrossRef413
Wilko Weichert, Christiane Schewe, Annika Lehmann, Christine Sers, Carsten Denkert, Jan Budczies, Albrecht Stenzinger, Hans Joos, Olfert Landt, Volker Heiser, Christoph Röcken, Manfred Dietel. (2010) KRAS Genotyping of Paraffin-Embedded Colorectal Cancer Tissue in Routine Diagnostics. The Journal of Molecular Diagnostics 12:1, 35-42
CrossRef414
Pamela Hallquist Viale. (2010) Incorporating New Data on Colorectal Cancer Into Nursing Practice. Clinical Journal of Oncology Nursing 14:1, 92-100
CrossRef415
Takanori Hama, Takakuni Kato. (2010) Molecular targeted therapy for EGFR and VEGF in head and neck squamous cell carcinomas. Toukeibu Gan 36:4, 436-441
CrossRef416
Alexios S. Strimpakos, Kostas N. Syrigos, Muhammad Wasif Saif. (2010) The Molecular Targets for the Diagnosis and Treatment of Pancreatic Cancer. Gut and Liver 4:4, 433
CrossRef417
Laura R. Triano, Hari Deshpande, Scott N. Gettinger. (2010) Management of Patients with Advanced Non-Small Cell Lung Cancer. Drugs 70:2, 167-179
CrossRef418
Isamu Okamoto. (2010) Epidermal growth factor receptor in relation to tumor development: EGFR-targeted anticancer therapy. FEBS Journal 277:2, 309-315
CrossRef419
Markowitz, Sanford D., Bertagnolli, Monica M., . (2009) Molecular Basis of Colorectal Cancer. New England Journal of Medicine 361:25, 2449-2460
Full Text420
R. Sikorski, B. Yao. (2009) Parallel Paths to Predictive Biomarkers in Oncology: Uncoupling of Emergent Biomarker Development and Phase III Trial Execution. Science Translational Medicine 1:10, 10ps11-10ps11
CrossRef421
Thoralf Christoffersen, Tormod K. Guren, Karen-Lise Garm Spindler, Olav Dahl, Per Eystein Lønning, Bjørn Tore Gjertsen. (2009) Cancer therapy targeted at cellular signal transduction mechanisms: Strategies, clinical results, and unresolved issues. European Journal of Pharmacology 625:1-3, 6-22
CrossRef422
Cornelis J. A. Punt, Jolien Tol. (2009) More is less—combining targeted therapies in metastatic colorectal cancer. Nature Reviews Clinical Oncology 6:12, 731-733
CrossRef423
Miguel Martin, Parham Khosravi. (2009) Retrospective subset analyses in early breast cancer revisited. The Lancet Oncology 10:12, 1136-1137
CrossRef424
Barbara L Parsons, Fanxue Meng. (2009) K- RAS mutation in the screening, prognosis and treatment of cancer. Biomarkers in Medicine 3:6, 757-769
CrossRef425
Toshirou Nishida, Tsuyoshi Takahashi, Yasuaki Miyazaki. (2009) Gastrointestinal stromal tumor: a bridge between bench and bedside. Gastric Cancer 12:4, 175-188
CrossRef426
Fortunato Ciardiello, Sabine Tejpar, Demetris Papamichael. (2009) Implications of KRAS mutation status for the treatment of metastatic colorectal cancer. Targeted Oncology 4:4, 311-322
CrossRef427
Tanios Bekaii-Saab. (2009) KRAS Testing in Metastatic Colorectal Cancer: Implications on the Use of Biologic Agents. Clinical Cancer Reviews 3:1, 48-53
CrossRef428
G. Folprecht, C. Bokemeyer, J. Weitz. (2009) Therapie des metastasierten Kolonkarzinoms. Der Onkologe 15:12, 1223-1234
CrossRef429
Walter M. Stadler. (2009) Prognosis and prediction in a Facebook world. Cancer 115:23, 5368-5370
CrossRef430
Gisela Keller, Birgit Geist, Julia Slotta-Huspenina, Rupert Langer, Florian Nagl, Falko Fend, Heinz Höfler, Aurel Perren. (2009) Novel multiple, monoallelic KRAS mutations at codon 12 and 13. International Journal of Cancer 125:11, 2744-2745
CrossRef431
