Join the 200th Anniversary Celebration

Original Article

Dicer, Drosha, and Outcomes in Patients with Ovarian Cancer

William M. Merritt, M.D., Yvonne G. Lin, M.D., Liz Y. Han, M.D., Aparna A. Kamat, M.D., Whitney A. Spannuth, M.D., Rosemarie Schmandt, Ph.D., Diana Urbauer, M.S., Len A. Pennacchio, Ph.D., Jan-Fang Cheng, Ph.D., Alpa M. Nick, M.D., Michael T. Deavers, M.D., Alexandra Mourad-Zeidan, M.S., Hua Wang, Ph.D., Peter Mueller, Ph.D., Marc E. Lenburg, Ph.D., Joe W. Gray, Ph.D., Samuel Mok, Ph.D., Michael J. Birrer, M.D., Ph.D., Gabriel Lopez-Berestein, M.D., Robert L. Coleman, M.D., Menashe Bar-Eli, Ph.D., and Anil K. Sood, M.D.

N Engl J Med 2008; 359:2641-2650December 18, 2008

Abstract

Background

We studied Dicer and Drosha, components of the RNA-interference machinery, in ovarian cancer.

Methods

We measured messenger RNA (mRNA) levels of Dicer and Drosha in specimens of invasive epithelial ovarian cancer from 111 patients, using a quantitative reverse-transcriptase–polymerase-chain-reaction assay, and compared the results with clinical outcomes. Validation was performed with the use of published microarray data from cohorts of patients with ovarian, breast, and lung cancer. Mutational analyses of genomic DNA from the Dicer and Drosha genes were performed in a subgroup of ovarian-cancer specimens. Dicer-dependent functional assays were performed by means of in vitro transfection with small interfering RNA (siRNA) and short hairpin RNA (shRNA).

Results

Levels of Dicer and Drosha mRNA correlated with the levels of expression of the corresponding protein and were decreased in 60% and 51% of ovarian-cancer specimens, respectively. Low Dicer expression was significantly associated with advanced tumor stage (P=0.007), and low Drosha expression with suboptimal surgical cytoreduction (P=0.02). Cancer specimens with both high Dicer expression and high Drosha expression were associated with increased median survival (>11 years, vs. 2.66 years for other subgroups; P<0.001). We found three independent predictors of reduced disease-specific survival in multivariate analyses: low Dicer expression (hazard ratio, 2.10; P=0.02), high-grade histologic features (hazard ratio, 2.46; P=0.03), and poor response to chemotherapy (hazard ratio, 3.95; P<0.001). Poor clinical outcomes among patients with low Dicer expression were validated in additional cohorts of patients. Rare missense mutations were found in the Dicer and Drosha genes, but their presence or absence did not correlate with the level of expression. Functional assays indicated that gene silencing with shRNA, but not siRNA, may be impaired in cells with low Dicer expression.

Conclusions

Our findings indicate that levels of Dicer and Drosha mRNA in ovarian-cancer cells have associations with outcomes in patients with ovarian cancer.

Media in This Article

Figure 1The RNA-Interference Cascade in Humans.
Figure 2Kaplan–Meier Survival Curves for Patients According to Tumor Expression of Dicer and Drosha.
Article

The discovery that gene expression can be altered through RNA interference1 has stimulated research on the role of RNA interference in the development of cancer. Targeting specific genes by RNA-interference molecules allows for the identification of regulators of angiogenic, proliferative, and survival pathways in cancer cells. Furthermore, RNA-interference molecules that silence specific genes are being tested in preclinical studies as a treatment for cancer.2,3

Regulation of gene expression through RNA interference occurs by means of microRNA (miRNA) or small interfering RNA (siRNA) (Figure 1Figure 1The RNA-Interference Cascade in Humans.). In the nucleus, endogenous double-stranded RNA segments are cut into short, hairpin-shaped double-stranded RNA precursor structures (of approximately 60 to 70 nucleotides each)4,5 by the RNase III enzyme Drosha. These precursors move to the cytoplasm, where Dicer, also an RNase III enzyme, cleaves them into mature double-stranded RNA fragments (miRNA), 19 to 21 nucleotides each.6 Translational repression or degradation of messenger RNA (mRNA) occurs when miRNA binds to the RNA-induced silencing complex (RISC).7,8 The siRNA production occurs in a similar manner, although processing by Drosha is not required.9

Alterations of miRNAs in human cancers have been reported, but the regulation of these molecules is unclear. In ovarian tumors, decreased expression of a substantial proportion of miRNAs has been found,10-13 but the downstream effects of this decrease are not known. Nevertheless, these findings support the hypothesis that miRNAs have an underlying role in cancer progression.10-12 We investigated whether altered levels of Dicer and Drosha mRNA, components of the RNA-interference machinery, are associated with clinical outcome in ovarian cancer.

Methods

Cell Lines

The derivation, sources, and maintenance of the ovarian-cancer cell lines used in this study have been reported previously.14 The lines were HeyA8, SKOV3ip1, A2780-Par, IGROV, EG, 222, OVCAR3, and OVCAR420 (for sources, see the Supplementary Appendix, available with the full text of this article at www.nejm.org).

Tumor Samples

After the study was approved by the Institutional Review Board and written informed consent was obtained from the patients for the use of clinical specimens for research, we obtained 111 specimens of invasive epithelial ovarian cancer from the M.D. Anderson Cancer Center Tumor Bank and the Brigham and Women's Gynecologic Oncology Tumor Bank. Before collection of these samples, 11 benign ovarian epithelial samples were obtained as controls from microdissected paraffin-embedded specimens or epithelial scrapings taken after surgical removal.

Data on clinical outcome were obtained from patients' records. Responses to initial chemotherapy were recorded as either sensitive (if there was normalization of the CA-125 level, a negative finding on second-look laparotomy, or both within 6 months after completion of initial chemotherapy) or refractory or resistant (if there was progression or recurrence within 6 months after completion of initial chemotherapy).

Dicer and Drosha mRNA

A quantitative reverse-transcriptase–polymerase-chain-reaction (RT-PCR) assay was used to measure Dicer and Drosha mRNA in RNA extracted from ovarian cell lines and ovarian tumors. Protein expression was examined in all cell lines by means of Western blots (see the Supplementary Appendix) and in ovarian tumors by means of immunohistochemical methods. Quantitative RT-PCR was performed with the use of the TaqMan gene-expression assay kit (Applied Biosystems), with either Dicer, Drosha, or 18s RNA primers (Applied Biosystems), as previously described.15,16 The final mRNA levels were converted to ratios of decreased expression (≤1) or increased expression (>1) relative to levels of Dicer and Drosha mRNA in normal ovarian epithelium.

Immunohistochemical Analysis

Slides were deparaffinized and rehydrated with sequential washes in xylene and ethanol. Antigen retrieval was performed in a pressure cooker at 90°C with the use of Borg Decloaker solution (Biocare Medical). Slides were then incubated with primary antibodies against Dicer (1:100 dilution, Sigma) or Drosha (1:200, Abcam) overnight, followed by incubation with a mouse–rabbit–horseradish peroxidase polymer (MR-HRP, Biocare Medical) and 3,3′-diaminobenzidine substrate (Phoenix Biotechnologies). The stained slides were scored by two investigators who were unaware of the RT-PCR results, on the basis of the histochemical score (with a score of >100 defined as high expression and ≤100, low expression), according to the method described by McCarty et al.,17,18 which considers both the intensity of staining and the percentage of cells stained.

Validation

The relation between levels of Dicer and Drosha mRNA and survival among patients with ovarian cancer (GEO accession number, GSE314919), breast cancer (ArrayExpress accession number, E-TABM-15820; and GEO accession numbers, GSE145621 and GSE492222), and lung cancer (GEO accession number, GSE314119) was examined in existing microarray data sets of samples that had been profiled with an Affymetrix GeneChip assay (either HG-U133A or HG U133 Plus 2.0). Probe sets 212888_at and 218269_at were used to measure Dicer and Drosha expression, respectively.

Mutational Analysis

Genomic DNA extracted from four ovarian cell lines and 37 previously examined ovarian tumors was sequenced for the Dicer gene DICER1 (NM_177438) and the Drosha gene RNASEN (NM_013235) coding exons and their flanking splice sites to assess for potential mutations, as previously described.23 All sequence variants were verified through manual inspection of the chromatograms.

