Original Article
Brief Report
HHV-6A in Syncytial Giant-Cell Hepatitis
N Engl J Med 2008; 359:593-602August 7, 2008
- Abstract
Syncytial giant-cell hepatitis is a rare but severe form of hepatitis that is associated with autoimmune diseases, drug reactions, and viral infections. We used serologic, molecular, and immunohistochemical methods to search for an infectious cause in a case of syncytial giant-cell hepatitis that developed in a liver-transplant recipient who had latent infection with variant B of human herpesvirus 6 (HHV-6B) and who had received the organ from a donor with variant A latent infection (HHV-6A). At the onset of the disease, the detection of HHV-6A (but not HHV-6B) DNA in plasma, in affected liver tissue, and in single micromanipulated syncytial giant cells with the use of two different polymerase-chain-reaction (PCR) assays indicated the presence of active HHV-6A infection in the patient. Expression of the HHV-6A–specific early protein, p41/38, but not of the HHV-6B–specific late protein, p101, was demonstrated only in liver syncytial giant cells in the absence of other infectious pathogens. The same markers of HHV-6A active infection were documented in serial follow-up samples from the patient and disappeared only at the resolution of syncytial giant-cell hepatitis. Neither HHV-6B DNA nor late protein was identified in the same follow-up samples from the patient. Thus, HHV-6A may be a cause of syncytial giant-cell hepatitis.
Media in This Article
Figure 1
Clinical Course of the Patient.Figure 2
Histologic and Immunohistochemical Findings in Biopsy Specimens from the Patient and a Control Subject.Article Activity
- Article
Syncytial giant-cell hepatitis is an uncommon form of hepatitis in the post-infantile period, clinically characterized by a severe, often fatal course that is associated with autoimmune diseases, drug reactions, and viral infections.1-4 Although a potential paramyxoviral cause has been suggested, no direct evidence of the putative infectious agent has yet been found on electron microscopy.1-4 Medical therapies, namely immunosuppressive drugs and antiviral treatments, have been tried with limited success, and orthotopic liver transplantation is often the only therapeutic option, although the disease may recur after transplantation.1-5
HHV-6, a ubiquitous beta-herpesvirus with two distinct variants, A and B, is the causative agent of sixth disease of childhood.6,7 After primary infection, HHV-6 establishes a latent state in the host, but it may reactivate and cause illness in immunocompromised patients.6,8 HHV-6 reactivation occurs in 40 to 50% of recipients of bone marrow and solid-organ transplants, mostly due to variant B, with variant A accounting for less than 2 to 3% of infections. Active infection (or reactivation) has been associated with bone marrow suppression, encephalitis, pneumonitis, and hepatitis.8 Occasionally, HHV-6 infection may result from primary infection as a consequence of virus transmission from the donor to the recipient through a transplanted organ.6,8 We describe a case of severe post-transplantation syncytial giant-cell hepatitis in an adult patient who was latently infected with HHV-6B.
Case Report
A 43-year-old man with Caroli's disease underwent orthotopic liver transplantation because of recurrent cholangitis. Serologic analyses that were performed before transplantation were positive for cytomegalovirus (CMV), Epstein–Barr virus (EBV), human herpes simplex viruses 1 and 2 (HSV-1 and HSV-2), varicella–zoster virus (VZV), and parvovirus B19 and were negative for human immunodeficiency virus (HIV) and hepatitis virus types A, B, and C. Serologic analyses of the donor were positive for CMV and EBV and negative for HIV and hepatitis virus types A, B, and C.
