Original Article
Brief Report
Long-Term Control of HIV by CCR5 Delta32/Delta32 Stem-Cell Transplantation
N Engl J Med 2009; 360:692-698February 12, 2009
- Abstract
Infection with the human immunodeficiency virus type 1 (HIV-1) requires the presence of a CD4 receptor and a chemokine receptor, principally chemokine receptor 5 (CCR5). Homozygosity for a 32-bp deletion in the CCR5 allele provides resistance against HIV-1 acquisition. We transplanted stem cells from a donor who was homozygous for CCR5 delta32 in a patient with acute myeloid leukemia and HIV-1 infection. The patient remained without viral rebound 20 months after transplantation and discontinuation of antiretroviral therapy. This outcome demonstrates the critical role CCR5 plays in maintaining HIV-1 infection.
Media in This Article
Figure 1
Genotyping of CCR5 Alleles.Figure 2
Cellular and Humoral Immune Response to HIV-1.Article Activity
- Article
HIV-1 enters host cells by binding to a CD4 receptor and then interacting with either CCR5 or the CXC chemokine receptor (CXCR4). Homozygosity for a 32-bp deletion (delta32/delta32) in the CCR5 allele results in an inactive CCR5 gene product and consequently confers high resistance against HIV-1 acquisition.1
Allogeneic stem-cell transplantation from an HLA-matched donor is a feasible option for patients with hematologic neoplasms, but it has not been established as a therapeutic option for patients who are also infected with HIV.2 Survival of patients with HIV infection has improved considerably since the introduction of highly active antiretroviral therapy (HAART),3 and as a consequence, successful allogeneic stem-cell transplantation with ongoing HAART was performed in 2000.4
In this report, we describe the outcome of allogeneic stem-cell transplantation in a patient with HIV infection and acute myeloid leukemia, using a transplant from an HLA-matched, unrelated donor who was screened for homozygosity for the CCR5 delta32 deletion.
Case Report
A 40-year-old white man with newly diagnosed acute myeloid leukemia (FAB M4 subtype, with normal cytogenetic features) presented to our hospital. HIV-1 infection had been diagnosed more than 10 years earlier, and the patient had been treated with HAART (600 mg of efavirenz, 200 mg of emtricitabine, and 300 mg of tenofovir per day) for the previous 4 years, during which no illnesses associated with the acquired immunodeficiency syndrome (AIDS) were observed. At the time that acute myeloid leukemia was diagnosed, the patient's CD4 T-cell count was 415 per cubic millimeter, and HIV-1 RNA was not detectable (stage A2 according to classification by the Centers for Disease Control and Prevention). Initial treatment of the acute myeloid leukemia consisted of two courses of induction chemotherapy and one course of consolidation chemotherapy. During the first induction course, severe hepatic toxic effects developed and renal failure occurred. Consequently, HAART was discontinued, leading to a viral rebound (6.9×106 copies of HIV-1 RNA per milliliter). The therapy was resumed immediately, before a viral steady state was reached, and 3 months later, HIV-1 RNA was undetectable.
Seven months after presentation, acute myeloid leukemia relapsed, and the patient underwent allogeneic stem-cell transplantation with CD34+ peripheral-blood stem cells from an HLA-identical donor who had been screened for homozygosity for the CCR5 delta32 allele. The patient provided informed consent for this procedure, and the protocol was approved by the institutional review board. The HLA genotypes of the patient and the donor were identical at the following loci: A*0201; B*0702,3501; Cw*0401,0702; DRB1*0101,1501; and DQB1*0501,0602. The patient underwent a conditioning regimen and received a graft containing 2.3×106 CD34+ cells per kilogram of body weight.5 Prophylaxis against graft-versus-host disease consisted of 0.5 mg of rabbit antithymocyte globulin per kilogram 3 days before transplantation, 2.5 mg per kilogram 2 days before, and 2.5 mg per kilogram 1 day before. The patient received two doses of 2.5 mg of cyclosporine per kilogram intravenously 1 day before the procedure and treatment with mycophenolate mofetil at a dose of 1 g three times per day was started 6 hours after transplantation. HAART was administered until the day before the procedure, and engraftment was achieved 13 days after the procedure. Except for the presence of grade I graft-versus-host disease of the skin, which was treated by adjusting the dosage of cyclosporine, there were no serious infections or toxic effects other than grade I during the first year of follow-up. Acute myeloid leukemia relapsed 332 days after transplantation, and chimerism transiently decreased to 15%. The patient underwent reinduction therapy with cytarabine and gemtuzumab and on day 391 received a second transplant, consisting of 2.1×106 CD34+ cells per kilogram, from the same donor, after treatment with a single dose of whole-body irradiation (200 cGy). The second procedure led to a complete remission of the acute myeloid leukemia, which was still in remission at month 20 of follow-up.
Methods
CCR5 Genotyping
Genomic DNA was extracted from heparinized peripheral-blood monocytes obtained from the patient and the prospective donor, with the use of the QIAamp Blood Midi Kit (Qiagen). Screening of donors for the CCR5 delta32 allele was performed with a genomic polymerase-chain-reaction (PCR) assay, with primers flanking the site of the deletion (forward, 5′CTCCCAGGAATCATCTTTACC3′; reverse, 5′TCATTTCGACACCGAAGCAG3′), resulting in a PCR fragment of 200 bp for the CCR5 allele and 168 bp for a delta32 deletion. Results were confirmed by allele-specific PCR and by direct sequencing with the use of the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). Sequences were analyzed with the use of Vector NTI ContigExpress software (Invitrogen).
Viral-Envelope Genotyping
Coreceptor use by HIV-1 was assessed through V3 amino acid sequences of the env region for both DNA and RNA. Bulk PCR products were subjected to direct sequencing and determined according to the 11/25 and net charge rules, as described by Delobel et al.6
For RNA, the HIV env region was sequenced from position 6538 to 6816 and Web position-specific scoring matrix (WebPSSM), and geno2pheno bioinformatic software was used to predict viral coreceptor use. In addition, an ultradeep PCR analysis with parallel sequencing (454-Life-Sciences, Roche) was performed.7
Chemokine Receptors and Surface Antigens
Mucosal cells were isolated from 10 rectal-biopsy specimens according to the method of Moos et al.8 CCR5 expression was stimulated by phytohemagglutinin (Sigma), and the cells were analyzed by means of flow cytometry with the use of antibodies against CD3, CD4, CD11c, CD163, and CCR5 (BD Biosciences).