Transfection with Small Interfering and Short Hairpin RNA

The anti–galectin-3 oligonucleotide (target sequence, GTACAATCATCGGGTTAAATT; Dharmacon) and control nontargeting oligonucleotides (target sequence, UUCUCCGAACGUGUCACGU; Qiagen) were used for transfection of siRNA and short hairpin RNA (shRNA). The shRNA was prepared using a lentivirus gene-transfer vector (containing green fluorescent protein), as previously described24; shRNA induces stable genetic silencing.

For siRNA and shRNA transfections, 2×105 cells per well were plated and 5 μg of galectin-3 or nontargeting siRNA was added according to the manufacturer's protocol. Transfection was considered successful if a transfection rate of more than 90% was achieved. Gene silencing was assessed by means of Western blot analysis.

Statistical Analysis

To determine the distribution of Dicer and Drosha levels around cutoff points, histograms were created on a log2 scale of the expression ratio and tested for normality with the Kolmogorov–Smirnov test. The Wilcoxon test was used to compare rank distributions of continuous variables not conforming to the assumptions of normality. Contingency tables and Fisher's exact test were used to evaluate the relationship between death and categorical variables. Kaplan–Meier plots were constructed and a log-rank test was used to determine differences among survival curves according to Dicer and Drosha expression level. Multivariate analyses were performed with the use of a Cox proportional-hazards model to examine the effects of Dicer and Drosha expression on death from disease while adjusting for other covariates. Bonferroni corrections were used in analyses involving multiple comparisons.

The relation between the expression of the Dicer and Drosha genes and survival was explored in microarray data sets by separating the cases from each cohort into a group with a high median level of expression and a group with a low median level of expression. The statistical significance of the Cox hazard ratio was assessed by means of Wald's test (using the “survival” package [version 2.34] in the R language for statistical computing [version 2.6.1]).25 A kappa statistic was calculated to assess the agreement between RT-PCR results and histochemical scores. All P values were two-sided, and a P value of less than 0.05 was considered to indicate statistical significance.

Results

Dicer and Drosha Expression

We examined 111 ovarian-cancer specimens and 11 benign epithelial-ovarian specimens by using quantitative RT-PCR for mRNA and calculated the ratios of the expression in the tumors and the expression in the benign specimens. The distribution of Dicer mRNA levels in the ovarian-cancer specimens was bimodal (P=0.002 by the Kolmogorov–Smirnov test for normality) with two peaks in the ratio (0.43 and 4.25). The division between these two subpopulations corresponded to a Dicer mRNA ratio of 1.20. Levels of Drosha mRNA in cancer specimens followed a normal distribution (P=0.15 by the Kolmogorov–Smirnov test for normality), with a peak corresponding to a median ratio of 1.00. These findings support our decision to use 1 as the cutoff value for high and low Dicer and Drosha mRNA levels in subsequent analyses.

Levels of mRNA varied among cancer specimens; 60% had decreased Dicer mRNA and 51% had decreased Drosha mRNA (Table 1 in the Supplementary Appendix). In 39% of specimens, there were decreased levels of both Dicer and Drosha mRNA. The median ratio of Dicer expression in cancer specimens with decreased Dicer mRNA levels was 0.27 (range, 0.01 to 1.00; three specimens with undetectable levels) and in those with decreased Drosha mRNA levels was 0.52 (range, 0.02 to 1.00; one specimen with undetectable levels). Specimens with increased mRNA levels had a median ratio for Dicer of 3.38 (range, 1.13 to 10.41) and a median ratio for Drosha of 1.98 (range, 1.02 to 18.85).

To determine whether mRNA levels reflected protein expression, a subgroup of 32 ovarian tumors was also examined through immunohistochemical methods (Figure 1 in the Supplementary Appendix). The histochemical score was in agreement with the quantitative RT-PCR results for both Dicer (kappa=1.00; 95% confidence interval [CI], 1.00 to 1.00) and Drosha (kappa=0.86; 95% CI, 0.68 to 1.00).

We also examined Dicer and Drosha mRNA levels in a panel of ovarian-cancer cell lines. As compared with nontransformed ovarian surface-epithelial cells, 50% of ovarian-cancer cell lines had reduced levels of both Dicer mRNA (to between 50 to 8% of the control level) and Drosha mRNA (to between 91 and 7% of the control level). Similar to ovarian tumors, the ovarian-cancer cell lines had mRNA levels that were concordant with protein levels (Figure 2 in the Supplementary Appendix).

Clinical Associations

Table 1Table 1Baseline Characteristics of the 111 Patients with Invasive Epithelial Ovarian Carcinoma. lists the baseline characteristics of all 111 patients (mean age, 62.5 years) with invasive epithelial ovarian carcinoma. Most of these patients had advanced-stage, poorly differentiated tumors, and 77.5% had undergone optimal surgical reduction of the primary tumor (residual tumor, ≤1 cm in diameter). Most patients (53.2%) had tumors that were sensitive to initial chemotherapy, whereas 33.3% had refractory or resistant disease (with data missing for 13.5% of patients). In univariate analyses, neither Dicer nor Drosha mRNA levels were significantly associated with age, tumor grade, or response to chemotherapy (Table 2Table 2Correlation of Clinical and Pathological Features with Drosha and Dicer Messenger RNA (mRNA) Levels in the 111 Patients with Invasive Epithelial Ovarian Carcinoma.). Low Dicer mRNA levels were, however, significantly associated with advanced tumor stage (P=0.007), as were low Drosha mRNA levels with suboptimal cytoreductive surgery (P=0.02).

The median overall survival was substantially reduced among women whose tumor had low levels of Dicer mRNA (2.33 years, vs. 9.25 years for high levels; P<0.001) and Drosha mRNA (2.74 years, vs. 7.92 years for high levels; P=0.008) (Figure 2Figure 2Kaplan–Meier Survival Curves for Patients According to Tumor Expression of Dicer and Drosha.). As compared with other subgroups (tumors with low Dicer and low Drosha expression, high Dicer and low Drosha expression, and low Dicer and high Drosha expression), tumors with high levels of both Dicer and Drosha mRNA were associated with an increased median survival (>11 years [median survival not reached], vs. 2.66 years; P<0.001) (Figure 3 in the Supplementary Appendix). In univariate analyses, death from ovarian cancer was associated with low levels of both Dicer and Drosha mRNA (P=0.01 and P=0.007, respectively).

In multivariate analyses (including age, tumor stage and grade, Dicer and Drosha mRNA levels, optimal or suboptimal cytoreduction, and response to initial chemotherapy), poorly differentiated tumors (P=0.03) and a resistant or refractory chemoresponse (P<0.001) were associated with poor survival (Table 3Table 3Results of Multivariate Analyses of Independent Prognostic Factors in Patients with Invasive Epithelial Ovarian Carcinoma.). A decreased Dicer mRNA level was an indicator of a poor prognosis (hazard ratio, 2.10; 95% CI, 1.15 to 3.85; P=0.02). A low Drosha mRNA level, however, was not an independent predictor of survival (hazard ratio, 1.22; 95% CI, 0.69 to 2.16; P=0.50). When paired in an interaction model, low Dicer and low Drosha mRNA levels had a greater association with decreased survival (hazard ratio, 4.00; 95% CI, 1.82 to 9.09; P<0.001) than either one alone.

To validate our findings, we used previously reported microarray data to compare expression of Dicer and Drosha genes with survival in 132 patients with ovarian cancer.19 Similar to our initial findings, increased survival was associated with high expression of Drosha mRNA (hazard ratio, 0.55; 95% CI, 0.34 to 0.89; P=0.02) and Dicer mRNA (hazard ratio, 0.53; 95% CI, 0.33 to 0.85; P=0.008) (Figure 2B).

To examine whether this association also holds for other tumors, we measured the relative expression ratios for Dicer and Drosha in microarrays with cohorts of 91 patients with lung cancer19 and 129 patients with breast cancer.20 Increased survival in the lung-cancer cohort was associated with high levels of Dicer mRNA (hazard ratio, 0.43; 95% CI, 0.23 to 0.80; P=0.008) but not Drosha mRNA (hazard ratio, 1.34; 95% CI, 0.74 to 2.40; P=0.33) (Figure 2C). Similarly, increased disease-free survival in the breast-cancer cohort was associated with high levels of Dicer mRNA (hazard ratio, 0.32; 95% CI, 0.14 to 0.72; P=0.006) but not of Drosha mRNA (hazard ratio, 0.93; 95% CI, 0.45 to 1.92; P=0.84), as was overall survival (data not shown). A relationship between high Dicer mRNA levels and increased disease-free survival was also found from microarray analysis of specimens obtained from two other cohorts of patients with breast cancer: one with 159 patients21 (hazard ratio, 0.33; 95% CI, 0.17 to 0.66; P=0.002) (Figure 2D) and one with 249 patients22 (hazard ratio, 0.64; 95% CI, 0.42 to 0.97; P=0.04) (Figure 2E).