Induction immunosuppression consisted of a triple-drug schedule with tacrolimus, corticosteroids, and mycophenolate mofetil. Maintenance immunosuppression consisted of tacrolimus with trough blood levels of 10 to 15 ng per milliliter after postoperative day 2. On day 10, fever developed. The physical examination was unremarkable. A full blood count showed mild neutrophil leukocytosis, and liver-function tests revealed elevated levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) (Figure 1Figure 1
Clinical Course of the Patient.).Microbiologic cultures and molecular examination of blood, urine, and stool were normal. PCR assays of body fluids were negative for hepatitis viruses B and C, CMV, EBV, HSV-1, HSV-2, VZV, parvovirus B19, human herpesviruses 7 and 8 (HHV-7 and HHV-8), adenovirus, and polyomaviruses (JC and BK). Abdominal ultrasonography showed mild splenomegaly. Empiric antibiotic and antifungal treatments were started, and a liver biopsy was performed. Histologic examination revealed signs of moderate acute graft rejection, according to the Banff grading score.9
High-dose corticosteroid pulse treatment, followed by the administration of the monoclonal antibody muromonab-CD3 (OKT3), was undertaken for 5 days. Despite gradual improvement in AST and ALT levels, the cholestatic indexes increased and fever persisted (Figure 1). On day 13, the results of another liver biopsy showed improvement in the acute graft rejection (indeterminate, according to Banff grading) and the appearance of few giant-cell hepatocytes. On day 16, microbiologic and molecular examinations again were normal, including for the aforementioned viruses, except for HHV-6, which was positive on PCR. Intravenous ganciclovir was started at a dose of 5 mg per kilogram of body weight twice daily. On day 18, the results of a third liver biopsy showed complete resolution of acute graft rejection and diffuse giant transformation of hepatocytes, consistent with syncytial giant-cell hepatitis (Figure 2AFigure 2
Histologic and Immunohistochemical Findings in Biopsy Specimens from the Patient and a Control Subject.). On day 34, after continued ganciclovir therapy, the fever resolved, but the cholestatic indexes remained elevated, and the full blood count disclosed anemia (hemoglobin, 8.5 g per deciliter), with an elevated reticulocyte count (40%) and lactate dehydrogenase level (2140 IU per liter), thrombocytopenia (platelet count, 45,000 per cubic millimeter), and mild renal failure (creatinine level, 2.1 mg per deciliter [186 μmol per liter]). The Coombs test and analyses for antiplatelet antibodies were negative. HHV-6 viremia was still detectable in plasma, in the absence of all the other pathogens, either by culture or molecular examination, and the results of a new liver biopsy showed the persistence of syncytial giant-cell hepatitis. A diagnosis of thrombotic microangiopathy was suspected.Another course of corticosteroid pulse treatment was administered. After 2 weeks, the full blood count normalized, and the cholestatic indexes markedly improved. Corticosteroids (i.e., prednisone) were progressively reduced to 5 mg per day, and on day 56, ganciclovir was switched to an oral formulation at a dose of 1 g three times daily. After 2 months, the patient was asymptomatic, plasma HHV-6 was still detectable on PCR assay, and a liver-biopsy specimen showed mild signs of syncytial giant-cell hepatitis. HHV-6 became undetectable in plasma after 4 months. At 1 year, the results of liver biopsy were normal, and oral ganciclovir was reduced to 250 mg twice daily for an additional year.
Methods
Serologic Studies
The serologic assays that were performed have been described previously.10 The sources of virus antigens were the GS strain (variant A) of HHV-6 passaged in the T-cell acute lymphoblastic leukemia–derived cell line, HSB-2, and the Z29 strain (variant B) passaged in Molt3 cells. The serologic results were evaluated with sample identities masked.
Histopathological and Immunohistochemical Studies
Formalin-fixed and paraffin-embedded liver specimens were obtained from fine-needle biopsy from the patient on postoperative days 11, 13, 18, 40, and 44 and at 3 and 6 months and 1 year after transplantation. The specimens were stained with hematoxylin and eosin for routine histologic studies.
In situ hybridization and immunohistochemical analyses with standard immunoperoxidase-staining procedures were performed, as described previously,11,12 with the use of a mouse monoclonal antibody against the early protein (p41/38) of HHV-6A (Advanced Biotechnologies); a mouse monoclonal antibody against the late protein (p101K) of HHV-6B (Chemicon International); monoclonal or polyclonal antibodies against HSV-1 and HSV-2 (code numbers, B0114 and B0116, respectively) at a dilution of 1:200, against CMV (clone CCH2) at a dilution of 1:50, against EBV (EBER, PNA probe/Fluorescein), and against human papillomavirus (clone K1H8) at a dilution of 1:100 (all from Dakopatts); and monoclonal antibody against adenovirus (clone 20/11) at a dilution of 1:100 (Chemicon).11,12 Both HHV-6 monoclonal antibodies were applied for 1 hour at room temperature (dilution 1:200) after antigen retrieval in a microwavable pressure cooker (Nordic Ware) containing 1.5 liters of 10 mM citrate buffer (pH 6.0) with 0.1% Tween 20 and were microwaved (Model R4A80, Sharp Electronics) for 8 minutes at 700 W. They were visualized with the use of EnvisionPlus (Dako), according to the manufacturer's instructions.11,12
Molecular Studies and Micromanipulation and Single-Cell PCR
Molecular studies and micromanipulation and single-cell PCR were performed as described previously.13,14 A quantitative real-time PCR assay was performed with the use of a commercially available diagnostic kit (Nanogen Advanced Diagnostics) in order to quantify the HHV-6 load in the donor's peripheral-blood leukocytes, as well as in the five available liver-biopsy specimens from the patient. Results by quantitative PCR were confirmed by an independent laboratory. The presence of DNA from herpesvirus (EBV, CMV, HHV-6, HHV-8, HHV-7, HSV-1, HSV-2, and VZV), adenovirus, and polyomavirus (either JC or BK) was confirmed in micromanipulated single giant-cell hepatocytes by PCR analysis with the use of protocols that have been described previously.13-17 Results were confirmed by an independent laboratory in a double-blinded manner.
