Original Article
Brief Report
EGFR Mutation and Resistance of Non–Small-Cell Lung Cancer to Gefitinib
N Engl J Med 2005; 352:786-792February 24, 2005
- Abstract
Mutations of the epidermal growth factor receptor (EGFR) gene have been identified in specimens from patients with non–small-cell lung cancer who have a response to anilinoquinazoline EGFR inhibitors. Despite the dramatic responses to such inhibitors, most patients ultimately have a relapse. The mechanism of the drug resistance is unknown. Here we report the case of a patient with EGFR-mutant, gefitinib-responsive, advanced non–small-cell lung cancer who had a relapse after two years of complete remission during treatment with gefitinib. The DNA sequence of the EGFR gene in his tumor biopsy specimen at relapse revealed the presence of a second point mutation, resulting in threonine-to-methionine amino acid change at position 790 of EGFR. Structural modeling and biochemical studies showed that this second mutation led to gefitinib resistance.
Media in This Article
Figure 1
Identification of a Second EGFR Mutation.Figure 2
Mechanism of Drug Resistance.Article Activity
- Article
Non–small-cell lung cancer is the leading cause of death from cancer in both men and women in the United States.1 Chemotherapy, the mainstay of treatment in advanced disease, is only marginally effective,2,3 but gefitinib and erlotinib, which target the epidermal growth factor receptor (EGFR) pathway, show promise in the treatment of metastatic non–small-cell lung cancer.4 Response rates are 10 to 20 percent when these ATP-competitive anilinoquinazoline inhibitors are used as second- or third-line treatment for advanced disease.5-7
Responsiveness to these drugs is a characteristic of distinct subgroups of patients: women, patients who have never smoked, patients with adenocarcinoma, and Asians.8 In the majority of patients with highly responsive tumors, the tumor contains somatic mutations of the EGFR gene. These mutations are small deletions that affect amino acids 747 through 750 or point mutations (most commonly a replacement of leucine by arginine at codon 858 [L858R]).9-11 These mutations mediate oncogenic effects by altering downstream signaling and antiapoptotic mechanisms.12 Both types of mutation increase the sensitivity of the tumor to anilinoquinazoline inhibitors of EGFR, most likely by repositioning critical residues surrounding the ATP-binding cleft of the tyrosine kinase domain of the receptor, thereby stabilizing their interactions with both ATP and its competitive inhibitors.9,10 Notwithstanding the success of these drugs in cases of non–small-cell lung cancer with activating EGFR mutations, it appears that all cases eventually progress despite such treatment.
Case Report
A 71-year-old former smoker was found to have advanced, moderately differentiated adenocarcinoma of the lung in May 2001. The diagnostic transbronchial tumor-biopsy specimen had a deletion, delL747–S752,13 identical to a previously described EGFR mutation that is associated with responsiveness to gefitinib. The disease progressed despite treatment with carboplatin, taxanes, and gemcitabine. However, the patient had a clinical and radiographic response to gefitinib monotherapy, which was started in August 2002.
After 24 months of complete remission, during which he continued to take gefitinib monotherapy, his symptoms worsened and computed tomography revealed progressive lung abnormalities consistent with the occurrence of a relapse. At this point, gefitinib was stopped, the patient provided written informed consent, and a transbronchial aspirate and transbronchial biopsy specimen were obtained. Both cytologic and pathological analysis confirmed the presence of recurrent, moderately differentiated adenocarcinoma (Figure 1AFigure 1
Identification of a Second EGFR Mutation.) against a background of normal tissue, with approximately 30 percent of the specimen made up of tumor cells. We hypothesized that the patient's relapse may have been due to an acquired, second mutation in the EGFR gene that conferred resistance to gefitinib, and therefore, we resequenced the EGFR tyrosine kinase domain in the second biopsy specimen. Since the relapse, the patient has been receiving various salvage therapies for advanced lung cancer.Methods
Sequencing of the EGFR Gene
Genomic DNA was extracted from both tumor specimens from the patient, and exons 18 through 21 (the area of the EGFR gene coding for the tyrosine kinase domain) were amplified and sequenced as previously described.9 Sense and antisense sequences were obtained from the products of the same amplification reactions. All polymerase-chain-reaction (PCR) assays were repeated twice. The presence of the second mutation was confirmed by isolating RNA from the tumor specimen and sequencing the resultant complementary DNA (cDNA). Total RNA was extracted from paraffin-embedded tumor samples with the use of an RNA isolation kit (Optimum FFPE, Ambion Diagnostics). Then, 800 ng of total RNA was subjected to reverse-transcription PCR with random hexamer primers. Amplification of the cDNA (sense primer: 5'GTTAAAATTCCCGTCGCTATC3', and antisense primer: 5'GGACATAGTCCAGGAGGCAG3') yielded two fragments, a 196-bp (wild-type) fragment and a 178-bp (deletion product) fragment. PCR products were subcloned into the pGEM-T easy cloning vector (Invitrogen) and sequenced.
EGFR Expression Constructs
Constructs with the full-length wild-type EGFR, as well as the common mutations L858R and delL747–P753insS, were kindly provided by Dr. Kwok-Kin Wong. The delL747–S752 mutation (the initial EGFR mutation identified in our patient) and a second mutation in which methionine was substituted for threonine at position 790 (T790M — the second EGFR mutation identified in our patient) were introduced by means of a site-directed mutagenesis kit (QuikChange XL, Stratagene). All fragments containing point mutations or deletions, or both, were swapped with the corresponding sequence in wild-type EGFR that had been subcloned into plasmid DNA (pcDNA3.1). A hemagglutinin tag was added to the 3' end of the EGFR coding region. The resulting constructs were confirmed by sequencing.
Transfection and Western Blotting
For transient-transfection experiments, COS-7 or NIH-3T3 cells were plated at a concentration of 5×104 cells per well in six-well plates. The following day, these cells were transfected with 1 μg of the expression constructs with the use of Fugene 6 (Roche), incubated for 12 hours in serum, and then incubated in serum-free medium for an additional 12 hours. The cells were then stimulated with 100 ng of epidermal growth factor (EGF) per milliliter for 15 minutes (Sigma). To determine whether the mutant receptors were inhibited by gefitinib (AstraZeneca), AG1478 (Calbiochem), cetuximab (commercial supply), erlotinib (commercial supply), or CL-387,785 (Calbiochem), each drug was added to the culture medium three hours before the addition of EGF. Whole-cell extracts were separated on 8 percent sodium dodecyl sulfate–polyacrylamide gels, transferred to nitrocellulose or polyvinylidine difluoride membranes, and analyzed with the use of a chemiluminescence reagent (Western Lightning, PerkinElmer Life Science). Autophosphorylation of EGFR was detected with antibody against phosphotyrosine at position 1068 (1:1000 dilution; Cell Signaling Technology), and total protein expression was measured with the use of antibody against EGFR (1:1000 dilution; Santa Cruz Biotechnology).
Structural Modeling
The crystallographic structure of the EGFR tyrosine kinase domain, solved in complex with erlotinib, was used as a model for the prediction of kinase-inhibitor binding (Protein Data Bank accession code 1M17).14 The inhibitor and solvent were stripped from the model. We used the AutoDock program, version 3.0,15 to predict binding, first using a model of erlotinib, made by means of the JME molecular-editing feature of the online resource PRODRG.16 The erlotinib test yielded a model for ligand binding highly similar to that seen in the crystal structure. Using the AutoDockTools interface, we used a grid spacing of 0.375Å and 60×50×40 points centered around the catalytic cleft of the enzyme for docking and adopted the genetic algorithm with local search using default settings. Gefitinib and CL-387,785 were then docked with the use of the same protocol. To illustrate potential inhibitor clashes with the T790M mutant, we prepared figures in which threonine at position 790 (T790) is mutated to methionine. We then chose the lowest free-energy cluster that overlapped in the quinazoline moiety with the crystallographic coordinates found for erlotinib binding.
Results
Exons 18 through 21 of the EGFR gene were sequenced from DNA isolated from both the original diagnostic biopsy specimen and the biopsy specimen obtained at relapse. These exons encompass most of the tyrosine kinase binding domain of EGFR and all activating EGFR mutations described thus far. The original diagnostic biopsy specimen contained a small deletion mutation, delL747–S752, consistent with other, commonly identified EGFR mutations. Examination of the sequences of exon 19 confirmed the persistence of the original delL747–S752 mutation in the second biopsy specimen.
Comparison of the DNA sequences from the original diagnostic biopsy specimen and the second biopsy specimen demonstrated the presence of a new, double peak in exon 20, which was confirmed by re-amplification and sequencing in both sense and antisense directions (Figure 1B). The product of exon 20 amplification was subcloned, and multiple subclones were sequenced. Whereas 13 of 17 subclones demonstrated wild-type sequences, 4 contained an identical single base-pair change from cytosine to thymidine (C to T) (Figure 1B), confirming that the new peak was caused by a base-pair change at this position (position 164208; GenBank accession number AY588246).
To obtain further evidence of the presence of a second mutation, cDNA was generated from RNA isolated from the paraffin block of the biopsy specimen obtained at the time of relapse. The cDNA was amplified, and the C-to-T base-pair change was confirmed in 14 of 40 subclones. Interestingly, the C-to-T base-pair change was consistently observed with either wild-type or delL747–S752 sequences, suggesting that the mutation is either biallelic or that the tumor has two distinct populations of cells.
The C-to-T base-pair change is predicted to change threonine to methionine at position 790 (T790M) in the catalytic cleft of the EGFR tyrosine kinase domain. Structural modeling was performed on the basis of a cocrystallization model of the binding of erlotinib to the EGFR tyrosine kinase domain.14 Using the coordinates from this model, we found that T790 appears to be critical for the binding of erlotinib to EGFR and is in juxtaposition to the acetylene side chain of the aniline group (Figure 2AFigure 2
Mechanism of Drug Resistance.). Because the methionine substitution introduces a bulkier amino acid side chain than does threonine at this position, the resulting steric hindrance may interfere with the binding of erlotinib (Figure 2B). Moreover, high-affinity binding of erlotinib by means of water-mediated hydrogen bonding could not take place with the methionine side chain, whereas the hydroxyl group of T790 likely contributes to high-affinity binding of erlotinib.Although a crystal structure of the gefitinib–EGFR complex has not been published, a model of this complex suggested that, in a conformation similar to the erlotinib–EGFR complex, the chloride at the 3 position of the aniline group lies in juxtaposition to the T790 moiety. A T790M substitution is predicted to lead to a similar steric clash with the gefitinib molecule (Figure 2C). This amino acid change is not expected to interfere with ATP-binding itself and, therefore, is not expected to alter the activity of the kinase on ligand stimulation.
To confirm the functional effects predicted by our structural model, the T790M substitution was introduced into the sequence of the wild-type EGFR, delL747–P753insS mutant EGFR (a frequently identified deletion mutant), the L858R mutant EGFR (the most common point mutation), and the delL747–S752 mutant. We performed transient-transfection experiments in COS-7 and NIH-3T3 cells using all four construct pairs (original construct vs. original construct with the T790M mutation). All four construct pairs demonstrated identical levels of expression of total EGFR and phosphorylated EGFR (phosphorylated EGFR corresponds to activated EGFR tyrosine kinase), suggesting that the presence of the T790M mutation does not substantially alter the production, degradation, activation, or deactivation of the scaffold EGFR molecule. In contrast, when transiently transfected COS-7 cells were treated with increasing concentrations of gefitinib before EGF stimulation, the original constructs were fully inhibited at a concentration of 20 nM, whereas all four constructs carrying the T790M amino acid substitution demonstrated high-level resistance, with persistent generation of phosphorylated EGFR at concentrations of gefitinib as high as 2 μM (Figure 3AFigure 3
Resistance of EGFR with the T790M Mutation to Gefitinib (Panel A) and Susceptibility of EGFR with the T790M Mutation to an Alternative Inhibitor (Panel B).). Identical results were obtained in NIH-3T3 cells (data not shown).To determine whether the T790M mutation leads to resistance to EGFR inhibitors that have different molecular structures and mechanisms, we screened four commercially available EGFR inhibitors (AG1478, cetuximab, erlotinib, and CL-387,785) using cells that were transiently transfected with the delL747–S752 construct and the delL747–S752+ T790M construct. We consistently found that CL-387,785, a specific and irreversible anilinoquinazoline EGFR inhibitor,17 strongly inhibited EGF-induced phosphorylation of both the delL747–S752 construct (apparent 50 percent inhibitory concentration [IC50] of 0.3 nM) and the delL747–S752+ T790 M double-mutant construct (apparent IC50 of 3.0 nM) (Figure 3B). When tested with the double-mutant construct, the CL-387,785 inhibitor demonstrated 1/10th its potency against the delL747–S752 construct, whereas the other tested inhibitors were ineffective against the double-mutant construct (data not shown). A model was generated with CL-387,785 and EGFR (Figure 2D). The 3-bromine side chain in this model points away from T790, as opposed to its orientation with respect to erlotinib and gefitinib, thereby potentially reducing the steric hindrance to binding of the mutated protein. The sensitivity of the delL747–S752+T790M construct to CL-387,785 might be explained by either its altered binding to the kinase domain or its covalent binding to EGFR.
Discussion
We identified a novel, second mutation of the EGFR gene in a tumor with the delL747–S752 mutation of EGFR. The delL747–S752 mutation is associated with susceptibility of non–small-cell lung cancer to gefitinib, and in our patient, the tumor was highly responsive to the drug. After a two-year remission while still receiving gefitinib, however, the patient had a relapse, and analysis of a biopsy of the gefitinib-resistant tumor revealed a second mutation in the tyrosine kinase domain of EGFR. Insertion of this mutation into test cells rendered them resistant to gefitinib in vitro. The development of a second mutation in the EGFR gene that confers resistance to gefitinib suggests that the tumor cells remain dependent on an active EGFR pathway for their proliferation.
In chronic myeloid leukemia and gastrointestinal stromal tumors, the two main mechanisms of resistance to imatinib are point mutations or, less commonly, amplification of the BCR-ABL gene.18-20 Knowledge of these mechanisms has led to the development of second-generation BCR-ABL inhibitors.21 Interestingly, one of the most common imatinib resistance mutations in BCR-ABL replaces threonine at position 315 (the amino acid structurally corresponding to T790 of EGFR) with isoleucine in the ABL tyrosine kinase domain (T315I), leading to a structural change very similar to that observed with EGFR T790M.18 In fact, on the basis of the structural similarity between ABL and EGFR tyrosine kinases, the T790M change has been introduced into wild-type EGFR; this altered EGFR has high-level resistance to anilinoquinazoline inhibitors.22 Daily oral administration of gefitinib at recommended doses results in mean steady-state plasma concentrations of 0.4 to 1.4 μM.23 Since at these levels the T790M mutation still allows the activation of EGFR, the presence of such a mutation might result in clinical resistance.
Although the T315I substitution in BCR-ABL confers high-level resistance to all tested inhibitor compounds, the corresponding T790M mutation of EGFR does not seem to confer such universal resistance, given the fact that in the context of the delL747–S752 mutation, it can effectively be inhibited by CL-387,785. Our results should motivate the development of alternative EGFR inhibitors or inhibitors of downstream targets of EGFR such as phosphatidylinositol 3'-kinase or STAT5 for patients with EGFR-mutant tumors with acquired resistance to anilinoquinazoline inhibitors.
Our findings, and results in patients with chronic myeloid leukemia and gastrointestinal stromal tumors, suggest that when a relapse occurs in patients with anilinoquinazoline-responsive lung cancer with a drug-susceptibility mutation, the tumor cells will contain other mutations in EGFR that confer resistance to the drug. Our work also underscores the need to consider incorporating repeated biopsies into clinical studies of novel targeted therapies, such as those involving mutant tyrosine kinases. Such information may guide the selection of second-line EGFR-inhibitor therapy.
Supported by a Specialized Program of Research Excellence (SPORE) Grant in Lung Cancer (PA20-CA090578-01A1, to Drs. Johnson and Tenen) and a grant (1K12CA87723-01, to Dr. Jänne) from the National Institutes of Health. Dr. Halmos was supported by an American Association for Cancer Research/Cancer Research Foundation of America/AstraZeneca Young Investigator Award for Translational Lung Cancer Research as well as by a Flight Attendant Medical Research Institute Young Clinical Scientist Award. Dr. Kobayashi was supported by the Uehara Memorial Foundation. Dr. Boggon is an American Society of Hematology Basic Research Fellow.
We are indebted to Drs. Gang Huang and Hideyo Hirai for their scientific and technical advice, to Dr. Kwok-Kin Wong for his kind gift of EGFR constructs, and to Dr. D. Gary Gilliland as well as members of the Tenen laboratory for their helpful comments and suggestions.
Source Information
From the Division of Hematology/Oncology (S.K., T.D., D.G.T., B.H.) and the Department of Pathology (O.K.), Beth Israel Deaconess Medical Center, Harvard Medical School; the Departments of Cancer Biology (T.J.B., M.J.E.), Medical Oncology (P.A.J., B.E.J., M.M.), and Pathology (M.M.), Dana–Farber Cancer Institute, Harvard Medical School; the Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School (T.J.B., M.J.E.); and the Department of Medicine, Brigham and Women's Hospital, Harvard Medical School (P.A.J., B.E.J.) — all in Boston; and the Ireland Cancer Center, University Hospitals of Cleveland, Case School of Medicine, Cleveland (B.H.).