Chimerism
Standard chimerism analyses were based on the discrimination between donor and recipient alleles on short tandem repeats, with the use of PCR and fluorescence-labeled primers according to the method of Blau et al.9
Cellular and Humoral Immune Responses
Secretion of interferon-γ by antigen-specific cells was induced according to the method of Ganepola et al.10 For measurement of T-cell–mediated immune responses, two HLA-A*0201–binding peptides were used: HIV-1476–484 (ILKEPVHGV) and cytomegalovirus (CMV)65–73 (NLVPMVATV). The presence of antibodies against HIV-1 and HIV type 2 (HIV-2) was determined by means of an enzyme-linked immunoassay and immunoblot assays in accordance with the procedures recommended by the manufacturers (Abbott and Immogenetics).
Amplification of HIV-1 RNA and DNA
HIV-1 RNA was isolated from plasma and amplified with the use of the Cobas AmpliPrep–TaqMan HIV assay system (Roche). Total DNA was isolated from peripheral-blood monocytes and rectal-biopsy specimens with the use of the QIAamp DNA Blood Mini Kit and the AllPrep DNA/RNA Mini Kit, respectively (both from Qiagen). The env and long-terminal-repeat regions were amplified according to the method of Cassol et al. and Drosten et al.11,12 The sensitivity of the RNA assay was 40 copies per milliliter, and the lower limit of detection for both complementary DNA (cDNA) PCR assays is 5 copies per reaction, with a positivity rate of more than 95%. Each assay contained 2×104 to 5×104 CD4+ T cells. The successful amplification of 1 μg of cellular DNA extracted from various housekeeping genes (GAPDH, CCR5, and CD4) extracted from 1 μg cellular DNA indicated the suitability of the DNA isolated from the mucosal specimens.
Results
Distribution of CCR5 Alleles
Genomic DNA from 62 of 80 potential HLA-identical stem-cell donors registered at the German Bone Marrow Donor Center was sequenced in the CCR5 region. The frequencies of the delta32 allele and the wild-type allele were 0.21 and 0.79, respectively. Only one donor was homozygous for the CCR5 delta32 deletion in this cohort.
Analysis of HIV-1 Coreceptor Phenotype
Sequence analysis of the patient's viral variants revealed a glycine at position 11 and a glutamic acid at position 25 of the V3 region. The net charge of amino acids was +3. These results indicated CCR5 coreceptor use by the HIV-1 strain infecting the patient, a finding that was confirmed by sequencing RNA in the HIV env region. The ultradeep sequencing analysis revealed a proportion of 2.9% for the X4 and dual-tropic variants combined.
Recipient Chimerism
With ongoing engraftment, the PCR patterns of CCR5 were transformed, indicating a shift from a heterozygous genotype to a homozygous delta32/delta32 genotype (Figure 1Figure 1
Genotyping of CCR5 Alleles.). Complete chimerism, determined on the basis of allelic short tandem repeats, was obtained 61 days after allogeneic stem-cell transplantation.Cellular and Humoral Immune Responses
T-cell responses to defined HLA-A2–restricted antigens, determined with the use of an interferon-γ enzyme-linked immunospot assay, revealed elevated frequencies of HIV-specific T cells before stem-cell transplantation and undetectable frequencies after transplantation (Figure 2AFigure 2
Cellular and Humoral Immune Response to HIV-1.). Immunoblot analysis revealed a predominant loss of antibodies to polymerase and capsid proteins after transplantation, whereas levels of antibodies to soluble glycoprotein 120 and glycoprotein 41 remained detectable (Figure 2B).Quantification of Viremia
The HIV-1 load was measured with the use of RNA and DNA PCR assays (Figure 3Figure 3
Clinical Course and HIV-1 Viremia.). Throughout the follow-up period, serum levels of HIV-1 RNA remained undetectable. Also during follow-up, the semiquantitative assay showed no detectable proviral DNA except on the 20th day after transplantation, for both the env and long-terminal-repeat loci, and on the 61st day after transplantation, for the env locus.Rectal-Biopsy Specimens
In rectal-biopsy specimens obtained 159 days after transplantation, macrophages showed expression of CCR5, whereas a distinct CCR5-expressing population was not present in the mucosal CD4+ T lymphocytes (Figure 4Figure 4
Expression of CD Surface Antigen and Chemokine Coreceptor in the Patient's Rectal Mucosa.).Discussion
To enter target cells, HIV-1 requires both CD4 and a coreceptor, predominantly CCR5. Blocking of the preferentially used CCR5 receptor by inhibitors or through gene knockdown conferred antiviral protection to R5-tropic variants.13,14 The homozygous CCR5 delta32 deletion, observed in approximately 1% of the white population, offers a natural resistance to HIV acquisition. We report a successful transplantation of allogeneic stem cells homozygous for the CCR5 delta32 allele to a patient with HIV.
Although discontinuation of antiretroviral therapy typically leads to a rapid rebound of HIV load within weeks, in this patient, no active, replicating HIV could be detected 20 months after HAART had been discontinued.15 This observation is remarkable because homozygosity for CCR5 delta32 is associated with high but not complete resistance to HIV-1. This outcome can be explained by the behavior of non-CCR5-tropic variants, such as CXCR4-tropic viruses (X4), which are able to use CXCR4 as a coreceptor. The switch occurs in the natural course of infection, and the proportion of X4 increases with ongoing HAART.16 Genotypic and phenotypic assays can be used to determine the nature and extent of coreceptor use, but the presence of heterogeneous viral populations in samples from patients limits the sensitivity of the assay.17 When genotypic analysis was performed in two laboratories applying WebPSSM and geno2pheno prediction algorithms, X4 variants were not detected in the plasma of our patient. To determine the proportion of minor variants in the plasma, we performed an ultradeep sequencing analysis, which revealed a small proportion of X4 variants before the allogeneic stem-cell transplantation.