To obtain efficient PCR amplification of HHV-6 DNA in single cells from formalin-fixed, paraffin-embedded tissues, two new primers were designed to amplify a 306-bp fragment (left primer, 5′ATCACGATCGGCGTGCTAT3′; right primer, 5′ATGGATTTCCGTGGAAGAAA3′). The number of cycles was 35 at an annealing temperature of 55°C. The PCR conditions were the same as those reported previously.13
The characterization of HHV-6 variants was performed by restriction analysis of the HHV-6 PCR product13 and also by a highly sensitive primer-specific PCR assay, as described previously.18 Moreover, in order to obtain efficient PCR amplification of HHV-6 in single cells from formalin-fixed, paraffin-embedded tissues with the primer-specific PCR assay, the probe, as originally described by Boutolleau et al.,18 was used as an internal primer for a second round of PCR to amplify a 113-bp fragment.
Results
Serologic Studies
On the day of transplantation, serum from the donor was negative for IgM and positive for IgG antibodies against HHV-6 at a titer of 1:80, and serum from the patient was negative for IgM and positive for IgG antibodies against HHV-6 at a titer of 1:40 (Figure 1). After urea treatment of the samples, the HHV-6 IgG titers, from both the donor and the patient, were reduced by a factor of 4 or less (log2 reduction, ≤2), indicative of high-avidity antibodies and consistent with the HHV-6 seropositive status.
On postoperative day 16, the patient had both a positive IgM titer (1:40) and a rising titer of IgG antibodies against HHV-6. The avidity of the latter was low, as shown by the reduction in the IgG titer by a factor of 8 after washing with urea (from 1:2560 to 1:320; log2 reduction, 3). A reduction in the antibody titer by a factor of 8 after urea treatment is mild and not conclusive for the presence of low-avidity IgG in our patient, although a similar finding in a transplant recipient was described previously.10 Since the serologic assay cannot discriminate between the two HHV-6 variants, we hypothesized that this borderline drop in IgG after urea treatment could be ascribed to the presence of a mixture of low-avidity IgG antibodies against HHV-6A and high-avidity IgG antibodies against HHV-6B so that this background of high-avidity antibodies would have prevented a sharper decrease in the IgG titers. These serologic findings, which suggested possible active viral infection, spurred us to investigate whether HHV-6A was the replicating virus in our patient with latent HHV-6B infection (Figure 1).
Molecular Studies
The identification of HHV-6 variants A and B in all samples from the donor and the patient was confirmed by two different assays: a primer-specific PCR assay (Figure 3Figure 3
Detection of HHV-6 and Y Chromosome by Primer-Specific Polymerase Chain Reaction (PCR).)13 and a restriction analysis of the HHV-6 PCR product (Figure 4E and 4FFigure 4
Micromanipulation of Syncytial Giant Cells and Polymerase-Chain-Reaction (PCR) Detection of HHV-6A.).18 At the time of transplantation, HHV-6A (but not HHV-6B) DNA was detected in peripheral-blood leukocytes from the donor, with a viral load of 4500 genome equivalents (gEq) per microgram of DNA. At the same time, HHV-6B (but not HHV-6A) DNA was detected in peripheral-blood leukocytes from the patient on PCR (Figure 3A). On PCR assay, HHV-6A DNA was detected in the patient's plasma at a relatively low titer (20 to 40 genomes per milliliter), starting on postoperative day 16 and persisting at similar levels until the sixth month after transplantation, whereas HHV-6B DNA was never detected in the same plasma samples (Figure 1).PCR that was performed on formalin-fixed, paraffin-embedded liver sections showed HHV-6A (but not HHV-6B) DNA on postoperative day 18, concomitant with the onset of clinical symptoms and the appearance of the histologic signs of syncytial giant-cell hepatitis, as well as on all subsequent samples except for the last, which was collected 1 year after transplantation, concomitant with the histologic resolution of syncytial giant-cell hepatitis (Figure 3A). The following viral loads (per microgram of DNA) were detected in the patient's paraffin-embedded liver-biopsy samples with histologic signs of syncytial giant-cell hepatitis: day 18, 44,000 gEq; day 40, 800 gEq; day 44, 700 gEq; and day 109, 700 gEq. A viral load of 10 gEq per microgram or less of DNA was detected in a liver-biopsy specimen after the resolution of syncytial giant-cell hepatitis on postoperative day 354 (Figure 1).