Address reprint requests to Dr. Tenen at the Harvard Institutes of Medicine, HIM-954, 77 Louis Pasteur Ave., Boston, MA 02215, or at dtenen@bidmc.harvard.edu.
- References
References
1
Jemal A ,Tiwari RC ,Murray T , et al. Cancer statistics, 2004. CA Cancer J Clin 2004;54:8-29
CrossRef | Web of Science | Medline2
Schiller JH ,Harrington D ,Belani CP , et al. Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med 2002;346:92-98
Full Text | Web of Science | Medline3
Scagliotti GV ,De Marinis F ,Rinaldi M , et al. Phase III randomized trial comparing three platinum-based doublets in advanced non-small-cell lung cancer. J Clin Oncol 2002;20:4285-4291
CrossRef | Web of Science | Medline4
Mendelsohn J ,Baselga J . Status of epidermal growth factor receptor antagonists in the biology and treatment of cancer. J Clin Oncol 2003;21:2787-2799
CrossRef | Web of Science | Medline5
Fukuoka M ,Yano S ,Giaccone G , et al. Multi-institutional randomized phase II trial of gefitinib for previously treated patients with advanced non-small-cell lung cancer (the IDEAL 1 Trial). J Clin Oncol 2003;21:2237-2246[Erratum, J Clin Oncol 2004;22:4811.]
CrossRef | Web of Science | Medline6
Kris MG ,Natale RB ,Herbst RS , et al. Efficacy of gefitinib, an inhibitor of the epidermal growth factor receptor tyrosine kinase, in symptomatic patients with non-small cell lung cancer: a randomized trial. JAMA 2003;290:2149-2158
CrossRef | Web of Science | Medline7
Perez-Soler R ,Chachoua A ,Hammond LA , et al. Determinants of tumor response and survival with erlotinib in patients with non-small-cell lung cancer. J Clin Oncol 2004;22:3238-3247
CrossRef | Web of Science | Medline8
Miller VA ,Kris MG ,Shah N , et al. Bronchioloalveolar pathologic subtype and smoking history predict sensitivity to gefitinib in advanced non-small-cell lung cancer. J Clin Oncol 2004;22:1103-1109
CrossRef | Web of Science | Medline9
Lynch TJ ,Bell DW ,Sordella R , et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004;350:2129-2139
Full Text | Web of Science | Medline10
Paez JG ,Janne PA ,Lee JC , et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 2004;304:1497-1500
CrossRef | Web of Science | Medline11
Pao W ,Miller V ,Zakowski M , et al. EGF receptor gene mutations are common in lung cancers from “never smokers“ and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 2004;101:13306-13311
CrossRef | Web of Science | Medline12
Sordella R ,Bell DW ,Haber DA ,Settleman J . Gefitinib-sensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways. Science 2004;305:1163-1167
CrossRef | Web of Science | Medline13
Cho D ,Kocher O ,Tenen DG , et al. Unusual cases in multiple myeloma and a dramatic response in metastatic lung cancer: case 4: mutation of the epidermal growth factor receptor in an elderly man with advanced, gefitinib-responsive, non-small-cell lung cancer. J Clin Oncol 2005;23:235-237
CrossRef | Web of Science | Medline14
Stamos J ,Sliwkowski MX ,Eigenbrot C . Structure of the epidermal growth factor receptor kinase domain alone and in complex with a 4-anilinoquinazoline inhibitor. J Biol Chem 2002;277:46265-46272
CrossRef | Web of Science | Medline15
Morris GM ,Goodsell DS ,Halliday RS , et al. Automated docking using a Lamarckian genetic algorithm and empirical binding free energy function. J Comput Chem 1998;19:1639-1662
CrossRef | Web of Science16
Schuettelkopf AW ,van Aalten DMF . PRODRG: a tool for high-throughput crystallography of protein-ligand complexes. Acta Crystallogr D Biol Crystallogr 2004;60:1355-1363
CrossRef | Web of Science | Medline17
Discafani CM ,Carroll ML ,Floyd MB Jr , et al. Irreversible inhibition of epidermal growth factor receptor tyrosine kinase with in vivo activity by N-[4-[(3-bromophenyl)amino]-6-quinazolinyl]-2-butynamide (CL-387,785). Biochem Pharmacol 1999;57:917-925
CrossRef | Web of Science | Medline18
Gorre ME ,Mohammed M ,Ellwood K , et al. Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science 2001;293:876-880
CrossRef | Web of Science | Medline19
Chen LL ,Trent JC ,Wu EF , et al. A missense mutation in KIT kinase domain 1 correlates with imatinib resistance in gastrointestinal stromal tumors. Cancer Res 2004;64:5913-5919
CrossRef | Web of Science | Medline20
Azam M ,Latek RR ,Daley GQ . Mechanisms of autoinhibition and STI-571/imatinib resistance revealed by mutagenesis of BCR-ABL. Cell 2003;112:831-843
CrossRef | Web of Science | Medline21
Shah NP ,Tran C ,Lee FY ,Chen P ,Norris D ,Sawyers CL . Overriding imatinib resistance with a novel ABL kinase inhibitor. Science 2004;305:399-401
CrossRef | Web of Science | Medline22
Blencke S ,Ullrich A ,Daub H . Mutation of threonine 766 in the epidermal growth factor receptor reveals a hotspot for resistance formation against selective tyrosine kinase inhibitors. J Biol Chem 2003;278:15435-15440
CrossRef | Web of Science | Medline23
Albanell J ,Rojo F ,Averbuch S , et al. Pharmacodynamic studies of the epidermal growth factor receptor inhibitor ZD1839 in skin from cancer patients: histopathologic and molecular consequences of receptor inhibition. J Clin Oncol 2002;20:110-124
CrossRef | Web of Science | Medline
- Citing Articles (570)
Citing Articles
1
Hua Zhang, Andrew Photiou, Grothey Arnhild, Justin Stebbing, Georgios Giamas. (2012) The role of pseudokinases in cancer. Cellular Signalling
CrossRef2
Liang Cheng, Riley E Alexander, Gregory T MacLennan, Oscar W Cummings, Rodolfo Montironi, Antonio Lopez-Beltran, Harvey M Cramer, Darrell D Davidson, Shaobo Zhang. (2012) Molecular pathology of lung cancer: key to personalized medicine. Modern Pathology
CrossRef3
Caterina Carmi, Elena Galvani, Federica Vacondio, Silvia Rivara, Alessio Lodola, Simonetta Russo, Stefania Aiello, Fabrizio Bordi, Gabriele Costantino, Andrea Cavazzoni, Roberta R Alfieri, Andrea Ardizzoni, Pier Giorgio Petronini, Marco Mor. (2012) Irreversible Inhibition of Epidermal Growth Factor Receptor Activity by 3-Aminopropanamides. Journal of Medicinal Chemistry120126232033003
CrossRef4
Toshiaki Takahashi, Narikazu Boku, Haruyasu Murakami, Tateaki Naito, Asuka Tsuya, Yukiko Nakamura, Akira Ono, Nozomu Machida, Kentaro Yamazaki, Junichiro Watanabe, Ana Ruiz-Garcia, Keiji Imai, Emiko Ohki, Nobuyuki Yamamoto. (2012) Phase I and pharmacokinetic study of dacomitinib (PF-00299804), an oral irreversible, small molecule inhibitor of human epidermal growth factor receptor-1, -2, and -4 tyrosine kinases, in Japanese patients with advanced solid tumors. Investigational New Drugs
CrossRef5
T Yamadori, Y Ishii, S Homma, Y Morishima, K Kurishima, K Itoh, M Yamamoto, Y Minami, M Noguchi, N Hizawa. (2012) Molecular mechanisms for the regulation of Nrf2-mediated cell proliferation in non-small-cell lung cancers. Oncogene
CrossRef6
Parthasarathy Seshacharyulu, Moorthy P Ponnusamy, Dhanya Haridas, Maneesh Jain, Apar K Ganti, Surinder K Batra. (2012) Targeting the EGFR signaling pathway in cancer therapy. Expert Opinion on Therapeutic Targets15-31
CrossRef7
Haifa Shen, Jian You, Guodong Zhang, Arturas Ziemys, Qingpo Li, Litao Bai, Xiaoyong Deng, Donald R. Erm, Xuewu Liu, Chun Li, Mauro Ferrari. (2012) Cooperative, Nanoparticle-Enabled Thermal Therapy of Breast Cancer. Advanced Healthcare Materials 1:1, 84-89
CrossRef8
Nicolas Girard. (2012) Driver mutations as predictive biomarkers in lung cancer. Current Respiratory Care Reports
CrossRef9
Sai-Hong Ignatius Ou. (2012) Second-generation irreversible epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs): A better mousetrap? A review of the clinical evidence. Critical Reviews in Oncology/Hematology
CrossRef10
Hiroyuki Yasuda, Susumu Kobayashi, Daniel B Costa. (2012) EGFR exon 20 insertion mutations in non-small-cell lung cancer: preclinical data and clinical implications. The Lancet Oncology 13:1, e23-e31
CrossRef11
Corey J. Langer. (2012) Individualized therapy for patients with non-small cell lung cancer: Emerging trends and challenges. Critical Reviews in Oncology/Hematology
CrossRef12
Roman Thomas, Jürgen Wolf. (2012) Personalized Therapy of Lung Cancer. Onkologie 35:s1, 14-19
CrossRef13
Luka Ozretić, Lukas C. Heukamp, Margarete Odenthal, Reinhard Buettner. (2012) The Role of Molecular Diagnostics in Cancer Diagnosis and Treatment. Onkologie 35:s1, 8-12
CrossRef14
Hugo Lavoie, Marc Therrien. (2011) Cancer: A drug-resistant duo. Nature 480:7377, 329-330
CrossRef15
M Tessema, C M Yingling, C L Thomas, D M Klinge, A M Bernauer, Y Liu, S Dacic, J M Siegfried, S E Dahlberg, J H Schiller, S A Belinsky. (2011) SULF2 methylation is prognostic for lung cancer survival and increases sensitivity to topoisomerase-I inhibitors via induction of ISG15. Oncogene
CrossRef16
Hang Zhu, Hua Cheng, Yuan Ren, Zhan Guo Liu, Yi Fang Zhang, Bing Luo. (2011) Synergistic inhibitory effects by the combination of gefitinib and genistein on NSCLC with acquired drug-resistance in vitro and in vivo. Molecular Biology Reports
CrossRef17
Ranee Mehra, Ilya G. Serebriiskii, Roland L. Dunbrack, Matthew K. Robinson, Barbara Burtness, Erica A. Golemis. (2011) Protein-intrinsic and signaling network-based sources of resistance to EGFR- and ErbB family-targeted therapies in head and neck cancer. Drug Resistance Updates 14:6, 260-279
CrossRef18
Laura Bonanno, Adolfo Favaretto, Massimo Rugge, Miquel Taron, Rafael Rosell. (2011) Role of Genotyping in Non-Small Cell Lung Cancer Treatment. Drugs 71:17, 2231-2246
CrossRef19
Seiji Yano, Tadaaki Yamada, Shinji Takeuchi, Keisei Tachibana, Yuko Minami, Yasushi Yatabe, Tetsuya Mitsudomi, Hidenori Tanaka, Tatsuo Kimura, Shinzoh Kudoh, Hiroshi Nokihara, Yuichiro Ohe, Jun Yokota, Hidetaka Uramoto, Kosei Yasumoto, Katsuyuki Kiura, Masahiko Higashiyama, Makoto Oda, Haruhiro Saito, Junji Yoshida, Kazuya Kondoh, Masayuki Noguchi. (2011) Hepatocyte Growth Factor Expression in EGFR Mutant Lung Cancer with Intrinsic and Acquired Resistance to Tyrosine Kinase Inhibitors in a Japanese Cohort. Journal of Thoracic Oncology 6:12, 2011-2017
CrossRef20
Phillip A. Schwartz, Brion W. Murray. (2011) Protein kinase biochemistry and drug discovery. Bioorganic Chemistry 39:5-6, 192-210
CrossRef21
Benjamin Scheier, Rodabe Amaria, Karl Lewis, Rene Gonzalez. (2011) Novel therapies in melanoma. Immunotherapy 3:12, 1461-1469
CrossRef22
Jill E. Larsen, John D. Minna. (2011) Molecular Biology of Lung Cancer: Clinical Implications. Clinics in Chest Medicine 32:4, 703-740
CrossRef23
Scott Gettinger, Thomas Lynch. (2011) A Decade of Advances in Treatment for Advanced Non–Small Cell Lung Cancer. Clinics in Chest Medicine 32:4, 839-851
CrossRef24
Thanyanan Reungwetwattana, Saravut J. Weroha, Julian R. Molina. (2011) Oncogenic Pathways, Molecularly Targeted Therapies, and Highlighted Clinical Trials in Non-Small-Cell Lung Cancer (NSCLC). Clinical Lung Cancer
CrossRef25
Nichole T. Tanner, Nicholas J. Pastis, Carol Sherman, George R. Simon, David Lewin, Gerard A. Silvestri. (2011) The role of molecular analyses in the era of personalized therapy for advanced NSCLC. Lung Cancer
CrossRef26
Jan Nyrop Jakobsen, Jens Benn Sørensen. (2011) Intratumor heterogeneity and chemotherapy-induced changes in EGFR status in non-small cell lung cancer. Cancer Chemotherapy and Pharmacology
CrossRef27
Fang Bai, Hongyan Liu, Linjiang Tong, Wei Zhou, Li Liu, Zhenjiang Zhao, Xiaofeng Liu, Hualiang Jiang, Xicheng Wang, Hua Xie, Honglin Li. (2011) Discovery of novel selective inhibitors for EGFR-T790M/L858R. Bioorganic & Medicinal Chemistry Letters
CrossRef28
Mi-Sook Lee, Hwang-Phill Kim, Tae-You Kim, Jung Weon Lee. (2011) Gefitinib resistance of cancer cells correlated with TM4SF5-mediated epithelial–mesenchymal transition. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research
CrossRef29
Shuang Zhang, Hongwei Tian, Qingyuan Jiang, Li Li, Yu Ding, Lei Dai, Yu Xiang, Guobo Shen, Lin Cheng, Qiaorong Huang, Yalin Liu, Xiaomei Zhang, Yongping Ma, Na Zhang, Shengyong Liu, Wei Wang, Lixia Dai, Yiming Li, Xia Zhao, Yuquan Wei, Hongxin Deng. (2011) Suppression of Epidermal Growth Factor Receptor (EGFR) Expression by Small Hairpin RNA Inhibits the Growth of Human Nonsmall Cell Lung Cancers Bearing Wild-type and Mutant EGFR. Cancer Investigation 29:10, 701-708
CrossRef30
Amy C. Anderson. (2011) Winning the Arms Race by Improving Drug Discovery against Mutating Targets. ACS Chemical Biology111111091236007
CrossRef31
E. F. Smit. (2011) Medicatie bij longcarcinoom. Huisarts en wetenschap
CrossRef32
Richard L Schilsky. (2011) Drug approval challenges in the age of personalized cancer treatment. Personalized Medicine 8:6, 633-640
CrossRef33
Akito Hata, Nobuyuki Katakami, Hiroshige Yoshioka, Shiro Fujita, Kei Kunimasa, Shigeki Nanjo, Kyoko Otsuka, Reiko Kaji, Keisuke Tomii, Masahiro Iwasaku, Akihiro Nishiyama, Hidetoshi Hayashi, Satoshi Morita, Tadashi Ishida. (2011) Erlotinib after gefitinib failure in relapsed non-small cell lung cancer: Clinical benefit with optimal patient selection. Lung Cancer 74:2, 268-273
CrossRef34
Akshay Sudhindra, Roberto Ochoa, Edgardo S. Santos. (2011) Biomarkers, Prediction, and Prognosis in Non–Small-Cell Lung Cancer: A Platform for Personalized Treatment. Clinical Lung Cancer 12:6, 360-368
CrossRef35
Xiwu Lin. (2011) Effect of Predictive Performance of a Biomarker for the Sample Size of Targeted Designs for Randomized Clinical Trials. Statistics in Biopharmaceutical Research 3:4, 536-548
CrossRef36
Seung-Tae Lee, Ji-Youn Kim, Min-Jung Kown, Sun Wook Kim, Jae Hoon Chung, Myung-Ju Ahn, Young Lyun Oh, Jong-Won Kim, Chang-Seok Ki. (2011) Mutant Enrichment with 3′-Modified Oligonucleotides. The Journal of Molecular Diagnostics 13:6, 657-668
CrossRef37
James A. McCubrey, Linda S. Steelman, C. Ruth Kempf, William H. Chappell, Stephen L. Abrams, Franca Stivala, Graziella Malaponte, Ferdinando Nicoletti, Massimo Libra, Jörg Bäsecke, Danijela Maksimovic-Ivanic, Sanja Mijatovic, Giuseppe Montalto, Melchiorre Cervello, Lucio Cocco, Alberto M. Martelli. (2011) Therapeutic resistance resulting from mutations in Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR signaling pathways. Journal of Cellular Physiology 226:11, 2762-2781
CrossRef38
Kenichi Suda, Kenji Tomizawa, Hirotaka Osada, Yoshihiko Maehara, Yasushi Yatabe, Yoshitaka Sekido, Tetsuya Mitsudomi. (2011) Conversion from the “oncogene addiction” to “drug addiction” by intensive inhibition of the EGFR and MET in lung cancer with activating EGFR mutation. Lung Cancer
CrossRef39
Shunsuke Okumura, Takaaki Sasaki, Yoshinori Minami, Yoshinobu Ohsaki. (2011) Nicotinamide Phosphoribosyltransferase: A Potent Therapeutic Target in Non-small Cell Lung Cancer with Epidermal Growth Factor Receptor-Gene Mutation. Journal of Thoracic Oncology1