Mutations of Dicer and Drosha

We next investigated whether the variable levels of Dicer and Drosha mRNA could be explained by the presence of mutations. Initial studies, performed in cell lines with high or low gene expression, revealed several missense mutations for both genes and one splice-site mutation for the Drosha gene (see the Supplementary Appendix). Next, genomic DNA from 37 ovarian tumors previously analyzed for Dicer and Drosha mRNA was examined for the Dicer and Drosha gene mutations. For the Dicer gene, two missense mutations were discovered in two tumors. Similarly, two missense mutations were revealed for the Drosha gene. These mutations were not, however, associated with alterations in levels of mRNA of Dicer or Drosha.

Functional Analysis of Decreased Dicer Expression

To elucidate the functional consequences of low Dicer mRNA levels, we compared the silencing of a constitutively expressed gene, the galectin-3 gene, between ovarian-cancer cell lines with high Dicer expression and those with low Dicer expression. Specifically, we compared shRNA constructs (exhibiting stable gene silencing) with the shorter siRNA fragments (which have transient gene silencing) (Figure 3Figure 3Transfection of Small Interfering RNA (siRNA) and Short Hairpin RNA (shRNA) Targeting Galectin-3 in Ovarian-Cancer Cell Lines with Low Dicer Expression and Those with High Dicer Expression.). As compared with control (nontargeting) constructs, transfection of siRNA reduced galectin-3 levels in the cell lines with low Dicer expression: HeyA8, which showed a reduction by 78% from the control level, and SKOV3ip1, reduced by 95% from the control level. In contrast, poor silencing was noted in these cells with shRNA (8% and 4%, respectively). In the OVCAR3 and 222 cells, which have high Dicer expression, silencing of galectin-3 by 62% to 73% as compared with control levels was observed with both siRNA and shRNA constructs.

Discussion

We found that Dicer and Drosha mRNA expression is variable among invasive epithelial ovarian cancer specimens and in ovarian-cancer cell lines and that they are significantly associated with survival, indicating that levels of mRNA of Dicer and Drosha in ovarian-cancer cells are clinically relevant. The association was validated in independent clinical data sets for ovarian cancer. We also sought mutations in the genomic sequences of the Dicer and Drosha genes in a cohort of patients with variable gene expression and did not find a consistent trend. Furthermore, the results of our functional assays indicate that cells with low Dicer expression could not effectively silence genes when synthetic shRNA constructs were transfected.

The production of mature endogenous interfering RNA involves a cascade of events that are inextricably linked to the functions of Dicer and Drosha. For example, Lee et al.5 demonstrated that in cells with silenced Dicer or Drosha expression, precursor and mature miRNA sequences were reduced. Loss of Dicer in mice disrupts embryonic stem-cell differentiation and is lethal during early development.26 Low levels of Dicer mRNA also affect normal cellular development and immune responses in preclinical models.27-29 Furthermore, abnormalities in the copy number of DNA of the Dicer gene and the argonaute 2 gene (a component of the RNA-induced silencing complex) have been described in human melanoma, breast, and ovarian cancers.13 It is therefore possible that deregulated miRNA expression, observed in several types of tumor,13 is secondary to defective RNA silencing machinery. Decreased Dicer mRNA has also been associated with decreased survival in patients with non–small-cell lung cancer.30 In addition, Dicer expression appears to be up-regulated in noninvasive precursors of invasive lung adenocarcinoma.31

Some findings in other tumor types are inconsistent with our findings. High Dicer expression and high Drosha expression were correlated with poor prognostic factors in prostate cancer and esophageal carcinoma.32,33 Furthermore, reduction of Drosha expression by means of siRNA reduced cellular proliferation has been reported in esophageal-cancer cell lines.33 There are several plausible explanations for the divergent expression patterns of Dicer and Drosha among different solid tumors and how they relate to clinical and pathologic variables. Direct interactions with other components of the RNA-interference cascade could result in compensatory alterations of Dicer or Drosha expression in the presence of mutated cofactors such as genes for the DiGeorge syndrome critical region gene 8 (DGCR8), exportin 5 (XPO5), and argonaute 2 (AGO2).31,34-36 In addition, miRNA could have varying regulatory effects independent of alterations in the RNA-interference processing machinery.37 In support of this contention is the association of altered Dicer protein expression (both overexpression and underexpression relative to controls) in mucoepidermoid carcinomas of the upper aerodigestive tract with overall survival.38

Despite growing evidence that Dicer and Drosha mRNA levels vary among tumor types, the regulation of these genes is unclear. Dicer gene mutations have been found in Caenorhabditis elegans 39 and in humans, and deletions of the Dicer gene locus were detected in some precancerous and invasive lung adenocarcinomas.31 Our mutational analyses showed that alterations of genomic DNA probably do not account for the variability in Dicer and Drosha levels. We did find that single-nucleotide mutations can occur in both genes; however, the functional role of such mutations remains unclear. In breast-cancer cell lines, there are two forms of Dicer, due to alternative splicing mechanisms, which appear to affect the stability of the Dicer protein.40 DNA methylation of the Dicer gene was not found in a small subgroup of lung-cancer specimens.30 As the function of miRNAs in the genesis of tumors becomes clearer, further studies will be needed to elucidate the regulation and stability of the RNA-interference machinery.

Our findings have implications for the development of treatments for ovarian cancer that are based on RNA interference. Highlighting this point is the differential targeting efficiency of a constitutively expressed gene that we found through a functional assay of gene silencing. The shRNA that is complementary to the target gene has been tested in animal models and found to induce robust gene silencing. However, one study showed increased mortality among mice after delivery of multiple shRNA sequences.41 These results and our data suggest that miRNA processing may be hindered in tumors with low Dicer and low Drosha expression, which could lead to a poor clinical outcome.

Supported by grants from the National Cancer Institute (T32 Training Grant CA101642), the Ovarian Cancer Research Fund Program Project Development Grant, the University of Texas M.D. Anderson Cancer Center Ovarian Cancer Specialized Program of Research Excellence (P50 CA083639), the National Institutes of Health (CA110793, CA109298, P50 CA58207, and U54 CA112970), the Gynecologic Cancer Foundation, the Zarrow Foundation, the Betty Ann Asche Murray Distinguished Professorship, the Marcus Foundation, and the U.S. Department of Energy, Office of Science, Office of Biological and Environmental Research (contract DE-AC03-76SF00098).

Dr. Gray reports receiving consulting fees from Agendia and Sirna. No other potential conflict of interest relevant to this article was reported.

This article (10.1056/NEJMoa0803785) was updated on November 3, 2010, at NEJM.org.

Source Information

From the University of Texas M.D. Anderson Cancer Center, Houston (W.M.M., Y.G.L., L.Y.H., A.A.K., W.A.S., R.S., D.U., A.M.N., M.T.D., A.M.-Z., H.W., P.M., G.L.-B., R.L.C., M.B.-E., A.K.S.); Lawrence Berkeley National Laboratory, Berkeley, CA (L.A.P., J.-F.C., J.W.G.); the U.S. Department of Energy Joint Genome Institute, Walnut Creek, CA (L.A.P., J.-F.C.); Boston University School of Medicine (M.E.L.) and Brigham and Women's Hospital (S.M.) — both in Boston; and the Center for Cancer Research, Bethesda, MD (M.J.B.).

Address reprint requests to Dr. Sood at the Departments of Gynecologic Oncology and Cancer Biology, M.D. Anderson Cancer Center, Unit 1362, P.O. Box 301439, Houston, TX 77230-1439, or at .