Single-cell PCR that was performed on micromanipulated giant-cell hepatocytes from the liver-biopsy specimen on day 18 confirmed the presence of HHV-6A DNA, at an average level of 500 to 850 genomes per cell, but not HHV-6B or other viruses mentioned above. HHV-6A DNA was found only in giant-cell hepatocytes with an amplification efficiency ranging from 40 to 50%14 (Figure 3B and Figure 4A through 4F). HHV-6A DNA was not detected in any of the 90 to 100 normal uninuclear hepatocytes, whereas Y-chromosome DNA could be amplified in 10 to 20% of the same cells (Figure 3C and 3D).
Immunohistochemical Studies
Immunohistochemical analysis of the liver-biopsy specimen obtained on day 18 with the use of p41/38 monoclonal antibody against HHV-6A highlighted cytoplasmic reactivity only in giant-cell hepatocytes, confirming their productive infection by HHV-6A (Figure 2B). The result of such analysis was negative with antibodies against the other viruses (Figure 2C). The same analysis for HHV-6A had negative results on a liver-biopsy sample without syncytial giant-cell hepatitis, collected 1 year after transplantation (Figure 2D). Immunohistochemical analysis with the HHV-6B p101K monoclonal antibody on a liver-biopsy specimen obtained on day 18 was negative (Figure 2E). Such analysis showed intense staining of follicular dendritic cells of a reactive germinal center in a patient with HHV-6–related lymphadenopathy, who was tested as a positive control subject and was found to have HHV-6B DNA11,12 (Figure 2F).
Discussion
In this patient, active HHV-6 infection was manifested as syncytial giant-cell hepatitis. These findings implicate HHV-6 as a possible new cause of this disease. In most cases, syncytial giant-cell hepatitis that is caused by an infectious agent has been related to a paramyxoviral source, as determined either by the finding of structures resembling nucleocapsids of paramyxoviruses in hepatocytes or by the theory that the fusion of cells to form syncytial giant cells is a pathologic feature of paramyxovirus infection.1-5
A possible relationship between HHV-6 and syncytial giant-cell hepatitis has been suggested previously on the basis of serologic positivity to HHV-6 in a single patient, in whom both an acute drug reaction and an autoimmune disease might have been other causative factors.19 The demonstration of HHV-6A active infection by several methods in plasma, liver tissue, and single giant-cell hepatocytes, which coincided with the onset of the patient's symptoms and histologic diagnosis, provides strong evidence that HHV-6A had a pathogenic role in this case. Extensive and repeated microbiologic testing during the entire course of the disease did not identify any other potential cause. Of interest, HHV-6 has been reported to induce cell–cell fusion in lymphocytes and epithelial cells both in vitro and in vivo in a manner similar to that of paramyxoviruses.20-22
We have also documented the transmission of HHV-6A from a liver donor to a recipient with latent HHV-6B infection by showing the presence of either HHV-6A DNA or antigen in plasma and affected liver tissue from the recipient after transplantation. It has been reported that the detection of HHV-6 DNA in plasma, even at low titers, is correlated with active viral replication in immunosuppressed patients.23,24 HHV-6 chromosomal integration may occur in vivo, either in patients with various diseases or in healthy subjects, and is associated with the persistence of a high viral load in infected cells.6,25 The viral load in a sample of peripheral-blood leukocytes from the donor at the time of transplantation was elevated but not at a level typically seen with HHV-6 chromosomal integration.25
Of note, it has been reported that HHV-6 is frequently reactivated in critically ill patients as a result of stress-related mechanisms, without affecting the severity of disease.26 It remains to be established whether such a reactivation is critical to the viral transmission and whether it could enhance pathogenicity in organ recipients. Furthermore, the progressive decrease in the viral load in serial liver-biopsy and plasma samples from the patient makes it unlikely that integrated HHV-6 was transmitted through liver transplantation and stably retained in the recipient's liver. It is also unlikely that HHV-6 DNA that was detected in the patient's plasma was simply the result of the shedding of stably infected cells. On the other hand, the absence of HHV-6B DNA and antigen in plasma and affected liver tissue in a patient with latent HHV-6B infection strongly suggests that HHV-6B did not have a pathogenic role.