R. M. Simon, S. Paik, D. F. Hayes. (2009) Use of Archived Specimens in Evaluation of Prognostic and Predictive Biomarkers. JNCI Journal of the National Cancer Institute 101:21, 1446-1452
CrossRef432
Roy D Baynes, Jennifer Gansert. (2009) KRAS Mutational Status as a Predictor of Epidermal Growth Factor Receptor Inhibitor Efficacy in Colorectal Cancer. American Journal of Therapeutics 16:6, 554-561
CrossRef433
Jose A. García-Sáenz, Javier Sastre, Eduardo Díaz-Rubio García. (2009) Biomarkers and anti-EGFR therapies for KRAS wild-type metastatic colorectal cancer. Clinical and Translational Oncology 11:11, 737-747
CrossRef434
Ben Markman, Jaume Capdevila, Elena Elez, Josep Tabernero. (2009) New trends in epidermal growth factor receptor-directed monoclonal antibodies. Immunotherapy 1:6, 965-982
CrossRef435
S. Siena, A. Sartore-Bianchi, F. Di Nicolantonio, J. Balfour, A. Bardelli. (2009) Biomarkers Predicting Clinical Outcome of Epidermal Growth Factor Receptor-Targeted Therapy in Metastatic Colorectal Cancer. JNCI Journal of the National Cancer Institute 101:19, 1308-1324
CrossRef436
E. Martinelli, R. De Palma, M. Orditura, F. De Vita, F. Ciardiello. (2009) Anti-epidermal growth factor receptor monoclonal antibodies in cancer therapy. Clinical & Experimental Immunology 158:1, 1-9
CrossRef437
Takahisa Furuta. (2009) Pharmacogenomics in chemotherapy for GI tract cancer. Journal of Gastroenterology 44:10, 1016-1025
CrossRef438
Fernando Rivera, Almudena García-Castaño, Noelia Vega, Maria Eugenia Vega-Villegas, Lourdes Gutiérrez-Sanz. (2009) Cetuximab in metastatic or recurrent head and neck cancer: the EXTREME trial. Expert Review of Anticancer Therapy 9:10, 1421-1428
CrossRef439
Frank Thomas Kolligs. (2009) Conference Scene: DGVS Spring Conference 2009. Biomarkers in Medicine 3:5, 573-575
CrossRef440
Melanie Ongchin, Elizabeth Sharratt, Ivan Dominguez, Neka Simms, Jing Wang, Richard Cheney, Charles LeVea, Michael Brattain, Ashwani Rajput. (2009) The Effects of Epidermal Growth Factor Receptor Activation and Attenuation of the TGFβ Pathway in an Orthotopic Model of Colon Cancer. Journal of Surgical Research 156:2, 250-256
CrossRef441
M. Holdhoff, K. Schmidt, R. Donehower, L. A. Diaz. (2009) Analysis of Circulating Tumor DNA to Confirm Somatic KRAS Mutations. JNCI Journal of the National Cancer Institute 101:18, 1284-1285
CrossRef442
W Chua, D Goldstein, C K Lee, H Dhillon, M Michael, P Mitchell, S J Clarke, B Iacopetta. (2009) Molecular markers of response and toxicity to FOLFOX chemotherapy in metastatic colorectal cancer. British Journal of Cancer 101:6, 998-1004
CrossRef443
N. Mittmann, H.-J. Au, D. Tu, C. J. O'Callaghan, P. K. Isogai, C. S. Karapetis, J. R. Zalcberg, W. K. Evans, M. J. Moore, J. Siddiqui, B. Findlay, B. Colwell, J. Simes, P. Gibbs, M. Links, N. C. Tebbutt, D. J. Jonker, . (2009) Prospective Cost-Effectiveness Analysis of Cetuximab in Metastatic Colorectal Cancer: Evaluation of National Cancer Institute of Canada Clinical Trials Group CO.17 Trial. JNCI Journal of the National Cancer Institute 101:17, 1182-1192
CrossRef444
K. R. Yabroff, D. Schrag. (2009) Challenges and Opportunities for Use of Cost-Effectiveness Analysis. JNCI Journal of the National Cancer Institute 101:17, 1161-1163
CrossRef445
Jeeyun Lee, Kyung Hae Jung, Young Suk Park, Joong Bae Ahn, Sang Jun Shin, Seock-Ah Im, Do Youn Oh, Dong Bok Shin, Tae Won Kim, Namsu Lee, Jae Ho Byun, Yong Sang Hong, Joon Oh Park, Se Hoon Park, Ho Yeong Lim, Won Ki Kang. (2009) Simvastatin plus irinotecan, 5-fluorouracil, and leucovorin (FOLFIRI) as first-line chemotherapy in metastatic colorectal patients: a multicenter phase II study. Cancer Chemotherapy and Pharmacology 64:4, 657-663