References

References

  1. 1

    Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998;391:806-811
    CrossRef | Web of Science | Medline

  2. 2

    Halder J, Kamat AA, Landen CN Jr, et al. Focal adhesion kinase targeting using in vivo short interfering RNA delivery in neutral liposomes for ovarian carcinoma therapy. Clin Cancer Res 2006;12:4916-4924
    CrossRef | Web of Science | Medline

  3. 3

    Landen CN Jr, Chavez-Reyes A, Bucana C, et al. Therapeutic EphA2 gene targeting in vivo using neutral liposomal small interfering RNA delivery. Cancer Res 2005;65:6910-6918
    CrossRef | Web of Science | Medline

  4. 4

    Hannon GJ. RNA interference. Nature 2002;418:244-251
    CrossRef | Web of Science | Medline

  5. 5

    Lee Y, Ahn C, Han J, et al. The nuclear RNase III Drosha initiates microRNA processing. Nature 2003;425:415-419
    CrossRef | Web of Science | Medline

  6. 6

    Bernstein E, Caudy AA, Hammond SM, Hannon GJ. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 2001;409:363-366
    CrossRef | Web of Science | Medline

  7. 7

    Sevignani C, Calin GA, Siracusa LD, Croce CM. Mammalian microRNAs: a small world for fine-tuning gene expression. Mamm Genome 2006;17:189-202
    CrossRef | Web of Science | Medline

  8. 8

    Zhang B, Wang Q, Pan X. MicroRNAs and their regulatory roles in animals and plants. J Cell Physiol 2007;210:279-289
    CrossRef | Web of Science | Medline

  9. 9

    McManus MT, Sharp PA. Gene silencing in mammals by small interfering RNAs. Nat Rev Genet 2002;3:737-747
    CrossRef | Web of Science | Medline

  10. 10

    Croce CM, Calin GA. miRNAs, cancer, and stem cell division. Cell 2005;122:6-7
    CrossRef | Web of Science | Medline

  11. 11

    McManus MT. MicroRNAs and cancer. Semin Cancer Biol 2003;13:253-258
    CrossRef | Web of Science | Medline

  12. 12

    Zhang L, Coukos G. MicroRNAs: a new insight into cancer genome. Cell Cycle 2006;5:2216-2219
    CrossRef | Web of Science | Medline

  13. 13

    Zhang L, Huang J, Yang N, et al. MicroRNAs exhibit high frequency genomic alterations in human cancer. Proc Natl Acad Sci U S A 2006;103:9136-9141
    CrossRef | Web of Science | Medline

  14. 14

    Sood AK, Seftor EA, Fletcher MS, et al. Molecular determinants of ovarian cancer plasticity. Am J Pathol 2001;158:1279-1288
    CrossRef | Web of Science | Medline

  15. 15

    Thaker PH, Han LY, Kamat AA, et al. Chronic stress promotes tumor growth and angiogenesis in a mouse model of ovarian carcinoma. Nat Med 2006;12:939-944
    CrossRef | Web of Science | Medline

  16. 16

    Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25:402-408
    CrossRef | Web of Science | Medline

  17. 17

    McCarty KS Jr, Miller LS, Cox EB, Konrath J, McCarty KS. Estrogen receptor analyses: correlation of biochemical and immunohistochemical methods using monoclonal antireceptor antibodies. Arch Pathol Lab Med 1985;109:716-721
    Web of Science | Medline

  18. 18

    Singh M, Zaino RJ, Filiaci VJ, Leslie KK. Relationship of estrogen and progesterone receptors to clinical outcome in metastatic endometrial carcinoma: a Gynecologic Oncology Group study. Gynecol Oncol 2007;106:325-333
    CrossRef | Web of Science | Medline

  19. 19

    Bild AH, Yao G, Chang JT, et al. Oncogenic pathway signatures in human cancers as a guide to targeted therapies. Nature 2006;439:353-357
    CrossRef | Web of Science | Medline

  20. 20

    Chin K, DeVries S, Fridlyand J, et al. Genomic and transcriptional aberrations linked to breast cancer pathophysiologies. Cancer Cell 2006;10:529-541
    CrossRef | Web of Science | Medline

  21. 21

    Pawitan Y, Bjohle J, Amler L, et al. Gene expression profiling spares early breast cancer patients from adjuvant therapy: derived and validated in two population-based cohorts. Breast Cancer Res 2005;7:R953-R964
    CrossRef | Web of Science | Medline

  22. 22

    Ivshina AV, George J, Senko O, et al. Genetic reclassification of histologic grade delineates new clinical subtypes of breast cancer. Cancer Res 2006;66:10292-10301
    CrossRef | Web of Science | Medline

  23. 23

    Ahituv N, Kavaslar N, Schackwitz W, et al. Medical sequencing at the extremes of human body mass. Am J Hum Genet 2007;80:779-791
    CrossRef | Web of Science | Medline

  24. 24

    Wiznerowicz M, Trono D. Conditional suppression of cellular genes: lentivirus vector-mediated drug-inducible RNA interference. J Virol 2003;77:8957-8961
    CrossRef | Web of Science | Medline

  25. 25

    The R Foundation for Statistical Computing. R: a language and environment for statistical computing. Vienna: The R Foundation, 2007. (Accessed November 24, 2008, at http://www.R-project.org.)

  26. 26

    Bernstein E, Kim SY, Carmell MA, et al. Dicer is essential for mouse development. Nat Genet 2003;35:215-217[Erratum, Nat Genet 2008;35:287.]
    CrossRef | Web of Science | Medline

  27. 27

    Cobb BS, Hertweck A, Smith J, et al. A role for Dicer in immune regulation. J Exp Med 2006;203:2519-2527
    CrossRef | Web of Science | Medline

  28. 28

    Damiani D, Alexander JJ, O'Rourke JR, et al. Dicer inactivation leads to progressive functional and structural degeneration of the mouse retina. J Neurosci 2008;28:4878-4887
    CrossRef | Web of Science | Medline

  29. 29

    Kobayashi T, Lu J, Cobb BS, et al. Dicer-dependent pathways regulate chondrocyte proliferation and differentiation. Proc Natl Acad Sci U S A 2008;105:1949-1954
    CrossRef | Web of Science | Medline

  30. 30

    Karube Y, Tanaka H, Osada H, et al. Reduced expression of Dicer associated with poor prognosis in lung cancer patients. Cancer Sci 2005;96:111-115
    CrossRef | Web of Science | Medline

  31. 31

    Chiosea S, Jelezcova E, Chandran U, et al. Overexpression of Dicer in precursor lesions of lung adenocarcinoma. Cancer Res 2007;67:2345-2350
    CrossRef | Web of Science | Medline

  32. 32

    Chiosea S, Jelezcova E, Chandran U, et al. Up-regulation of Dicer, a component of the microRNA machinery, in prostate adenocarcinoma. Am J Pathol 2006;169:1812-1820
    CrossRef | Web of Science | Medline

  33. 33

    Sugito N, Ishiguro H, Kuwabara Y, et al. RNASEN regulates cell proliferation and affects survival in esophageal cancer patients. Clin Cancer Res 2006;12:7322-7328
    CrossRef | Web of Science | Medline

  34. 34

    Qi HH, Ongusaha PP, Myllyharju J, et al. Prolyl 4-hydroxylation regulates Argonaute 2 stability. Nature 2008;455:421-424
    CrossRef | Web of Science | Medline

  35. 35

    Schmitter D, Filkowski J, Sewer A, et al. Effects of Dicer and Argonaute down-regulation on mRNA levels in human HEK293 cells. Nucleic Acids Res 2006;34:4801-4815
    CrossRef | Web of Science | Medline

  36. 36

    Yi R, Qin Y, Macara IG, Cullen BR. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev 2003;17:3011-3016
    CrossRef | Web of Science | Medline

  37. 37

    Wiemer EA. The role of microRNAs in cancer: no small matter. Eur J Cancer 2007;43:1529-1544
    CrossRef | Web of Science | Medline

  38. 38

    Chiosea SI, Barnes EL, Lai SY, et al. Mucoepidermoid carcinoma of upper aerodigestive tract: clinicopathologic study of 78 cases with immunohistochemical analysis of Dicer expression. Virchows Arch 2008;452:629-635
    CrossRef | Web of Science | Medline

  39. 39

    Welker NC, Habig JW, Bass BL. Genes misregulated in C. elegans deficient in Dicer, RDE-4, or RDE-1 are enriched for innate immunity genes. RNA 2007;13:1090-1102
    CrossRef | Web of Science | Medline

  40. 40

    Irvin-Wilson CV, Chaudhuri G. Alternative initiation and splicing in dicer gene expression in human breast cells. Breast Cancer Res 2005;7:R563-R569
    CrossRef | Web of Science | Medline

  41. 41

    Grimm D, Streetz KL, Jopling CL, et al. Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature 2006;441:537-541
    CrossRef | Web of Science | Medline

Citing Articles (103)

Citing Articles

  1. 1

    Wei Liu, Chang Liu, Jingxi Zhu, Pengcheng Shu, Bin Yin, Yanhua Gong, Boqin Qiang, Jiangang Yuan, Xiaozhong Peng. (2012) MicroRNA-16 targets amyloid precursor protein to potentially modulate Alzheimer's-associated pathogenesis in SAMP8 mice. Neurobiology of Aging 33:3, 522-534
    CrossRef

  2. 2

    Qiuwei Pan, Luc J.W. van der Laan, Harry L.A. Janssen, Maikel P. Peppelenbosch. (2012) A dynamic perspective of RNAi library development. Trends in Biotechnology
    CrossRef