These findings also raise issues about the immune response to the two HHV-6 variants and provide further arguments in support of systematic virologic screening of organ donors. Although HHV-6A and HHV-6B are supposed to stimulate cross-reactive T-cell responses because they share more than 88% sequence homology,27,28 it has been reported that at least 7% of the T-cell clones that are reactive to HHV-6 show specific and distinct patterns of proliferation either to variant A or variant B in vitro.29 The HHV-6A active infection in our patient suggests that the immune response that was mounted against HHV-6B may not have been protective against HHV-6A. Thus, more extensive screening of organ donors, on the basis of a wider panel of tests for both variants, may specifically address the infectious risks of the recipients and have consequences in designing prophylactic or preemptive therapeutic strategies, as in the case of CMV.8 In our patient, we continued ganciclovir for a prolonged time, because a few cases of syncytial giant-cell hepatitis were reported to have resolved with prolonged courses of ribavirin.30,31 It is unclear which factor — the use of antiviral therapy or the patient's recovery of immune function — led to the resolution of disease in this patient over several months.32,33 In conclusion, HHV-6 should be included among the possible causes of syncytial giant-cell hepatitis, at least in liver-transplant recipients.
Supported by grants from the Italian Ministry for Education, Universities, and Research (to Dr. Torelli), the Associazione Italiana per la Ricerca sul Cancro (to Dr. Luppi), the European Commission's Sixth FrameWork Programme, INCA project (2005-018704) (to Drs. Luppi and Schulz), the Associazione Italiana Lotta alle Leucemie, Linfoma e Mieloma, Modena Omlus (to Dr. Potenza), and the Programma di Ricerca Regione Università 2007–2009 (to Dr. Torelli).
No potential conflict of interest relevant to this article was reported.
Drs. Potenza, Luppi, and Barozzi contributed equally to this article.
We thank Claudio Cermelli and Gianandrea Pasquinelli for their technical advice and Alberto Bagni and Antonio Daniele Pinna for their clinical follow-up of the patient.
Source Information
From the Department of Oncology and Hematology (L.P., M.L., P.B., G.T.), the Integrated Department of Diagnostic and Laboratory Services and Legal Medicine (G.R., M. Pecorari, W.G., M. Portolani), the Department of Internal Medicine and Medical Specialties (S.C., M.C., G.G.), and the Liver and Multivisceral Transplant Center (M.M., F.D.B., G.E.G.) — all at the University of Modena and Reggio Emilia, Azienda Ospedaliera Policlinico, Modena; and the Department of Clinical and Experimental Medicine, University of Bologna, and St. Orsola Malpighi General Hospital, Bologna (T.L., M.P.L.) — all in Italy; and the Department of Virology, Hannover Medical School, Hannover, Germany (T.F.S.).
Address reprint requests to Dr. Luppi at the Department of Oncology and Hematology, University of Modena and Reggio Emilia, Azienda Ospedaliera Policlinico, Via del Pozzo 71, 41100 Modena, Italy, or at mario.luppi@unimore.it.
- References
References
1
Phillips MJ ,Blendis LM ,Poucell S , et al. Syncytial giant-cell hepatitits: sporadic hepatitis with distinctive pathologic features, a severe clinical course, and paramyxoviral features. N Engl J Med 1991;324:455-460
Full Text | Web of Science | Medline2
Lau JYN ,Koukoulis G ,Mieli-Vergani G ,Portmann BC ,Williams R . Syncytial giant-cell hepatitis -- a specific disease entity? J Hepatol 1992;15:216-219
CrossRef | Web of Science | Medline3
Devaney K ,Goodman ZD ,Ishak KG . Postinfantile giant-cell transformation in hepatitis. Hepatology 1992;16:327-333
CrossRef | Web of Science | Medline4
Fimmel CJ ,Guo L ,Compans RW , et al. A case of syncytial giant cell hepatitis with features of a paramyxoviral infection. Am J Gastroenterol 1998;93:1931-1937
CrossRef | Web of Science | Medline5
Pappo O ,Yunis E ,Jordan JA , et al. Recurrent and de novo giant cell hepatitis after orthotopic liver transplantation. Am J Surg Pathol 1994;18:804-813
CrossRef | Web of Science | Medline6
Maciejewski JP, Luppi M, Torelli G. Human cytomegalovirus, human herpesvirus 8, and other herpesviruses. In: Young NS, Gerson ST, High KA. Clinical hematology. St. Louis: Mosby, 2006:967-80.