CrossRef40
Shannon M. Mumenthaler, Jasmine Foo, Kevin Leder, Nathan C. Choi, David B. Agus, William Pao, Parag Mallick, Franziska Michor. (2011) Evolutionary Modeling of Combination Treatment Strategies To Overcome Resistance to Tyrosine Kinase Inhibitors in Non-Small Cell Lung Cancer. Molecular Pharmaceutics111025141453009
CrossRef41
A Horiike, K Kudo, E Miyauchi, F Ohyanagi, K Kasahara, T Horai, M Nishio. (2011) Phase I study of irinotecan and gefitinib in patients with gefitinib treatment failure for non-small cell lung cancer. British Journal of Cancer 105:8, 1131-1136
CrossRef42
Tsuyoshi Ueno, Kazunori Tsukuda, Shinichi Toyooka, Midori Ando, Munenori Takaoka, Junichi Soh, Hiroaki Asano, Yuho Maki, Takayuki Muraoka, Norimitsu Tanaka, Kazuhiko Shien, Masashi Furukawa, Tomoki Yamatsuji, Katsuyuki Kiura, Yoshio Naomoto, Shinichiro Miyoshi. (2011) Strong anti-tumor effect of NVP-AUY922, a novel Hsp90 inhibitor, on non-small cell lung cancer. Lung Cancer
CrossRef43
Josep M. Llovet, Valerie Paradis, Masatoshi Kudo, Jessica Zucman-Rossi. (2011) Tissue biomarkers as predictors of outcome and selection of transplant candidates with hepatocellular carcinoma. Liver Transplantation 17:S2, S67-S71
CrossRef44
Tomomi Nakamura, Naoko Sueoka-Aragane, Kentaro Iwanaga, Akemi Sato, Kazutoshi Komiya, Tomonori Abe, Norio Ureshino, Shinichiro Hayashi, Toshiya Hosomi, Mitsuharu Hirai, Eisaburo Sueoka, Shinya Kimura. (2011) A Noninvasive System for Monitoring Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors with Plasma DNA. Journal of Thoracic Oncology 6:10, 1639-1648
CrossRef45
Yi Hu, Yanfang Ju, Dongmei Lin, Zhikuan Wang, Yurong Huang, Sujie Zhang, Chao Wu, Shunchang Jiao. (2011) Mutation of the Nrf2 gene in non-small cell lung cancer. Molecular Biology Reports
CrossRef46
Wael Saleem, Yoshiyuki Suzuki, Abdulelah Mobaraki, Yukari Yoshida, Shinei Noda, Jun-ich Saitoh, Takashi Nakano. (2011) Reduction of nitric oxide level enhances the radiosensitivity of hypoxic non-small cell lung cancer. Cancer Scienceno-no
CrossRef47
Naomi Fujioka, Julia Nguyen, Chunsheng Chen, Yunfang Li, Teena Pasrija, Gloria Niehans, Kathryn N. Johnson, Vinita Gupta, Robert A. Kratzke, Kalpna Gupta. (2011) Morphine-Induced Epidermal Growth Factor Pathway Activation in Non–Small Cell Lung Cancer. Anesthesia & Analgesia1
CrossRef48
M. Catherine Pietanza, Thomas James Lynch, Primo N. Lara, John Cho, Ronald H. Yanagihara, Nandagopal Vrindavanam, Naveed Mahfooz Chowhan, Shirish M. Gadgeel, Nathan A. Pennell, Roel Funke, Ben Mitchell, Heather A. Wakelee, Vincent A. Miller. (2011) XL647—A Multitargeted Tyrosine Kinase Inhibitor. Journal of Thoracic Oncology1
CrossRef49
Alexander Zawaira, Anil Pooran, Samantha Barichievy, Denis Chopera. (2011) A Discussion of Molecular Biology Methods for Protein Engineering. Molecular Biotechnology
CrossRef50
Thomas I. Peng Soh, Wei Peng Yong, Federico Innocenti. (2011) Review: Recent progress and clinical importance on pharmacogenetics in cancer therapy. Clinical Chemistry and Laboratory Medicine---
CrossRef51
Kit Man Wong, Thomas J. Hudson, John D. McPherson. (2011) Unraveling the Genetics of Cancer: Genome Sequencing and Beyond. Annual Review of Genomics and Human Genetics 12:1, 407-430
CrossRef52
J. Hu, M. Jo, W. K. Cavenee, F. Furnari, S. R. VandenBerg, S. L. Gonias. (2011) Crosstalk between the urokinase-type plasminogen activator receptor and EGF receptor variant III supports survival and growth of glioblastoma cells. Proceedings of the National Academy of Sciences 108:38, 15984-15989
CrossRef53
Hidenori Tanaka, Tatsuo Kimura, Shinzoh Kudoh, Shigeki Mitsuoka, Tetsuya Watanabe, Tomohiro Suzumura, Keisei Tachibana, Masayuki Noguchi, Seiji Yano, Kazuto Hirata. (2011) Reaction of plasma hepatocyte growth factor levels in non-small cell lung cancer patients treated with EGFR-TKIs. International Journal of Cancer 129:6, 1410-1416
CrossRef54
K. Yonesaka, K. Zejnullahu, I. Okamoto, T. Satoh, F. Cappuzzo, J. Souglakos, D. Ercan, A. Rogers, M. Roncalli, M. Takeda, Y. Fujisaka, J. Philips, T. Shimizu, O. Maenishi, Y. Cho, J. Sun, A. Destro, K. Taira, K. Takeda, T. Okabe, J. Swanson, H. Itoh, M. Takada, E. Lifshits, K. Okuno, J. A. Engelman, R. A. Shivdasani, K. Nishio, M. Fukuoka, M. Varella-Garcia, K. Nakagawa, P. A. Janne. (2011) Activation of ERBB2 Signaling Causes Resistance to the EGFR-Directed Therapeutic Antibody Cetuximab. Science Translational Medicine 3:99, 99ra86-99ra86
CrossRef55
Feng Pan, Jing Tian, Xuchao Zhang, Ying Zhang, Yueyin Pan. (2011) Synergistic interaction between sunitinib and docetaxel is sequence dependent in human non–small lung cancer with EGFR TKIs-resistant mutation. Journal of Cancer Research and Clinical Oncology 137:9, 1397-1408
CrossRef56
Filip Janku, Ignacio Garrido-Laguna, Lubos B. Petruzelka, David J. Stewart, Razelle Kurzrock. (2011) Novel Therapeutic Targets in Non-small Cell Lung Cancer. Journal of Thoracic Oncology 6:9, 1601-1612
CrossRef57
Hidetaka Uramoto, Hidehiko Shimokawa, Takeshi Hanagiri, Michihiko Kuwano, Mayumi Ono. (2011) Expression of selected gene for acquired drug resistance to EGFR-TKI in lung adenocarcinoma. Lung Cancer 73:3, 361-365
CrossRef58
Koichi Azuma, Isamu Okamoto, Akihiko Kawahara, Tomoki Taira, Kazutaka Nakashima, Satoshi Hattori, Takashi Kinoshita, Masayuki Takeda, Kazuhiko Nakagawa, Shinzo Takamori, Michihiko Kuwano, Mayumi Ono, Masayoshi Kage. (2011) Association of the Expression of Mutant Epidermal Growth Factor Receptor Protein as Determined with Mutation-Specific Antibodies in Non-small Cell Lung Cancer with Progression-Free Survival after Gefitinib Treatment. Journal of Thoracic Oncology1
CrossRef59
William R. Sellers. (2011) A Blueprint for Advancing Genetics-Based Cancer Therapy. Cell 147:1, 26-31
CrossRef60
Tony S. K. Mok. (2011) Personalized medicine in lung cancer: what we need to know. Nature Reviews Clinical Oncology 8:11, 661-668
CrossRef61
Deborah Balzano, Stefano Santaguida, Andrea Musacchio, Fabrizio Villa. (2011) A General Framework for Inhibitor Resistance in Protein Kinases. Chemistry & Biology 18:8, 966-975
CrossRef62
Kristan E. Vos, Leonora Balaj, Johan Skog, Xandra O. Breakefield. (2011) Brain Tumor Microvesicles: Insights into Intercellular Communication in the Nervous System. Cellular and Molecular Neurobiology 31:6, 949-959
CrossRef63
Jonathan P. DiNitto, Joe C. Wu. (2011) Molecular mechanisms of drug resistance in tyrosine kinases cAbl and cKit. Critical Reviews in Biochemistry and Molecular Biology 46:4, 295-309
CrossRef64
L.C. Heukamp, J. Wolf, R. Büttner. (2011) Pathophysiologie und Molekulardiagnostik beim nichtkleinzelligen Lungenkarzinom. Der Onkologe 17:8, 670-678
CrossRef65
Zhiwei Yu, Binbin Cui, Yinghu Jin, Haipeng Chen, Xishan Wang. (2011) Novel irreversible EGFR tyrosine kinase inhibitor 324674 sensitizes human colon carcinoma HT29 and SW480 cells to apoptosis by blocking the EGFR pathway. Biochemical and Biophysical Research Communications 411:4, 751-756
CrossRef66
Shinichi Toyooka, Tetsuya Mitsudomi, Junichi Soh, Keiju Aokage, Masaomi Yamane, Takahiro Oto, Katsuyuki Kiura, Shinichiro Miyoshi. (2011) Molecular oncology of lung cancer. General Thoracic and Cardiovascular Surgery 59:8, 527-537
CrossRef67
J. Chmielecki, J. Foo, G. R. Oxnard, K. Hutchinson, K. Ohashi, R. Somwar, L. Wang, K. R. Amato, M. Arcila, M. L. Sos, N. D. Socci, A. Viale, E. de Stanchina, M. S. Ginsberg, R. K. Thomas, M. G. Kris, A. Inoue, M. Ladanyi, V. A. Miller, F. Michor, W. Pao. (2011) Optimization of Dosing for EGFR-Mutant Non-Small Cell Lung Cancer with Evolutionary Cancer Modeling. Science Translational Medicine 3:90, 90ra59-90ra59
CrossRef68
Kenichi Suda, Kenji Tomizawa, Makiko Fujii, Hideki Murakami, Hirotaka Osada, Yoshihiko Maehara, Yasushi Yatabe, Yoshitaka Sekido, Tetsuya Mitsudomi. (2011) Epithelial to Mesenchymal Transition in an Epidermal Growth Factor Receptor-Mutant Lung Cancer Cell Line with Acquired Resistance to Erlotinib. Journal of Thoracic Oncology 6:7, 1152-1161
CrossRef69
Patricia J T A Groenen, Willeke A M Blokx, Coos Diepenbroek, Lambert Burgers, Franco Visinoni, Pieter Wesseling, Johan H J M van Krieken. (2011) Preparing pathology for personalized medicine: possibilities for improvement of the pre-analytical phase. Histopathology 59:1, 1-7
CrossRef70
Jing Wen, Jianhua Fu, Wei Zhang, Ming Guo. (2011) Genetic and epigenetic changes in lung carcinoma and their clinical implications. Modern Pathology 24:7, 932-943
CrossRef71
Amy C. Anderson, Michael P. Pollastri, Celia A. Schiffer, Norton P. Peet. (2011) The challenge of developing robust drugs to overcome resistance. Drug Discovery Today
CrossRef72
JI EUN OH, CHANG HYEOK AN, NAM JIN YOO, SUG HYUNG LEE. (2011) Detection of low-level EGFR T790M mutation in lung cancer tissues. APMIS 119:7, 403-411
CrossRef73
Shu-Yan Han, Ming-Bo Zhao, Gui-Bao Zhuang, Ping-Ping Li. (2011) Marsdenia tenacissima extract restored gefitinib sensitivity in resistant non-small cell lung cancer cells. Lung Cancer
CrossRef74
Hideki Kimura, Takahiro Nakajima, Kengo Takeuchi, Manabu Soda, Hiroyuki Mano, Toshihiko Iizasa, Yukiko Matsui, Mitsuru Yoshino, Masato Shingyoji, Meiji Itakura, Makiko Itami, Dai Ikebe, Sana Yokoi, Hajime Kageyama, Miki Ohira, Akira Nakagawara. (2011) ALK fusion gene positive lung cancer and 3 cases treated with an inhibitor for ALK kinase activity. Lung Cancer
CrossRef75
Naruyuki Kobayashi, Shinichi Toyooka, Junichi Soh, Hiromasa Yamamoto, Hideaki Dote, Kensuke Kawasaki, Hiroki Otani, Takafumi Kubo, Masaru Jida, Tsuyoshi Ueno, Midori Ando, Atsuko Ogino, Katsuyuki Kiura, Shinichiro Miyoshi. (2011) The anti-proliferative effect of heat shock protein 90 inhibitor, 17-DMAG, on non-small-cell lung cancers being resistant to EGFR tyrosine kinase inhibitor. Lung Cancer
CrossRef76
Shin Ogita, Patricia LoRusso. (2011) Targeting phosphatidylinositol 3 kinase (PI3K)-Akt beyond rapalogs. Targeted Oncology 6:2, 103-117
CrossRef77
Ri-Dong Li, Xin Zhang, Qiao-Yan Li, Ze-Mei Ge, Run-Tao Li. (2011) Novel EGFR inhibitors prepared by combination of dithiocarbamic acid esters and 4-anilinoquinazolines. Bioorganic & Medicinal Chemistry Letters 21:12, 3637-3640
CrossRef78
Maureen Cronin, Jeffrey S Ross. (2011) Comprehensive next-generation cancer genome sequencing in the era of targeted therapy and personalized oncology. Biomarkers in Medicine 5:3, 293-305
CrossRef79
F. Barlesi. (2011) Prise en charges des patients présentant une résistance aux TKI de l’EGFR. Revue de Pneumologie Clinique 67, S30-S35
CrossRef80
Daigo Kawano, Tokujiro Yano, Fumihiro Shoji, Kensaku Ito, Yosuke Morodomi, Akira Haro, Naoko Miura, Tomoyoshi Takenaka, Ichiro Yoshino, Yoshihiko Maehara. (2011) The influence of intracellular epidermal growth factor receptor (EGFR) signal activation on the outcome of EGFR tyrosine kinase inhibitor treatment for pulmonary adenocarcinoma. Surgery Today 41:6, 818-823
CrossRef81
Mariacarmela Santarpia, Giuseppe Altavilla, Maria F Salazar, Ignacio Magri, Giuseppe Pettineo, Sara Benecchi, Rafael Rosell. (2011) Tyrosine kinase inhibitors for non-small-cell lung cancer: finding patients who will be responsive. Expert Review of Respiratory Medicine 5:3, 413-424
CrossRef82
Deepak Lokwani, Shashikant Bhandari, Radha Pujari, Padma Shastri, Ganesh shelke, Vidya Pawar. (2011) Use of Quantitative Structure–Activity Relationship (QSAR) and ADMET prediction studies as screening methods for design of benzyl urea derivatives for anti-cancer activity. Journal of Enzyme Inhibition and Medicinal Chemistry 26:3, 319-331
CrossRef83
Heidi Schwarzenbach, Dave S. B. Hoon, Klaus Pantel. (2011) Cell-free nucleic acids as biomarkers in cancer patients. Nature Reviews Cancer 11:6, 426-437
CrossRef84
B. Besse, G. Zalcman. (2011) Quelle séquence de traitement chez les patients EGFR mutés ?. Revue de Pneumologie Clinique 67, S24-S29
CrossRef85
Miyako Saitoh, Mafumi Niijima, Yuichi Takiguchi, Kenzo Hiroshima, Yoshihiko Fujita, Kazuto Nishio, Koichiro Tatsumi. (2011) An early event of EGFR mutation in pleomorphic carcinoma of the lung. International Journal of Clinical Oncology
CrossRef86
R. Katayama, T. M. Khan, C. Benes, E. Lifshits, H. Ebi, V. M. Rivera, W. C. Shakespeare, A. J. Iafrate, J. A. Engelman, A. T. Shaw. (2011) Therapeutic strategies to overcome crizotinib resistance in non-small cell lung cancers harboring the fusion oncogene EML4-ALK. Proceedings of the National Academy of Sciences 108:18, 7535-7540
CrossRef87
Rebekka Krumbach, Julia Schüler, Michael Hofmann, Torsten Giesemann, Heinz-Herbert Fiebig, Thomas Beckers. (2011) Primary resistance to cetuximab in a panel of patient-derived tumour xenograft models: Activation of MET as one mechanism for drug resistance. European Journal of Cancer 47:8, 1231-1243
CrossRef88
Augusto Villanueva, Josep M. Llovet. (2011) Targeted Therapies for Hepatocellular Carcinoma. Gastroenterology 140:5, 1410-1426
CrossRef89
Rachael Natrajan, Jorge S Reis-Filho. (2011) Next-generation sequencing applied to molecular diagnostics. Expert Review of Molecular Diagnostics 11:4, 425-444
CrossRef90
Giulio Metro, Lucio Crinò. (2011) The LUX-Lung clinical trial program of afatinib for non-small-cell lung cancer. Expert Review of Anticancer Therapy 11:5, 673-682
CrossRef91
T. Zander, M. Hallek. (2011) Thyrosinkinaseinhibitoren in der Onkologie. Der Internist 52:5, 595-600
CrossRef92
Shahreen Billah, John Stewart, Gregg Staerkel, Su Chen, Yun Gong, Ming Guo. (2011) EGFR and KRAS mutations in lung carcinoma. Cancer Cytopathology 119:2, 111-117
CrossRef93
T Harada, A Lopez-Chavez, L Xi, M Raffeld, Y Wang, G Giaccone. (2011) Characterization of epidermal growth factor receptor mutations in non-small-cell lung cancer patients of African-American ancestry. Oncogene 30:15, 1744-1752
CrossRef94
Tina Cascone, Matthew H. Herynk, Li Xu, Zhiqiang Du, Humam Kadara, Monique B. Nilsson, Carol J. Oborn, Yun-Yong Park, Baruch Erez, Jörg J. Jacoby, Ju-Seog Lee, Heather Y. Lin, Fortunato Ciardiello, Roy S. Herbst, Robert R. Langley, John V. Heymach. (2011) Upregulated stromal EGFR and vascular remodeling in mouse xenograft models of angiogenesis inhibitor–resistant human lung adenocarcinoma. Journal of Clinical Investigation 121:4, 1313-1328
CrossRef95
Liang Cheng, Shaobo Zhang, Riley Alexander, Yongxue Yao, Gregory T MacLennan, Chong-xian Pan, Jiaoti Huang, Mingsheng Wang, Rodolfo Montironi, Antonio Lopez-Beltran. (2011) The landscape of EGFR pathways and personalized management of non-small-cell lung cancer. Future Oncology 7:4, 519-541
CrossRef96