CrossRef446
Nicola Normanno, Sabine Tejpar, Floriana Morgillo, Antonella De Luca, Eric Van Cutsem, Fortunato Ciardiello. (2009) Implications for KRAS status and EGFR-targeted therapies in metastatic CRC. Nature Reviews Clinical Oncology 6:9, 519-527
CrossRef447
B. Venugopal, J. Cassidy. (2009) How to integrate biologicals in the continuum of care. European Journal of Cancer 45, 57-69
CrossRef448
A.G. Pallis, L. Serfass, R. Dziadziuszko, J.P. van Meerbeeck, D. Fennell, D. Lacombe, J. Welch, C. Gridelli. (2009) Targeted therapies in the treatment of advanced/metastatic NSCLC. European Journal of Cancer 45:14, 2473-2487
CrossRef449
Hans Prenen, Sabine Tejpar, Eric Van Cutsem. (2009) Impact of molecular markers on treatment selection in advanced colorectal cancer. European Journal of Cancer 45, 70-78
CrossRef450
Yohann Loriot, Pierre Mordant, Eric Deutsch, Ken André Olaussen, Jean-Charles Soria. (2009) Are RAS mutations predictive markers of resistance to standard chemotherapy?. Nature Reviews Clinical Oncology 6:9, 528-534
CrossRef451
Timothy PL Quek, Benedict Yan, Wei Peng Yong, Manuel Salto-Tellez. (2009) Targeted therapeutics-oriented tumor classification: a paradigm shift. Personalized Medicine 6:5, 465-468
CrossRef452
László Landherr, Tamás Nagykálnai. (2009) A távoli áttétes kolorektális rák (mCRC) első választású kezelésének fejlődése. Magyar Onkológia 53:3, 237-246
CrossRef453
F Loupakis, A Ruzzo, C Cremolini, B Vincenzi, L Salvatore, D Santini, G Masi, I Stasi, E Canestrari, E Rulli, I Floriani, K Bencardino, N Galluccio, V Catalano, G Tonini, M Magnani, G Fontanini, F Basolo, A Falcone, F Graziano. (2009) KRAS codon 61, 146 and BRAF mutations predict resistance to cetuximab plus irinotecan in KRAS codon 12 and 13 wild-type metastatic colorectal cancer. British Journal of Cancer 101:4, 715-721
CrossRef454
Yixing Jiang, Eric T. Kimchi, Kevin F. Staveley-O'Carroll, Hua Cheng, Jaffer A. Ajani. (2009) Assessment of K- ras mutation. Cancer 115:16, 3609-3617
CrossRef455
J Souglakos, J Philips, R Wang, S Marwah, M Silver, M Tzardi, J Silver, S Ogino, S Hooshmand, E Kwak, E Freed, J A Meyerhardt, Z Saridaki, V Georgoulias, D Finkelstein, C S Fuchs, M H Kulke, R A Shivdasani. (2009) Prognostic and predictive value of common mutations for treatment response and survival in patients with metastatic colorectal cancer. British Journal of Cancer 101:3, 465-472
CrossRef456
Edward James, Maeve G. Waldron-Lynch, Muhammad Wasif Saif. (2009) Prolonged survival in a patient with BRCA2 associated metastatic pancreatic cancer after exposure to camptothecin: a case report and review of literature. Anti-Cancer Drugs 20:7, 634-638
CrossRef457
Zhuang Zuo, Su S Chen, Pranil K Chandra, John M Galbincea, Matthew Soape, Steven Doan, Bedia A Barkoh, Hartmut Koeppen, L Jeffrey Medeiros, Rajyalakshmi Luthra. (2009) Application of COLD-PCR for improved detection of KRAS mutations in clinical samples. Modern Pathology 22:8, 1023-1031
CrossRef458
Giulia Bianchi, Sibylle Loibl, Claudio Zamagni, Stefania Salvagni, Guenter Raab, Salvatore Siena, Nicole Laferriere, Carol Peña, Chetan Lathia, Loredana Bergamini, Luca Gianni. (2009) Phase II multicenter, uncontrolled trial of sorafenib in patients with metastatic breast cancer. Anti-Cancer Drugs 20:7, 616-624