Even after prolonged HAART, the persistence of HIV-1 populations in various anatomical compartments can be observed in patients without detectable viremia.18 In particular, the intestinal lamina propria represents an important reservoir of HIV-1, and genomic virus detection is possible in patients without viremia.19 In this patient, a rectal biopsy performed 159 days after transplantation revealed that CCR5-expressing macrophages were still present in the intestinal mucosa, indicating that they had not yet been replaced by the new immune system. Although these long-lasting cells from the host can represent viral reservoirs even after transplantation, HIV-1 DNA could not be detected in this patient's rectal mucosa.
It is likely that X4 variants remained in other anatomical reservoirs as potential sources for reemerging viruses, but the number of X4-tropic infectious particles after transplantation could have been too low to allow reseeding of the patient's replaced immune system.
The loss of anti-HIV, virus-specific, interferon-γ–producing T-cells during follow-up suggests that HIV antigen stimulation was not present after transplantation. This disappearance of effector T cells was not associated with a deficient immune reconstitution, as shown by the absence of relevant infection or reactivation of other persistent viruses, such as CMV and Epstein–Barr virus. Thus, the absence of measurable HIV viremia in our patient probably represents the removal of the HIV immunologic stimulus.20 Antibodies against HIV-envelope antigens have remained detectable, but at continually decreasing levels. The sustained secretion of antibodies might be caused by long-lived plasma cells that are relatively resistant to common immunosuppressive therapies.21,22
In the past, there were several attempts to control HIV-1 infection by means of allogeneic stem-cell transplantation without regard to the donor's CCR5 delta32 status, but these efforts were not successful.23 In our patient, transplantation led to complete chimerism, and the patient's peripheral-blood monocytes changed from a heterozygous to a homozygous genotype regarding the CCR5 delta32 allele. Although the patient had non–CCR5-tropic X4 variants and HAART was discontinued for more than 20 months, HIV-1 virus could not be detected in peripheral blood, bone marrow, or rectal mucosa, as assessed with RNA and proviral DNA PCR assays. For as long as the viral load continues to be undetectable, this patient will not require antiretroviral therapy. Our findings underscore the central role of the CCR5 receptor during HIV-1 infection and disease progression and should encourage further investigation of the development of CCR5-targeted treatment options.
Supported by a grant from the German Research Foundation (DFG KFO grant 104 1/1).
Dr. Hofmann reports serving as a consultant or advisory-board member and on speakers' bureaus for Celgene and Novartis. No other potential conflict of interest relevant to this article was reported.
Drs. Hofmann and Thiel contributed equally to this article.
We thank Alexander Schmidt, Petra Leuker, and Gerhard Ehninger (German Bone Marrow Center, Tübingen and Dresden, Germany) for their encouragement and cooperation regarding access of donor blood samples; Emil Morsch (Stefan Morsch Foundation, Birkenfeld, Germany) and Martin Meixner (Department of Biochemistry, Charité Universitätsmedizin, Berlin) for performing sequencing; Stephan Fuhrmann and Mathias Streitz (Department of Immunology, Charité Universitätsmedizin, Berlin) for providing HIV p24 antigens; Alexander Thielen (Max-Planck-Institut für Informatik, Saarbrücken, Germany) for performing 454 ultradeep-sequencing data analysis; Lutz Uharek (Department of Hematology, Charité Universitätsmedizin) for clinical supervision of the allogeneic stem-cell transplantation; and Martin Raftery (Institute of Medical Virology, Charité Universitätsmedizin, Berlin) for reading an earlier version of this article.
Source Information
From the Department of Hematology, Oncology, and Transfusion Medicine (G.H., D.N., M.M., S.G., A.M., O.B., I.W.B., W.K.H., E.T.) and the Department of Gastroenterology, Infectious Diseases, and Rheumatology (K.A., T.S.), Campus Benjamin Franklin; and the Institute of Medical Virology, Campus Mitte (J.H.) — all at Charité Universitätsmedizin Berlin; and the Robert Koch Institute (C.K.) — all in Berlin.
Address reprint requests to Dr. Hütter at Medical Department III Hematology, Oncology, and Transfusion Medicine, Charité Campus Benjamin Franklin, Hindenburgdamm 30 D-12203 Berlin, Germany, or at gero.huetter@charite.de.
- References
References
1
Liu R ,Paxton WA ,Choe S , et al. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 1996;86:367-377
CrossRef | Web of Science | Medline2
Ayash LJ ,Ratanatharathorn V ,Braun T ,Silver SM ,Reynolds CM ,Uberti JP . Unrelated donor bone marrow transplantation using a chemotherapy-only preparative regimen for adults with high-risk acute myelogenous leukemia. Am J Hematol 2007;82:6-14
CrossRef | Web of Science | Medline3
Palella FJ Jr ,Delaney KM ,Moorman AC , et al. Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection. N Engl J Med 1998;338:853-860
Full Text | Web of Science | Medline4
Sora F ,Antinori A ,Piccirillo N , et al. Highly active antiretroviral therapy and allogeneic CD34(+) peripheral blood progenitor cells transplantation in an HIV/HCV coinfected patient with acute myeloid leukemia. Exp Hematol 2002;30:279-284
CrossRef | Web of Science | Medline5
Schmid C ,Weisser M ,Ledderose G ,Stotzer O ,Schleuning M ,Kolb HJ . Dose-reduced conditioning before allogeneic stem cell transplantation: principles, clinical protocols and preliminary results. Dtsch Med Wochenschr 2002;127:2186-2192
CrossRef | Web of Science | Medline6
Delobel P ,Nugeyre MT ,Cazabat M , et al. Population-based sequencing of the V3 region of env for predicting the coreceptor usage of human immunodeficiency virus type 1 quasispecies. J Clin Microbiol 2007;45:1572-1580
CrossRef | Web of Science | Medline7
Däumer M, Kaiser R, Klein R, Lengauer T, Thiele B, Thielen A. Inferring viral tropism from genotype with massively parallel sequencing: qualitative and quantitative analysis. Presented at the XVII International HIV Drug Resistance Workshop, Sitges, Spain, June 10–14, 2008. (Accessed January 26, 2009, at http://domino.mpi-inf.mpg.de/intranet/ag3/ag3publ.nsf/MPGPublications?OpenAgent&LastYear.)