Daniel A. Haber, Nathanael S. Gray, Jose Baselga. (2011) The Evolving War on Cancer. Cell 145:1, 19-24
CrossRef97
Mizuki Nishino, David M. Jackman, Hiroto Hatabu, Pasi A. Jänne, Bruce E. Johnson, Annick D. Van den Abbeele. (2011) Imaging of Lung Cancer in the Era of Molecular Medicine. Academic Radiology 18:4, 424-436
CrossRef98
Young Joo Lee, Joo-Hang Kim, Se Kyu Kim, Sang-Jun Ha, Tony S. Mok, Tetsuya Mitsudomi, Byoung Chul Cho. (2011) Lung cancer in never smokers: Change of a mindset in the molecular era. Lung Cancer 72:1, 9-15
CrossRef99
Yongzheng Wang, Jiandong Zhang, Hairong Liu, Shuanghu Yuan, Fuli Wang, Kang Ning, Fengjun Liu, Jinming Yu. (2011) Erlotinib Resistance is Altered after Gemcitabine Chemotherapy for Recurrent Non-Small-Cell Lung Cancer. Clinical Drug Investigation 31:4, 279-283
CrossRef100
Jongkook Lee, Seung-Mann Paek, Sun-Young Han. (2011) FMS-like tyrosine kinase 3 inhibitors: a patent review. Expert Opinion on Therapeutic Patents 21:4, 483-503
CrossRef101
L. V. Sequist, B. A. Waltman, D. Dias-Santagata, S. Digumarthy, A. B. Turke, P. Fidias, K. Bergethon, A. T. Shaw, S. Gettinger, A. K. Cosper, S. Akhavanfard, R. S. Heist, J. Temel, J. G. Christensen, J. C. Wain, T. J. Lynch, K. Vernovsky, E. J. Mark, M. Lanuti, A. J. Iafrate, M. Mino-Kenudson, J. A. Engelman. (2011) Genotypic and Histological Evolution of Lung Cancers Acquiring Resistance to EGFR Inhibitors. Science Translational Medicine 3:75, 75ra26-75ra26
CrossRef102
Cataldo, Vince D., Gibbons, Don L., Pérez-Soler, Román, Quintás-Cardama, Alfonso, . (2011) Treatment of Non–Small-Cell Lung Cancer with Erlotinib or Gefitinib. New England Journal of Medicine 364:10, 947-955
Full Text103
Ki Won Lee, Ann M. Bode, Zigang Dong. (2011) Molecular targets of phytochemicals for cancer prevention. Nature Reviews Cancer 11:3, 211-218
CrossRef104
Naohiro Nose, Hidetaka Uramoto, Teruo Iwata, Takeshi Hanagiri, Kosei Yasumoto. (2011) Expression of estrogen receptor beta predicts a clinical response and longer progression-free survival after treatment with EGFR–TKI for adenocarcinoma of the lung. Lung Cancer 71:3, 350-355
CrossRef105
Giordano Caponigro, William R. Sellers. (2011) Advances in the preclinical testing of cancer therapeutic hypotheses. Nature Reviews Drug Discovery 10:3, 179-187
CrossRef106
Coren A Milbury, Jin Li, Pingfang Liu, G Mike Makrigiorgos. (2011) COLD-PCR: improving the sensitivity of molecular diagnostics assays. Expert Review of Molecular Diagnostics 11:2, 159-169
CrossRef107
Suresh S. Ramalingam, Taofeek K. Owonikoko, Fadlo R. Khuri. (2011) Lung cancer: New biological insights and recent therapeutic advances. CA: A Cancer Journal for Clinicians 61:2, 91-112
CrossRef108
Gilda da Cunha Santos, Frances A. Shepherd, Ming Sound Tsao. (2011) EGFR Mutations and Lung Cancer. Annual Review of Pathology: Mechanisms of Disease 6:1, 49-69
CrossRef109
Rama Krishna Kancha, Christian Peschel, Justus Duyster. (2011) The Epidermal Growth Factor Receptor-L861Q Mutation Increases Kinase Activity without Leading to Enhanced Sensitivity Toward Epidermal Growth Factor Receptor Kinase Inhibitors. Journal of Thoracic Oncology 6:2, 387-392
CrossRef110
L.C. Heukamp, J. Wolf, R. Büttner. (2011) Molekulardiagnostik zur Therapiestratifizierung des Lungenkarzinoms. Der Internist 52:2, 146-154
CrossRef111
Akito Hata, Reiko Kaji, Shiro Fujita, Nobuyuki Katakami. (2011) Does the Addition of Vascular Endothelial Growth Factor Inhibitors to Epidermal Growth Factor Receptor-Tyrosine Kinase Inhibitor Overcome T790M Acquired Resistance?. Journal of Thoracic Oncology 6:2, 404
CrossRef112
Zengliu Su. (2011) Epidermal growth factor receptor mutation-guided treatment for lung cancers: Where are we now?. Thoracic Cancer 2:1, 1-6
CrossRef113
Wendy A Cooper, Sandra OʼToole, Michael Boyer, Lisa Horvath, Annabelle Mahar. (2011) Whatʼs new in non-small cell lung cancer for pathologists: the importance of accurate subtyping, EGFR mutations and ALK rearrangements. Pathology 43:2, 103-115
CrossRef114
Nana Tamaishi, Mitsutoshi Tsukimoto, Akihiro Kitami, Shuji Kojima. (2011) P2Y6 Receptors and ADAM17 Mediate Low-Dose Gamma-Ray-Induced Focus Formation (Activation) of EGF Receptor. Radiation Research 175:2, 193-200
CrossRef115
David F. Heigener, Martin Reck. (2011) Mutations in the epidermal growth factor receptor gene in non-small cell lung cancer: Impact on treatment beyond gefitinib and erlotinib. Advances in Therapy 28:2, 126-133
CrossRef116
H. H. Yeh, K. Ogawa, J. Balatoni, U. Mukhapadhyay, A. Pal, C. Gonzalez-Lepera, A. Shavrin, S. Soghomonyan, L. Flores, D. Young, A. Y. Volgin, A. M. Najjar, V. Krasnykh, W. Tong, M. M. Alauddin, J. G. Gelovani. (2011) Molecular imaging of active mutant L858R EGF receptor (EGFR) kinase-expressing nonsmall cell lung carcinomas using PET/CT. Proceedings of the National Academy of Sciences 108:4, 1603-1608
CrossRef117
Ravi Iyengar. (2011) Computational Analysis of Systems-Level Regulation and Drug Action. Annual Review of Pharmacology and Toxicology 52:1, 110301101444027
CrossRef118
Martin Krug, Kanin Wichapong, German Erlenkamp, Wolfgang Sippl, Christoph Schächtele, Frank Totzke, Andreas Hilgeroth. (2011) Discovery of 4-Benzylamino-Substituted α-Carbolines as a Novel Class of Receptor Tyrosine Kinase Inhibitors. ChemMedChem 6:1, 63-72
CrossRef119
Katey S. S. Enfield, Greg L. Stewart, Larissa A. Pikor, Carlos E. Alvarez, Stephen Lam, Wan L. Lam, Raj Chari. (2011) MicroRNA Gene Dosage Alterations and Drug Response in Lung Cancer. Journal of Biomedicine and Biotechnology 2011, 1-15
CrossRef120
Emma Borràs, Ismael Jurado, Imma Hernan, María Gamundi, Miguel Dias, Isabel Martí, Begoña Mañé, Àngels Arcusa, José AG Agúndez, Miguel Blanca, Miguel Carballo. (2011) Clinical pharmacogenomic testing of KRAS, BRAF and EGFR mutations by high resolution melting analysis and ultra-deep pyrosequencing. BMC Cancer 11:1, 406
CrossRef121
Mi Young Cha, Kwang-Ok Lee, Mira Kim, Ji Yeon Song, Kyu Hang Lee, Jongmin Park, Yun Jung Chae, Young Hoon Kim, Kwee Hyun Suh, Gwan Sun Lee, Seung Bum Park, Maeng Sup Kim. (2011) Antitumor activity of HM781-36B, a highly effective pan-HER inhibitor in erlotinib-resistant NSCLC and other EGFR-dependent cancer models. International Journal of Cancern/a-n/a
CrossRef122
David F. Heigener. (2011) Non-Small Cell Lung Cancer in Never-Smokers: A New Disease Entity?. Onkologie 34:4, 202-207
CrossRef123
Sung Chul Hong, Yun Su Sim, Jin Hwa Lee, Yon Ju Ryu, Jung Hyun Chang. (2011) Successful Rechallenge with Gefitinib for an Initial Erlotinib-Responder with Advanced Lung Adenocarcinoma. Tuberculosis and Respiratory Diseases 71:4, 286
CrossRef124
Chia-Chi Lin, James Chih-Hsin Yang. (2011) Optimal Management of Patients with Non-Small Cell Lung Cancer and Epidermal Growth Factor Receptor Mutations. Drugs 71:1, 79-88
CrossRef125
Hua C. Gong, Sean Wang, Gary Mayer, Guoan Chen, Glen Leesman, Sharat Singh, David G. Beer. (2011) Signatures of Drug Sensitivity in Nonsmall Cell Lung Cancer. International Journal of Proteomics 2011, 1-13
CrossRef126
Po-Cheng Chen, Yi-You Huang, Jyh-Lyh Juang. (2011) MEMS microwell and microcolumn arrays: novel methods for high-throughput cell-based assays. Lab on a Chip 11:21, 3619
CrossRef127
Hiroyuki Mano. (2011) Molecular targeted drugs against ALK fusions. Folia Pharmacologica Japonica 138:1, 3-7
CrossRef128
C. A. Milbury, J. Li, G. M. Makrigiorgos. (2011) Ice-COLD-PCR enables rapid amplification and robust enrichment for low-abundance unknown DNA mutations. Nucleic Acids Research 39:1, e2-e2
CrossRef129
Eiki Ichihara, Kadoaki Ohashi, Nagio Takigawa, Masahiro Osawa, Atsuko Ogino, Mitsune Tanimoto, Katsuyuki Kiura. (2011) Effects of vandetanib on lung adenocarcinoma cells harboring epidermal growth factor receptor T790M mutation in vivo. Okayama Igakkai Zasshi (Journal of Okayama Medical Association) 123:1, 13-18
CrossRef130
Fumiko Tokuhashi, Shinji Sakaguchi, Kazutoshi Isobe, Keishi Sugino, Tsutomu Hatori, Sakae Homma. (2011) An Autopsied Case of Lung Cancer Which Simultaneously Expressed L858R and T790M Mutations Before Gefitinib Therapy. Haigan 51:2, 84-88
CrossRef131
Yvonne Hui-Fang Teng, Wai-Jin Tan, Aye-Aye Thike, Poh-Yian Cheok, Gary Man-Kit Tse, Nan-Soon Wong, George Wai-Cheong Yip, Boon-Huat Bay, Puay-Hoon Tan. (2011) Mutations in the epidermal growth factor receptor (EGFR) gene in triple negative breast cancer: possible implications for targeted therapy. Breast Cancer Research 13:2, R35
CrossRef132
Erika Taube, Elina Jokinen, Peppi Koivunen, Jussi P. Koivunen. (2011) A novel treatment strategy for EGFR mutant NSCLC with T790M-mediated acquired resistance. International Journal of Cancern/a-n/a
CrossRef133
Tianjun Zhou, Lois Commodore, Wei-Sheng Huang, Yihan Wang, Mathew Thomas, Jeff Keats, Qihong Xu, Victor M. Rivera, William C. Shakespeare, Tim Clackson, David C. Dalgarno, Xiaotian Zhu. (2011) Structural Mechanism of the Pan-BCR-ABL Inhibitor Ponatinib (AP24534): Lessons for Overcoming Kinase Inhibitor Resistance. Chemical Biology & Drug Design 77:1, 1-11
CrossRef134
Zengliu Su, Dora Dias-Santagata, MarKeesa Duke, Katherine Hutchinson, Ya-Lun Lin, Darrell R. Borger, Christine H. Chung, Pierre P. Massion, Cindy L. Vnencak-Jones, A. John Iafrate, William Pao. (2011) A Platform for Rapid Detection of Multiple Oncogenic Mutations With Relevance to Targeted Therapy in Non–Small-Cell Lung Cancer. The Journal of Molecular Diagnostics 13:1, 74-84
CrossRef135
Tianhai Tian, Sarah Olson, James M. Whitacre, Angus Harding. (2011) The origins of cancer robustness and evolvability. Integrative Biology 3:1, 17
CrossRef136
Ning Lv, Xiaoming Xie, Qidong Ge, Suxia Lin, Xi Wang, Yanan Kong, Hongliu Shi, Xinhua Xie, Weidong Wei. (2011) Epidermal growth factor receptor in breast carcinoma: association between gene copy number and mutations. Diagnostic Pathology 6:1, 118
CrossRef137
H Li, G Schmid-Bindert, D Wang, Y Zhao, X Yang, B Su, C Zhou. (2011) Blocking the PI3K/AKT and MEK/ERK signaling pathways can overcome Gefitinib-resistance in non-small cell lung cancer cell lines. Advances in Medical Sciences 1:-1, 1-10
CrossRef138
Jun-ichi Hanai, Nathaniel Doro, Atsuo T. Sasaki, Susumu Kobayashi, Lewis C. Cantley, Pankaj Seth, Vikas P. Sukhatme. (2011) Inhibition of lung cancer growth: ATP citrate lyase knockdown and statin treatment leads to dual blockade of mitogen-actiated protein kinase (MAPK) and phosphatidylinositol-3- kinase (PI3K)/AKT pathways. Journal of Cellular Physiologyn/a-n/a
CrossRef139
Don L. Gibbons, Sabrina Pricl, Hagop Kantarjian, Jorge Cortes, Alfonso Quintás-Cardama. (2011) The rise and fall of gatekeeper mutations? The BCR-ABL1 T315I paradigm. Cancern/a-n/a
CrossRef140
Shin Yup Lee, Jae Yong Park. (2011) Personalized Therapy in Lung Cancer: Focused on Molecular Targeted Therapy. Journal of Lung Cancer 10:1, 1
CrossRef141
Lixia Ju, Caicun Zhou, Wei Li, Linghua Yan. (2010) Integrin beta1 over-expression associates with resistance to tyrosine kinase inhibitor gefitinib in non-small cell lung cancer. Journal of Cellular Biochemistry 111:6, 1565-1574
CrossRef142
Sabine Klüter , Jeffrey R. Simard , Haridas B. Rode, Christian Grütter, Vijaykumar Pawar, Hans C. A. Raaijmakers, Tjeerd A. Barf, Matthias Rabiller, Willem A. L. van Otterlo , Daniel Rauh . (2010) Characterization of Irreversible Kinase Inhibitors by Directly Detecting Covalent Bond Formation: A Tool for Dissecting Kinase Drug Resistance. ChemBioChem 11:18, 2557-2566
CrossRef143
Martin Krug, German Erlenkamp, Wolfgang Sippl, Christoph Schächtele, Frank Totzke, Andreas Hilgeroth. (2010) Discovery and selectivity-profiling of 4-benzylamino 1-aza-9-oxafluorene derivatives as lead structures for IGF-1R inhibitors. Bioorganic & Medicinal Chemistry Letters 20:23, 6915-6919
CrossRef144
Claudius Mueller, Lance A. Liotta, Virginia Espina. (2010) Reverse phase protein microarrays advance to use in clinical trials. Molecular Oncology 4:6, 461-481
CrossRef145
Young Joo Lee, Hyo Sub Shim, Young Ae Kang, Su Jung Hong, Hyun Ki Kim, Hoguen Kim, Se Kyu Kim, Sung Ho Choi, Joo-Hang Kim, Byoung Chul Cho. (2010) Dose effect of cigarette smoking on frequency and spectrum of epidermal growth factor receptor gene mutations in Korean patients with non-small cell lung cancer. Journal of Cancer Research and Clinical Oncology 136:12, 1937-1944
CrossRef146
James F. Spicer, Sarah M. Rudman. (2010) EGFR inhibitors in non-small cell lung cancer (NSCLC): the emerging role of the dual irreversible EGFR/HER2 inhibitor BIBW 2992. Targeted Oncology 5:4, 245-255
CrossRef147
Jessie Villanueva, Adina Vultur, John T. Lee, Rajasekharan Somasundaram, Mizuho Fukunaga-Kalabis, Angela K. Cipolla, Bradley Wubbenhorst, Xiaowei Xu, Phyllis A. Gimotty, Damien Kee, Ademi E. Santiago-Walker, Richard Letrero, Kurt D'Andrea, Anitha Pushparajan, James E. Hayden, Kimberly Dahlman Brown, Sylvie Laquerre, Grant A. McArthur, Jeffrey A. Sosman, Katherine L. Nathanson, Meenhard Herlyn. (2010) Acquired Resistance to BRAF Inhibitors Mediated by a RAF Kinase Switch in Melanoma Can Be Overcome by Cotargeting MEK and IGF-1R/PI3K. Cancer Cell 18:6, 683-695
CrossRef148
Jin Zhang, Jing Zhou, Xiaomei Ren, Yanyan Diao, Honglin Li, Hualiang Jiang, Ke Ding, Duanqing Pei. (2010) A new diaryl urea compound, D181, induces cell cycle arrest in the G1 and M phases by targeting receptor tyrosine kinases and the microtubule skeleton. Investigational New Drugs
CrossRef149
Sun-Young Han, Chong Ock Lee, Sung-Hoon Ahn, Mi-Ok Lee, So-Young Kang, Hyuk-Jin Cha, Sung Yun Cho, Jae Du Ha, Jae Wook Ryu, Heejung Jung, Hyoung Rae Kim, Jong Sung Koh, Jongkook Lee. (2010) Evaluation of a multi-kinase inhibitor KRC-108 as an anti-tumor agent in vitro and in vivo. Investigational New Drugs
CrossRef150
Kouki Ohtsuka, Hiroaki Ohnishi, Takeshi Morii, Masachika Fujiwara, Tomonori Kishino, Wataru Ogura, Misaki Chiba, Satsuki Matsushima, Tomoyuki Goya, Takashi Watanabe. (2010) Downregulated ABCG2 Enhances Sensitivity to Topoisomerase I Inhibitor in Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor-Resistant Non-small Cell Lung Cancer. Journal of Thoracic Oncology 5:11, 1726-1733
CrossRef151
William Pao, Juliann Chmielecki. (2010) Rational, biologically based treatment of EGFR-mutant non-small-cell lung cancer. Nature Reviews Cancer 10:11, 760-774
CrossRef152
Giuseppe Bronte, Sergio Rizzo, Laura La Paglia, Vincenzo Adamo, Sergio Siragusa, Corrado Ficorella, Daniele Santini, Viviana Bazan, Giuseppe Colucci, Nicola Gebbia, Antonio Russo. (2010) Driver mutations and differential sensitivity to targeted therapies: a new approach to the treatment of lung adenocarcinoma. Cancer Treatment Reviews 36, S21-S29
CrossRef153