  3. 3

    Dionysios J. Papachristou, Uma N. M. Rao, Angeliki Korpetinou, Efstathia Giannopoulou, Emilia Sklirou, Vasileios Kontogeorgakos, Haralabos P. Kalofonos. (2012) Prognostic Significance of Dicer Cellular Levels in Soft Tissue Sarcomas. Cancer Investigation 30:2, 172-179
    CrossRef

  4. 4

    Heravi-Moussavi, Alireza, Anglesio, Michael S., Cheng, S.-W. Grace, Senz, Janine, Yang, Winnie, Prentice, Leah, Fejes, Anthony P., Chow, Christine, Tone, Alicia, Kalloger, Steve E., Hamel, Nancy, Roth, Andrew, Ha, Gavin, Wan, Adrian N.C., Maines-Bandiera, Sarah, Salamanca, Clara, Pasini, Barbara, Clarke, Blaise A., Lee, Anna F., Lee, Cheng-Han, Zhao, Chengquan, Young, Robert H., Aparicio, Samuel A., Sorensen, Poul H.B., Woo, Michelle M.M., Boyd, Niki, Jones, Steven J.M., Hirst, Martin, Marra, Marco A., Gilks, Blake, Shah, Sohrab P., Foulkes, William D., Morin, Gregg B., Huntsman, David G., . (2012) Recurrent Somatic DICER1 Mutations in Nonepithelial Ovarian Cancers. New England Journal of Medicine 366:3, 234-242
    Full Text

  5. 5

    P. A. Da Costa Martins, L. J. De Windt. (2012) MicroRNAs in Control of Cardiac Hypertrophy. Cardiovascular Research
    CrossRef

  6. 6

    Zhanjun Guo, Chensi Wu, Xiaoling Wang, Cuiju Wang, Ruixing Zhang, Baoen Shan. (2012) A polymorphism at the miR-502 binding site in the 3′-untranslated region of the histone methyltransferase SET8 is associated with hepatocellular carcinoma outcome. International Journal of Cancern/a-n/a
    CrossRef

  7. 7

    Xiaofang Guo, Qianjin Liao, Pan Chen, Xiayu Li, Wei Xiong, Jian Ma, Xiaoling Li, Zhaohui Luo, Hailin Tang, Min Deng, Yin Zheng, Rong Wang, Wenling Zhang, Guiyuan Li. (2012) The microRNA-processing enzymes: Drosha and Dicer can predict prognosis of nasopharyngeal carcinoma. Journal of Cancer Research and Clinical Oncology 138:1, 49-56
    CrossRef

  8. 8

    Josep M. Mercader, Juan R. González, Juan José Lozano, Mads Bak, Sakari Kauppinen, Lauro Sumoy, Mara Dierssen, Fernando Fernández-Aranda, Joana Visa, Mònica Gratacòs, Xavier Estivill. (2012) Aberrant brain microRNA target and miRISC gene expression in the anx/anx anorexia mouse model. Gene
    CrossRef

  9. 9

    Guillermo Armaiz-Pena, Bulent Ozpolat, Anil Sood, Gabriel Lopez-Berestein. 2011. Nanomedicine-based use of siRNA in Cancer. .
    CrossRef

  10. 10

    Andrew D. Cutting, Stephanie C. Bannister, Tim J. Doran, Andrew H. Sinclair, Mark V. L. Tizard, Craig A. Smith. (2011) The potential role of microRNAs in regulating gonadal sex differentiation in the chicken embryo. Chromosome Research
    CrossRef

  11. 11

    Patrick J. Halvey, Bing Zhang, Robert J. Coffey, Daniel C. Liebler, Robbert J. C. Slebos. (2011) Proteomic Consequences of a Single Gene Mutation in a Colorectal Cancer Model. Journal of Proteome Research111213161646000
    CrossRef

  12. 12

    Hyuna Sung, Kyoung-Mu Lee, Ji-Yeob Choi, Sohee Han, Ji-Young Lee, Lian Li, Sue K. Park, Keun-Young Yoo, Dong-Young Noh, Sei-Hyun Ahn, Daehee Kang. (2011) Common genetic polymorphisms of microRNA biogenesis pathway genes and risk of breast cancer: a case–control study in Korea. Breast Cancer Research and Treatment 130:3, 939-951
    CrossRef

  13. 13

    Dan-Avi Landau, Frank J. Slack. (2011) MicroRNAs in Mutagenesis, Genomic Instability, and DNA Repair. Seminars in Oncology 38:6, 743-751
    CrossRef

  14. 14

    Man Lung Yeung, Kuan-Teh Jeang. (2011) MicroRNAs and Cancer Therapeutics. Pharmaceutical Research 28:12, 3043-3049
    CrossRef

  15. 15

    Julia Valencak, Katharina Schmid, Franz Trautinger, Werner Wallnöfer, Leonhard Muellauer, Afschin Soleiman, Robert Knobler, Andrea Haitel, Hubert Pehamberger, Markus Raderer. (2011) High expression of Dicer reveals a negative prognostic influence in certain subtypes of primary cutaneous T cell lymphomas. Journal of Dermatological Science 64:3, 185-190
    CrossRef

  16. 16

    Rachel E. Bell, Carmit Levy. (2011) The three M’s: melanoma, microphthalmia-associated transcription factor and microRNA. Pigment Cell & Melanoma Research 24:6, 1088-1106
    CrossRef

  17. 17

    Matteo Ligorio, Alberto Izzotti, Alessandra Pulliero, Patrizio Arrigo. (2011) Mutagens interfere with microRNA maturation by inhibiting DICER. An in silico biology analysis. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 717:1-2, 116-128
    CrossRef

  18. 18

    A. Bahubeshi, M. Tischkowitz, W. D. Foulkes. (2011) miRNA Processing and Human Cancer: DICER1 Cuts the Mustard. Science Translational Medicine 3:111, 111ps46-111ps46
    CrossRef

  19. 19

    Man Lung Yeung, Kuan-Teh Jeang. (2011) Roles of miRNAs in virus-mediated cellular transformation: lessons from human T-cell leukemia virus type 1. Future Virology 6:11, 1351-1360
    CrossRef

  20. 20

    Anna Torres, Kamil Torres, Ryszard Maciejewski, William H. Harvey. (2011) MicroRNAs and their role in gynecological tumors. Medicinal Research Reviews 31:6, 895-923
    CrossRef

  21. 21

    Hiroshi I. Suzuki, Mayu Arase, Hironori Matsuyama, Young Lim Choi, Toshihide Ueno, Hiroyuki Mano, Koichi Sugimoto, Kohei Miyazono. (2011) MCPIP1 Ribonuclease Antagonizes Dicer and Terminates MicroRNA Biogenesis through Precursor MicroRNA Degradation. Molecular Cell 44:3, 424-436
    CrossRef

  22. 22

    Dionysios J. Papachristou, Angeliki Korpetinou, Efstathia Giannopoulou, Anna G. Antonacopoulou, Helen Papadaki, Petros Grivas, Chrisoula D. Scopa, Haralabos P. Kalofonos. (2011) Expression of the ribonucleases Drosha, Dicer, and Ago2 in colorectal carcinomas. Virchows Archiv 459:4, 431-440
    CrossRef

  23. 23

    Min Yan, Hong-Yan Huang, Ting Wang, Yi Wan, Shu-De Cui, Zhen-zhen Liu, Qing-Xia Fan. (2011) Dysregulated Expression of Dicer and Drosha in Breast Cancer. Pathology & Oncology Research
    CrossRef

  24. 24

    Jin-Feng Wu, Wei Shen, Nian-Zhou Liu, Gui-Li Zeng, Mei Yang, Guo-Qing Zuo, Xiu-Ni Gan, Hong Ren, Kai-Fu Tang. (2011) Down-regulation of Dicer in hepatocellular carcinoma. Medical Oncology 28:3, 804-809
    CrossRef

  25. 25

    Pei-Yao LI, Fu-Chu HE, Gang-Qiao ZHOU. (2011) Association of human microRNA related genetic variations with cancer. Hereditas (Beijing) 33:8, 870-878
    CrossRef

  26. 26

    P Lopez-Serra, M Esteller. (2011) DNA methylation-associated silencing of tumor-suppressor microRNAs in cancer. Oncogene
    CrossRef

  27. 27

    Anna Torres, Kamil Torres, Tomasz Paszkowski, Barbara Jodłowska-Jędrych, Tomasz Radomański, Andrzej Książek, Ryszard Maciejewski. (2011) Major regulators of microRNAs biogenesis Dicer and Drosha are down-regulated in endometrial cancer. Tumor Biology 32:4, 769-776
    CrossRef