7
Zerr DM ,Meier AS ,Selke SS , et al. A population-based study of primary human herpesvirus 6 infection. N Engl J Med 2005;352:768-776
Full Text | Web of Science | Medline8
Ljungman P . β-Herpesvirus challenges in the transplant recipient. J Infect Dis 2002;186:Suppl 1:S99-S109
CrossRef | Web of Science | Medline9
Demetris AJ ,Batts KP ,Dhillon AP , et al. Banff schema for grading liver allograft rejection: an international consensus document. Hepatology 1997;25:658-663
CrossRef | Web of Science | Medline10
Ward KN ,Gray JJ ,Joslin ME ,Sheldon MJ . Avidity of IgG antibodies to human herpesvirus-6 distinguishes primary from recurrent infection in organ transplant recipients and excludes cross-reactivity with other herpesviruses. J Med Virol 1993;39:44-49
CrossRef | Web of Science | Medline11
Maric I ,Bryant R ,Abu-Asab M , et al. Human herpesvirus-6-associated acute lymphadenitis in immunocompetent adults. Mod Pathol 2004;17:1427-1433
CrossRef | Web of Science | Medline12
Luppi M ,Barozzi P ,Garber R , et al. Expression of human herpesvirus-6 antigens in benign and malignant lymphoproliferative diseases. Am J Pathol 1998;153:815-823
CrossRef | Web of Science | Medline13
Portolani M ,Tamassia MG ,Gennari W , et al. Post-mortem diagnosis of encephalitis in a 75-year-old man associated with human herpesvirus-6 variant A. J Med Virol 2005;77:244-248
CrossRef | Web of Science | Medline14
Barozzi P ,Luppi M ,Facchetti F , et al. Post-transplant Kaposi sarcoma originates from the seeding of donor-derived progenitors. Nat Med 2003;9:554-561[Erratum, Nat Med 2003;9:975.]
CrossRef | Web of Science | Medline15
Wang FZ ,Dahl H ,Linde A ,Brytting M ,Ehrnst A ,Ljungman P . Lymphotropic herpesviruses in allogeneic bone marrow transplantation. Blood 1996;88:3615-3620
Web of Science | Medline16
MacKenzie J ,Perry J ,Ford AM ,Jarrett RF ,Greaves M . JC and BK virus sequences are not detectable in leukaemic samples from children with common acute lymphoblastic leukaemia. Br J Cancer 1999;81:898-899
CrossRef | Web of Science | Medline17
Bultmann BD ,Klingel K ,Sotlar K ,Bock T ,Kandolf R . Parvovirus B19: a pathogen responsible for more than hematologic disorders. Virchows Arch 2003;442:8-17
Web of Science | Medline18
Boutolleau D ,Duros C ,Bonnafous C , et al. Identification of human herpesvirus 6 variants A and B by primer-specific real-time PCR may help to revisit their respective role in pathology. J Clin Virol 2006;35:257-263
CrossRef | Web of Science | Medline19
Kuntzen T ,Friedrichs N ,Fisher PH ,Eis-Hubinger AM ,Sauerbruch T ,Spengler U . Postinfantile giant-cell hepatitis with autoimmune features following a human herpesvirus 6-induced adverse drug reaction. Eur J Gastoenterol Hepatol 2005;17:1131-1134
CrossRef | Web of Science | Medline20
Mori Y ,Seya T ,Huang HL ,Akkapaiboon P ,Dhepakson P ,Yamanishi K . Human herpesvirus 6 variant A but not variant B induces fusion from without in a variety of human cells through a human herpesvirus 6 entry receptor, CD46. J Virol 2002;76:6750-6761
CrossRef | Web of Science | Medline21
Pedersen SM ,Oster B ,Bundgaard B ,Hollsberg P . Induction of cell-cell fusion from without by human herpevirus 6B. J Virol 2006;80:9916-9920
CrossRef | Web of Science | Medline22
Randhawa PS ,Jenkins FJ ,Nalesnik MA , et al. Herpesvirus 6 variant A infection after heart transplantation with giant cell transformation in bile ductular and gastroduodenal epithelium. Am J Surg Pathol 1997;21:847-853
CrossRef | Web of Science | Medline23
Zerr DM ,Corey L ,Huang ML ,Kim HW ,Nguy L ,Boeckh M . Clinical outcomes of human herpesvirus 6 reactivation after hematopoietic stem cell transplantation. Clin Infect Dis 2005;40:932-940
CrossRef | Web of Science | Medline24
Secchiero P ,Carrigan DR ,Asano Y , et al. Detection of human herpesvirus 6 in plasma of children with primary infection and immunosuppressed patients by polymerase chain reaction. J Infect Dis 1995;171:273-280