CrossRef459
D M Kweekel, N F Antonini, J W R Nortier, C J A Punt, H Gelderblom, H-J Guchelaar. (2009) Explorative study to identify novel candidate genes related to oxaliplatin efficacy and toxicity using a DNA repair array. British Journal of Cancer 101:2, 357-362
CrossRef460
I Floriani, D Santini, V Torri, C Cremolini, A Falcone, F Loupakis. (2009) Do we need biopsies of metastases for colorectal cancer patients?. British Journal of Cancer 101:2, 374-375
CrossRef461
Tol, Jolien, Nagtegaal, Iris D., Punt, Cornelis J.A., . (2009) BRAF Mutation in Metastatic Colorectal Cancer. New England Journal of Medicine 361:1, 98-99
Full Text462
(2009) Cetuximab for Metastatic Colorectal Cancer. New England Journal of Medicine 361:1, 95-97
Full Text463
Alberto Sobrero. (2009) Molecular markers of chemotherapy in advanced colorectal cancer: Back to square one. European Journal of Cancer 45:11, 1902-1903
CrossRef464
Axel Walther, Elaine Johnstone, Charles Swanton, Rachel Midgley, Ian Tomlinson, David Kerr. (2009) Genetic prognostic and predictive markers in colorectal cancer. Nature Reviews Cancer 9:7, 489-499
CrossRef465
Stephen Leong, S. Gail Eckhardt, Antonio Jimeno, Wells Messersmith. (2009) The importance of KRAS status in managing metastatic colorectal cancer. Current Colorectal Cancer Reports 5:3, 129-134
CrossRef466
Hans Christian Spangenberg, Robert Thimme, Hubert E. Blum. (2009) Targeted therapy for hepatocellular carcinoma. Nature Reviews Gastroenterology & Hepatology 6:7, 423-432
CrossRef467
Julien Taieb, Pierre Laurent-Puig, Steven Alberts. (2009) Incidence of KRAS status in ongoing adjuvant trials in colon cancer. Current Colorectal Cancer Reports 5:3, 171-178
CrossRef468
Frank A Sinicrope, Daniel J Sargent. (2009) Clinical implications of microsatellite instability in sporadic colon cancers. Current Opinion in Oncology 21:4, 369-373
CrossRef469
Thomas P. Plesec, Jennifer L. Hunt. (2009) KRAS Mutation Testing in Colorectal Cancer. Advances in Anatomic Pathology 16:4, 196-203
CrossRef470
Helen X. Chen, Jessica N. Cleck, Rochelle Coelho, Janet E. Dancey. (2009) Epidermal Growth Factor Receptor Inhibitors: Current Status and Future Directions. Current Problems in Cancer 33:4, 245-294
CrossRef471
I Chau, D Cunningham. (2009) Treatment in advanced colorectal cancer: what, when and how?. British Journal of Cancer 100:11, 1704-1719
CrossRef472
Rakesh K. Jain, Dan G. Duda, Christopher G. Willett, Dushyant V. Sahani, Andrew X. Zhu, Jay S. Loeffler, Tracy T. Batchelor, A. Gregory Sorensen. (2009) Biomarkers of response and resistance to antiangiogenic therapy. Nature Reviews Clinical Oncology 6:6, 327-338
CrossRef473
A S Strimpakos, K N Syrigos, M W Saif. (2009) Pharmacogenetics and biomarkers in colorectal cancer. The Pharmacogenomics Journal 9:3, 147-160
CrossRef474
James W. Watters, Pearl S. Huang. (2009) Can phenotypic pathway signatures improve the prediction of response to PI3K pathway inhibitors?. Drug Discovery Today: Therapeutic Strategies 6:2, 57-62
CrossRef475
George J. Chang. (2009) INVITED COMMENTARY. Diseases of the Colon & Rectum 52:6, 1152-1153
CrossRef476
Astrid Lièvre, Pierre Laurent-Puig. (2009) Genetics: Predictive value of KRAS mutations in chemoresistant CRC. Nature Reviews Clinical Oncology 6:6, 306-307
CrossRef477
S. Gattenlöhner, B. Etschmann, H. Riedmiller, H.-K. Müller-Hermelink. (2009) Lack of KRAS and BRAF Mutation in Renal Cell Carcinoma. European Urology 55:6, 1490-1491
