Original Article
An Obesity-Associated FTO Gene Variant and Increased Energy Intake in Children
N Engl J Med 2008; 359:2558-2566December 11, 2008
- Abstract
Background
Variation in the fat mass and obesity–associated (FTO) gene has provided the most robust associations with common obesity to date. However, the role of FTO variants in modulating specific components of energy balance is unknown.
Methods
We studied 2726 Scottish children, 4 to 10 years of age, who underwent genotyping for FTO variant rs9939609 and were measured for height and weight. A subsample of 97 children was examined for possible association of the FTO variant with adiposity, energy expenditure, and food intake.
Results
In the total study group and the subsample, the A allele of rs9939609 was associated with increased weight (P=0.003 and P=0.049, respectively) and body-mass index (P=0.003 and P=0.03, respectively). In the intensively phenotyped subsample, the A allele was also associated with increased fat mass (P=0.01) but not with lean mass. Although total and resting energy expenditures were increased in children with the A allele (P=0.009 and P=0.03, respectively), resting energy expenditure was identical to that predicted for the age and weight of the child, indicating that there is no defect in metabolic adaptation to obesity in persons bearing the risk-associated allele. The A allele was associated with increased energy intake (P=0.006) independently of body weight. In contrast, the weight of food ingested by children who had the allele was similar to that in children who did not have the allele (P=0.82).
Conclusions
The FTO variant that confers a predisposition to obesity does not appear to be involved in the regulation of energy expenditure but may have a role in the control of food intake and food choice, suggesting a link to a hyperphagic phenotype or a preference for energy-dense foods.
Media in This Article
Figure 1
Energy Expenditure in Carriers and Noncarriers of the A Allele.Figure 2
Energy Intake and Weight of Ingested Food at the Test Meal in Carriers and Noncarriers of the A Allele.Article Activity
- Article
Childhood obesity is a major public health problem in most affluent countries, despite policies targeted toward reducing its prevalence. Impaired glucose tolerance and type 2 diabetes are currently being diagnosed in overweight children,1,2 along with associated risk factors for cardiovascular disease and the metabolic syndrome, conditions previously seen primarily in adults.3-5
Variation in the fat mass and obesity–associated (FTO) gene has been linked with obesity in a recent series of genomewide association studies.6-8 A number of single-nucleotide polymorphisms (SNPs) in tight linkage disequilibrium with rs9939609, and residing in the first intron of the FTO gene, have been associated with obesity in large populations of adults and children. These variants have also been shown to be associated with type 2 diabetes in an obesity-dependent manner.6-8 Expression of FTO in the arcuate nucleus in mice is regulated by fasting and feeding,9-11 suggesting a potential role for this gene in central control of energy homeostasis. The protein encoded by FTO has recently been shown to have 2-oxoglutarate–dependent nucleic acid demethylase activity; however, it is not known whether the nucleic acid substrate of the protein is DNA or RNA, nor have the genes or gene products that might be regulated by this enzyme been identified.11
In the present study, we examined the association between rs9939609 and both body weight and body-mass index (BMI) in a group of young Scottish schoolchildren. We also explored the role of rs9939609 in the control of energy expenditure and eating behavior in an intensively analyzed subsample of these children.
Methods
Subjects
Study participants were prepubertal schoolchildren, 4 to 10 years of age, from northeastern Scotland, most of whom were of European descent (95%). They were recruited from the Energy Balance Study, an investigation of phenotype–genotype associations in the maintenance of energy balance in children.12-14 Genomic DNA was isolated from saliva samples from all subjects after the parents or guardians had provided written informed consent and the children had provided assent. Approval for the Energy Balance Study was granted by the Tayside Committee on Medical Research Ethics and the Fife Local Research Committee. The education department in each school authority (or district) and school head teachers (or principals) also gave their approval.
Genomic DNA from 2726 children was available for genotyping for association of the FTO gene variant of interest with overweight and obesity. A subsample of 97 children was available for evaluation of adiposity, energy expenditure, and eating behavior. These children were recruited from a subsample of the Energy Balance Study, prospectively enriched for variants of the peroxisome proliferator-activated receptor gene, PPARG. 14
Genotyping
A SNP variant rs9939609 was genotyped with the use of an allelic discrimination assay (Custom TaqMan MGB, Applied Biosystems) with a 7700 detector (Applied Biosystems). The sequences of the assay components were as follows: forward primer, CTAGGTTCCTTGCGACTGCT; reverse primer, ACCTATTAAAACTTTAGAGTAACAGAGACTATCCA; probe 1, VIC-CATCACAAAATTCAC-BHQ, and probe 2, FAM-CATCACTAAATTCAC-BHQ.
Anthropometric Measurements
Date of birth was ascertained. The BMI was calculated as the weight in kilograms divided by the square of the height in meters. Standing height, without shoes, was measured (to the nearest 0.1 cm) with the use of a stadiometer (Leicester Stadiometer, Seca). Body weight, in light clothing, was measured (to the nearest 0.1 kg) with the use of a mechanical floor scale (Seca). Waist circumference (to the nearest 0.1 cm) was measured, in the standing position, midway between the iliac crest and the lower costal margin. Hip circumference (to the nearest 0.1 cm) was measured, in the standing position, at the maximum circumference over the buttocks. Anthropometric measurements included biceps, triceps, and subscapular and suprailiac skinfolds. The sum of the skinfold measurements was used to estimate fat and lean mass by means of Lohman's equations.15,16 All skinfold measurements were performed on the right side of the body by the same investigator.
Measurement of Food Intake at a Test Meal
The procedure for measurement of food intake at a test meal has been reported elsewhere.14,17 Briefly, on three occasions in school, 1.5 hours before a test-meal lunch, children ingested a beverage or combination of food and beverage that varied in energy density: a no-energy control consisting of 250 ml of water (0 kJ), a low-energy combination of a 250-ml orange drink and 56-g muffin (783 kJ), and a high-energy combination of a 250-ml orange drink and 56-g muffin (1628 kJ). The amount of food subsequently consumed at the test meal was assessed by weighing the food items before and after eating. Energy and macronutrient intakes were assessed according to the manufacturers' information. In total, 76 children successfully completed all three tests and were included in this analysis.
Energy Expenditure
The resting metabolic rate was assessed by indirect calorimetry, with the use of a ventilated hood (Deltatrac, Datex-Ohmeda) adapted for use with children. Measurements were performed when children were in a postprandial state, at the same time in the afternoon. The children's oxygen consumption and carbon dioxide output stabilized after approximately 4 minutes under the hood, and resting energy expenditure was measured for at least another 15 minutes. The mean of at least 10 stable values was used for analysis.