CrossRef | Web of Science | Medline25
Ward KN ,Leong HN ,Thiruchelvam AD ,Atkinson CE ,Clark DA . Human herpesvirus 6 DNA levels in cerebrospinal fluid due to primary infection differ from those due to chromosomal viral integration and have implications for diagnosis of encephalitis. J Clin Microbiol 2007;45:1298-1304
CrossRef | Web of Science | Medline26
Razonable RR ,Fanning C ,Brown RA , et al. Selective reactivation of human herpesvirus 6 variant A occurs in critically ill immunocompetent hosts. J Infect Dis 2002;185:110-113
CrossRef | Web of Science | Medline27
Wang FZ ,Dahl H ,Ljungman P ,Linde A . Lymphoproliferative responses to human herpesvirus-6 variant A and variant B in healthy adults. J Med Virol 1999;57:134-139
CrossRef | Web of Science | Medline28
De Bolle L ,Naesens L ,De Clercq E . Update on human herpesvirus 6 biology, clinical features, and therapy. Clin Microbiol Rev 2005;18:217-245
CrossRef | Web of Science | Medline29
Yasukawa M ,Yakushijin Y ,Furukawa M ,Fujita S . Specificity analysis of human CD4+ T-cell clones directed against human herpesvirus 6 (HHV-6), HHV-7, and human cytomegalovirus. J Virol 1993;67:6259-6264
Web of Science | Medline30
Roberts E ,Ford-Jones EL ,Phillips JM . Ribavirin for syncytial giant cell hepatitis. Lancet 1993;341:640-641
CrossRef | Web of Science | Medline31
Moreno A ,Moreno A ,Perez-Elias MJ , et al. Syncytial giant cell hepatitis in human immunodeficiency virus-infected patients with chronic hepatitits C: 2 cases and review of the literature. Hum Pathol 2006;37:1344-1349
CrossRef | Web of Science | Medline32
Razonable RR ,van Cruijsen H ,Brown RA , et al. Dynamics of cytomegalovirus replication during preemptive therapy with oral ganciclovir. J Infect Dis 2003;187:1801-1808
CrossRef | Web of Science | Medline33
Singh N ,Bentlejewski C ,Carrigan DR ,Gayowski T ,Knox KK ,Zeevi A . Persistent lack of human herpesvirus-6 specific T-helper cell response in liver transplant recipients. Transpl Infect Dis 2002;4:59-63
CrossRef | Medline
- Citing Articles (20)
Citing Articles
1
Stefan Welte, Michael Gagesch, Achim Weber, Thomas Longerich, Gunda Millonig. (2012) Fulminant liver failure in Wilson’s disease with histologic features of postinfantile giant cell hepatitis; cytomegalovirus as the trigger for both?. European Journal of Gastroenterology & Hepatology1
CrossRef2
Stefan G. Hübscher, Andrew D. Clouston. 2012. Transplantation pathology. , 853-933.
CrossRef3
Ulrich Spengler, Hans-Peter Fischer, Wolfgang H. Caselmann. 2012. Liver Disease Associated with Viral Infections. , 629-643.
CrossRef4
Sven Pischke, Juliane Gösling, Ilka Engelmann, Jerome Schlue, Benno Wölk, Elmar Jäckel, Christoph Meyer-Heithuis, Ulrich Lehmann, Christian P Strassburg, Hannelore Barg-Hock, Thomas Becker, Michael P Manns, Thomas Schulz, Heiner Wedemeyer, Albert Heim. (2012) High intrahepatic HHV-6 virus loads but neither CMV nor EBV are associated with decreased graft survival after diagnosis of graft hepatitis. Journal of Hepatology
CrossRef5
Teemu Karlsson, Laura Mannonen, Raisa Loginov, Maija Lappalainen, Krister Höckerstedt, Irmeli Lautenschlager. (2012) Development of a new quantitative real-time HHV-6-PCR and monitoring of HHV-6 DNAaemia after liver transplantation. Journal of Virological Methods
CrossRef6
L. Potenza, D. Vallerini, P. Barozzi, G. Riva, F. Forghieri, E. Zanetti, C. Quadrelli, A. Candoni, J. Maertens, G. Rossi, M. Morselli, M. Codeluppi, A. Paolini, M. Maccaferri, C. Del Giovane, R. D'Amico, F. Rumpianesi, M. Pecorari, F. Cavalleri, R. Marasca, F. Narni, M. Luppi. (2011) Mucorales-specific T cells emerge in the course of invasive mucormycosis and may be used as a surrogate diagnostic marker in high-risk patients. Blood 118:20, 5416-5419
CrossRef7