  28. 28

    Deug-Chan Lee, Roberto Romero, Jung-Sun Kim, Adi L. Tarca, Daniel Montenegro, Beth L. Pineles, Ernest Kim, JoonHo Lee, Sun Young Kim, Sorin Draghici, Pooja Mittal, Juan Pedro Kusanovic, Tinnakorn Chaiworapongsa, Sonia S. Hassan, Chong Jai Kim. (2011) miR-210 Targets Iron-Sulfur Cluster Scaffold Homologue in Human Trophoblast Cell Lines. The American Journal of Pathology 179:2, 590-602
    CrossRef

  29. 29

    Kris Ann P. Schultz, M. Cristina Pacheco, Jiandong Yang, Gretchen M. Williams, Yoav Messinger, D. Ashley Hill, Louis P. Dehner, John R. Priest. (2011) Ovarian sex cord-stromal tumors, pleuropulmonary blastoma and DICER1 mutations: A report from the International Pleuropulmonary Blastoma Registry. Gynecologic Oncology 122:2, 246-250
    CrossRef

  30. 30

    Olga Vaksman, Helene Tuft Stavnes, Janne Kaern, Claes G. Trope, Ben Davidson, Reuven Reich. (2011) miRNA profiling along tumour progression in ovarian carcinoma. Journal of Cellular and Molecular Medicine 15:7, 1593-1602
    CrossRef

  31. 31

    Marie E. Maradeo, Paul Cairns. (2011) Translational application of epigenetic alterations: Ovarian cancer as a model. FEBS Letters 585:13, 2112-2120
    CrossRef

  32. 32

    Maria Angelica Cortez, Carlos Bueso-Ramos, Jana Ferdin, Gabriel Lopez-Berestein, Anil K. Sood, George A. Calin. (2011) MicroRNAs in body fluids—the mix of hormones and biomarkers. Nature Reviews Clinical Oncology 8:8, 467-477
    CrossRef

  33. 33

    C. Röcken. (2011) Die Rolle der Mikro-RNA bei der Entstehung onkologischer Erkrankungen. Der Onkologe 17:6, 487-494
    CrossRef

  34. 34

    C. Faber, D. Horst, F. Hlubek, T. Kirchner. (2011) Overexpression of Dicer predicts poor survival in colorectal cancer. European Journal of Cancer 47:9, 1414-1419
    CrossRef

  35. 35

    Israel Zighelboim, Andrew J. Reinhart, Feng Gao, Amy P. Schmidt, David G. Mutch, Premal H. Thaker, Paul J. Goodfellow. (2011) DICER1 expression and outcomes in endometrioid endometrial adenocarcinoma. Cancer 117:7, 1446-1453
    CrossRef

  36. 36

    Hiroki Kaneko, Sami Dridi, Valeria Tarallo, Bradley D. Gelfand, Benjamin J. Fowler, Won Gil Cho, Mark E. Kleinman, Steven L. Ponicsan, William W. Hauswirth, Vince A. Chiodo, Katalin Karikó, Jae Wook Yoo, Dong-ki Lee, Majda Hadziahmetovic, Ying Song, Smita Misra, Gautam Chaudhuri, Frank W. Buaas, Robert E. Braun, David R. Hinton, Qing Zhang, Hans E. Grossniklaus, Jan M. Provis, Michele C. Madigan, Ann H. Milam, Nikki L. Justice, Romulo J. C. Albuquerque, Alexander D. Blandford, Sasha Bogdanovich, Yoshio Hirano, Jassir Witta, Elaine Fuchs, Dan R. Littman, Balamurali K. Ambati, Charles M. Rudin, Mark M. W. Chong, Patrick Provost, Jennifer F. Kugel, James A. Goodrich, Joshua L. Dunaief, Judit Z. Baffi, Jayakrishna Ambati. (2011) DICER1 deficit induces Alu RNA toxicity in age-related macular degeneration. Nature 471:7338, 325-330
    CrossRef

  37. 37

    S. Melo, A. Villanueva, C. Moutinho, V. Davalos, R. Spizzo, C. Ivan, S. Rossi, F. Setien, O. Casanovas, L. Simo-Riudalbas, J. Carmona, J. Carrere, A. Vidal, A. Aytes, S. Puertas, S. Ropero, R. Kalluri, C. M. Croce, G. A. Calin, M. Esteller. (2011) Small molecule enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2-mediated microRNA processing. Proceedings of the National Academy of Sciences 108:11, 4394-4399
    CrossRef

  38. 38

    Angela M. Liu, Chunsheng Zhang, Julja Burchard, S.T. Fan, Kwong-Fai Wong, Hongyue Dai, Ronnie T. Poon, John M. Luk. (2011) Global Regulation on microRNA in Hepatitis B Virus-Associated Hepatocellular Carcinoma. OMICS: A Journal of Integrative Biology 15:3, 187-191
    CrossRef

  39. 39

    Sergio Marchini, Duccio Cavalieri, Robert Fruscio, Enrica Calura, Daniela Garavaglia, Ilaria Fuso Nerini, Costantino Mangioni, Giorgio Cattoretti, Luca Clivio, Luca Beltrame, Dionyssios Katsaros, Luca Scarampi, Guido Menato, Patrizia Perego, Giovanna Chiorino, Alessandro Buda, Chiara Romualdi, Maurizio D'Incalci. (2011) Association between miR-200c and the survival of patients with stage I epithelial ovarian cancer: a retrospective study of two independent tumour tissue collections. The Lancet Oncology 12:3, 273-285
    CrossRef

  40. 40

    Xinna Zhang, Guohui Wan, Franklin G. Berger, Xiaoming He, Xiongbin Lu. (2011) The ATM Kinase Induces MicroRNA Biogenesis in the DNA Damage Response. Molecular Cell 41:4, 371-383
    CrossRef

  41. 41

    Chad V. Pecot, George A. Calin, Robert L. Coleman, Gabriel Lopez-Berestein, Anil K. Sood. (2011) RNA interference in the clinic: challenges and future directions. Nature Reviews Cancer 11:1, 59-67
    CrossRef

  42. 42

    H. I. Suzuki, K. Miyazono. (2011) Emerging complexity of microRNA generation cascades. Journal of Biochemistry 149:1, 15-25
    CrossRef

  43. 43

    Stuart A Rushworth. (2011) Targeting the oncogenic role of miRNA in human cancer using naturally occurring compounds. British Journal of Pharmacology 162:2, 346-348
    CrossRef

  44. 44

    Angela Hui, Christine How, Emma Ito, Fei-Fei Liu. (2011) Micro-RNAs as diagnostic or prognostic markers in human epithelial malignancies. BMC Cancer 11:1, 500
    CrossRef

  45. 45

    Johannes Stratmann, Chao-Jie Wang, Sebastian Gnosa, Åsa Wallin, David Hinselwood, Xiao-Feng Sun, Hong Zhang. (2011) Dicer and miRNA in relation to clinicopathological variables in colorectal cancer patients. BMC Cancer 11:1, 345
    CrossRef

  46. 46

    Tony Bou Kheir, Ewa Futoma-Kazmierczak, Anders Jacobsen, Anders Krogh, Linda Bardram, Christoffer Hother, Kirsten Grønbæk, Birgitte Federspiel, Anders H Lund, Lennart Friis-Hansen. (2011) miR-449 inhibits cell proliferation and is down-regulated in gastric cancer. Molecular Cancer 10:1, 29
    CrossRef

  47. 47

    Stefan Mockenhaupt, Nina Schürmann, Dirk Grimm. 2011. When Cellular Networks Run Out of Control. , 165-242.
    CrossRef

  48. 48

    Christopher S Inchley, Tonje Sonerud, Hans O Fjærli, Britt Nakstad. (2011) Reduced Dicer expression in the cord blood of infants admitted with severe respiratory syncytial virus disease. BMC Infectious Diseases 11:1, 59
    CrossRef

  49. 49

    A Lujambio, A Portela, J Liz, S A Melo, S Rossi, R Spizzo, C M Croce, G A Calin, M Esteller. (2010) CpG island hypermethylation-associated silencing of non-coding RNAs transcribed from ultraconserved regions in human cancer. Oncogene 29:48, 6390-6401
    CrossRef

  50. 50

    Ming Shi, Dan Liu, Huijun Duan, Beifen Shen, Ning Guo. (2010) Metastasis-related miRNAs, active players in breast cancer invasion, and metastasis. Cancer and Metastasis Reviews 29:4, 785-799
    CrossRef