8
Moos V ,Kunkel D ,Marth T , et al. Reduced peripheral and mucosal Tropheryma whipplei-specific Th1 response in patients with Whipple's disease. J Immunol 2006;177:2015-2022
Web of Science | Medline9
Blau IW ,Schmidt-Hieber M ,Leschinger N , et al. Engraftment kinetics and hematopoietic chimerism after reduced-intensity conditioning with fludarabine and treosulfan before allogeneic stem cell transplantation. Ann Hematol 2007;86:583-589
CrossRef | Web of Science | Medline10
Ganepola S ,Gentilini C ,Hilbers U , et al. Patients at high risk for CMV infection and disease show delayed CD8+ T-cell immune recovery after allogeneic stem cell transplantation. Bone Marrow Transplant 2007;39:293-299
CrossRef | Web of Science | Medline11
Cassol S ,Salas T ,Arella M ,Neumann P ,Schechter MT ,O'Shaughnessy M . Use of dried blood spot specimens in the detection of human immunodeficiency virus type 1 by the polymerase chain reaction. J Clin Microbiol 1991;29:667-671
Web of Science | Medline12
Drosten C ,Seifried E ,Roth WK . TaqMan 5′-nuclease human immunodeficiency virus type 1 PCR assay with phage-packaged competitive internal control for high-throughput blood donor screening. J Clin Microbiol 2001;39:4302-4308
CrossRef | Web of Science | Medline13
Mueller MC ,Bogner JR . Treatment with CCR5 antagonists: which patient may have a benefit? Eur J Med Res 2007;12:441-452
Web of Science | Medline14
Anderson J ,Akkina R . Complete knockdown of CCR5 by lentiviral vector-expressed siRNAs and protection of transgenic macrophages against HIV-1 infection. Gene Ther 2007;14:1287-1297
CrossRef | Web of Science | Medline15
Jubault V ,Burgard M ,Le Corfec E ,Costagliola D ,Rouzioux C ,Viard JP . High rebound of plasma and cellular HIV load after discontinuation of triple combination therapy. AIDS 1998;12:2358-2359
Web of Science | Medline16
Delobel P ,Sandres-Saune K ,Cazabat M , et al. R5 to X4 switch of the predominant HIV-1 population in cellular reservoirs during effective highly active antiretroviral therapy. J Acquir Immune Defic Syndr 2005;38:382-392
CrossRef | Web of Science | Medline17
Skrabal K ,Low AJ ,Dong W , et al. Determining human immunodeficiency virus coreceptor use in a clinical setting: degree of correlation between two phenotypic assays and a bioinformatic model. J Clin Microbiol 2007;45:279-284
CrossRef | Web of Science | Medline18
Delobel P ,Sandres-Saune K ,Cazabat M , et al. Persistence of distinct HIV-1 populations in blood monocytes and naive and memory CD4 T cells during prolonged suppressive HAART. AIDS 2005;19:1739-1750
CrossRef | Web of Science | Medline19
Fackler OT ,Schafer M ,Schmidt W , et al. HIV-1 p24 but not proviral load is increased in the intestinal mucosa compared with the peripheral blood in HIV-infected patients. AIDS 1998;12:139-146
CrossRef | Web of Science | Medline20
Kiepiela P ,Ngumbela K ,Thobakgale C , et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nat Med 2007;13:46-53
CrossRef | Web of Science | Medline21
Wahren B ,Gahrton G ,Linde A , et al. Transfer and persistence of viral antibody-producing cells in bone marrow transplantation. J Infect Dis 1984;150:358-365
CrossRef | Web of Science | Medline22
Manz RA ,Moser K ,Burmester GR ,Radbruch A ,Hiepe F . Immunological memory stabilizing autoreactivity. Curr Top Microbiol Immunol 2006;305:241-257
CrossRef | Web of Science | Medline23
Huzicka I . Could bone marrow transplantation cure AIDS? Med Hypotheses 1999;52:247-257
CrossRef | Web of Science | Medline
- Citing Articles (108)
Citing Articles
1
Hans-Peter Kiem, Keith R. Jerome, Steven G. Deeks, Joseph M. McCune. (2012) Hematopoietic-Stem-Cell-Based Gene Therapy for HIV Disease. Cell Stem Cell 10:2, 137-147
CrossRef2
J. P. Williams, J. Frater. (2012) Current understanding in HIV immunopathology and treatment. QJM
CrossRef3
V. Le Douce, A. Janossy, H. Hallay, S. Ali, R. Riclet, O. Rohr, C. Schwartz. (2012) Achieving a cure for HIV infection: do we have reasons to be optimistic?. Journal of Antimicrobial Chemotherapy
CrossRef4
Jos Domen, Kimberly Gandy, Jignesh Dalal. (2012) Emerging uses for pediatric hematopoietic stem cells. Pediatric Research
CrossRef5
Jinyun Yuan, Jianbin Wang, Karen Crain, Colleen Fearns, Kenneth A Kim, Kevin L Hua, Philip D Gregory, Michael C Holmes, Bruce E Torbett. (2012) Zinc-finger Nuclease Editing of Human cxcr4 Promotes HIV-1 CD4+ T Cell Resistance and Enrichment. Molecular Therapy
CrossRef6
Manju Pant, Pretty Garg, Pankaj Seth. (2012) Central Nervous System Infection by HIV-1: Special Emphasis to NeuroAIDS in India. Proceedings of the National Academy of Sciences, India Section B: Biological Sciences
CrossRef7
Miranda Z. Smith, Fiona Wightman, Sharon R. Lewin. (2012) HIV Reservoirs and Strategies for Eradication. Current HIV/AIDS Reports
CrossRef8
Jan Münch, Frank Kirchhoff. 2012. Natural SIV Infection. , 3-45.
CrossRef9
Ma Luo, Paul J. McLaren, Francis A. Plummer. 2012. Host Genetics and Resistance to HIV-1 Infection. , 169-209.