Philip E. Pellett, Dharam V. Ablashi, Peter F. Ambros, Henri Agut, Mary T. Caserta, Vincent Descamps, Louis Flamand, Agnès Gautheret-Dejean, Caroline B. Hall, Rammurti T. Kamble, Uwe Kuehl, Dirk Lassner, Irmeli Lautenschlager, Kristin S. Loomis, Mario Luppi, Paolo Lusso, Peter G. Medveczky, Jose G. Montoya, Yasuko Mori, Masao Ogata, Joshua C. Pritchett, Sylvie Rogez, Edward Seto, Katherine N. Ward, Tetsushi Yoshikawa, Raymund R. Razonable. (2011) Chromosomally integrated human herpesvirus 6: questions and answers. Reviews in Medical Virologyn/a-n/a
CrossRef8
Giuseppe Maggiore, Marco Sciveres, Monique Fabre, Laura Gori, Lucia Pacifico, Massimo Resti, Jean-Jacques Choulot, Emmanuel Jacquemin, Olivier Bernard. (2011) Giant Cell Hepatitis with Autoimmune Hemolytic Anemia in Early Childhood: Long-Term Outcome in 16 Children. The Journal of Pediatrics 159:1, 127-132.e1
CrossRef9
Matthieu Revest, Sophie Minjolle, David Veyer, Gisèle Lagathu, Christian Michelet, Ronald Colimon. (2011) Detection of HHV-6 in over a thousand samples: New types of infection revealed by an analysis of positive results. Journal of Clinical Virology 51:1, 20-24
CrossRef10
Jane WS Fang, Regino P González-Peralta, Sonny KF Chong, Grace M Lau, Gillian M Lau, Johnson YN Lau. (2011) Hepatic Expression of Cell Proliferation Markers and Growth Factors in Giant Cell Hepatitis: Implications for the Pathogenetic Mechanisms Involved. Journal of Pediatric Gastroenterology and Nutrition 52:1, 65-72
CrossRef11
Hiroki Hayashi, Ryoichi Narita, Masaaki Hiura, Shintaro Abe, Akinari Tabaru, Akihide Tanimoto, Yasuyuki Sasaguri, Masaru Harada. (2011) A Case of Adult Autoimmune Hepatitis with Histological Features of Giant Cell Hepatitis. Internal Medicine 50:4, 315-319
CrossRef12
Raymund R Razonable. (2010) Infections due to human herpesvirus 6 in solid organ transplant recipients. Current Opinion in Organ Transplantation 15:6, 671-675
CrossRef13
Amanda F. Peppercorn, Melissa B. Miller, David Fitzgerald, David J. Weber, Pamela A. Groben, Bruce A. Cairns. (2010) High-Level Human Herpesvirus-6 Viremia Associated With Onset of Stevens-Johnson Syndrome: Report of Two Cases. Journal of Burn Care & Research 31:2, 365-368
CrossRef14
Fabio Forghieri, Leonardo Potenza, Patrizia Barozzi, Daniela Vallerini, Giovanni Riva, Eleonora Zanetti, Chiara Quadrelli, Giuseppe Torelli, Mario Luppi. (2010) HHV-6 and atypical lymphoproliferative disorders: are only qualitative molecular examinations sufficient to support a pathogenetic role?. Leukemia & Lymphoma 51:3, 565-567
CrossRef15
R. R. Razonable, D. M. Zerr, . (2009) HHV-6, HHV-7 and HHV-8 in Solid Organ Transplant Recipients. American Journal of Transplantation 9, S97-S100
CrossRef16
M. Mennicke, A. Zawodniak, M. Keller, L. Wilkens, N. Yawalkar, F. Stickel, A. Keogh, D. Inderbitzin, D. Candinas, W. J. Pichler. (2009) Fulminant Liver Failure After Vancomycin in a Sulfasalazine-Induced DRESS Syndrome: Fatal Recurrence After Liver Transplantation. American Journal of Transplantation 9:9, 2197-2202
CrossRef17
Helen Pilmore, John Collins, Ian Dittmer, Laurie Williams, Logan Carpenter, Stephen Thomas, Margaret Croxson, Mark Thomas. (2009) Fatal Human Herpesvirus-6 Infection After Renal Transplantation. Transplantation 88:6, 762-765
CrossRef18
L. Potenza, P. Barozzi, M. Masetti, M. Pecorari, P. Bresciani, A. Gautheret-Dejean, G. Riva, D. Vallerini, S. Tagliazucchi, M. Codeluppi, F. Di Benedetto, G. E. Gerunda, F. Narni, G. Torelli, M. Luppi. (2009) Prevalence of Human Herpesvirus-6 Chromosomal Integration (CIHHV-6) in Italian Solid Organ and Allogeneic Stem Cell Transplant Patients. American Journal of Transplantation 9:7, 1690-1697
CrossRef19
Matthew Bates, Mwaka Monze, Humphrey Bima, Mirriam Kapambwe, David Clark, Francis C. Kasolo, Ursula A. Gompels. (2009) Predominant human herpesvirus 6 variant A infant infections in an HIV-1 endemic region of Sub-Saharan Africa. Journal of Medical Virology 81:5, 779-789
CrossRef20
Jay H. Lefkowitch. (2009) Recent developments in liver pathology. Human Pathology 40:4, 445-455
CrossRef