  51. 51

    X. Zhang, H. Yang, J. J. Lee, E. Kim, S. M. Lippman, F. R. Khuri, M. R. Spitz, R. Lotan, W. K. Hong, X. Wu. (2010) MicroRNA-related genetic variations as predictors for risk of second primary tumor and/or recurrence in patients with early-stage head and neck cancer. Carcinogenesis 31:12, 2118-2123
    CrossRef

  52. 52

    Oleg Tchernitsa, Atsuko Kasajima, Reinhold Schäfer, Ralf-Jürgen Kuban, Ute Ungethüm, Balazs Györffy, Ulf Neumann, Eva Simon, Wilko Weichert, Matthias PA Ebert, Christoph Röcken. (2010) Systematic evaluation of the miRNA-ome and its downstream effects on mRNA expression identifies gastric cancer progression. The Journal of Pathology 222:3, 310-319
    CrossRef

  53. 53

    Rodolphe Taby, Jean-Pierre J. Issa. (2010) Cancer Epigenetics. CA: A Cancer Journal for Clinicians 60:6, 376-392
    CrossRef

  54. 54

    Alexander V. Sirotkin. (2010) RNA interference and ovarian functions. Journal of Cellular Physiology 225:2, 354-363
    CrossRef

  55. 55

    Hiroshi I. Suzuki, Kohei Miyazono. (2010) Dynamics of microRNA biogenesis: crosstalk between p53 network and microRNA processing pathway. Journal of Molecular Medicine 88:11, 1085-1094
    CrossRef

  56. 56

    Xiaohua Su, Deepavali Chakravarti, Min Soon Cho, Lingzhi Liu, Young Jin Gi, Yu-Li Lin, Marco L. Leung, Adel El-Naggar, Chad J. Creighton, Milind B. Suraokar, Ignacio Wistuba, Elsa R. Flores. (2010) TAp63 suppresses metastasis through coordinate regulation of Dicer and miRNAs. Nature 467:7318, 986-990
    CrossRef

  57. 57

    P-Y Lin, S-L Yu, P-C Yang. (2010) MicroRNA in lung cancer. British Journal of Cancer 103:8, 1144-1148
    CrossRef

  58. 58

    J. Lin, Y. Horikawa, P. Tamboli, J. Clague, C. G. Wood, X. Wu. (2010) Genetic variations in microRNA-related genes are associated with survival and recurrence in patients with renal cell carcinoma. Carcinogenesis 31:10, 1805-1812
    CrossRef

  59. 59

    Vladimir A. Krutovskikh, Zdenko Herceg. (2010) Oncogenic microRNAs (OncomiRs) as a new class of cancer biomarkers. BioEssays 32:10, 894-904
    CrossRef

  60. 60

    Marilena V. Iorio, Claudia Piovan, Carlo M. Croce. (2010) Interplay between microRNAs and the epigenetic machinery: An intricate network. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms 1799:10-12, 694-701
    CrossRef

  61. 61

    X. Tang, Y. Zhang, L. Tucker, B. Ramratnam. (2010) Phosphorylation of the RNase III enzyme Drosha at Serine300 or Serine302 is required for its nuclear localization. Nucleic Acids Research 38:19, 6610-6619
    CrossRef

  62. 62

    Sonia A. Melo, Catia Moutinho, Santiago Ropero, George A. Calin, Simona Rossi, Riccardo Spizzo, Agustin F. Fernandez, Veronica Davalos, Alberto Villanueva, Guillermo Montoya, Hiroyuki Yamamoto, Simo Schwartz, Manel Esteller. (2010) A Genetic Defect in Exportin-5 Traps Precursor MicroRNAs in the Nucleus of Cancer Cells. Cancer Cell 18:4, 303-315
    CrossRef

  63. 63

    Ramiro Garzon, Guido Marcucci, Carlo M. Croce. (2010) Targeting microRNAs in cancer: rationale, strategies and challenges. Nature Reviews Drug Discovery 9:10, 775-789
    CrossRef

  64. 64

    Prue A. Cowin, Michael Anglesio, Dariush Etemadmoghadam, David D.L. Bowtell. (2010) Profiling the Cancer Genome. Annual Review of Genomics and Human Genetics 11:1, 133-159
    CrossRef

  65. 65

    I Van der Auwera, R Limame, P van Dam, P B Vermeulen, L Y Dirix, S J Van Laere. (2010) Integrated miRNA and mRNA expression profiling of the inflammatory breast cancer subtype. British Journal of Cancer 103:4, 532-541
    CrossRef

  66. 66

    Marijn T.M. van Jaarsveld, Jozien Helleman, Els M.J.J. Berns, Erik A.C. Wiemer. (2010) MicroRNAs in ovarian cancer biology and therapy resistance. The International Journal of Biochemistry & Cell Biology 42:8, 1282-1290
    CrossRef

  67. 67

    Chunhua Lu, Hee Dong Han, Lingegowda S. Mangala, Rouba Ali-Fehmi, Christopher S. Newton, Laurent Ozbun, Guillermo N. Armaiz-Pena, Wei Hu, Rebecca L. Stone, Adnan Munkarah, Murali K. Ravoori, Mian M.K. Shahzad, Jeong-Won Lee, Edna Mora, Robert R. Langley, Amy R. Carroll, Koji Matsuo, Whitney A. Spannuth, Rosemarie Schmandt, Nicholas B. Jennings, Blake W. Goodman, Robert B. Jaffe, Alpa M. Nick, Hye Sun Kim, Eylem Ozturk Guven, Ya-Huey Chen, Long-Yuan Li, Ming-Chuan Hsu, Robert L. Coleman, George A. Calin, Emir B. Denkbas, Jae Yun Lim, Ju-Seog Lee, Vikas Kundra, Michael J. Birrer, Mien-Chie Hung, Gabriel Lopez-Berestein, Anil K. Sood. (2010) Regulation of Tumor Angiogenesis by EZH2. Cancer Cell 18:2, 185-197
    CrossRef

  68. 68

    Delia Mezzanzanica, Marina Bagnoli, Loris De Cecco, Barbara Valeri, Silvana Canevari. (2010) Role of microRNAs in ovarian cancer pathogenesis and potential clinical implications. The International Journal of Biochemistry & Cell Biology 42:8, 1262-1272
    CrossRef

  69. 69

    Rachel Senturia, Michael Faller, Sheng Yin, Joseph A. Loo, Duilio Cascio, Michael R. Sawaya, Daniel Hwang, Robert T. Clubb, Feng Guo. (2010) Structure of the dimerization domain of DiGeorge Critical Region 8. Protein Science 19:7, 1354-1365
    CrossRef

  70. 70

    Shaheenah Dawood. (2010) Novel biomarkers of metastatic cancer. Expert Review of Molecular Diagnostics 10:5, 581-590
    CrossRef

  71. 71

    Andrew Jakymiw, Rushi S. Patel, Natasha Deming, Indraneel Bhattacharyya, Priya Shah, Richard J. Lamont, Carol M. Stewart, Donald M. Cohen, Edward K. L. Chan. (2010) Overexpression of dicer as a result of reduced let-7 MicroRNA levels contributes to increased cell proliferation of oral cancer cells. Genes, Chromosomes and Cancer 49:6, 549-559
    CrossRef

  72. 72

    Bríd M. Ryan, Ana I. Robles, Curtis C. Harris. (2010) Genetic variation in microRNA networks: the implications for cancer research. Nature Reviews Cancer 10:6, 389-402
    CrossRef

  73. 73

    Curtis Balch, Daniela E Matei, Tim H-M Huang, Kenneth P Nephew. (2010) Role of epigenomics in ovarian and endometrial cancers. Epigenomics 2:3, 419-447
    CrossRef

  74. 74

    Michael Sand, Thilo Gambichler, Marina Skrygan, Daniel Sand, Nina Scola, Peter Altmeyer, Falk G. Bechara. (2010) Expression Levels of the microRNA Processing Enzymes Drosha and Dicer in Epithelial Skin Cancer. Cancer Investigation 28:6, 649-653
    CrossRef

  75. 75

    Graziano Martello, Antonio Rosato, Francesco Ferrari, Andrea Manfrin, Michelangelo Cordenonsi, Sirio Dupont, Elena Enzo, Vincenza Guzzardo, Maria Rondina, Thomas Spruce, Anna R. Parenti, Maria Grazia Daidone, Silvio Bicciato, Stefano Piccolo. (2010) A MicroRNA Targeting Dicer for Metastasis Control. Cell 141:7, 1195-1207
    CrossRef