CrossRef10
Christine Durand, Richard Ambinder, Joel Blankson, Stephen Forman. (2012) HIV-1 and Hematopoietic Stem Cell Transplantation. Biology of Blood and Marrow Transplantation 18:1, S172-S176
CrossRef11
Per Johan Klasse, Rogier W. Sanders, Andrea Cerutti, John P. Moore. (2012) How Can HIV-Type-1-Env Immunogenicity Be Improved to Facilitate Antibody-Based Vaccine Development?. AIDS Research and Human Retroviruses 28:1, 1-15
CrossRef12
Ivona Pandrea, Alan L. Landay. 2012. Implications for Therapy. , 81-132.
CrossRef13
Yongchao Yao, Bayaer Nashun, Tiancheng Zhou, Li Qin, Limei Qin, Siting Zhao, Jianyong Xu, Miguel A. Esteban, Xiaoping Chen. (2011) Generation of CD34 + Cells from CCR5-Disrupted Human Embryonic and Induced Pluripotent Stem Cells. Human Gene Therapy111214064531008
CrossRef14
Melanie Swan. (2011) Steady Advance of Stem Cell Therapies: Report from the 2011 World Stem Cell Summit, Pasadena, California, October 3–5. Rejuvenation Research 14:6, 699-704
CrossRef15
Priya S. Shah, David V. Schaffer. (2011) Antiviral RNAi: Translating Science Towards Therapeutic Success. Pharmaceutical Research 28:12, 2966-2982
CrossRef16
J Zhou, J J Rossi. (2011) Current progress in the development of RNAi-based therapeutics for HIV-1. Gene Therapy 18:12, 1134-1138
CrossRef17
John Frater. (2011) New approaches in HIV eradication research. Current Opinion in Infectious Diseases 24:6, 593-598
CrossRef18
S. Palmer, L. Josefsson, J. M. Coffin. (2011) HIV reservoirs and the possibility of a cure for HIV infection. Journal of Internal Medicine 270:6, 550-560
CrossRef19
Ricky Maung, Kathryn E. Medders, Natalia E. Sejbuk, Maya K. Desai, Rossella Russo, Marcus Kaul. (2011) Genetic Knockouts Suggest a Critical Role for HIV Co-Receptors in Models of HIV gp120-Induced Brain Injury. Journal of Neuroimmune Pharmacology
CrossRef20
Michael W. Evans, Anthony D. Sung, Ivana Gojo, Michael Tidwell, Jacqueline Greer, Mark Levis, Judith Karp, Maria R. Baer. (2011) Risk assessment in human immunodeficiency virus-associated acute myeloid leukemia. Leukemia & Lymphoma1-5
CrossRef21
Janet Chung, John J Rossi, Ulrike Jung. (2011) Current progress and challenges in HIV gene therapy. Future Virology 6:11, 1319-1328
CrossRef22
Patrick Arbuthnot. (2011) MicroRNA-like antivirals. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms 1809:11-12, 746-755
CrossRef23
Scott L. Butler, Hernan Valdez, Michael Westby, Manos Perros, Carl H. June, Jeffrey M. Jacobson, Yves Levy, David A. Cooper, Daniel Douek, Michael M. Lederman, Pablo Tebas. (2011) Disease-Modifying Therapeutic Concepts for HIV in the Era of Highly Active Antiretroviral Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 58:3, 297-303
CrossRef24
Alessandra Bandera, Andrea Gori. (2011) Uncovering the reservoirs: examining HIV replication in T-cell depleted individuals. Future Virology 6:11, 1267-1269
CrossRef25
Ben Berkhout, Rogier W. Sanders. (2011) Molecular strategies to design an escape-proof antiviral therapy. Antiviral Research 92:1, 7-14
CrossRef26
L. C. Swenson, T. Mo, W. W. Y. Dong, X. Zhong, C. K. Woods, A. Thielen, M. A. Jensen, D. J. H. F. Knapp, D. Chapman, S. Portsmouth, M. Lewis, I. James, J. Heera, H. Valdez, P. R. Harrigan. (2011) Deep V3 Sequencing for HIV Type 1 Tropism in Treatment-Naive Patients: A Reanalysis of the MERIT Trial of Maraviroc. Clinical Infectious Diseases 53:7, 732-742
CrossRef27
Aarthi Chary, Mark Holodniy. (2011) Interferon combination therapy for HIV/hepatitis C virus coinfection. Immunotherapy 3:9, 1087-1102
CrossRef28
Erica B. Schleifman, Ranjit Bindra, Jean Leif, Jacob del Campo, Faye A. Rogers, Pradeep Uchil, Olaf Kutsch, Leonard D. Shultz, Priti Kumar, Dale L. Greiner, Peter M. Glazer. (2011) Targeted Disruption of the CCR5 Gene in Human Hematopoietic Stem Cells Stimulated by Peptide Nucleic Acids. Chemistry & Biology 18:9, 1189-1198
CrossRef29
G Gonzalez, SS Park, DW Chen, S Armitage, EJ Shpall, RR Behringer. (2011) Identification and frequency of CCR5Δ32/Δ32 HIV-resistant cord blood units from Houston area hospitals. HIV Medicine 12:8, 481-486
CrossRef30
S. Scerra, G. Melica, J.-D. Lelièvre. (2011) Thérapie génique conduisant à l’inactivation de CCR5 – Vers l’éradication du VIH?. Journal des Anti-infectieux 13:3, 184-190
CrossRef31
Mark G. Lewis, Sandrina DaFonseca, Nicolas Chomont, Anna T. Palamara, Maria Tardugno, Antonello Mai, Matt Collins, Wendeline L. Wagner, Jake Yalley-Ogunro, Jack Greenhouse, Barbara Chirullo, Sandro Norelli, Enrico Garaci, Andrea Savarino. (2011) Gold drug auranofin restricts the viral reservoir in the monkey AIDS model and induces containment of viral load following ART suspension. AIDS 25:11, 1347-1356
CrossRef32
Anjali Joshi, Himanshu Garg, Sherimay Ablan, Eric O. Freed, Kunio Nagashima, N. Manjunath, Premlata Shankar. (2011) Targeting the HIV entry, assembly and release pathways for anti-HIV gene therapy. Virology 415:2, 95-106
CrossRef33
M. Reiss, I.C. Büttel, C.K. Schneider. (2011) Erfahrungsbericht aus dem Ausschuss für neuartige Therapien (CAT). Bundesgesundheitsblatt - Gesundheitsforschung - Gesundheitsschutz 54:7, 822-830
CrossRef34
Jason F. Okulicz. (2011) Current perspectives in HIV therapeutics. Annals of Allergy, Asthma & Immunology 107:1, 12-13
CrossRef35
Nancy S Padian, Sandra I McCoy, Salim S Abdool Karim, Nina Hasen, Julia Kim, Michael Bartos, Elly Katabira, Stefano M Bertozzi, Bernhard Schwartländer, Myron S Cohen. (2011) HIV prevention transformed: the new prevention research agenda. The Lancet 378:9787, 269-278