Stacey J. Baker, E. Premkumar Reddy. (2010) Targeted Inhibition of Kinases in Cancer Therapy. Mount Sinai Journal of Medicine: A Journal of Translational and Personalized Medicine 77:6, 573-586
CrossRef154
Choi, Young Lim, Soda, Manabu, Yamashita, Yoshihiro, Ueno, Toshihide, Takashima, Junpei, Nakajima, Takahiro, Yatabe, Yasushi, Takeuchi, Kengo, Hamada, Toru, Haruta, Hidenori, Ishikawa, Yuichi, Kimura, Hideki, Mitsudomi, Tetsuya, Tanio, Yoshiro, Mano, Hiroyuki, . (2010) EML4-ALK Mutations in Lung Cancer That Confer Resistance to ALK Inhibitors. New England Journal of Medicine 363:18, 1734-1739
Full Text155
Barbara L. Parsons, Meagan B. Myers, Fanxue Meng, Yiying Wang, Page B. McKinzie. (2010) Oncomutations as biomarkers of cancer risk. Environmental and Molecular Mutagenesis 51:8-9, 836-850
CrossRef156
Akito Hata, Hiroshige Yoshioka, Shiro Fujita, Kei Kunimasa, Reiko Kaji, Yukihiro Imai, Keisuke Tomii, Masahiro Iwasaku, Akihiro Nishiyama, Tadashi Ishida, Nobuyuki Katakami. (2010) Complex Mutations in the Epidermal Growth Factor Receptor Gene in Non-small Cell Lung Cancer. Journal of Thoracic Oncology 5:10, 1524-1528
CrossRef157
Bipasha Mukherjee, Hak Choy, Chaitanya Nirodi, Sandeep Burma. (2010) Targeting Nonhomologous End-Joining Through Epidermal Growth Factor Receptor Inhibition: Rationale and Strategies for Radiosensitization. Seminars in Radiation Oncology 20:4, 250-257
CrossRef158
Gelenis Domingo, Cesar A Perez, Michel Velez, Jennifer Cudris, Luis E Raez, Edgardo S Santos. (2010) EGF receptor in lung cancer: a successful story of targeted therapy. Expert Review of Anticancer Therapy 10:10, 1577-1587
CrossRef159
Robert Pirker, Felix J. F. Herth, Keith M. Kerr, Martin Filipits, Miquel Taron, David Gandara, Fred R. Hirsch, Dominique Grunenwald, Helmut Popper, Egbert Smit, Manfred Dietel, Antonio Marchetti, Christian Manegold, Peter Schirmacher, Michael Thomas, Rafael Rosell, Federico Cappuzzo, Rolf Stahel. (2010) Consensus for EGFR Mutation Testing in Non-small Cell Lung Cancer. Journal of Thoracic Oncology 5:10, 1706-1713
CrossRef160
Tony S Mok, Qing Zhou, Linda Leung, Herbert H Loong. (2010) Personalized medicine for non-small-cell lung cancer. Expert Review of Anticancer Therapy 10:10, 1601-1611
CrossRef161
Lee M Ellis, Isaiah J Fidler. (2010) Finding the tumor copycat: Therapy fails, patients don't. Nature Medicine 16:9, 974-975
CrossRef162
Deric L. Wheeler, Emily F. Dunn, Paul M. Harari. (2010) Understanding resistance to EGFR inhibitors—impact on future treatment strategies. Nature Reviews Clinical Oncology 7:9, 493-507
CrossRef163
Yoichi Nakamura, Kazumi Sano, Hiroshi Soda, Hiroshi Takatani, Minoru Fukuda, Seiji Nagashima, Tomayoshi Hayashi, Mikio Oka, Kazuhiro Tsukamoto, Shigeru Kohno. (2010) Pharmacokinetics of Gefitinib Predicts Antitumor Activity for Advanced Non-small Cell Lung Cancer. Journal of Thoracic Oncology 5:9, 1404-1409
CrossRef164
Neal Ready, Pasi A. Jänne, Jeffrey Bogart, Thomas DiPetrillo, Jennifer Garst, Stephen Graziano, Lin Gu, Xiaofei Wang, Mark R. Green, Everett E. Vokes. (2010) Chemoradiotherapy and Gefitinib in Stage III Non-small Cell Lung Cancer with Epidermal Growth Factor Receptor and KRAS Mutation Analysis. Journal of Thoracic Oncology 5:9, 1382-1390
CrossRef165
Hongbin Ji. (2010) Mechanistic insights into acquired drug resistance in epidermal growth factor receptor mutation-targeted lung cancer therapy. Cancer Science 101:9, 1933-1938
CrossRef166
Guo Jian, Zhou Songwen, Zhang Ling, Deng Qinfang, Zhang Jie, Tang Liang, Zhou Caicun. (2010) Prediction of epidermal growth factor receptor mutations in the plasma/pleural effusion to efficacy of gefitinib treatment in advanced non-small cell lung cancer. Journal of Cancer Research and Clinical Oncology 136:9, 1341-1347
CrossRef167
James S. Myerson, Syed A. Iqbal, Mary E. R. O'Brien, Sanjay Popat. (2010) Supersensitive Mutation: Two Case Reports of Non–Small-Cell Lung Cancer Treated With Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors. Clinical Lung Cancer 11:5, E5-E8
CrossRef168
Haiying Cheng, Xunhai Xu, Daniel B. Costa, Charles A. Powell, Balazs Halmos. (2010) Molecular Testing in Lung Cancer: The Time Is Now. Current Oncology Reports 12:5, 335-348
CrossRef169
Eudocia C. Quant, Patrick Y. Wen. (2010) Novel Medical Therapeutics in Glioblastomas, Including Targeted Molecular Therapies, Current and Future Clinical Trials. Neuroimaging Clinics of North America 20:3, 425-448
CrossRef170
Hu Zhu, Xinyu Cao, Francis Ali-Osman, Stephen Keir, Hui-Wen Lo. (2010) EGFR and EGFRvIII interact with PUMA to inhibit mitochondrial translocalization of PUMA and PUMA-mediated apoptosis independent of EGFR kinase activity. Cancer Letters 294:1, 101-110
CrossRef171
Yuriko Saito, Takako Furukawa, Yasushi Arano, Yasuhisa Fujibayashi, Tsuneo Saga. (2010) Fusion protein based on Grb2-SH2 domain for cancer therapy. Biochemical and Biophysical Research Communications 399:2, 262-267
CrossRef172
Robert C. Doebele, Ana B. Oton, Nir Peled, D. Ross Camidge, Paul A. Bunn. (2010) New strategies to overcome limitations of reversible EGFR tyrosine kinase inhibitor therapy in non-small cell lung cancer. Lung Cancer 69:1, 1-12
CrossRef173
Jenn-Yu Wu, Chih-Hsin Yang, Ya-Chieh Hsu, Chong-Jen Yu, Shih-Han Chang, Jin-Yuan Shih, Pan-Chyr Yang. (2010) Use of Cetuximab After Failure of Gefitinib in Patients With Advanced Non–Small-Cell Lung Cancer. Clinical Lung Cancer 11:4, 257-263
CrossRef174
Lynette M. Sholl, Neal I. Lindeman. (2010) Molecular Diagnostics Testing for Lung Adenocarcinoma. Pathology Case Reviews 15:4, 103-110
CrossRef175
J. W. Tyner, T. G. Bumm, J. Deininger, L. Wood, K. J. Aichberger, M. M. Loriaux, B. J. Druker, C. J. Burns, E. Fantino, M. W. Deininger. (2010) CYT387, a novel JAK2 inhibitor, induces hematologic responses and normalizes inflammatory cytokines in murine myeloproliferative neoplasms. Blood 115:25, 5232-5240
CrossRef176
L. A. Garraway, W. C. Hahn. (2010) On or Off Target: Mutations, Models, and Predictions. Science Translational Medicine 2:35, 35ps28-35ps28
CrossRef177
Stéphanie Kermorgant, Jonna Nevo, Johanna Ivaska. (2010) Research Highlights. Pharmacogenomics 11:6, 743-746
CrossRef178
Flavia F. Moreira-Leite, Luke R. Harrison, Alexandr Mironov, Ruth A. Roberts, Caroline Dive. (2010) Inducible EGFR T790M-Mediated Gefitinib Resistance in Non-small Cell Lung Cancer Cells Does Not Modulate Sensitivity to PI103 Provoked Autophagy. Journal of Thoracic Oncology 5:6, 765-777
CrossRef179
Mitchell S. Cairo, Craig T. Jordan, Carlo C. Maley, Clifford Chao, Ari Melnick, Scott A. Armstrong, Warren Shlomchik, Jeff Molldrem, Soldano Ferrone, Crystal Mackall, Laurence Zitvogel, Michael R. Bishop, Sergio A. Giralt, Carl H. June. (2010) NCI First International Workshop on the Biology, Prevention, and Treatment of Relapse After Allogeneic Hematopoietic Stem Cell Transplantation: Report from the Committee on the Biological Considerations of Hematological Relapse following Allogeneic Stem Cell Transplantation Unrelated to Graft-versus-Tumor Effects: State of the Science. Biology of Blood and Marrow Transplantation 16:6, 709-728
CrossRef180
Lukas C. Heukamp, Reinhard Büttner. (2010) Molekulardiagnostik des Lungenkarzinoms zur Therapiestratifizierung. Onkopipeline 3:2, 87-93
CrossRef181
E. Weisberg, H. G. Choi, A. Ray, R. Barrett, J. Zhang, T. Sim, W. Zhou, M. Seeliger, M. Cameron, M. Azam, J. A. Fletcher, M. Debiec-Rychter, M. Mayeda, D. Moreno, A. L. Kung, P. A. Janne, R. Khosravi-Far, J. V. Melo, P. W. Manley, S. Adamia, C. Wu, N. Gray, J. D. Griffin. (2010) Discovery of a small-molecule type II inhibitor of wild-type and gatekeeper mutants of BCR-ABL, PDGFR , Kit, and Src kinases: novel type II inhibitor of gatekeeper mutants. Blood 115:21, 4206-4216
CrossRef182
Wee-Lee Yeo, Gregory J. Riely, Beow Y. Yeap, Michelle W. Lau, Jeremy L. Warner, Kelly Bodio, Mark S. Huberman, Mark G. Kris, Daniel G. Tenen, William Pao, Susumu Kobayashi, Daniel B. Costa. (2010) Erlotinib at a Dose of 25 mg Daily for Non-small Cell Lung Cancers with EGFR Mutations. Journal of Thoracic Oncology1
CrossRef183
Dora Dias-Santagata, Sara Akhavanfard, Serena S. David, Kathy Vernovsky, Georgiana Kuhlmann, Susan L. Boisvert, Hannah Stubbs, Ultan McDermott, Jeffrey Settleman, Eunice L. Kwak, Jeffrey W. Clark, Steven J. Isakoff, Lecia V. Sequist, Jeffrey A. Engelman, Thomas J. Lynch, Daniel A. Haber, David N. Louis, Leif W. Ellisen, Darrell R. Borger, A. John Iafrate. (2010) Rapid targeted mutational analysis of human tumours: a clinical platform to guide personalized cancer medicine. EMBO Molecular Medicine 2:5, 146-158
CrossRef184
Mark A. Socinski. (2010) The Emerging Role of Biomarkers in Advanced Non–Small-Cell Lung Cancer. Clinical Lung Cancer 11:3, 149-159
CrossRef185
Matthew K. Wong, Alvis I. Lo, Bing Lam, W. K. Lam, Mary S. Ip, James C. Ho. (2010) Erlotinib as salvage treatment after failure to first-line gefitinib in non-small cell lung cancer. Cancer Chemotherapy and Pharmacology 65:6, 1023-1028
CrossRef186
Yoshio Tomizawa, Yuka Fujita, Atsuhisa Tamura, Masahiro Shirai, Satoshi Shibata, Tsutomu Kawabata, Takuo Shibayama, Shimao Fukai, Masaaki Kawahra, Ryusei Saito. (2010) Effect of gefitinib re-challenge to initial gefitinib responder with non-small cell lung cancer followed by chemotherapy. Lung Cancer 68:2, 269-272
CrossRef187
Richard L. Schilsky. (2010) Personalized medicine in oncology: the future is now. Nature Reviews Drug Discovery 9:5, 363-366
CrossRef188
Takamitsu Onitsuka, Hidetaka Uramoto, Naohiro Nose, Mitsuhiro Takenoyama, Takeshi Hanagiri, Kenji Sugio, Kosei Yasumoto. (2010) Acquired resistance to gefitinib: The contribution of mechanisms other than the T790M, MET, and HGF status. Lung Cancer 68:2, 198-203
CrossRef189
Yosuke Togashi, Katsuhiro Masago, Masahide Fukudo, Tomohiro Terada, Shiro Fujita, Kaoru Irisa, Yuichi Sakamori, Young Hak Kim, Tadashi Mio, Ken-ichi Inui, Michiaki Mishima. (2010) Cerebrospinal Fluid Concentration of Erlotinib and its Active Metabolite OSI-420 in Patients with Central Nervous System Metastases of Non-small Cell Lung Cancer. Journal of Thoracic Oncology1
CrossRef190
D Ercan, K Zejnullahu, K Yonesaka, Y Xiao, M Capelletti, A Rogers, E Lifshits, A Brown, C Lee, J G Christensen, D J Kwiatkowski, J A Engelman, P A Jänne. (2010) Amplification of EGFR T790M causes resistance to an irreversible EGFR inhibitor. Oncogene 29:16, 2346-2356
CrossRef191
Young-Kwang Yoon, Hwang-Phill Kim, Sae-Won Han, Do Youn Oh, Seock-Ah Im, Yung-Jue Bang, Tae-You Kim. (2010) KRAS mutant lung cancer cells are differentially responsive to MEK inhibitor due to AKT or STAT3 activation: Implication for combinatorial approach. Molecular Carcinogenesis 49:4, 353-362
CrossRef192
Raffaele Di Francia, Ferdinando Frigeri, Massimiliano Berretta, Erika Cecchin, Claudio Orlando, Antonio Pinto, Pamela Pinzani. (2010) Decision criteria for rational selection of homogeneous genotyping platforms for pharmacogenomics testing in clinical diagnostics. Clinical Chemistry and Laboratory Medicine 48:4, 447-459
CrossRef193
Z. Zhang, S. Kobayashi, A. C. Borczuk, R. S. Leidner, T. LaFramboise, A. D. Levine, B. Halmos. (2010) Dual specificity phosphatase 6 (DUSP6) is an ETS-regulated negative feedback mediator of oncogenic ERK signaling in lung cancer cells. Carcinogenesis 31:4, 577-586
CrossRef194
Ulrich Keller, Nikolas Von Bubnoff, Christian Peschel, Justus Duyster. (2010) Oncologist’s/haematologist’s view on the roles of pathologists for molecular targeted cancer therapy. Journal of Cellular and Molecular Medicine 14:4, 805-817
CrossRef195
Sabino Ciavarella, Annalisa Milano, Franco Dammacco, Franco Silvestris. (2010) Targeted Therapies in Cancer. BioDrugs 24:2, 77-88
CrossRef196
Kyoichi Kaira, Tateaki Naito, Toshiaki Takahashi, Eriko Ayabe, Rai Shimoyama, Rieko Kaira, Akira Ono, Satoshi Igawa, Takehito Shukuya, Haruyasu Murakami, Asuka Tsuya, Yukiko Nakamura, Masahiro Endo, Nobuyuki Yamamoto. (2010) Pooled analysis of the reports of erlotinib after failure of gefitinib for non-small cell lung cancer. Lung Cancer 68:1, 99-104
CrossRef197
Rocio Sotillo, Juan-Manuel Schvartzman, Nicholas D. Socci, Robert Benezra. (2010) Mad2-induced chromosome instability leads to lung tumour relapse after oncogene withdrawal. Nature 464:7287, 436-440
CrossRef198
Takamitsu Onitsuka, Hidetaka Uramoto, Kenji Ono, Mitsuhiro Takenoyama, Takeshi Hanagiri, Tsunehiro Oyama, Hiroto Izumi, Kimitoshi Kohno, Kosei Yasumoto. (2010) Comprehensive Molecular Analyses of Lung Adenocarcinoma with Regard to the Epidermal Growth Factor Receptor, K-ras, MET, and Hepatocyte Growth Factor Status. Journal of Thoracic Oncology1
CrossRef199
Michael J. Eck, Cai-Hong Yun. (2010) Structural and mechanistic underpinnings of the differential drug sensitivity of EGFR mutations in non-small cell lung cancer. Biochimica et Biophysica Acta (BBA) - Proteins & Proteomics 1804:3, 559-566
CrossRef200
Yasushi Yatabe. (2010) EGFR mutations and the terminal respiratory unit. Cancer and Metastasis Reviews 29:1, 23-36
CrossRef201
Adi F. Gazdar. (2010) Epidermal growth factor receptor inhibition in lung cancer: the evolving role of individualized therapy. Cancer and Metastasis Reviews 29:1, 37-48
CrossRef202
Peng Yue, William F. Forrest, Joshua S. Kaminker, Scott Lohr, Zemin Zhang, Guy Cavet. (2010) Inferring the functional effects of mutation through clusters of mutations in homologous proteins. Human Mutation 31:3, 264-271
CrossRef203
R. Rajasekaran, Rao Sethumadhavan. (2010) In Silico Identification of Significant Detrimental Missense Mutations of EGFR and Their Effect with 4-Anilinoquinazoline-Based Drugs. Applied Biochemistry and Biotechnology 160:6, 1723-1733
CrossRef204
Augusto Villanueva, Beatriz Minguez, Alejandro Forner, Maria Reig, Josep M. Llovet. (2010) Hepatocellular Carcinoma: Novel Molecular Approaches for Diagnosis, Prognosis, and Therapy. Annual Review of Medicine 61:1, 317-328
CrossRef205
J. T. Auman, H. L. McLeod. (2010) Now's the time to find biomarkers on purpose. Annals of Oncology 21:2, 193-194
CrossRef206
T. Mitsudomi. (2010) Advances in Target Therapy for Lung Cancer. Japanese Journal of Clinical Oncology 40:2, 101-106
CrossRef207
R. CABRERA, D. R. NELSON. (2010) Review article: the management of hepatocellular carcinoma. Alimentary Pharmacology & Therapeutics 31:4, 461-476
CrossRef208
L.C. Heukamp, R. Büttner. (2010) Molekulardiagnostik des Lungenkarzinoms zur Therapiestratifizierung. Der Pathologe 31:1, 22-28
CrossRef209
Jeffrey Jie-Lou Liao. 2010. Structure-Based Design of Kinase Inhibitors: Molecular Recognition of Protein Multiple Conformations. .