Total energy expenditure was measured by means of the doubly labeled water method over a period of 10 days. A preisotope urine sample was obtained on day 0 for estimation of the unenriched isotope ratios of 18O and deuterium. After the sample was taken, the children were given an oral dose of labeled water (2H2 18O) in a low-calorie fruit juice. The juice was given at a dose of 0.15 g of 99% 2H2O (Sigma-Aldrich) per kilogram of body weight and 1.5 to 2.0 g of 10% H2 18O (Goss Scientific Instruments) per kilogram of body weight. Urine samples were collected 4 hours after dosing and then once daily on days 1 through 5 and on day 10. Samples were frozen immediately after collection and returned to the laboratory after day 10. Urine samples were analyzed by isotope ratio mass spectrometry for enrichment of 18O and deuterium. The fat mass was calculated on the assumption that 73% of lean body mass is water, as previously described.18,19
Statistical Analysis
Data were analyzed with the use of SPSS software for Macintosh (version 16, SPSS), with the results expressed as means ±SE. Because of the low numbers of AA homozygotes, the genotype was analyzed with the use of the dominant-allele model, with the A allele being dominant. Quantitative traits (height, weight, BMI, waist and hip measurements, percent body fat, and energy expenditure) were analyzed with the use of univariate analysis of variance. Age and sex were incorporated as covariates when appropriate. Data on food intake were analyzed with the use of repeated-measures general linear modeling, with genotype included as a between-subject factor and age included as a covariate. Total energy intake was adjusted for body weight. Socioeconomic status (determined according to whether the child was entitled to receive free school meals) and sex were initially included as covariates in the model but were dropped by means of stepwise removal (removed if P≥0.40). Data on resting energy expenditure were analyzed with univariate analysis of variance with adjustment for lean body mass. Total energy expenditure and energy spent in activity were analyzed by univariate analysis of variance, with age, weight, and socioeconomic status included as covariates. The gaussian distribution was assessed with the use of the D'Agostino–Pearson omnibus normality test. Nonparametric analysis was performed by means of a Mann–Whitney U tests with GraphPad Prism software for Macintosh, version 4b (GraphPad Software). All reported P values are two sided, and a P value of less than 0.05 was considered to indicate statistical significance.
Results
Allele Frequencies
The allele frequencies of FTO rs9939609 for both the total group and the subsample are shown in Table 1Table 1
FTO Genotype Frequencies and the Frequency of the A Allele in the Total Study Sample and the Subsample.. The frequency of the A allele was 0.385 for the total population and 0.381 for the subsample; it was in Hardy–Weinberg equilibrium in both groups (P>0.20).BMI and Genotype
The association of FTO rs9939609 with height, weight, and BMI was examined by means of univariate general linear modeling. In the total study group (Table 2Table 2
Association of the rs9939609 Variant of the FTO Gene with Height, Weight, and Body-Mass Index in the Total Study Group.), the A allele of rs9939609 was associated with significantly increased weight (P=0.003) and BMI (P=0.003). An allele-dose–dependent trend was observed for weight and BMI. In the subsample of 97 children, similar increases in weight (P=0.049) and BMI (P=0.03) were associated with the A allele (Table 3Table 3
Association of the rs9939609 Variant of the FTO Gene with Anthropometric Measures in the Subsample.).Adiposity and Genotype
Children carrying the A allele had somewhat higher measures of waist and hip circumference than children who did not have the A allele, but the differences were not significant (Table 3). The A allele was also associated with significantly increased anthropometric skinfold values (P=0.03). Fat mass and lean mass were assessed with the use of both the skinfold data (with the use of the equations of Lohman) and the data for total body water (from the isotope-dilution studies). On the basis of the skinfold data, the children who carried the A allele had an estimated fat mass that was 1.78 kg greater than that of noncarriers (P=0.01) and an estimated lean mass that was less than 400 g greater than that of noncarriers (P=0.46). On the basis of the isotope-dilution data, the fat mass was 1.28 kg greater (P=0.10) and the lean mass less than 400 g greater (P=0.58) for carriers than for noncarriers.
Energy Expenditure and Genotype
As assessed by indirect calorimetry, resting energy expenditure was 349 kJ greater in children who carried the A allele than in noncarriers (P=0.03) (Figure 1AFigure 1
Energy Expenditure in Carriers and Noncarriers of the A Allele.). This difference was similar to that predicted for resting energy expenditure with the use of Schofield's equations (P=0.01) (Figure 1A),20 which take body weight, age, and sex into consideration and are widely used to predict resting energy expenditure in children.20,21 In agreement with this observation, inclusion of body mass (weight) or lean body mass as a covariate in the regression model abolished the association between genotype and resting energy expenditure (P>0.20 in both cases). Total energy expenditure as measured on the basis of isotope dilution was also significantly greater in carriers of the A allele than in noncarriers, with a difference of 1160 kJ (P=0.009) (Figure 1B). Subtraction of resting energy expenditure from total energy expenditure provides an estimate of the expenditure due to physical activity. Energy expenditure due to physical activity was also higher for carriers, with a difference of 1103 kJ (P=0.02). This measure of energy expenditure related to activity was not correlated with the weight or BMI of the children when body weight was included as a covariate in the regression model.Eating Behavior and Genotype
Increased food intake at test meals (measured in kilojoules) was associated with the A allele. The presence of the rs9939609 variant was found to affect energy intake (P=0.006 by analysis of variance for the comparison of energy intake after the no-energy, low-energy, and high-energy premeal loads). After adjustment for age, the children who carried the A allele had significantly greater energy intake at the test meals that followed the control and low-energy loads than did noncarriers (P=0.02 and P=0.002, respectively) (Figure 2AFigure 2
Energy Intake and Weight of Ingested Food at the Test Meal in Carriers and Noncarriers of the A Allele.), with a similar trend with respect to the high-energy premeal load. These observations could not be explained by the presence of spurious outliers, since nonparametric analysis of total energy intake provided similar, if not stronger, results (P=0.006 for the control premeal load, P=0.001 for the low-energy load, and P=0.03 for the high-energy load by the Mann–Whitney U test). This increase in energy intake was independent of body mass, since these differences persisted when weight or lean body mass was included as a covariate in the regression model, and similar results were obtained when energy intake was expressed as kilojoules of food ingested per kilogram of body weight (P=0.005 by analysis of variance and P=0.025 by the Mann–Whitney U test for the low-energy premeal load) (Figure 2B). Interestingly, the total weight of food ingested was not markedly increased in carriers of the A allele as compared with noncarriers (P=0.82) (Figure 2C), whereas the weights of individual macronutrients were consistently higher for carriers (Table 4Table 4
Association of the rs9939609 Variant of the FTO Gene with Macronutrient Intake in the Subsample.), with 30% higher fat intake after the low-energy premeal load in the A allele carriers (P=0.004 by analysis of variance adjusted for body weight, and P=0.003 by the Mann–Whitney U test). Intake levels of the individual macronutrients did not differ significantly according to genotype, after adjustment for total energy intake. The energy density of the food ingested (kilojoules per gram of food ingested) after all three premeal loads tended to be higher among carriers of the A allele than among noncarriers, with 16% greater energy density of food ingested by carriers after the low-energy load (P=0.03 by analysis of variance and P=0.03 by the Mann–Whitney U test) (Figure 2D).Discussion
The association of the FTO gene with human obesity is robust in populations of European descent.6-8 The only negative studies published to date have involved non-European populations.22,23 Although the genetic architecture of the FTO locus has not been examined in great detail in either of these populations, evidence is emerging that rs9939609 may be in tight linkage disequilibrium with a causal variant in populations of European descent but that this linkage disequilibrium may break down in other ethnic and racial groups, such as blacks.24
We confirmed the association of the FTO variant with BMI in a population of Scottish schoolchildren and then examined energy expenditure and eating in a subsample. The frequency of the A allele in the subsample (as well as the total study group) was consistent with the frequency reported in the initial association study.6 This reassured us that the use of the FTO genotype in the subsample, which had been enriched for the PPARG Pro12ala variant,14 was a valid approach. No interaction was observed between the FTO and PPARG variants for the association with height, weight, or BMI (data not shown).