CrossRef36
Rik Schrijvers, Belete Ayele Desimmie, Zeger Debyser. (2011) Rilpivirine: a step forward in tailored HIV treatment. The Lancet 378:9787, 201-203
CrossRef37
Jan Lunzen, Boris Fehse, Joachim Hauber. (2011) Gene Therapy Strategies: Can We Eradicate HIV?. Current HIV/AIDS Reports 8:2, 78-84
CrossRef38
J. L. Troyer, G. W. Nelson, J. A. Lautenberger, L. Chinn, C. McIntosh, R. C. Johnson, E. Sezgin, B. Kessing, M. Malasky, S. L. Hendrickson, G. Li, J. Pontius, M. Tang, P. An, C. A. Winkler, S. Limou, S. Le Clerc, O. Delaneau, J.-F. Zagury, H. Schuitemaker, D. van Manen, J. H. Bream, E. D. Gomperts, S. Buchbinder, J. J. Goedert, G. D. Kirk, S. J. O'Brien. (2011) Genome-Wide Association Study Implicates PARD3B-Based AIDS Restriction. Journal of Infectious Diseases 203:10, 1491-1502
CrossRef39
(2011) In the Literature. Clinical Infectious Diseases 52:10, iii-iv
CrossRef40
Brigitte Autran, Benjamin Descours, Véronique Avettand-Fenoel, Christine Rouzioux. (2011) Elite controllers as a model of functional cure. Current Opinion in HIV and AIDS 6:3, 181-187
CrossRef41
Yuning Lei, Chi-Lin Lee, Kye-Il Joo, Jonathan Zarzar, Yarong Liu, Bingbing Dai, Victoria Fox, Pin Wang. (2011) Gene Editing of Human Embryonic Stem Cells via an Engineered Baculoviral Vector Carrying Zinc-finger Nucleases. Molecular Therapy 19:5, 942-950
CrossRef42
L. J. Scherer, J. J. Rossi. (2011) Ex vivo gene therapy for HIV-1 treatment. Human Molecular Genetics 20:R1, R100-R107
CrossRef43
Gero Hütter, Kristina Allers, Thomas Schneider. (2011) The Additional Use of Viral Entry Inhibitors during Autologous Hematopoietic Stem Cell Transplantation in Patients with Non-Hodgkin Lymphoma and HIV-1 Infection. Biology of Blood and Marrow Transplantation 17:4, 586-587
CrossRef44
Sharon R Lewin, Christine Rouzioux. (2011) HIV cure and eradication: how will we get from the laboratory to effective clinical trials?. AIDS 25:7, 885-897
CrossRef45
Xiaohui Wang, Yueyun Wang, Lin Chen, Jin Zhao, Li Liu, Xiumin Gan, Xiangdong Shi, Duoshuang Xie, Shaofa Nie, Jinquan Cheng. (2011) Correlation among HLA alleles A*02/A*24 , HLA-DR expression and resistance to HIV-1 infection in Chinese populations. Future Virology 6:4, 535-541
CrossRef46
R. Parker, I. Sereti. (2011) The power of 1 in HIV therapeutics. Blood 117:10, 2746-2747
CrossRef47
K. Allers, G. Hutter, J. Hofmann, C. Loddenkemper, K. Rieger, E. Thiel, T. Schneider. (2011) Evidence for the cure of HIV infection by CCR5 32/ 32 stem cell transplantation. Blood 117:10, 2791-2799
CrossRef48
G. Hütter, J. A. Zaia. (2011) Allogeneic haematopoietic stem cell transplantation in patients with human immunodeficiency virus: the experiences of more than 25 years. Clinical & Experimental Immunology 163:3, 284-295
CrossRef49
Avindra Nath, Janice E Clements. (2011) Eradication of HIV from the brain: reasons for pause. AIDS 25:5, 577-580
CrossRef50
Paul R. Gorry, Petronela Ancuta. (2011) Coreceptors and HIV-1 Pathogenesis. Current HIV/AIDS Reports 8:1, 45-53
CrossRef51
Scott G. Kitchen, Saki Shimizu, Dong Sung An. (2011) Stem cell-based anti-HIV gene therapy. Virology 411:2, 260-272
CrossRef52
Rupert Kaul, Craig R. Cohen, Duncan Chege, Tae J. Yi, Wangari Tharao, Lyle R. McKinnon, Robert Remis, Omu Anzala, Joshua Kimani. (2011) Biological Factors that May Contribute to Regional and Racial Disparities in HIV Prevalence. American Journal of Reproductive Immunology 65:3, 317-324
CrossRef53
Amal Kambal, Gaela Mitchell, Whitney Cary, William Gruenloh, Yunjoon Jung, Stefanos Kalomoiris, Catherine Nacey, Jeannine McGee, Matt Lindsey, Brian Fury, Gerhard Bauer, Jan A Nolta, Joseph S Anderson. (2011) Generation of HIV-1 Resistant and Functional Macrophages From Hematopoietic Stem Cell–derived Induced Pluripotent Stem Cells. Molecular Therapy 19:3, 584-593
CrossRef54
Silvia Sorce, Renier Myburgh, Karl-Heinz Krause. (2011) The chemokine receptor CCR5 in the central nervous system. Progress in Neurobiology 93:2, 297-311
CrossRef55
Agnieszka Czechowicz, Irving L. Weissman. (2011) Purified Hematopoietic Stem Cell Transplantation: The Next Generation of Blood and Immune Replacement. Hematology/Oncology Clinics of North America 25:1, 75-87
CrossRef56
Nataša Ćolović, Vladimir Jurišić, Tatjana Terzić, Djordje Jevtović, Milica Ćolović. (2011) Alveolar Granulocytic Sarcoma of the Mandible in a Patient with HIV. Onkologie 34:1-2, 55-58
CrossRef57
Alain Lafeuillade. (2011) Potential Strategies for an HIV Infection Cure. HIV Clinical Trials 12:3, 121-130
CrossRef58
Paula Cannon, Carl June. (2011) Chemokine receptor 5 knockout strategies. Current Opinion in HIV and AIDS 6:1, 74-79
CrossRef59
Scott G Kitchen, Jerome A Zack. (2011) Stem cell-based approaches to treating HIV infection. Current Opinion in HIV and AIDS 6:1, 68-73
CrossRef60
Gero Hütter, Eckhard Thiel. (2011) Allogeneic transplantation of CCR5-deficient progenitor cells in a patient with HIV infection: an update after 3 years and the search for patient no. 2. AIDS 25:2, 273-274
CrossRef61
Edward A Berger. (2011) Targeted cytotoxic therapy: adapting a rapidly progressing anticancer paradigm for depletion of persistent HIV-infected cell reservoirs. Current Opinion in HIV and AIDS 6:1, 80-85
CrossRef62
Julia J.M. Eekels, Ben Berkhout. 2011. Toward a Durable Treatment of HIV-1 Infection Using RNA Interference. , 141-163.