CrossRef210
Jianming Zhang, Francisco J. Adrián, Wolfgang Jahnke, Sandra W. Cowan-Jacob, Allen G. Li, Roxana E. Iacob, Taebo Sim, John Powers, Christine Dierks, Fangxian Sun, Gui-Rong Guo, Qiang Ding, Barun Okram, Yongmun Choi, Amy Wojciechowski, Xianming Deng, Guoxun Liu, Gabriele Fendrich, André Strauss, Navratna Vajpai, Stephan Grzesiek, Tove Tuntland, Yi Liu, Badry Bursulaya, Mohammad Azam, Paul W. Manley, John R. Engen, George Q. Daley, Markus Warmuth, Nathanael S. Gray. (2010) Targeting Bcr–Abl by combining allosteric with ATP-binding-site inhibitors. Nature 463:7280, 501-506
CrossRef211
Alexa B. Turke, Kreshnik Zejnullahu, Yi-Long Wu, Youngchul Song, Dora Dias-Santagata, Eugene Lifshits, Luca Toschi, Andrew Rogers, Tony Mok, Lecia Sequist, Neal I. Lindeman, Carly Murphy, Sara Akhavanfard, Beow Y. Yeap, Yun Xiao, Marzia Capelletti, A. John Iafrate, Charles Lee, James G. Christensen, Jeffrey A. Engelman, Pasi A. Jänne. (2010) Preexistence and Clonal Selection of MET Amplification in EGFR Mutant NSCLC. Cancer Cell 17:1, 77-88
CrossRef212
Aaron G. Mammoser, Morris D. Groves. (2010) Biology and Therapy of Neoplastic Meningitis. Current Oncology Reports 12:1, 41-49
CrossRef213
Jenn-Yu Wu, Jin-Yuan Shih, Chih-Hsin Yang, Kuan-Yu Chen, Chao-Chi Ho, Chong-Jen Yu, Pan-Chyr Yang. (2010) Second-line treatments after first-line gefitinib therapy in advanced nonsmall cell lung cancer. International Journal of Cancer 126:1, 247-255
CrossRef214
Nathan T. Harvey, Nancy Lerda, Graeme Casey, Glenice Cheetham. (2010) SYNCHRONOUS EGFR AND KRAS MUTATIONS IN NON-SMALL CELL LUNG CARCINOMA. Pathology 42:Sup 1, S69
CrossRef215
Takeshi Yoshida, Isamu Okamoto, Wataru Okamoto, Erina Hatashita, Yuki Yamada, Kiyoko Kuwata, Kazuto Nishio, Masahiro Fukuoka, Pasi A. Jänne, Kazuhiko Nakagawa. (2010) Effects of Src inhibitors on cell growth and epidermal growth factor receptor and MET signaling in gefitinib-resistant non-small cell lung cancer cells with acquired MET amplification. Cancer Science 101:1, 167-172
CrossRef216
Marcin Teodorczyk, Ana Martin-Villalba. (2010) Sensing invasion: Cell surface receptors driving spreading of glioblastoma. Journal of Cellular Physiology 222:1, 1-10
CrossRef217
Shinichi Toyooka, Tetsuya Mitsudomi, Junichi Soh, Hiromasa Yamamoto, Shinichiro Miyoshi. (2010) Molecular Biology of Lung Cancer. Haigan 50:4, 329-341
CrossRef218
Hiroshi Hashimoto, Yoshinori Nakagishi, Kiyohaya Obara, Yoshiro Oshika. (2010) A Patient with Advanced Lung Adenocarcinoma Effectively Treated with Gemcitabine Plus Vinorelbine After Failure with Gefitinib. Haigan 50:3, 297-302
CrossRef219
Hajime Asahina, Satoshi Oizumi, Akira Inoue, Ichiro Kinoshita, Takashi Ishida, Yuka Fujita, Noriaki Sukoh, Masao Harada, Makoto Maemondo, Yasuo Saijo, Hirotoshi Dosaka-Akita, Hiroshi Isobe, Toshihiro Nukiwa, Masaharu Nishimura. (2010) Phase II Study of Gefitinib Readministration in Patients with Advanced Non-Small Cell Lung Cancer and Previous Response to Gefitinib. Oncology 79:5-6, 423-429
CrossRef220
Nagahiro Saijo, Hirotsugu Kenmotsu. (2010) Recent Development of Molecular-Targeted Drugs in Lung Cancer. Internal Medicine 49:18, 1923-1934
CrossRef221
Hiroyuki Mano. (2010) Discovery of a Lung Cancer Oncogene, EML4-ALK, and Its Clinical Application. Haigan 50:7, 889-893
CrossRef222
Yinghui Zhou, William M Rideout, Tong Zi, Angela Bressel, Shailaja Reddypalli, Rebecca Rancourt, Jin-Kyeung Woo, James W Horner, Lynda Chin, M Isabel Chiu, Marcus Bosenberg, Tyler Jacks, Steven C Clark, Ronald A DePinho, Murray O Robinson, Joerg Heyer. (2010) Chimeric mouse tumor models reveal differences in pathway activation between ERBB family– and KRAS-dependent lung adenocarcinomas. Nature Biotechnology 28:1, 71-78
CrossRef223
Greg V. Manson, Patrick C. Ma. (2010) Response to Pemetrexed Chemotherapy in Lung Adenocarcinoma-Bronchioloalveolar Carcinoma Insensitive to Erlotinib. Clinical Lung Cancer 11:1, 57-60
CrossRef224
Isamu Okamoto. (2010) Epidermal growth factor receptor in relation to tumor development: EGFR-targeted anticancer therapy. FEBS Journal 277:2, 309-315
CrossRef225
Wenjun Zhou, Dalia Ercan, Liang Chen, Cai-Hong Yun, Danan Li, Marzia Capelletti, Alexis B. Cortot, Lucian Chirieac, Roxana E. Iacob, Robert Padera, John R. Engen, Kwok-Kin Wong, Michael J. Eck, Nathanael S. Gray, Pasi A. Jänne. (2009) Novel mutant-selective EGFR kinase inhibitors against EGFR T790M. Nature 462:7276, 1070-1074
CrossRef226
Janusz M Sowadski, Robert K Suto. 2009. Protein Kinases: Signatures in Cancer. .
CrossRef227
Hua-Jun Chen, Tony S. Mok, Zhi-Hong Chen, Ai-Lin Guo, Xu-Chao Zhang, Jian Su, Yi-Long Wu. (2009) Clinicopathologic and Molecular Features of Epidermal Growth Factor Receptor T790M Mutation and c-MET Amplification in Tyrosine Kinase Inhibitor-resistant Chinese Non-small Cell Lung Cancer. Pathology & Oncology Research 15:4, 651-658
CrossRef228
Toshirou Nishida, Tsuyoshi Takahashi, Yasuaki Miyazaki. (2009) Gastrointestinal stromal tumor: a bridge between bench and bedside. Gastric Cancer 12:4, 175-188
CrossRef229
C. M. Emery, K. G. Vijayendran, M. C. Zipser, A. M. Sawyer, L. Niu, J. J. Kim, C. Hatton, R. Chopra, P. A. Oberholzer, M. B. Karpova, L. E. MacConaill, J. Zhang, N. S. Gray, W. R. Sellers, R. Dummer, L. A. Garraway. (2009) MEK1 mutations confer resistance to MEK and B-RAF inhibition. Proceedings of the National Academy of Sciences 106:48, 20411-20416
CrossRef230
A. C. Faber, D. Li, Y. Song, M.-C. Liang, B. Y. Yeap, R. T. Bronson, E. Lifshits, Z. Chen, S.-M. Maira, C. Garcia-Echeverria, K.-K. Wong, J. A. Engelman. (2009) Differential induction of apoptosis in HER2 and EGFR addicted cancers following PI3K inhibition. Proceedings of the National Academy of Sciences 106:46, 19503-19508
CrossRef231
Tatsuya Katayama, Junichi Shimizu, Kenichi Suda, Ryoichi Onozato, Takayuki Fukui, Simon Ito, Shunzo Hatooka, Taijiro Sueda, Toyoaki Hida, Yasushi Yatabe, Tetsuya Mitsudomi. (2009) Efficacy of Erlotinib for Brain and Leptomeningeal Metastases in Patients with Lung Adenocarcinoma Who Showed Initial Good Response to Gefitinib. Journal of Thoracic Oncology 4:11, 1415-1419
CrossRef232
Robert Y. Osamura. (2009) Roles of pathologists in molecular targeted cancer therapy. Journal of Cellular and Molecular Medicine 13:11-12, 4286-4290
CrossRef233
Haizhen Zhong, Ly M. Tran, Jenna L. Stang. (2009) Induced-fit docking studies of the active and inactive states of protein tyrosine kinases. Journal of Molecular Graphics and Modelling 28:4, 336-346
CrossRef234
C Li, M Iida, E F Dunn, A J Ghia, D L Wheeler. (2009) Nuclear EGFR contributes to acquired resistance to cetuximab. Oncogene 28:43, 3801-3813
CrossRef235
M. L. Sos, S. Fischer, R. Ullrich, M. Peifer, J. M. Heuckmann, M. Koker, S. Heynck, I. Stuckrath, J. Weiss, F. Fischer, K. Michel, A. Goel, L. Regales, K. A. Politi, S. Perera, M. Getlik, L. C. Heukamp, S. Ansen, T. Zander, R. Beroukhim, H. Kashkar, K. M. Shokat, W. R. Sellers, D. Rauh, C. Orr, K. P. Hoeflich, L. Friedman, K.-K. Wong, W. Pao, R. K. Thomas. (2009) Identifying genotype-dependent efficacy of single and combined PI3K- and MAPK-pathway inhibition in cancer. Proceedings of the National Academy of Sciences 106:43, 18351-18356
CrossRef236
William Lee, Peng Yue, Zemin Zhang. (2009) Analytical methods for inferring functional effects of single base pair substitutions in human cancers. Human Genetics 126:4, 481-498
CrossRef237
Nicholas Lydon. (2009) Attacking cancer at its foundation. Nature Medicine 15:10, 1153-1157
CrossRef238
Brian I Rini, Michael B Atkins. (2009) Resistance to targeted therapy in renal-cell carcinoma. The Lancet Oncology 10:10, 992-1000
CrossRef239
Lucia Regales, Yixuan Gong, Ronglai Shen, Elisa de Stanchina, Igor Vivanco, Aviva Goel, Jason A. Koutcher, Maria Spassova, Ouathek Ouerfelli, Ingo K. Mellinghoff, Maureen F. Zakowski, Katerina A. Politi, William Pao. (2009) Dual targeting of EGFR can overcome a major drug resistance mutation in mouse models of EGFR mutant lung cancer. Journal of Clinical Investigation
CrossRef240
Pasi A. Jänne, Nathanael Gray, Jeff Settleman. (2009) Factors underlying sensitivity of cancers to small-molecule kinase inhibitors. Nature Reviews Drug Discovery 8:9, 709-723
CrossRef241
Lei Ye, Libero Santarpia, Robert F. Gagel. (2009) Targeted Therapy for Endocrine Cancer: The Medullary Thyroid Carcinoma Paradigm. Endocrine Practice 15:6, 597-604
CrossRef242
Jaclyn A. Freudenberg, Qiang Wang, Makoto Katsumata, Jeffrey Drebin, Izumi Nagatomo, Mark I. Greene. (2009) The role of HER2 in early breast cancer metastasis and the origins of resistance to HER2-targeted therapies. Experimental and Molecular Pathology 87:1, 1-11
CrossRef243
A F Gazdar. (2009) Activating and resistance mutations of EGFR in non-small-cell lung cancer: role in clinical response to EGFR tyrosine kinase inhibitors. Oncogene 28, S24-S31
CrossRef244
T John, G Liu, M-S Tsao. (2009) Overview of molecular testing in non-small-cell lung cancer: mutational analysis, gene copy number, protein expression and other biomarkers of EGFR for the prediction of response to tyrosine kinase inhibitors. Oncogene 28, S14-S23
CrossRef245
H A Burris. (2009) Shortcomings of current therapies for non-small-cell lung cancer: unmet medical needs. Oncogene 28, S4-S13
CrossRef246
Ali Torkamani, Gennady Verkhivker, Nicholas J. Schork. (2009) Cancer driver mutations in protein kinase genes. Cancer Letters 281:2, 117-127
CrossRef247
Bruce H Littman. (2009) Translational strategies to implement personalized medicine: rheumatoid arthritis examples. Personalized Medicine 6:4, 429-437
CrossRef248
Michalis V Karamouzis, Panagiotis A Konstantinopoulos, Athanasios G Papavassiliou. (2009) Targeting MET as a strategy to overcome crosstalk-related resistance to EGFR inhibitors. The Lancet Oncology 10:7, 709-717
CrossRef249
L. Yang, H. Luo, J. Chen, Q. Xing, L. He. (2009) SePreSA: a server for the prediction of populations susceptible to serious adverse drug reactions implementing the methodology of a chemical-protein interactome. Nucleic Acids Research 37:Web Server, W406-W412
CrossRef250
Mariano Provencio, Rosario García-Campelo, Dolores Isla, Javier Castro. (2009) Clinical-molecular factors predicting response and survival for tyrosine-kinase inhibitors. Clinical and Translational Oncology 11:7, 428-436
CrossRef251
Kirsten Dorans. (2009) Outpacing Cancer. Nature Medicine 15:7, 718-722
CrossRef252
Hyeon Gyu Yi, Hye Jin Kim, Yu Jung Kim, Sae-Won Han, Do-Youn Oh, Se-Hoon Lee, Dong-Wan Kim, Seock-Ah Im, Tae-You Kim, Chul Soo Kim, Dae Seog Heo, Yung-Jue Bang. (2009) Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) are effective for leptomeningeal metastasis from non-small cell lung cancer patients with sensitive EGFR mutation or other predictive factors of good response for EGFR TKI. Lung Cancer 65:1, 80-84
CrossRef253
K. Kawaguchi, H. Murakami, T. Taniguchi, M. Fujii, S. Kawata, T. Fukui, Y. Kondo, H. Osada, N. Usami, K. Yokoi, Y. Ueda, Y. Yatabe, M. Ito, Y. Horio, T. Hida, Y. Sekido. (2009) Combined inhibition of MET and EGFR suppresses proliferation of malignant mesothelioma cells. Carcinogenesis 30:7, 1097-1105
CrossRef254
Dong-hai Huang, Ling Su, Xiang-hong Peng, Hongzheng Zhang, Fadlo R Khuri, Dong M Shin, Zhuo (Georgia) Chen. (2009) Quantum dot-based quantification revealed differences in subcellular localization of EGFR and E-cadherin between EGFR-TKI sensitive and insensitive cancer cells. Nanotechnology 20:22, 225102
CrossRef255
Jian Ming Xu, Yu Han, Hai Qing Duan, E. Mei Gao, Yang Zhang, Xiao Qing Liu, Jing Sheng Zhang, Luca Toschi, Domenico Galetta, Amalia Azzariti, Angelo Paradiso. (2009) EGFR mutations and HER2/3 protein expression and clinical outcome in Chinese advanced non-small cell lung cancer patients treated with gefitinib. Journal of Cancer Research and Clinical Oncology 135:6, 771-782
CrossRef256
Kenji Sugio, Hidetaka Uramoto, Takamitsu Onitsuka, Makiko Mizukami, Yoshinobu Ichiki, Masakazu Sugaya, Manabu Yasuda, Mitsuhiro Takenoyama, Tsunehiro Oyama, Takeshi Hanagiri, Kosei Yasumoto. (2009) Prospective phase II study of gefitinib in non-small cell lung cancer with epidermal growth factor receptor gene mutations. Lung Cancer 64:3, 314-318
CrossRef257
Helena Linardou, Issa J. Dahabreh, Dimitrios Bafaloukos, Paris Kosmidis, Samuel Murray. (2009) Somatic EGFR mutations and efficacy of tyrosine kinase inhibitors in NSCLC. Nature Reviews Clinical Oncology 6:6, 352-366
CrossRef258