The present data indicate that FTO SNP rs9939609 is associated with differences in BMI, with the presence of the A allele linked to a greater risk of increased BMI and increased values for specific measures of adiposity, such as the sum of skinfold values and total body water as assessed by isotope analysis. The skinfold approximation of the absolute amount of body fat was an underestimate, as previously reported in the literature,25 and this underestimate is to be expected, considering that this method involves only a physical measure of subcutaneous fat, with no direct measurement of abdominal and intraorgan deposits. In agreement with a previous study, which used dual-energy x-ray absorptiometry (DEXA),6 the FTO genotype was associated with greater fat mass but not lean mass, as measured by both techniques used in our study.
This study indicates that there is no defect in the “output” side of energy balance, which constitutes energy expenditure. We did observe an increase in resting energy metabolism in the A allele carriers that was consistent with their increased body mass. In addition, we observed that the difference in total energy expenditure between the genotype groups was primarily a difference in activity-related expenditure, suggesting that the A allele is unlikely to be a marker of sedentary behavior. However, we do not know how this finding relates to the nature of the physical activity (i.e., exercise or other activity).26
Most of our data suggest that the FTO gene influences the “input” side of the energy-balance equation, and this conclusion is supported by studies in rodents showing that the gene is expressed in the main regions of the brain that control feeding and that its expression is regulated by food deprivation.9-11 Another group of investigators, who used brain imaging in human subjects genotyped for the FTO alleles, found that the brains of subjects with the high-risk allele for the FTO gene were more resistant to the effects of insulin than were the brains of subjects without the high-risk allele.27
Our study tested satiety by directly measuring food intake from a test meal after ingestion of one of three preloads, and the results show a robust effect of genotype on energy intake but not on the weight of food ingested. This increase in energy intake was independent of body weight. Thus, the children carrying the A allele ingested more energy-dense foods than did the children who were not carrying the A allele, indicating a preference for energy-dense foods. However, larger studies are required to confirm these observations and to examine the effect of being homozygous for the A allele as compared with being heterozygous.
Most monogenic obesity disorders directly affect eating behavior,28 and our observations suggest that the FTO gene is not an exception. However, it is not yet clear whether FTO has a direct hypothalamic role in appetite regulation or has a systemic role in sensing food intake. In addition, it is possible that RPGRIP1L (the human orthologue of Ftm), a gene that encodes a molecular component of the basal body of cilia and that is coregulated by variation in the FTO locus, may have a role in the observed phenotype.9
In conclusion, variation within the FTO locus appears to confer a risk of obesity through increased energy intake, suggesting that moderate and controlled restriction of energy intake may prevent FTO genotype–associated obesity. This finding and its implications are especially important given the growing consensus that childhood obesity is a major predictor of cardiovascular morbidity and mortality in adulthood.29,30
Supported by a grant from the U.K. Biotechnology and Biological Sciences Research Council (D13460).
No potential conflict of interest relevant to this article was reported.
We thank the children, parents, and schoolteachers for their enthusiastic participation in this study; Dr. Wendy Wrieden, Dr. Deborah Wallis, and Inez Murrie for their support; and Dr. Lydia Martinez, Dr. Andy Coward, and Antony Wright for their technical assistance and helpful discussions.
Source Information
From the Bute Medical School, University of St Andrews, St Andrews (J.E.C.); the Biomedical Research Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee (R.T., C.N.A.P.); Chelsea School, University of Brighton, Brighton (P.W.); and the Department of Psychology, Glasgow Caledonian University, Glasgow (M.M.H.) — all in the United Kingdom.
Address reprint requests to Dr. Palmer at the Biomedical Research Institute, Ninewells Hospital and Medical School, University of Dundee, Scotland DD1 9SY, United Kingdom, or at nuclear-receptor@dundee.ac.uk.
- References
References
1
Burgert TS . Glucose and insulin metabolism in obese youth. Pediatr Endocrinol Rev 2006;3:Suppl 4:555-559
Medline2
Wiegand S ,Dannemann A ,Krude H ,Gruters A . Impaired glucose tolerance and type 2 diabetes mellitus: a new field for pediatrics in Europe. Int J Obes (Lond) 2005;29:Suppl 2:S136-S142
CrossRef | Web of Science | Medline3
Zimmet P ,Alberti G ,Kaufman F , et al. The metabolic syndrome in children and adolescents. Lancet 2007;369:2059-2061
CrossRef | Web of Science | Medline4
Ferreira AP ,Oliveira CE ,Franca NM . Metabolic syndrome and risk factors for cardiovascular disease in obese children: the relationship with insulin resistance (HOMA-IR). J Pediatr (Rio J) 2007;83:21-26
CrossRef | Web of Science | Medline5
Freedman DS . Clustering of coronary heart disease risk factors among obese children. J Pediatr Endocrinol Metab 2002;15:1099-1108
CrossRef | Web of Science | Medline6
Frayling TM ,Timpson NJ ,Weedon MN , et al. A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science 2007;316:889-894
CrossRef | Web of Science | Medline7
Dina C ,Meyre D ,Gallina S , et al. Variation in FTO contributes to childhood obesity and severe adult obesity. Nat Genet 2007;39:724-726