CrossRef63
Julia J.M. Eekels, Dirk Geerts, Rienk E. Jeeninga, Ben Berkhout. (2011) Long-term inhibition of HIV-1 replication with RNA interference against cellular co-factors. Antiviral Research 89:1, 43-53
CrossRef64
Lina Josefsson, Viktor Dahl, Sarah Palmer. (2010) Can HIV infection be eradicated through use of potent antiviral agents?. Current Opinion in Infectious Diseases 23:6, 628-632
CrossRef65
Jie Wang, Hong-sheng Lin, Meng-yu Liu, Yong Li. (2010) Immune reconstitution of acquired immune deficiency syndrome. Chinese Journal of Integrative Medicine 16:6, 557-564
CrossRef66
Geoff P. Symonds, Helen A. Johnstone, Michelle L. Millington, Maureen P. Boyd, Bryan P. Burke, Louis R. Breton. (2010) The use of cell-delivered gene therapy for the treatment of HIV/AIDS. Immunologic Research 48:1-3, 84-98
CrossRef67
Inmaculada Moreno-Gimeno, Maria H. Ledran, Majlinda Lako. (2010) Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations. Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague. FEBS Journal 277:24, 5014-5025
CrossRef68
Belinda Lee, Mark Bower, Thomas Newsom-Davis, Mark Nelson. (2010) HIV-related lymphoma. HIV Therapy 4:6, 649-659
CrossRef69
Masakazu Kamata, Shirley Liu, Min Liang, Yoshiko Nagaoka, Irvin S. Y. Chen. (2010) Generation of Human Induced Pluripotent Stem Cells Bearing an Anti-HIV Transgene by a Lentiviral Vector Carrying an Internal Murine Leukemia Virus Promoter. Human Gene Therapy 21:11, 1555-1567
CrossRef70
Rowena Johnston. (2010) HIV Cure: Controversy, Consensus, and a Consortium. AIDS Research and Human Retroviruses 26:9, 943-946
CrossRef71
Amrita Krishnan, Stephen J Forman. (2010) Hematopoietic stem cell transplantation for AIDS-related malignancies. Current Opinion in Oncology 22:5, 456-460
CrossRef72
Fyodor D. Urnov, Edward J. Rebar, Michael C. Holmes, H. Steve Zhang, Philip D. Gregory. (2010) Genome editing with engineered zinc finger nucleases. Nature Reviews Genetics 11:9, 636-646
CrossRef73
David Serrano, Pilar Miralles, Pascual Balsalobre, José Luis Díez-Martin, Juan Berenguer. (2010) Hematopoietic Stem Cell Transplantation in Patients Infected With HIV. Current HIV/AIDS Reports 7:3, 175-184
CrossRef74
Steven G Deeks, Joseph M McCune. (2010) Can HIV be cured with stem cell therapy?. Nature Biotechnology 28:8, 807-810
CrossRef75
Nathalia Holt, Jianbin Wang, Kenneth Kim, Geoffrey Friedman, Xingchao Wang, Vanessa Taupin, Gay M Crooks, Donald B Kohn, Philip D Gregory, Michael C Holmes, Paula M Cannon. (2010) Human hematopoietic stem/progenitor cells modified by zinc-finger nucleases targeted to CCR5 control HIV-1 in vivo. Nature Biotechnology 28:8, 839-847
CrossRef76
G D Trobridge, H-P Kiem. (2010) Large animal models of hematopoietic stem cell gene therapy. Gene Therapy 17:8, 939-948
CrossRef77
Leo Luznik, Ephraim J. Fuchs. (2010) High-dose, post-transplantation cyclophosphamide to promote graft-host tolerance after allogeneic hematopoietic stem cell transplantation. Immunologic Research 47:1-3, 65-77
CrossRef78
Ayca Gucalp, Ariela Noy. (2010) Spectrum of HIV lymphoma 2009. Current Opinion in Hematology 17:4, 362-367
CrossRef79
Ben Berkhout. (2010) HIV-based lentiviral vectors for anti-HIV gene therapy. Future Virology 5:4, 367-369
CrossRef80
Janelle Weaver. (2010) Researchers knock down gene to stop HIV in its tracks. Nature Medicine 16:7, 731-731
CrossRef81
Paul A Volberding, Steven G Deeks. (2010) Antiretroviral therapy and management of HIV infection. The Lancet 376:9734, 49-62
CrossRef82
D. L. DiGiusto, A. Krishnan, L. Li, H. Li, S. Li, A. Rao, S. Mi, P. Yam, S. Stinson, M. Kalos, J. Alvarnas, S. F. Lacey, J.-K. Yee, M. Li, L. Couture, D. Hsu, S. J. Forman, J. J. Rossi, J. A. Zaia. (2010) RNA-Based Gene Therapy for HIV with Lentiviral Vector-Modified CD34+ Cells in Patients Undergoing Transplantation for AIDS-Related Lymphoma. Science Translational Medicine 2:36, 36ra43-36ra43
CrossRef83
Agnieszka Czechowicz, Irving L. Weissman. (2010) Purified Hematopoietic Stem Cell Transplantation: The Next Generation of Blood and Immune Replacement. Immunology and Allergy Clinics of North America 30:2, 159-171
CrossRef84
Larry A. Donoso, Tamara Vrabec, Helena Kuivaniemi. (2010) The Role of Complement Factor H in Age-related Macular Degeneration: A Review. Survey of Ophthalmology 55:3, 227-246
CrossRef85