CrossRef478
J. -P. Metges, A. Volant, F. Grudé, O. Pradier, C. Riche, E. Gamelin, L. Corcos. (2009) La recherche clinique en cancérologie digestive: de la cible à la véritable personnalisation du traitement?. Oncologie 11:6, 325-330
CrossRef479
A Z Dudek, K Lesniewski-Kmak, N J Shehadeh, O N Pandey, M Franklin, R A Kratzke, E W Greeno, P Kumar. (2009) Phase I study of bortezomib and cetuximab in patients with solid tumours expressing epidermal growth factor receptor. British Journal of Cancer 100:9, 1379-1384
CrossRef480
BM Fine, L Amler. (2009) Predictive Biomarkers in the Development of Oncology Drugs: A Therapeutic Industry Perspective. Clinical Pharmacology & Therapeutics 85:5, 535-538
CrossRef481
Robert T. O’Neill. (2009) Medical Product Development, Innovation, and Life-Cycle Regulation: The Challenges for Biostatistics. Statistics in Biosciences 1:1, 1-9
CrossRef482
Kathryn A Gold, Edward S Kim. (2009) Role of molecular markers and gene profiling in head and neck cancers. Current Opinion in Oncology 21:3, 206-211
CrossRef483
K. Muro, T. Yoshino, T. Doi, K. Shirao, H. Takiuchi, Y. Hamamoto, H. Watanabe, B.-B. Yang, D. Asahi. (2009) A Phase 2 Clinical Trial of Panitumumab Monotherapy in Japanese Patients with Metastatic Colorectal Cancer. Japanese Journal of Clinical Oncology 39:5, 321-326
CrossRef484
Mitchell Kamrava, Olivier Rixe, James L Gulley. (2009) Research Highlights. Therapy 6:3, 305-308
CrossRef485
Robin K. Kelley, Alan P. Venook. (2009) Drug development in advanced colorectal cancer: Challenges and opportunities. Current Oncology Reports 11:3, 175-185
CrossRef486
R. Glynne-Jones. (2009) UK Third National Colorectal Cancer Consensus Meeting 2008. Clinical Oncology 21:4, 306-310
CrossRef487
Giulio Metro, Federico Cappuzzo. (2009) New targeted therapies for non-small-cell lung cancer. Therapy 6:3, 335-350
CrossRef488
Barry A Gusterson, Keith D Hunter. (2009) Should we be surprised at the paucity of response to EGFR inhibitors?. The Lancet Oncology 10:5, 522-527
CrossRef489
A Oden-Gangloff, F Di Fiore, F Bibeau, A Lamy, G Bougeard, F Charbonnier, F Blanchard, D Tougeron, M Ychou, F Boissière, F Le Pessot, J-C Sabourin, J-J Tuech, P Michel, T Frebourg. (2009) TP53 mutations predict disease control in metastatic colorectal cancer treated with cetuximab-based chemotherapy. British Journal of Cancer 100:8, 1330-1335
CrossRef490
Van Cutsem, Eric, Köhne, Claus-Henning, Hitre, Erika, Zaluski, Jerzy, Chang Chien, Chung-Rong, Makhson, Anatoly, D'Haens, Geert, Pintér, Tamás, Lim, Robert, Bodoky, György, Roh, Jae Kyung, Folprecht, Gunnar, Ruff, Paul, Stroh, Christopher, Tejpar, Sabine, Schlichting, Michael, Nippgen, Johannes, Rougier, Philippe, . (2009) Cetuximab and Chemotherapy as Initial Treatment for Metastatic Colorectal Cancer. New England Journal of Medicine 360:14, 1408-1417
Full Text491
Khaled M. Galal, Khaled Zaghloul, Abdel Monem M. Mourad. (2009) Inherent Resistance to Epidermal Growth Factor Receptor Antibodies in Refractory Metastatic Colorectal Cancer. Journal of Medical Sciences(Faisalabad) 9:4, 165-174
CrossRef492
Skye C Mayo, Timothy M Pawlik. (2009) Current management of colorectal hepatic metastasis. Expert Review of Gastroenterology & Hepatology 3:2, 131-144
CrossRef493
Liliane Goetsch, Nathalie Corvaïa. (2009) Insulin-like growth factor receptor type I as a target for cancer therapy. Immunotherapy 1:2, 265-279
CrossRef494