CrossRef | Web of Science | Medline8
Scuteri A ,Sanna S ,Chen WM , et al. Genome-wide association scan shows genetic variants in the FTO gene are associated with obesity-related traits. PLoS Genet 2007;3:e115-e115
CrossRef | Web of Science | Medline9
Stratigopoulos G ,Padilla S ,LeDuc CA , et al. Regulation of Fto/Ftm gene expression in mice and humans. Am J Physiol Regul Integr Comp Physiol 2008;294:R1185-R1196
CrossRef | Web of Science | Medline10
Fredriksson R ,Hagglund M ,Olszewski PK , et al. The obesity gene, FTO, is of ancient origin, upregulated during food deprivation and expressed in neurons of feeding-related nuclei of the brain. Endocrinology 2008;149:2062-2071
CrossRef | Web of Science | Medline11
Gerken T ,Girard CA ,Tung YC , et al. The obesity-associated FTO gene encodes a 2-oxoglutarate-dependent nucleic acid demethylase. Science 2007;318:1469-1472
CrossRef | Web of Science | Medline12
Cecil JE ,Watt P ,Murrie IS , et al. Childhood obesity and socioeconomic status: a novel role for height growth limitation. Int J Obes (Lond) 2005;29:1199-1203
CrossRef | Web of Science | Medline13
Cecil JE ,Watt P ,Palmer CN ,Hetherington M . Energy balance and food intake: the role of PPARgamma gene polymorphisms. Physiol Behav 2006;88:227-233
CrossRef | Web of Science | Medline14
Cecil JE ,Palmer CN ,Fischer B , et al. Variants of the peroxisome proliferator-activated receptor gamma- and beta-adrenergic receptor genes are associated with measures of compensatory eating behaviors in young children. Am J Clin Nutr 2007;86:167-173
Web of Science | Medline15
Lohman TG . Applicability of body composition techniques and constants for children and youths. Exerc Sport Sci Rev 1986;14:325-357
CrossRef | Web of Science | Medline16
Lohman TG . Assessment of body composition in children. Pediatr Exerc Sci 1989;1:19-3017
Cecil JE ,Palmer CNA ,Wrieden W , et al. Energy intakes of children after preloads: adjustment, not compensation. Am J Clin Nutr 2005;82:302-308
Web of Science | Medline18
Van Kreel BK ,Van der Vegt F ,Meers M ,Wagenmakers T ,Westerterp K ,Coward A . Determination of total body water by a simple and rapid mass spectrometric method. J Mass Spectrom 1996;31:108-111
CrossRef | Web of Science | Medline19
Schoeller DA . Energy expenditure from doubly labeled water: some fundamental considerations in humans. Am J Clin Nutr 1983;38:999-1005
Web of Science | Medline20
Ball EJ ,O'Connor J ,Abbott R , et al. Total energy expenditure, body fatness, and physical activity in children aged 6-9 y. Am J Clin Nutr 2001;74:524-528
Web of Science | Medline21
Reilly JJ ,Jackson DM ,Montgomery C , et al. Total energy expenditure and physical activity in young Scottish children: mixed longitudinal study. Lancet 2004;363:211-212
CrossRef | Web of Science | Medline22
Ohashi J ,Naka I ,Kimura R , et al. FTO polymorphisms in oceanic populations. J Hum Genet 2007;52:1031-1035
CrossRef | Web of Science | Medline23
Li H ,Wu Y ,Loos RJ , et al. Variants in the fat mass- and obesity-associated (FTO) gene are not associated with obesity in a Chinese Han population. Diabetes 2008;57:264-268
CrossRef | Web of Science | Medline24
Grant SF ,Li M ,Bradfield JP , et al. Association analysis of the FTO gene with obesity in children of Caucasian and African ancestry reveals a common tagging SNP. PLoS ONE 2008;3:e1746-e1746
CrossRef | Web of Science | Medline25
Garcia AL ,Wagner K ,Hothorn T ,Koebnick C ,Zunft HJ ,Trippo U . Improved prediction of body fat by measuring skinfold thickness, circumferences, and bone breadths. Obes Res 2005;13:626-634
CrossRef | Medline26
Levine JA ,Lanningham-Foster LM ,McCrady SK , et al. Interindividual variation in posture allocation: possible role in human obesity. Science 2005;307:584-586
CrossRef | Web of Science | Medline27
Tschritter O ,Preissl H ,Yokoyama Y ,Machicao F ,Haring HU ,Fritsche A . Variation in the FTO gene locus is associated with cerebrocortical insulin resistance in humans. Diabetologia 2007;50:2602-2603[Erratum, Diabetologia 2008;51:1558.]
CrossRef | Web of Science | Medline28
Farooqi IS ,O'Rahilly S . Monogenic obesity in humans. Annu Rev Med 2005;56:443-458
CrossRef | Web of Science | Medline29
Baker JL ,Olsen LW ,Sorensen TIA . Childhood body-mass index and the risk of coronary heart disease in adulthood. N Engl J Med 2007;357:2329-2337
Full Text | Web of Science | Medline30
Bibbins-Domingo K ,Coxson P ,Pletcher MJ ,Lightwood J ,Goldman L . Adolescent overweight and future adult coronary heart disease. N Engl J Med 2007;357:2371-2379
Full Text | Web of Science | Medline
- Citing Articles (99)
Citing Articles
1
Donghao Zhou, Hongjun Liu, Ming’ai Zhou, Shengxiang Wang, Jingling Zhang, Lin Liao, Fang He. (2012) Common variant (rs9939609) in the FTO gene is associated with metabolic syndrome. Molecular Biology Reports
CrossRef2
A Woehning, J-H Schultz, E Roeder, A Moeltner, B Isermann, P P Nawroth, C Wolfrum, G Rudofsky. (2012) The A-allele of the common FTO gene variant rs9939609 complicates weight maintenance in severe obese patients. International Journal of Obesity
CrossRef3
J. A. Marsh, C. E. Pennell, N. M. Warrington, D. Mook-Kanamori, L. Briollais, S. J. Lye, L. J. Beilin, E. Steegers, A. Hofman, V. W. V. Jaddoe, J. P. Newnham, L. J. Palmer. (2012) Fat mass and obesity-associated obesity-risk genotype is associated with lower foetal growth: an effect that is reversed in the offspring of smoking mothers. Journal of Developmental Origins of Health and Disease 3:01, 10-20
CrossRef4
Tiina Lappalainen, Jaana Lindström, Jussi Paananen, Johan G. Eriksson, Leila Karhunen, Jaakko Tuomilehto, Matti Uusitupa. (2012) Association of the fat mass and obesity-associated (FTO) gene variant (rs9939609) with dietary intake in the Finnish Diabetes Prevention Study. British Journal of Nutrition1-7
CrossRef5