Atze T Das, Rienk E Jeeninga, Ben Berkhout. (2010) Possible applications for replicating HIV-1 vectors. HIV Therapy 4:3, 361-369
CrossRef86
Kara S. Keedy, David M. Margolis. (2010) Therapy for persistent HIV. Trends in Pharmacological Sciences 31:5, 206-211
CrossRef87
Y Lai. (2010) Adopting autologous hematopoietic stem cells with non-functional CCR5 and CXCR4 against HIV. Bone Marrow Transplantation 45:4, 770-771
CrossRef88
Ping An, Cheryl A. Winkler. (2010) Host genes associated with HIV/AIDS: advances in gene discovery. Trends in Genetics 26:3, 119-131
CrossRef89
M N Polizzotto, M Skinner, M F Cole-Sinclair, S S Opat, A Spencer, S Avery. (2010) Allo-SCT for hematological malignancies in the setting of HIV. Bone Marrow Transplantation 45:3, 584-586
CrossRef90
Min Liang, Masakazu Kamata, Kevin N. Chen, Nonia Pariente, Dong Sung An, Irvin S. Y. Chen. (2010) Inhibition of HIV-1 infection by a unique short hairpin RNA to chemokine receptor 5 delivered into macrophages through hematopoietic progenitor cell transduction. The Journal of Gene Medicine 12:3, 255-265
CrossRef91
S. Shimizu, P. Hong, B. Arumugam, L. Pokomo, J. Boyer, N. Koizumi, P. Kittipongdaja, A. Chen, G. Bristol, Z. Galic, J. A. Zack, O. Yang, I. S. Y. Chen, B. Lee, D. S. An. (2010) A highly efficient short hairpin RNA potently down-regulates CCR5 expression in systemic lymphoid organs in the hu-BLT mouse model. Blood 115:8, 1534-1544
CrossRef92
John S. Albin, Reuben S. Harris. (2010) Interactions of host APOBEC3 restriction factors with HIV-1 in vivo: implications for therapeutics. Expert Reviews in Molecular Medicine 12,
CrossRef93
Yoko Oka, Haruko Tashiro, Mitsuho Mizutani-Noguchi, Ichiro Koga, Toshihiko Sugao, Ryosuke Shirasaki, Toshiyuki Miura, Nobu Akiyama, Kazuo Kawasugi, Shin Fujimori, Naoki Shirafuji. (2010) Successful unrelated bone marrow transplantation for a human immunodeficiency virus type-1-seropositive acute myelogenous leukemia patient following HAART. International Journal of Hematology 91:1, 140-145
CrossRef94
José A. Esté, Tomas Cihlar. (2010) Current status and challenges of antiretroviral research and therapy. Antiviral Research 85:1, 25-33
CrossRef95
Manel Juan, Roger Colobran. 2009. Chemokines and Chemokine Receptors. .
CrossRef96
Joseph S Anderson, John Javien, Jan A Nolta, Gerhard Bauer. (2009) Preintegration HIV-1 Inhibition by a Combination Lentiviral Vector Containing a Chimeric TRIM5α Protein, a CCR5 shRNA, and a TAR Decoy. Molecular Therapy 17:12, 2103-2114
CrossRef97
Friso L.H. Muntinghe, Sascha Gross, Stephan J.L. Bakker, Gijs W.D. Landman, Pim van der Harst, Henk J.G. Bilo, Gerjan Navis, Mike W. Zuurman. (2009) CCR5Δ32 genotype is associated with outcome in type 2 diabetes mellitus. Diabetes Research and Clinical Practice 86:2, 140-145
CrossRef98
Vincent Soriano, Carlo-Federico Perno, Rolf Kaiser, Vincent Calvez, Jose M Gatell, Giovanni di Perri, Deenan Pillay, Juergen Rockstroh, Anna María Geretti. (2009) When and how to use maraviroc in HIV-infected patients. AIDS 23:18, 2377-2385
CrossRef99
Joseph S Anderson, Jon Walker, Jan A Nolta, Gerhard Bauer. (2009) Specific Transduction of HIV-Susceptible Cells for CCR5 Knockdown and Resistance to HIV Infection: A Novel Method for Targeted Gene Therapy and Intracellular Immunization. JAIDS Journal of Acquired Immune Deficiency Syndromes 52:2, 152-161
CrossRef100
Ben Berkhout. (2009) Toward a Durable Anti-HIV Gene Therapy Based on RNA Interference. Annals of the New York Academy of Sciences 1175:1, 3-14
CrossRef101
Anastas Pashov, Swetha Garimalla, Behjatolah Monzavi-Karbassi, Thomas Kieber-Emmons. (2009) Carbohydrate targets in HIV vaccine research: lessons from failures. Immunotherapy 1:5, 777-794
CrossRef102
Manish Sagar. (2009) Clinical implications of new findings in HIV basic research. HIV Therapy 3:4, 351-360
CrossRef103
Joe Alper. (2009) One-off therapy for HIV. Nature Biotechnology 27:4, 300-300
CrossRef104
(2009) Trial watch: Novel HIV gene therapy enters Phase I trial. Nature Reviews Drug Discovery 8:4, 267-267
CrossRef105
(2009) Bone marrow transplant muffles HIV. Nature Medicine 15:4, 371-371
CrossRef106
(2009) In Brief. Nature Reviews Immunology 9:4, 227-227
CrossRef107
Levy, Jay A., . (2009) Not an HIV Cure, but Encouraging New Directions. New England Journal of Medicine 360:7, 724-725
Full Text108
Heidi Ledford. (2009) Stem-cell transplant wipes out HIV. Nature
CrossRef