  76. 76

    Anil K. Sood, Guillermo N. Armaiz-Pena, Jyotsnabaran Halder, Alpa M. Nick, Rebecca L. Stone, Wei Hu, Amy R. Carroll, Whitney A. Spannuth, Michael T. Deavers, Julie K. Allen, Liz Y. Han, Aparna A. Kamat, Mian M.K. Shahzad, Bradley W. McIntyre, Claudia M. Diaz-Montero, Nicholas B. Jennings, Yvonne G. Lin, William M. Merritt, Koen DeGeest, Pablo E. Vivas-Mejia, Gabriel Lopez-Berestein, Michael D. Schaller, Steven W. Cole, Susan K. Lutgendorf. (2010) Adrenergic modulation of focal adhesion kinase protects human ovarian cancer cells from anoikis. Journal of Clinical Investigation 120:5, 1515-1523
    CrossRef

  77. 77

    Y. Zhou, L. Chen, B. Barlogie, O. Stephens, X. Wu, D. R. Williams, M.-A. Cartron, F. van Rhee, B. Nair, S. Waheed, M. Pineda-Roman, Y. Alsayed, E. Anaissie, J. D. Shaughnessy. (2010) High-risk myeloma is associated with global elevation of miRNAs and overexpression of EIF2C2/AGO2. Proceedings of the National Academy of Sciences 107:17, 7904-7909
    CrossRef

  78. 78

    Georgios Pampalakis, Eleftherios P. Diamandis, Dionyssios Katsaros, Georgia Sotiropoulou. (2010) Down-regulation of dicer expression in ovarian cancer tissues. Clinical Biochemistry 43:3, 324-327
    CrossRef

  79. 79

    Kaitlyn Wurz, Rochelle L. Garcia, Barbara A. Goff, Patrick S. Mitchell, Jun Haeng Lee, Muneesh Tewari, Elizabeth M. Swisher. (2010) MiR-221 and MiR-222 alterations in sporadic ovarian carcinoma: Relationship to CDKN1B, CDKNIC and overall survival. Genes, Chromosomes and CancerNA-NA
    CrossRef

  80. 80

    Veronica Davalos, Manel Esteller. (2010) MicroRNAs and cancer epigenetics: a macrorevolution. Current Opinion in Oncology 22:1, 35-45
    CrossRef

  81. 81

    Harriet E. Gee, Carme Camps, Francesca M. Buffa, Shalini Patiar, Stuart C. Winter, Guy Betts, Jarrod Homer, Rogan Corbridge, Graham Cox, Catharine M. L. West, Jiannis Ragoussis, Adrian L. Harris. (2010) hsa-miR-210 is a marker of tumor hypoxia and a prognostic factor in head and neck cancer. CancerNA-NA
    CrossRef

  82. 82

    B. Ozpolat, A. K. Sood, G. Lopez-Berestein. (2010) Nanomedicine based approaches for the delivery of siRNA in cancer. Journal of Internal Medicine 267:1, 44-53
    CrossRef

  83. 83

    Richard Hummel, Damian J. Hussey, Joerg Haier. (2010) MicroRNAs: Predictors and modifiers of chemo- and radiotherapy in different tumour types. European Journal of Cancer 46:2, 298-311
    CrossRef

  84. 84

    Jay D. Turner, Richard Williamson, Kaith K. Almefty, Peter Nakaji, Randall Porter, Victor Tse, M. Yashar S. Kalani. (2010) The many roles of microRNAs in brain tumor biology. Neurosurgical FOCUS 28:1, E3
    CrossRef

  85. 85

    Somesh Baranwal, Suresh K. Alahari. (2010) miRNA control of tumor cell invasion and metastasis. International Journal of CancerNA-NA
    CrossRef

  86. 86

    XuPing Fu, ChenYi Xue, Yan Huang, Yi Xie, Yao Li. (2010) The activity and expression of microRNAs in prostate cancers. Molecular BioSystems 6:12, 2561
    CrossRef

  87. 87

    Ryan J Taft, Ken C Pang, Timothy R Mercer, Marcel Dinger, John S Mattick. (2010) Non-coding RNAs: regulators of disease. The Journal of Pathology 220:2, 126-139
    CrossRef

  88. 88

    Chunsheng Li, Yi Feng, George Coukos, Lin Zhang. (2009) Therapeutic MicroRNA Strategies in Human Cancer. The AAPS Journal 11:4, 747-757
    CrossRef

  89. 89

    J.-W. Lee, H. D. Han, M. M. K. Shahzad, S. W. Kim, L. S. Mangala, A. M. Nick, C. Lu, R. R. Langley, R. Schmandt, H.-S. Kim, S. Mao, J. Gooya, C. Fazenbaker, D. Jackson, D. A. Tice, C. N. Landen, R. L. Coleman, A. K. Sood. (2009) EphA2 Immunoconjugate as Molecularly Targeted Chemotherapy for Ovarian Carcinoma. JNCI Journal of the National Cancer Institute 101:17, 1193-1205
    CrossRef

  90. 90

    Gang Li, Xiaojia Xiong. (2009) MicroRNAs and hepatitis viruses. Frontiers of Medicine in China 3:3, 265-270
    CrossRef

  91. 91

    Joachim Silber, C. David James, J. Graeme Hodgson. (2009) microRNAs in Gliomas: Small Regulators of a Big Problem. NeuroMolecular Medicine 11:3, 208-222
    CrossRef

  92. 92

    G Grelier, N Voirin, A-S Ay, D G Cox, S Chabaud, I Treilleux, S Léon-Goddard, R Rimokh, I Mikaelian, C Venoux, A Puisieux, C Lasset, C Moyret-Lalle. (2009) Prognostic value of Dicer expression in human breast cancers and association with the mesenchymal phenotype. British Journal of Cancer 101:4, 673-683
    CrossRef

  93. 93

    Mike G. Martin, Jacqueline E. Payton, Daniel C. Link. (2009) Dicer and outcomes in patients with acute myeloid leukemia (AML). Leukemia Research 33:8, e127
    CrossRef

  94. 94

    Lacey J. Luense, Martha Z. Carletti, Lane K. Christenson. (2009) Role of Dicer in female fertility. Trends in Endocrinology & Metabolism 20:6, 265-272
    CrossRef

  95. 95

    Donald D. Rao, John S. Vorhies, Neil Senzer, John Nemunaitis. (2009) siRNA vs. shRNA: Similarities and differences. Advanced Drug Delivery Reviews 61:9, 746-759
    CrossRef

  96. 96

    Ritu Salani, Floor J Backes, Larry J Copeland. (2009) Overview of epithelial ovarian cancer and updates in management strategies. Expert Review of Obstetrics & Gynecology 4:4, 383-399
    CrossRef

  97. 97

    Mandy Aujla. (2009) Genetics: Dicer and Drosha predict outcomes in ovarian cancer. Nature Reviews Clinical Oncology 6:4, 185-185
    CrossRef

  98. 98

    (2009) Dicer and Drosha in Ovarian Cancer. New England Journal of Medicine 360:11, 1150-1151
    Full Text

  99. 99

    Areeg Faggad, Jan Budczies, Oleg Tchernitsa, Silvia Darb-Esfahani, Jalid Sehouli, Berit M Müller, Ralph Wirtz, Radoslav Chekerov, Wilko Weichert, Bruno Sinn, Christin Mucha, Nasr E Elwali, Reinhold Schäfer, Manfred Dietel, Carsten Denkert. (2009) Prognostic significance of Dicer expression in ovarian cancerâlink to global microRNA changes and oestrogen receptor expression. The Journal of Pathologyn/a-n/a
    CrossRef

  100. 100

    Jessica Clague, Scott M. Lippman, Hushan Yang, Michelle A.T. Hildebrandt, Yuanqing Ye, J. Jack Lee, Xifeng Wu. (2009) Genetic variation in MicroRNA genes and risk of oral premalignant lesions. Molecular Carcinogenesisn/a-n/a
    CrossRef

  101. 101

    Carola G. Vinuesa, Robert J. Rigby, Di Yu. (2009) Logic and Extent of miRNA-Mediated Control of Autoimmune Gene Expression. International Reviews of Immunology 28:3-4, 112-138
    CrossRef

  102. 102

    Slack, Frank J., Weidhaas, Joanne B., . (2008) MicroRNA in Cancer Prognosis. New England Journal of Medicine 359:25, 2720-2722
    Full Text

  103. 103

    P Trang, J B Weidhaas, F J Slack. (2008) MicroRNAs as potential cancer therapeutics. Oncogene 27, S52-S57
    CrossRef

Letters