D M Hallman, V C Friedel, M A H Eissa, E Boerwinkle, J C Huber, R B Harrist, S R Srinivasan, W Chen, S Dai, D R Labarthe, G S Berenson. (2012) The association of variants in the FTO gene with longitudinal body mass index profiles in non-Hispanic white children and adolescents. International Journal of Obesity 36:1, 61-68
CrossRef6
Lina Wang, Qing Yu, Yan Xiong, Linfei Liu, Xuening Zhang, Zhen Zhang, Jianru Wu, Bei Wang. (2012) Variant rs1421085 in the FTO gene contribute childhood obesity in Chinese children aged 3–6years. Obesity Research & Clinical Practice
CrossRef7
Paul C. D. Johnson, Jennifer Logue, Alex McConnachie, Niveen M. E. Abu-Rmeileh, Carole Hart, Mark N. Upton, Mike Lean, Naveed Sattar, Graham Watt. (2011) Intergenerational change and familial aggregation of body mass index. European Journal of Epidemiology
CrossRef8
SCOTT A. LEAR, WEI Q. DENG, GUILLAUME PARÉ, DIAN C. SULISTYONINGRUM, RUTH J. F. LOOS, ANGELA DEVLIN. (2011) Associations of the FTO rs9939609 variant with discrete body fat depots and dietary intake in a multi-ethnic cohort. Genetics Research 93:06, 419-426
CrossRef9
X Jia, Q Nie, S J Lamont, X Zhang. (2011) Variation in sequence and expression of the avian FTO, and association with glucose metabolism, body weight, fatness and body composition in chickens. International Journal of Obesity
CrossRef10
Benilde Riffo, Sylvia Asenjo, Katia Sáez, Claudio Aguayo, Isabel Muñoz, Paulina Bustos, CA Celis-Morales, Jenny Lagos, Jorge Sapunar, Natalia Ulloa. (2011) FTO gene is related to obesity in Chilean Amerindian children and impairs HOMA-IR in prepubertal girls. Pediatric Diabetesn/a-n/a
CrossRef11
Angela M. Craigie, Amelia A. Lake, Sarah A. Kelly, Ashley J. Adamson, John C. Mathers. (2011) Tracking of obesity-related behaviours from childhood to adulthood: A systematic review. Maturitas 70:3, 266-284
CrossRef12
Patrizia Zavattari, Alberto Loche, Sabrina Pilia, Anastasia Ibba, Loredana Moi, Chiara Guzzetti, Maria Rosaria Casini, Sandro Loche. (2011) rs9939609 in the FTO Gene is Associated with Obesity but not with Several Biochemical Parameters in Sardinian Obese Children. Annals of Human Genetics 75:6, 648-654
CrossRef13
Wei Tang, Jun-jie Zou, Xiang-fang Chen, Jiao-yang Zheng, Hua-zong Zeng, Zhi-min Liu, Yong-quan Shi. (2011) Association of two polymorphisms within and near SOCS3 gene with obesity in three nationalities in Xinjiang province of China. Acta Pharmacologica Sinica 32:11, 1381-1386
CrossRef14
V. Ott, C. Benedict, B. Schultes, J. Born, M. Hallschmid. (2011) Intranasal administration of insulin to the brain impacts cognitive function and peripheral metabolism. Diabetes, Obesity and Metabolismno-no
CrossRef15
Ramon Bossardi Ramos, Gislaine Krolow Casanova, Maria Augusta Maturana, Poli Mara Spritzer. (2011) Variations in the fat mass and obesity–associated (FTO) gene are related to glucose levels and higher lipid accumulation product in postmenopausal women from southern Brazil. Fertility and Sterility 96:4, 974-979
CrossRef16
Melissa K. Crocker, Jack A. Yanovski. (2011) Pediatric Obesity: Etiology and Treatment. Pediatric Clinics of North America 58:5, 1217-1240
CrossRef17
Idoia Labayen, Jonatan R. Ruiz, Francisco B. Ortega, Frédéric Gottrand, Inge Huybrechts, Jean Dallongeville, Kurt Widhalm, Marika Ferrari, Annete Buyken, Mathilde Kersting, George Moschonis, Dominique Turck, Sonia Gómez, Michael Sjostrom, Aline Meirhaeghe, Luis A. Moreno. (2011) Body size at birth modifies the effect of fat mass and obesity associated (FTO) rs9939609 polymorphism on adiposity in adolescents: the Healthy Lifestyle in Europe by Nutrition in Adolescence (HELENA) study. British Journal of Nutrition1-7
CrossRef18
J. E. Blundell. (2011) Physical activity and appetite control: can we close the energy gap?. Nutrition Bulletin 36:3, 356-366
CrossRef19
Nuananong Seal, Michael Weaver, Lyle G. Best. (2011) Correlates of the FTO Gene Variant (rs9939609) and Growth of American Indian Infants. Genetic Testing and Molecular Biomarkers 15:9, 633-638
CrossRef20
T. Lappalainen, M. Kolehmainen, U.S. Schwab, A.M. Tolppanen, A. Stančáková, J. Lindström, J.G. Eriksson, S. Keinänen-Kiukaanniemi, S. Aunola, P. Ilanne-Parikka, C. Herder, W. Koenig, H. Gylling, H. Kolb, J. Tuomilehto, J. Kuusisto, M. Uusitupa. (2011) Association of the FTO gene variant (rs9939609) with cardiovascular disease in men with abnormal glucose metabolism – The Finnish Diabetes Prevention Study. Nutrition, Metabolism and Cardiovascular Diseases 21:9, 691-698
CrossRef21
Hanna Danielewicz, Andrzej Boznański, Anna Dębińska. (2011) Astma i otyłość – czy można mówić o wspólnych uwarunkowaniach genetycznych tych chorób?. Pediatria Polska 86:6, 574-581
CrossRef22
E Sonestedt, B Gullberg, U Ericson, E Wirfält, B Hedblad, M Orho-Melander. (2011) Association between fat intake, physical activity and mortality depending on genetic variation in FTO. International Journal of Obesity 35:8, 1041-1049
CrossRef23
Cristina Stewart B. Bogsan, Ana Carolina R. Florence, Natalia Perina, Ricardo C. Barbuti, Tomás Navarro-Rodriguez, Jaime N. Eisig, Maricê N. Oliveira. (2011) Probiotics intake and metabolic syndrome: A proposal. Trends in Food Science & Technology 22:8, 457-464
CrossRef24
Masayuki Okuda, Yuji Hinoda, Naoko Okayama, Yutaka Suehiro, Komei Shirabe, Satoshi Sasaki, Ichiro Kunitsugu, Norikazu Yoshitake, Tatsuya Hobara. (2011) Association between the FTO gene and overweight in Japanese children and adolescents. Pediatric Diabetes 12:5, 494-500
CrossRef25
SKOCZEN SZYMON, MIROSLAW BIK-MULTANOWSKI, WALENTYNA BALWIERZ, JACEK J. PIETRZYK, MARCIN SURMIAK, WOJCIECH STROJNY, DANUTA GALICKA-LATALA, JOLANTA GOZDZIK. (2011) Homozygosity for the rs9939609T allele of the FTO gene may have protective effect on becoming overweight in survivors of childhood acute lymphoblastic leukaemia. Journal of Genetics 90:2, 365-368
CrossRef26