Martin L. Sos, Kathrin Michel, Thomas Zander, Jonathan Weiss, Peter Frommolt, Martin Peifer, Danan Li, Roland Ullrich, Mirjam Koker, Florian Fischer, Takeshi Shimamura, Daniel Rauh, Craig Mermel, Stefanie Fischer, Isabel Stückrath, Stefanie Heynck, Rameen Beroukhim, William Lin, Wendy Winckler, Kinjal Shah, Thomas LaFramboise, Whei F. Moriarty, Megan Hanna, Laura Tolosi, Jörg Rahnenführer, Roel Verhaak, Derek Chiang, Gad Getz, Martin Hellmich, Jürgen Wolf, Luc Girard, Michael Peyton, Barbara A. Weir, Tzu-Hsiu Chen, Heidi Greulich, Jordi Barretina, Geoffrey I. Shapiro, Levi A. Garraway, Adi F. Gazdar, John D. Minna, Matthew Meyerson, Kwok-Kin Wong, Roman K. Thomas. (2009) Predicting drug susceptibility of non–small cell lung cancers based on genetic lesions. Journal of Clinical Investigation 119:6, 1727-1740
CrossRef259
Yi Xing, Lun Yang, Lei Wang, Liyan Shao, Zhiyun Wei, Jiekun Xuan, Jun Li, Shengying Qin, Anli Shu, Lin He, Qinghe Xing. (2009) Systematic screening for polymorphisms within the UGT1A6 gene in three Chinese populations and function prediction through structural modeling. Pharmacogenomics 10:5, 741-752
CrossRef260
Wolfram C.M. Dempke, Volker Heinemann. (2009) Resistance to EGF-R (erbB-1) and VEGF-R modulating agents. European Journal of Cancer 45:7, 1117-1128
CrossRef261
Giulio Metro, Federico Cappuzzo. (2009) New targeted therapies for non-small-cell lung cancer. Therapy 6:3, 335-350
CrossRef262
Sai-Hong Ignatius Ou, Coty Ho. (2009) Treatment of Advanced Lung Cancer. Clinical Pulmonary Medicine 16:3, 157-171
CrossRef263
Takafumi Kubo, Hiromasa Yamamoto, William W. Lockwood, Ilse Valencia, Junichi Soh, Michael Peyton, Masaru Jida, Hiroki Otani, Tetsuya Fujii, Mamoru Ouchida, Nagio Takigawa, Katsuyuki Kiura, Kenji Shimizu, Hiroshi Date, John D. Minna, Marileila Varella-Garcia, Wan L. Lam, Adi F. Gazdar, Shinichi Toyooka. (2009) MET gene amplification or EGFR mutation activate MET in lung cancers untreated with EGFR tyrosine kinase inhibitors. International Journal of Cancer 124:8, 1778-1784
CrossRef264
Michael J Eck, Paul W Manley. (2009) The interplay of structural information and functional studies in kinase drug design: insights from BCR-Abl. Current Opinion in Cell Biology 21:2, 288-295
CrossRef265
Mai Yamauchi, Noriko Gotoh. (2009) Theme: Oncology - Molecular mechanisms determining the efficacy of EGF receptor-specific tyrosine kinase inhibitors help to identify biomarker candidates. Biomarkers in Medicine 3:2, 139-151
CrossRef266
, Toshirou Nishida, Tsuyoshi Takahashi, Akiko Nishitani, Toshihiko Doi, Kuniaki Shirao, Yoshito Komatsu, Kiyokazu Nakajima, Seiichi Hirota. (2009) Sunitinib-resistant gastrointestinal stromal tumors harbor cis-mutations in the activation loop of the KIT gene. International Journal of Clinical Oncology 14:2, 143-149
CrossRef267
Georgios Voidonikolas, Stephanie S. Kreml, Changyi Chen, William E. Fisher, F. Charles Brunicardi, Richard A. Gibbs, Marie-Claude Gingras. (2009) Basic Principles and Technologies for Deciphering the Genetic Map of Cancer. World Journal of Surgery 33:4, 615-629
CrossRef268
Tony Hunter. (2009) Tyrosine phosphorylation: thirty years and counting. Current Opinion in Cell Biology 21:2, 140-146
CrossRef269
Darrin Stuart, William R Sellers. (2009) Linking somatic genetic alterations in cancer to therapeutics. Current Opinion in Cell Biology 21:2, 304-310
CrossRef270
Hiromasa Yamamoto, Shinichi Toyooka, Tetsuya Mitsudomi. (2009) Impact of EGFR mutation analysis in non-small cell lung cancer. Lung Cancer 63:3, 315-321
CrossRef271
Lecia V. Sequist, Sunitha Nagrath, Mehmet Toner, Daniel A. Haber, Thomas J. Lynch. (2009) The CTC-Chip. Journal of Thoracic Oncology 4:3, 281-283
CrossRef272
Jason H. Smouse, Edmund S. Cibas, Pasi A. Jänne, Victoria A. Joshi, Kelly H. Zou, Neal I. Lindeman. (2009) EGFR mutations are detected comparably in cytologic and surgical pathology specimens of nonsmall cell lung cancer. Cancer Cytopathology 117:1, 67-72
CrossRef273
A. Ushiki, T. Koizumi, N. Kobayashi, S. Kanda, M. Yasuo, H. Yamamoto, K. Kubo, D. Aoyagi, J. Nakayama. (2009) Genetic Heterogeneity of EGFR Mutation in Pleomorphic Carcinoma of the Lung: Response to Gefitinib and Clinical Outcome. Japanese Journal of Clinical Oncology 39:4, 267-270
CrossRef274
Jin Kyung Rho, Yun Jung Choi, Jin Kyung Lee, Baek-Yeol Ryoo, Im Il Na, Sung Hyun Yang, Cheol Hyeon Kim, Jae Cheol Lee. (2009) Epithelial to mesenchymal transition derived from repeated exposure to gefitinib determines the sensitivity to EGFR inhibitors in A549, a non-small cell lung cancer cell line. Lung Cancer 63:2, 219-226
CrossRef275
John W. Pepper, C. Scott Findlay, Rees Kassen, Sabrina L. Spencer, Carlo C. Maley. (2009) SYNTHESIS: Cancer research meets evolutionary biology. Evolutionary Applications 2:1, 62-70
CrossRef276
Sreenath V. Sharma, Jeffrey Settleman. (2009) ErbBs in lung cancer. Experimental Cell Research 315:4, 557-571
CrossRef277
Hideki Endoh, Yasunori Ishibashi, Ei Yamaki, Takeshi Yoshida, Toshiki Yajima, Hitoshi Kimura, Takayuki Kosaka, Ryoichi Onozato, Shigebumi Tanaka, Tetsuya Mitsudomi, Hiroyuki Kuwano. (2009) Immunohistochemical analysis of phosphorylated epidermal growth factor receptor might provide a surrogate marker of EGFR mutation. Lung Cancer 63:2, 241-246
CrossRef278
Z Tang, S Jiang, R Du, E T Petri, A El-Telbany, P S O Chan, T Kijima, S Dietrich, K Matsui, M Kobayashi, S Sasada, N Okamoto, H Suzuki, K Kawahara, T Iwasaki, K Nakagawa, I Kawase, J G Christensen, T Hirashima, B Halmos, R Salgia, T J Boggon, J A Kern, P C Ma. (2009) Disruption of the EGFR E884–R958 ion pair conserved in the human kinome differentially alters signaling and inhibitor sensitivity. Oncogene 28:4, 518-533
CrossRef279
E. Vasile, C. Tibaldi, A. Falcone. (2009) Is erlotinib really active after failure of gefitinib in advanced non-small-cell lung cancer patients?. Annals of Oncology 20:4, 790-791
CrossRef280
Daphne W Bell. (2009) Our changing view of the genomic landscape of cancer. The Journal of Pathologyn/a-n/a
CrossRef281
Yukihiro Sugimoto, Hiroshi Semba, Shinji Fujii, Tomoki Tanaka, Eri Satou, Ryouichi Kurano. (2009) Clinical Analysis of 24 Cases Treated Twice or More with Gefitinib for Recurrent Non-small Cell Lung Cancer. Haigan 49:6, 831-835
CrossRef282
Takao Hanehira, Tadashi Takao, Yoshitaka Zenke, Jun Shikama, Yusuke Hakoda, Tomoharu Inoue. (2009) A Case of Lung Adenocarcinoma with Multiple Brain Metastasis Responded to Gefitinib by Epidermal Growth Factor Receptor Mutation. Haigan 49:3, 282-286
CrossRef283
Matthew Carlson, Beverly Wuertz, Jizhen Lin, Randy Taylor, Frank Ondrey. (2009) Exons 19 and 21 of Epidermal Growth Factor Receptor Are Highly Conserved in Squamous Cell Cancer of the Head and Neck. International Journal of Otolaryngology 2009, 1-4
CrossRef284
Seiji Yano. (2009) Molecular Mechanism of EGFR-TKI Resistance. Haigan 49:6, 939-943
CrossRef285
Rebecca Suk Heist, David Christiani. (2009) EGFR-targeted therapies in lung cancer: predictors of response and toxicity. Pharmacogenomics 10:1, 59-68
CrossRef286
Miyako Satouchi. (2009) Selective Use of Gefitinib and Erlotinib on Non-small Cell Lung Cancer Patients. Haigan 49:6, 950-956
CrossRef287
Toyoaki Hida, Shizu Ogawa, Jang Chul Park, Ji Young Park, Junichi Shimizu, Yoshitsugu Horio, Kimihide Yoshida. (2009) Gefitinib for the treatment of non-small-cell lung cancer. Expert Review of Anticancer Therapy 9:1, 17-35
CrossRef288
Teruyuki Sato, Akira Inoue, Tatsuro Fukuhara, Tomohiro Sakakibara, Hiromitsu Ohta, Masahito Ebina, Yasuo Saijo, Toshihiro Nukiwa. (2009) Retrospective Analysis of Acquired Resistance During the Treatment with Gefitinib in Non-Small Cell Lung Cancer Patients with Epidermal Growth Factor Receptor Mutations. Haigan 49:3, 257-261
CrossRef289
Ludmila Prudkin, Ximing Tang, Ignacio I. Wistuba. (2009) Germ-Line and Somatic Presentations of the EGFR T790M Mutation in Lung Cancer. Journal of Thoracic Oncology 4:1, 139-141
CrossRef290
Nobuyuki Yamamoto, Takehito Shukuya. (2009) Clinical Medicine of Molecular Targeted Drugs -New Molecular Targeted Drugs for Lung Cancer-. Haigan 49:6, 957-961
CrossRef291
Kenichi Suda, Ryoichi Onozato, Yasushi Yatabe, Tetsuya Mitsudomi. (2009) EGFR T790M Mutation. Journal of Thoracic Oncology 4:1, 1-4
CrossRef292
Rachel E Sanborn, Angela M Davies. (2009) Erlotinib: applications in therapy and current status of research. Expert Review of Clinical Pharmacology 2:1, 15-36
CrossRef293
Kaoru Kubota, Yutaka Nishiwaki, Tomohide Tamura, Kazuhiko Nakagawa, Kaoru Matsui, Koshiro Watanabe, Toyoaki Hida, Masaaki Kawahara, Nobuyuki Katakami, Koji Takeda, Akira Yokoyama, Kazumasa Noda, Masahiro Fukuoka, Nagahiro Saijo. (2008) Efficacy and Safety of Erlotinib Monotherapy for Japanese Patients with Advanced Non-small Cell Lung Cancer. Journal of Thoracic Oncology 3:12, 1439-1445
CrossRef294
Lukas C. Heukamp, Sebastian Zimmer, Philip Kahl, Sabine Merkelbach-Bruse, Reinhard Buettner. (2008) Molekulardiagnostik von Mutationen des epidermalen Wachstumsfaktor-Rezeptors und Aktivierung nachgeschalteter Signalwege in nichtkleinzelligen Lungenkarzinomen. Onkopipeline 1:3, 101-108
CrossRef295
April Scott, Ravi Salgia. (2008) Biomarkers in lung cancer: from early detection to novel therapeutics and decision making. Biomarkers in Medicine 2:6, 577-586
CrossRef296
Shi-Xu Jiang, Kazuya Yamashita, Michiko Yamamoto, Chun-Ji Piao, Atsuko Umezawa, Makoto Saegusa, Tsutomu Yoshida, Masato Katagiri, Noriyuki Masuda, Kazushige Hayakawa, Isao Okayasu. (2008) EGFR genetic heterogeneity of nonsmall cell lung cancers contributing to acquired gefitinib resistance. International Journal of Cancer 123:11, 2480-2486
CrossRef297
Patrick C. Ma, Maria S. Tretiakova, Alexander C. MacKinnon, Nithya Ramnath, Candace Johnson, Sascha Dietrich, Tanguy Seiwert, James G. Christensen, Ramasamy Jagadeeswaran, Thomas Krausz, Everett E. Vokes, Aliya N. Husain, Ravi Salgia. (2008) Expression and mutational analysis of MET in human solid cancers. Genes, Chromosomes and Cancer 47:12, 1025-1037
CrossRef298
Juri G. Gelovani. (2008) Molecular imaging of epidermal growth factor receptor expression–activity at the kinase level in tumors with positron emission tomography. Cancer and Metastasis Reviews 27:4, 645-653
CrossRef299
Chun-Chieh Wu, Hui-Yu Hsu, Hui-Ping Liu, John Wen-Cheng Chang, Ya-Ting Chen, Wen-Yu Hsieh, Jia-Juan Hsieh, Meng-Shu Hsieh, Yi-Rong Chen, Shiu-Feng Huang. (2008) Reversed mutation rates of KRAS and EGFR genes in adenocarcinoma of the lung in Taiwan and their implications. Cancer 113:11, 3199-3208
CrossRef300
T Pene-Dumitrescu, L F Peterson, N J Donato, T E Smithgall. (2008) An inhibitor-resistant mutant of Hck protects CML cells against the antiproliferative and apoptotic effects of the broad-spectrum Src family kinase inhibitor A-419259. Oncogene 27:56, 7055-7069
CrossRef301
Miguel A. Molina-Vila, Jordi Bertran-Alamillo, Noemí Reguart, Miquel Taron, Eva Castellà, Mariona Llatjós, Carlota Costa, Clara Mayo, Anna Pradas, Cristina Queralt, Mónica Botia, María Pérez-Cano, Esther Carrasco, Mireia Tomàs, Jose Luis Mate, Teresa Moran, Rafael Rosell. (2008) A Sensitive Method for Detecting EGFR Mutations in Non-small Cell Lung Cancer Samples with Few Tumor Cells. Journal of Thoracic Oncology 3:11, 1224-1235
CrossRef302
Li Ding, Gad Getz, David A. Wheeler, Elaine R. Mardis, Michael D. McLellan, Kristian Cibulskis, Carrie Sougnez, Heidi Greulich, Donna M. Muzny, Margaret B. Morgan, Lucinda Fulton, Robert S. Fulton, Qunyuan Zhang, Michael C. Wendl, Michael S. Lawrence, David E. Larson, Ken Chen, David J. Dooling, Aniko Sabo, Alicia C. Hawes, Hua Shen, Shalini N. Jhangiani, Lora R. Lewis, Otis Hall, Yiming Zhu, Tittu Mathew, Yanru Ren, Jiqiang Yao, Steven E. Scherer, Kerstin Clerc, Ginger A. Metcalf, Brian Ng, Aleksandar Milosavljevic, Manuel L. Gonzalez-Garay, John R. Osborne, Rick Meyer, Xiaoqi Shi, Yuzhu Tang, Daniel C. Koboldt, Ling Lin, Rachel Abbott, Tracie L. Miner, Craig Pohl, Ginger Fewell, Carrie Haipek, Heather Schmidt, Brian H. Dunford-Shore, Aldi Kraja, Seth D. Crosby, Christopher S. Sawyer, Tammi Vickery, Sacha Sander, Jody Robinson, Wendy Winckler, Jennifer Baldwin, Lucian R. Chirieac, Amit Dutt, Tim Fennell, Megan Hanna, Bruce E. Johnson, Robert C. Onofrio, Roman K. Thomas, Giovanni Tonon, Barbara A. Weir, Xiaojun Zhao, Liuda Ziaugra, Michael C. Zody, Thomas Giordano, Mark B. Orringer, Jack A. Roth, Margaret R. Spitz, Ignacio I. Wistuba, Bradley Ozenberger, Peter J. Good, Andrew C. Chang, David G. Beer, Mark A. Watson, Marc Ladanyi, Stephen Broderick, Akihiko Yoshizawa, William D. Travis, William Pao, Michael A. Province, George M. Weinstock, Harold E. Varmus, Stacey B. Gabriel, Eric S. Lander, Richard A. Gibbs, Matthew Meyerson, Richard K. Wilson. (2008) Somatic mutations affect key pathways in lung adenocarcinoma. Nature 455:7216, 1069-1075