Antonio Jimeno, Wells A. Messersmith, Fred R. Hirsch, Wilbur A. Franklin, S Gail Eckhardt. (2009) KRAS Mutations and Susceptibility to Cetuximab and Panitumumab in Colorectal Cancer. The Cancer Journal 15:2, 110-113
CrossRef495
Astrid Lièvre, Pierre Laurent-Puig. (2009) Toward an individualizing therapy for colorectal cancer: the example of the anti-EGFR monoclonal antibodies. Personalized Medicine 6:2, 145-157
CrossRef496
(2009) K-ras Mutations and Cetuximab in Colorectal Cancer. New England Journal of Medicine 360:8, 833-836
Full Text497
Tol, Jolien, Koopman, Miriam, Cats, Annemieke, Rodenburg, Cees J., Creemers, Geert J.M., Schrama, Jolanda G., Erdkamp, Frans L.G., Vos, Allert H., van Groeningen, Cees J., Sinnige, Harm A.M., Richel, Dirk J., Voest, Emile E., Dijkstra, Jeroen R., Vink-Börger, Marianne E., Antonini, Ninja F., Mol, Linda, van Krieken, Johan H.J.M., Dalesio, Otilia, Punt, Cornelis J.A., . (2009) Chemotherapy, Bevacizumab, and Cetuximab in Metastatic Colorectal Cancer. New England Journal of Medicine 360:6, 563-572
Full Text498
Mayer, Robert J., . (2009) Targeted Therapy for Advanced Colorectal Cancer — More Is Not Always Better. New England Journal of Medicine 360:6, 623-625
Full Text499
JHM Schellens, JH Beijnen. (2009) Novel Clinical Trial Designs for Innovative Therapies. Clinical Pharmacology & Therapeutics 85:2, 212-216
CrossRef500
(2009) Mutations in KRAS render cetuximab therapy for advanced CRC ineffective. Nature Clinical Practice Gastroenterology & Hepatology 6:2, 64-64
CrossRef501
Patrick Tan. (2009) Divide and Conquer: Progress in the Molecular Stratification of Cancer. Yonsei Medical Journal 50:4, 464
CrossRef502
Herbert H. Loong, Brigette B. Ma, Anthony T. C. Chan. (2009) Update in Antiepidermal Growth Factor Receptor Therapy in the Management of Metastatic Colorectal Cancer. Journal of Oncology 2009, 1-6
CrossRef503
ROBERT E. PETRAS, WENDY L. FRANKEL. 2009. Large Intestine (Colon). , 755-836.
CrossRef504
Toshiro Nishimura. (2009) A therapeutic experience of three cases with salivary duct carcinoma in the parotid gland. JOURNAL OF JAPAN SOCIETY FOR HEAD AND NECK SURGERY 19:1, 63-66
CrossRef505
John L. Marshall. (2009) Vascular Endothelial Growth Factor Plus Epidermal Growth Factor Receptor Dual Targeted Therapy in Metastatic Colorectal Cancer: Synergy or Antagonism?. Journal of Oncology 2009, 1-9
CrossRef506
S. Gattenlöhner, B. Etschmann, V. Kunzmann, A. Thalheimer, M. Hack, G. Kleber, H. Einsele, C. Germer, H.-K. Müller-Hermelink. (2009) Concordance of KRAS/BRAF Mutation Status in Metastatic Colorectal Cancer before and after Anti-EGFR Therapy. Journal of Oncology 2009, 1-9
CrossRef507
(2008) Gastrointestinal stromal tumors - A model for understanding solid tumor biology and development of targeted therapies, or just another low-hanging fruit?. Asia-Pacific Journal of Clinical Oncology 4:4, 185-187
CrossRef508
(2008) KRAS mutations and cetuximab. Nature Reviews Cancer 8:12, 909-909
CrossRef509
Messersmith, Wells A., Ahnen, Dennis J., . (2008) Targeting EGFR in Colorectal Cancer. New England Journal of Medicine 359:17, 1834-1836
Full Text510
Rebecca A Herbertson, Chris Karapetis, Tim Price, Niall Tebbutt, Nick Pavlakis, Rebecca A Herbertson. 2008. Epidermal growth factor receptor (EGF-R) inhibitors for metastatic colorectal cancer. .
CrossRef511
Dirk Arnold. (2008) Sequential or combination chemotherapy for a patient with mCRC?. Cancer Treatment Reviews 34, S12-S16
CrossRef
- Letters