Silke A. Schäfer, Fausto Machicao, Andreas Fritsche, Hans-Ulrich Häring, Konstantinos Kantartzis. (2011) New type 2 diabetes risk genes provide new insights in insulin secretion mechanisms. Diabetes Research and Clinical Practice 93, S9-S24
CrossRef27
Adriana Moleres, M. Carmen Ochoa, Tara Rendo-Urteaga, M. Angel Martínez-González, M. Cristina Azcona San Julián, J. Alfredo Martínez, Amelia Marti. (2011) Dietary fatty acid distribution modifies obesity risk linked to the rs9939609 polymorphism of the fat mass and obesity-associated gene in a Spanish case–control study of children. British Journal of Nutrition1-6
CrossRef28
Steven C. Moore, Marc J. Gunter, Carrie R. Daniel, K. Srinath Reddy, Preeti S. George, Susan Yurgalevitch, Niveditha Devasenapathy, Lakshmy Ramakrishnan, Nilanjan Chatterjee, Stephen J. Chanock, Sonja I. Berndt, Aleyamma Mathew, Dorairaj Prabhakaran, Rashmi Sinha. (2011) Common Genetic Variants and Central Adiposity Among Asian-Indians. Obesity
CrossRef29
G.A. Martos-Moreno, J. Argente. (2011) Obesidades pediátricas: de la lactancia a la adolescencia. Anales de Pediatría 75:1, 63.e1-63.e23
CrossRef30
Marta Díaz, Abel López-Bermejo, David Sánchez-Infantes, Judit Bassols, Francis de Zegher, Lourdes Ibáñez. (2011) Responsiveness to metformin in girls with androgen excess: collective influence of genetic polymorphisms. Fertility and Sterility 96:1, 208-213.e2
CrossRef31
Scott P. Sibbel, Matthew E. Talbert, Donald W. Bowden, Steve M. Haffner, Kent D. Taylor, Yii-Der I. Chen, Lynne E. Wagenknecht, Carl D. Langefeld, Jill M. Norris. (2011) RGS6 Variants Are Associated With Dietary Fat Intake in Hispanics: The IRAS Family Study. Obesity 19:7, 1433-1438
CrossRef32
J. Argente. (2011) Obesidad infantojuvenil: una enfermedad heterogénea con nuevos fundamentos fisiopatológicos. Anales de Pediatría 75:1, 1-5
CrossRef33
Herbert Tilg, Arthur Kaser. (2011) Gut microbiome, obesity, and metabolic dysfunction. Journal of Clinical Investigation 121:6, 2126-2132
CrossRef34
Shwetha Ramachandrappa, I. Sadaf Farooqi. (2011) Genetic approaches to understanding human obesity. Journal of Clinical Investigation 121:6, 2080-2086
CrossRef35
George V. Z. Dedoussis, Mary Yannakoulia, Nicholas J. Timpson, Yannis Manios, Stavroula Kanoni, Robert A. Scott, Constantina Papoutsakis, Panos Deloukas, Yannis P. Pitsiladis, George Davey-Smith, Joel N. Hirschhorn, Helen N. Lyon. (2011) Does a short breastfeeding period protect from FTO -induced adiposity in children?. International Journal of Pediatric Obesity 6:2-2, e326-e335
CrossRef36
Charles R. Jonassaint, Jin Peng Szatkiewicz, Cynthia M. Bulik, Laura M. Thornton, Cinnamon Bloss, Wade H. Berrettini, Walter H. Kaye, Andrew W. Bergen, Pierre Magistretti, Michael Strober, Pamela K. Keel, Harry Brandt, Steve Crawford, Scott Crow, Manfred M. Fichter, David Goldman, Katherine A. Halmi, Craig Johnson, Allan S. Kaplan, Kelly L. Klump, Maria La Via, James E. Mitchell, Alessandro Rotondo, Janet Treasure, D. Blake Woodside. (2011) Absence of association between specific common variants of the obesity-related FTO gene and psychological and behavioral eating disorder phenotypes. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics 156:4, 454-461
CrossRef37
N. L. Nock, S. J. Plummer, C. L. Thompson, G. Casey, L. Li. (2011) FTO polymorphisms are associated with adult body mass index (BMI) and colorectal adenomas in African-Americans. Carcinogenesis 32:5, 748-756
CrossRef38
C. Carette. (2011) La surexpression du gène FTO chez la souris entraîne une augmentation de la prise alimentaire et le développement d’une obésité. Obésité 6:2, 136-136
CrossRef39
M Rivera, S Cohen-Woods, K Kapur, G Breen, M Y Ng, A W Butler, N Craddock, M Gill, A Korszun, W Maier, O Mors, M J Owen, M Preisig, S Bergmann, F Tozzi, J Rice, M Rietschel, J Rucker, A Schosser, K J Aitchison, R Uher, I W Craig, C M Lewis, A E Farmer, P McGuffin. (2011) Depressive disorder moderates the effect of the FTO gene on body mass index. Molecular Psychiatry
CrossRef40
Agnieszka Sobczyk-Kopciol, Grazyna Broda, Marcin Wojnar, Pawel Kurjata, Andrzej Jakubczyk, Anna Klimkiewicz, Rafal Ploski. (2011) Inverse association of the obesity predisposing FTO rs9939609 genotype with alcohol consumption and risk for alcohol dependence. Addiction 106:4, 739-748
CrossRef41
2011. References. , 283-360.
CrossRef42
Yi-Chun Loraine Tung, Giles S. H. Yeo. (2011) From GWAS to biology: lessons from FTO. Annals of the New York Academy of Sciences 1220:1, 162-171
CrossRef43
D Rosskopf, C Schwahn, F Neumann, A Bornhorst, C Rimmbach, M Mischke, S Wolf, I Geissler, T Kocher, H-J Grabe, M Nauck, J Hebebrand, H K Kroemer, N Friedrich, H Völzke, H Wallaschofski. (2011) The growth hormone—IGF-I axis as a mediator for the association between FTO variants and body mass index: results of the Study of Health in Pomerania. International Journal of Obesity 35:3, 364-372
CrossRef44
Rachel Larder, M.K. Marcella Cheung, Y.C. Loraine Tung, Giles S.H. Yeo, Anthony P. Coll. (2011) Where to go with FTO?. Trends in Endocrinology & Metabolism 22:2, 53-59
CrossRef45
N J Timpson, B G Nordestgaard, R M Harbord, J Zacho, T M Frayling, A Tybjærg-Hansen, G Davey Smith. (2011) C-reactive protein levels and body mass index: elucidating direction of causation through reciprocal Mendelian randomization. International Journal of Obesity 35:2, 300-308
CrossRef46
Cristina Razquin, Amelia Marti, Jose Alfredo Martinez. (2011) Evidences on three relevant obesogenes: MC4R, FTO and PPARγ. Approaches for personalized nutrition. Molecular Nutrition & Food Research 55:1, 136-149
CrossRef47
I. Sadaf Farooqi. (2011) FTO and Obesity: The Missing Link. Cell Metabolism 13:1, 7-8
CrossRef48
A. E. Taylor, M. N. Sandeep, C. S. Janipalli, C. Giambartolomei, D. M. Evans, M. V. Kranthi Kumar, D. G. Vinay, P. Smitha, V. Gupta, M. Aruna, S. Kinra, R. M. Sullivan, L. Bowen, N. J. Timpson, G. Davey Smith, F. Dudbridge, D. Prabhakaran, Y. Ben-Shlomo, K. S. Reddy, S. Ebrahim, G. R. Chandak. (2011) Associations of FTO and MC4R Variants with Obesity Traits in Indians and the Role of Rural/Urban Environment as a Possible Effect Modifier. Journal of Obesity 2011, 1-7
CrossRef49
Seongwon Cha, Imhoi Koo, Byung L. Park, Sangkyun Jeong, Sun M. Choi, Kil S. Kim, Hyoung D. Shin, Jong Y. Kim. (2011) Genetic Effects of FTO and MC4R Polymorphisms on Body Mass in Constitutional Types. Evidence-Based Complementary and Alternative Medicine 2011, 1-7
CrossRef50
Michael Fenech, Ahmed El-Sohemy, Leah Cahill, Lynnette R. Ferguson, Tapaeru-Ariki C. French, E. Shyong Tai, John Milner, Woon-Puay Koh, Lin Xie, Michelle Zucker, Michael Buckley, Leah Cosgrove, Trevor Lockett, Kim Y.C. Fung, Richard Head. (2011) Nutrigenetics and Nutrigenomics: Viewpoints on the Current Status and Applications in Nutrition Research and Practice. Journal of Nutrigenetics and Nutrigenomics 4:2, 69-89
CrossRef51
Eleanor R Grimm, Nanette I Steinle. (2011) Genetics of eating behavior: established and emerging concepts. Nutrition Reviews 69:1, 52-60
CrossRef52
I Labayen, J R Ruiz, F B Ortega, J Dalongeville, D Jiménez-Pavón, M J Castillo, S De Henauw, M González-Gross, G Bueno, D Molnar, A Kafatos, L E Díaz, A Meirhaeghe, L A Moreno. (2011) Association between the FTO rs9939609 polymorphism and leptin in European adolescents: a possible link with energy balance control. The HELENA study. International Journal of Obesity 35:1, 66-71
CrossRef53
Felix R. Day, Ruth J.F. Loos. (2011) Developments in Obesity Genetics in the Era of Genome-Wide Association Studies. Journal of Nutrigenetics and Nutrigenomics 4:4, 222-238
CrossRef54
Robert A Scott, Mark E S Bailey, Colin N Moran, Richard H Wilson, Noriyuki Fuku, Masashi Tanaka, Athanasios Tsiokanos, Athanasios Z Jamurtas, Evangelia Grammatikaki, George Moschonis, Yannis Manios, Yannis P Pitsiladis. (2010) FTO genotype and adiposity in children: physical activity levels influence the effect of the risk genotype in adolescent males. European Journal of Human Genetics 18:12, 1339-1343
CrossRef55
Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells, Jens C Brüning, Patrick M Nolan, Frances M Ashcroft, Roger D Cox. (2010) Overexpression of Fto leads to increased food intake and results in obesity. Nature Genetics 42:12, 1086-1092
CrossRef56
Hye-Ja Lee, In kyoung Kim, Jae Heon Kang, Younjhin Ahn, Bok-Ghee Han, Jong-Young Lee, Jihyun Song. (2010) Effects of common FTO gene variants associated with BMI on dietary intake and physical activity in Koreans. Clinica Chimica Acta 411:21-22, 1716-1722
CrossRef57
Jason D. Boardman, Casey L. Blalock, Robin P. Corley, Michael C. Stallings, Benjamin W. Domingue, Matthew B. McQueen, Thomas J. Crowley, John K. Hewitt, Ying Lu, Samuel H. Field. (2010) Ethnicity, Body Mass, and Genome-Wide Data. Biodemography and Social Biology 56:2, 123-136
CrossRef58
C Holzapfel, H Grallert, C Huth, S Wahl, B Fischer, A Döring, I M Rückert, A Hinney, J Hebebrand, H-E Wichmann, H Hauner, T Illig, I M Heid. (2010) Genes and lifestyle factors in obesity: results from 12 462 subjects from MONICA/KORA. International Journal of Obesity 34:10, 1538-1545
CrossRef59
Sureka Bollepalli, Lawrence M. Dolan, Ranjan Deka, Lisa J. Martin. (2010) Association of FTO Gene Variants With Adiposity in African-American Adolescents. Obesity 18:10, 1959-1963
CrossRef60
J Bassols, A Prats-Puig, M Vázquez-Ruíz, M-M García-González, M Martínez-Pascual, P Avellí, R Martínez-Martínez, R Fàbrega, C Colomer-Virosta, P Soriano-Rodríguez, M Díaz, F de Zegher, L Ibánez, A López-Bermejo. (2010) Placental FTO expression relates to fetal growth. International Journal of Obesity 34:9, 1365-1370
CrossRef61
Marion L. Vetter, Lucy F. Faulconbridge, Victoria L. Webb, Thomas A. Wadden. (2010) Behavioral and pharmacologic therapies for obesity. Nature Reviews Endocrinology
CrossRef62
J. Shi, J. Long, Y.-T. Gao, W. Lu, Q. Cai, W. Wen, Y. Zheng, K. Yu, Y.-B. Xiang, F. B. Hu, W. Zheng, X.-O. Shu. (2010) Evaluation of Genetic Susceptibility Loci for Obesity in Chinese Women. American Journal of Epidemiology 172:3, 244-254
CrossRef63
Jaroslav A. Hubacek, Vladimír Staněk, Marie Gebauerová, Alexandra Pilipčincová, Dana Dlouhá, Rudolf Poledne, Michal Aschermann, Hana Skalická, Jana Matoušková, Andreas Kruger, Martin Pěnička, Hana Hrabáková, Josef Veselka, Petr Hájek, Věra Lánská, Věra Adámková, Jan Piťha. (2010) A FTO variant and risk of acute coronary syndrome. Clinica Chimica Acta 411:15-16, 1069-1072
CrossRef64
Miriam B. Vos, Jean Welsh. (2010) Childhood Obesity: Update on Predisposing Factors and Prevention Strategies. Current Gastroenterology Reports 12:4, 280-287
CrossRef65
Zhifu Han, Ning Huang, Tianhui Niu, Jijie Chai. (2010) A loop matters for FTO substrate selection. Protein & Cell 1:7, 616-620
CrossRef66
Katherine A. Fawcett, Inês Barroso. (2010) The genetics of obesity: FTO leads the way. Trends in Genetics 26:6, 266-274
CrossRef67
Athanasios Papathanasopoulos, Michael Camilleri, Paula J. Carlson, Adrian Vella, Sara J. Linker Nord, Duane D. Burton, Suwebatu T. Odunsi, Alan R. Zinsmeister. (2010) A Preliminary Candidate Genotype–Intermediate Phenotype Study of Satiation and Gastric Motor Function in Obesity. Obesity 18:6, 1201-1211
CrossRef68
TUOMO RANKINEN, STEPHEN M. ROTH, MOLLY S. BRAY, RUTH LOOS, LOUIS PÉRUSSE, BERND WOLFARTH, JAMES M. HAGBERG, CLAUDE BOUCHARD. (2010) Advances in Exercise, Fitness, and Performance Genomics. Medicine & Science in Sports & Exercise 42:5, 835-846
CrossRef69
Jason C. G. Halford, Emma J. Boyland, John E. Blundell, Tim C. Kirkham, Joanne A. Harrold. (2010) Pharmacological management of appetite expression in obesity. Nature Reviews Endocrinology 6:5, 255-269
CrossRef70
John R. Speakman. (2010) FTO effect on energy demand versus food intake. Nature 464:7289, E1-E1
CrossRef71
S.N. Wulan, K.R. Westerterp, G. Plasqui. (2010) Ethnic differences in body composition and the associated metabolic profile: A comparative study between Asians and Caucasians. Maturitas 65:4, 315-319
CrossRef72
Elisabeth Wehr, Natascha Schweighofer, Reinhard Möller, Albrecht Giuliani, Thomas R. Pieber, Barbara Obermayer-Pietsch. (2010) Association of FTO gene with hyperandrogenemia and metabolic parameters in women with polycystic ovary syndrome. Metabolism 59:4, 575-580
CrossRef73
Jimmy Z Liu, Sarah E Medland, Margaret J Wright, Anjali K Henders, Andrew C Heath, Pamela A. F Madden, Alexis Duncan, Grant W Montgomery, Nicholas G Martin, Allan F McRae. (2010) Genome-Wide Association Study of Height and Body Mass Index in Australian Twin Families. Twin Research and Human Genetics 13:2, 179-193
CrossRef74
Claire Z Larter, Shiv Chitturi, Déborah Heydet, Geoffrey C Farrell. (2010) A fresh look at NASH pathogenesis. Part 1: The metabolic movers. Journal of Gastroenterology and Hepatology 25:4, 672-690
CrossRef75
Julia Fischer, Linda Koch, Christian Emmerling, Jeanette Vierkotten, Thomas Peters, Jens C. Brüning, Ulrich Rüther. (2010) Fischer et al. reply. Nature 464:7289, E2-E2
CrossRef76
Artemis P. Simopoulos. (2010) Nutrigenetics/Nutrigenomics. Annual Review of Public Health 31:1, 53-68
CrossRef77
Anke Hinney, Carla I. G. Vogel, Johannes Hebebrand. (2010) From monogenic to polygenic obesity: recent advances. European Child & Adolescent Psychiatry 19:3, 297-310
CrossRef78
Gilbert S. Omenn. (2010) Overview of the Symposium on Public Health Significance of Genomics and Eco-Genetics. Annual Review of Public Health 31:1, 1-8
CrossRef79
(2010) Migraine and Obesity: Cause or Effect?. Headache: The Journal of Head and Face Pain 50:2, 326-328
CrossRef80
R. Hardy, A. K. Wills, A. Wong, C. E. Elks, N. J. Wareham, R. J.F. Loos, D. Kuh, K. K. Ong. (2010) Life course variations in the associations between FTO and MC4R gene variants and body size. Human Molecular Genetics 19:3, 545-552
CrossRef81
G. S. Omenn. (2010) Colloquium Paper: Evolution and public health. Proceedings of the National Academy of Sciences 107:suppl_1, 1702-1709
CrossRef82
Qun Yan, Jie Hong, Weiqiong Gu, Yifei Zhang, Qiaorui Liu, Yuxia Su, Yuwen Zhang, Xiaoying Li, Bin Cui, Guang Ning. (2009) Association of the common rs9939609 variant of FTO gene with polycystic ovary syndrome in Chinese women. Endocrine 36:3, 377-382
CrossRef83
Ruth J. F. Loos. (2009) Recent progress in the genetics of common obesity. British Journal of Clinical Pharmacology 68:6, 811-829
CrossRef84
Ellen Schur, Carolyn Noonan, Janet Polivy, Jack Goldberg, Dedra Buchwald. (2009) Genetic and environmental influences on restrained eating behavior. International Journal of Eating Disorders 42:8, 765-772
CrossRef85
Stephen O’Rahilly. (2009) Human genetics illuminates the paths to metabolic disease. Nature 462:7271, 307-314
CrossRef86
Y Tabara, H Osawa, H Guo, R Kawamoto, H Onuma, I Shimizu, Y Takara, W Nishida, M Yamamoto, H Makino, K Kohara, T Miki. (2009) Prognostic significance of FTO genotype in the development of obesity in Japanese: the J-SHIPP study. International Journal of Obesity 33:11, 1243-1248
CrossRef87
M. Hallschmid, B. Schultes. (2009) Central nervous insulin resistance: a promising target in the treatment of metabolic and cognitive disorders?. Diabetologia 52:11, 2264-2269
CrossRef88
J. V. van Vliet-Ostaptchouk, M. H. Hofker, Y. T. van der Schouw, C. Wijmenga, N. C. Onland-Moret. (2009) Genetic variation in the hypothalamic pathways and its role on obesity. Obesity Reviews 10:6, 593-609
CrossRef89
K Grau, T Hansen, C Holst, A Astrup, W H M Saris, P Arner, S Rössner, I Macdonald, J Polak, J-M Oppert, D Langin, J A Martinez, O Pedersen, T I A Sørensen. (2009) Macronutrient-specific effect of FTO rs9939609 in response to a 10-week randomized hypo-energetic diet among obese Europeans. International Journal of Obesity 33:11, 1227-1234
CrossRef90
Melissa K. Crocker, Jack A. Yanovski. (2009) Pediatric Obesity: Etiology and Treatment. Endocrinology & Metabolism Clinics of North America 38:3, 525-548
CrossRef91
A. Hamann. (2009) Aktuelles zur Adipositas. Der Diabetologe 5:6, 420-431
CrossRef92
Sarah Boissel, Orit Reish, Karine Proulx, Hiroko Kawagoe-Takaki, Barbara Sedgwick, Giles S.H. Yeo, David Meyre, Christelle Golzio, Florence Molinari, Noman Kadhom, Heather C. Etchevers, Vladimir Saudek, I. Sadaf Farooqi, Philippe Froguel, Tomas Lindahl, Stephen O'Rahilly, Arnold Munnich, Laurence Colleaux. (2009) Loss-of-Function Mutation in the Dioxygenase-Encoding FTO Gene Causes Severe Growth Retardation and Multiple Malformations. The American Journal of Human Genetics 85:1, 106-111
CrossRef93
B. Benelam. (2009) Satiation, satiety and their effects on eating behaviour. Nutrition Bulletin 34:2, 126-173
CrossRef94
BM Mishra, D Bhatnagar. (2009) Nutrition and metabolism. Current Opinion in Lipidology 20:3, 252-253
CrossRef95
Julie Bienertova-Vasku, Petr Bienert, Josef Tomandl, Martin Forejt, Anna Vasku. (2009) Relation between adiponectin 45 T/G polymorphism and dietary composition in the Czech population. Diabetes Research and Clinical Practice 84:3, 329-331
CrossRef96
Herbert Tilg, Alexander R. Moschen, Arthur Kaser. (2009) Obesity and the Microbiota. Gastroenterology 136:5, 1476-1483
CrossRef97
(2009) Obesity, FTO Gene Variant, and Energy Intake in Children. New England Journal of Medicine 360:15, 1571-1572
Full Text98
Jaroslav A. Hubacek, Jan Pitha, Vera Adamkova, Vera Lanska, Rudolf Poledne. (2009) A common variant in the FTO gene is associated with body mass index in males and postmenopausal females but not in premenopausal females. Czech post-MONICA and 3PMFs studies. Clinical Chemistry and Laboratory Medicine 47:4, 387-390
CrossRef99
Leibel, Rudolph L., . (2008) Energy In, Energy Out, and the Effects of Obesity-Related Genes. New England Journal of Medicine 359:24, 2603-2604
Full Text
- Letters