CrossRef303
A. Yano, S. Tsutsumi, S. Soga, M.-J. Lee, J. Trepel, H. Osada, L. Neckers. (2008) Inhibition of Hsp90 activates osteoclast c-Src signaling and promotes growth of prostate carcinoma cells in bone. Proceedings of the National Academy of Sciences 105:40, 15541-15546
CrossRef304
F. Cappuzzo, P. A. Janne, M. Skokan, G. Finocchiaro, E. Rossi, C. Ligorio, P. A. Zucali, L. Terracciano, L. Toschi, M. Roncalli, A. Destro, M. Incarbone, M. Alloisio, A. Santoro, M. Varella-Garcia. (2008) MET increased gene copy number and primary resistance to gefitinib therapy in non-small-cell lung cancer patients. Annals of Oncology 20:2, 298-304
CrossRef305
Sabitha Kotra, Kishore Kumar Madala, Kaiser Jamil. (2008) Homology models of the mutated EGFR and their response towards quinazolin analogues. Journal of Molecular Graphics and Modelling 27:3, 244-254
CrossRef306
Ichiro Kawada, Kenzo Soejima, Hideo Watanabe, Ichiro Nakachi, Hiroyuki Yasuda, Katsuhiko Naoki, Masafumi Kawamura, Keisuke Eguchi, Koichi Kobayashi, Akitoshi Ishizaka. (2008) An Alternative Method for Screening EGFR Mutation Using RFLP in Non-small Cell Lung Cancer Patients. Journal of Thoracic Oncology 3:10, 1096-1103
CrossRef307
Sigrid R. Ruuls, Jeroen J. Lammerts van Bueren, Jan G. J. van de Winkel, Paul W. H. I. Parren. (2008) Novel human antibody therapeutics: The age of the Umabs. Biotechnology Journal 3:9-10, 1157-1171
CrossRef308
John H. Sampson, Gary E. Archer, Duane A. Mitchell, Amy B. Heimberger, Darell D. Bigner. (2008) Tumor-specific immunotherapy targeting the EGFRvIII mutation in patients with malignant glioma. Seminars in Immunology 20:5, 267-275
CrossRef309
Mohammad Azam, Markus A Seeliger, Nathanael S Gray, John Kuriyan, George Q Daley. (2008) Activation of tyrosine kinases by mutation of the gatekeeper threonine. Nature Structural & Molecular Biology 15:10, 1109-1118
CrossRef310
O N Ikediobi. (2008) Somatic pharmacogenomics in cancer. The Pharmacogenomics Journal 8:5, 305-314
CrossRef311
Z Tang, R Du, S Jiang, C Wu, D S Barkauskas, J Richey, J Molter, M Lam, C Flask, S Gerson, A Dowlati, L Liu, Z Lee, B Halmos, Y Wang, J A Kern, P C Ma. (2008) Dual MET–EGFR combinatorial inhibition against T790M-EGFR-mediated erlotinib-resistant lung cancer. British Journal of Cancer 99:6, 911-922
CrossRef312
P. J. Campbell, E. D. Pleasance, P. J. Stephens, E. Dicks, R. Rance, I. Goodhead, G. A. Follows, A. R. Green, P. A. Futreal, M. R. Stratton. (2008) Subclonal phylogenetic structures in cancer revealed by ultra-deep sequencing. Proceedings of the National Academy of Sciences 105:35, 13081-13086
CrossRef313
Kadoaki Ohashi, Kammei Rai, Yoshiro Fujiwara, Masahiro Osawa, Seiki Hirano, Katsuyoshi Takata, Eisaku Kondo, Tadashi Yoshino, Minoru Takata, Mitsune Tanimoto, Katsuyuki Kiura. (2008) Induction of lung adenocarcinoma in transgenic mice expressing activated EGFR driven by the SP-C promoter. Cancer Science 99:9, 1747-1753
CrossRef314
David E. Gerber. (2008) EGFR inhibition in the treatment of non-small cell lung cancer. Drug Development Research 69:6, 359-372
CrossRef315
M. Wislez, J. Cadranel. (2008) Place des thérapeutiques biologiques ciblées. Oncologie 10:9, 540-544
CrossRef316
D Li, L Ambrogio, T Shimamura, S Kubo, M Takahashi, L R Chirieac, R F Padera, G I Shapiro, A Baum, F Himmelsbach, W J Rettig, M Meyerson, F Solca, H Greulich, K-K Wong. (2008) BIBW2992, an irreversible EGFR/HER2 inhibitor highly effective in preclinical lung cancer models. Oncogene 27:34, 4702-4711
CrossRef317
Hidefumi Sasaki, Katsuhiko Endo, Minoru Takada, Masaaki Kawahara, Hisaichi Tanaka, Naoto Kitahara, Akihide Matsumura, Keiji Iuchi, Tomoya Kawaguchi, Katsuhiro Okuda, Osamu Kawano, Haruhiro Yukiue, Tomoki Yokoyama, Motoki Yano, Yoshitaka Fujii. (2008) EGFR Polymorphism of the Kinase Domain in Japanese Lung Cancer. Journal of Surgical Research 148:2, 260-263
CrossRef318
Allan Wissner, Tarek S. Mansour. (2008) The Development of HKI‐272 and Related Compounds for the Treatment of Cancer. Archiv der Pharmazie 341:8, 465-477
CrossRef319
Nasser Hanna. (2008) Unlocking the Biological Clues of Lung Cancer. Journal of Thoracic Oncology 3:8, 809-810
CrossRef320
Matthias Peipp, Michael Dechant, Thomas Valerius. (2008) Effector mechanisms of therapeutic antibodies against ErbB receptors. Current Opinion in Immunology 20:4, 436-443
CrossRef321
D. H. Lee, S.-W. Kim, C. Suh, D. H. Yoon, E. J. Yi, J.-S. Lee. (2008) Phase II study of erlotinib as a salvage treatment for non-small-cell lung cancer patients after failure of gefitinib treatment. Annals of Oncology 19:12, 2039-2042
CrossRef322
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Rosenberg, Eric S., Cort, Alice M., Ebeling, Sally H.Peters, Christine C., Sequist, Lecia V., Settleman, Jeffrey E., Ackman, Jeanne B., Iafrate, A. John, . (2008) Case 23-2008. New England Journal of Medicine 359:4, 405-414
Full Text323
Maheswaran, Shyamala, Sequist, Lecia V., Nagrath, Sunitha, Ulkus, Lindsey, Brannigan, Brian, Collura, Chey V., Inserra, Elizabeth, Diederichs, Sven, Iafrate, A. John, Bell, Daphne W., Digumarthy, Subba, Muzikansky, Alona, Irimia, Daniel, Settleman, Jeffrey, Tompkins, Ronald G., Lynch, Thomas J., Toner, Mehmet, Haber, Daniel A., . (2008) Detection of Mutations in EGFR in Circulating Lung-Cancer Cells. New England Journal of Medicine 359:4, 366-377
Full Text324
Schiller, Joan H., . (2008) Noninvasive Monitoring of Tumors. New England Journal of Medicine 359:4, 418-420
Full Text325
Christina I. Zito, David Riches, Julia Kolmakova, Jan Simons, Michael Egholm, David F. Stern. (2008) Direct resequencing of the complete ERBB2 coding sequence reveals an absence of activating mutations in ERBB2 amplified breast cancer. Genes, Chromosomes and Cancer 47:7, 633-638
CrossRef326
Fernanda Milanezi, Silvia Carvalho, Fernando C Schmitt. (2008) EGFR/HER2 in breast cancer: a biological approach for molecular diagnosis and therapy. Expert Review of Molecular Diagnostics 8:4, 417-434
CrossRef327
Raffaele Califano, Fiona H. Blackhall, Giovanna Finocchiaro, Luca Toschi, Nicholas Thatcher, Federico Cappuzzo, Lucio Crinò. (2008) EGFR tyrosine kinase inhibitors in non-small cell lung cancer patients: how do we interpret the clinical and biomarker data?. Targeted Oncology 3:3, 173-186
CrossRef328
Jian-quan Zhu, Wen-zhao Zhong, Guo-chun Zhang, Rong Li, Xu-chao Zhang, Ai-lin Guo, Yi-fang Zhang, She-juan An, Tony S. Mok, Yi-long Wu. (2008) Better survival with EGFR exon 19 than exon 21 mutations in gefitinib-treated non-small cell lung cancer patients is due to differential inhibition of downstream signals. Cancer Letters 265:2, 307-317
CrossRef329
M. A. Villalona-Calero, G. A. Otterson, M. G. Wientjes, F. Weber, T. Bekaii-Saab, D. Young, A. J. Murgo, R. Jensen, T.-K. Yeh, Y. Wei, Y. Zhang, C. Eng, M. Grever, J. L.-S. Au. (2008) Noncytotoxic suramin as a chemosensitizer in patients with advanced non-small-cell lung cancer: a phase II study. Annals of Oncology 19:11, 1903-1909
CrossRef330
Noriko Motoi, Janos Szoke, Gregory J. Riely, Venkatraman E. Seshan, Mark G. Kris, Valerie W. Rusch, William L. Gerald, William D. Travis. (2008) Lung Adenocarcinoma: Modification of the 2004 WHO Mixed Subtype to Include the Major Histologic Subtype Suggests Correlations Between Papillary and Micropapillary Adenocarcinoma Subtypes, EGFR Mutations and Gene Expression Analysis. The American Journal of Surgical Pathology 32:6, 810-827
CrossRef331
Takeshi Shimamura, Geoffrey I. Shapiro. (2008) Heat Shock Protein 90 Inhibition in Lung Cancer. Journal of Thoracic Oncology 3:Supplement 2, S152-S159
CrossRef332
Qiang Wang, Mark I. Greene. (2008) Mechanisms of resistance to ErbB-targeted cancer therapeutics. Journal of Clinical Investigation
CrossRef333
Pasi A. Jänne. (2008) Challenges of detecting EGFR T790M in gefitinib/erlotinib-resistant tumours. Lung Cancer 60, S3-S9
CrossRef334
Gregory J. Riely. (2008) Second-Generation Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Non-small Cell Lung Cancer. Journal of Thoracic Oncology 3:Supplement 2, S146-S149
CrossRef335
Daigo Akahane, Tetsuzo Tauchi, Seiichi Okabe, Kousuke Nunoda, Kazuma Ohyashiki. (2008) Activity of a novel Aurora kinase inhibitor against the T315I mutant form of BCR-ABL: In vitro and in vivo studies. Cancer Science 99:6, 1251-1257
CrossRef336
Chih-Hsin Yang. (2008) EGFR tyrosine kinase inhibitors for the treatment of NSCLC in East Asia: present and future. Lung Cancer 60, S23-S30
CrossRef337
Marta Guix, Anthony C. Faber, Shizhen Emily Wang, Maria Graciela Olivares, Youngchul Song, Sherman Qu, Cammie Rinehart, Brenda Seidel, Douglas Yee, Carlos L. Arteaga, Jeffrey A. Engelman. (2008) Acquired resistance to EGFR tyrosine kinase inhibitors in cancer cells is mediated by loss of IGF-binding proteins. Journal of Clinical Investigation
CrossRef338
Lecia V. Sequist. (2008) First-Generation Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in EGFR Mutation. Journal of Thoracic Oncology 3:Supplement 2, S143-S145
CrossRef339
Gregory J. Riely. (2008) The use of first-generation tyrosine kinase inhibitors in patients with NSCLC and somatic EGFR mutations. Lung Cancer 60, S19-S22
CrossRef340
Kwok-Kin Wong. (2008) Searching for a magic bullet in NSCLC: the role of epidermal growth factor receptor mutations and tyrosine kinase inhibitors. Lung Cancer 60, S10-S18
CrossRef341
J. M. Llovet, A. M. Di Bisceglie, J. Bruix, B. S. Kramer, R. Lencioni, A. X. Zhu, M. Sherman, M. Schwartz, M. Lotze, J. Talwalkar, G. J. Gores, . (2008) Design and Endpoints of Clinical Trials in Hepatocellular Carcinoma. JNCI Journal of the National Cancer Institute 100:10, 698-711
CrossRef342
P. A. Zucali, M. G. Ruiz, E. Giovannetti, A. Destro, M. Varella-Garcia, K. Floor, G. L. Ceresoli, J. A. Rodriguez, I. Garassino, P. Comoglio, M. Roncalli, A. Santoro, G. Giaccone. (2008) Role of cMET expression in non-small-cell lung cancer patients treated with EGFR tyrosine kinase inhibitors. Annals of Oncology 19:9, 1605-1612
CrossRef343
Michael G. Ozawa, Amado J. Zurita, Emmanuel Dias-Neto, Diana N. Nunes, Richard L. Sidman, Juri G. Gelovani, Wadih Arap, Renata Pasqualini. (2008) Beyond Receptor Expression Levels: The Relevance of Target Accessibility in Ligand-Directed Pharmacodelivery Systems. Trends in Cardiovascular Medicine 18:4, 126-133
CrossRef344
Kazuya Taniguchi, Jiro Okami, Ken Kodama, Masahiko Higashiyama, Kikuya Kato. (2008) Intratumor heterogeneity of epidermal growth factor receptor mutations in lung cancer and its correlation to the response to gefitinib. Cancer Science 99:5, 929-935
CrossRef345
Marc Ladanyi, William Pao. (2008) Lung adenocarcinoma: guiding EGFR-targeted therapy and beyond. Modern Pathology 21, S16-S22
CrossRef346
Jin Li, Lilin Wang, Harvey Mamon, Matthew H Kulke, Ross Berbeco, G Mike Makrigiorgos. (2008) Replacing PCR with COLD-PCR enriches variant DNA sequences and redefines the sensitivity of genetic testing. Nature Medicine 14:5, 579-584
CrossRef347
I. Judson, J. Barriuso. (2008) Molecularly targeted therapy and cancer surgery. British Journal of Surgery 95:5, 537-538
CrossRef348
Alvin S. Wong, Richie Soong, Serena Bee-Kee Seah, Siew-Woon Lim, Khoon-Leong Chuah, Min-En Nga, Tan-Min Chin, Ross A. Soo. (2008) Evidence for Disease Control with Erlotinib after Gefitinib Failure in Typical Gefitinib-Sensitive Asian Patients with Non-small Cell Lung Cancer. Journal of Thoracic Oncology 3:4, 400-404
CrossRef349
Ciardiello, Fortunato, Tortora, Giampaolo, . (2008) EGFR Antagonists in Cancer Treatment. New England Journal of Medicine 358:11, 1160-1174
Full Text350
K Tamura, I Okamoto, T Kashii, S Negoro, T Hirashima, S Kudoh, Y Ichinose, N Ebi, K Shibata, T Nishimura, N Katakami, T Sawa, E Shimizu, J Fukuoka, T Satoh, M Fukuoka. (2008) Multicentre prospective phase II trial of gefitinib for advanced non-small cell lung cancer with epidermal growth factor receptor mutations: results of the West Japan Thoracic Oncology Group trial (WJTOG0403). British Journal of Cancer 98:5, 907-914
CrossRef351
Luis H Camacho. (2008) Novel therapies targeting the immune system: CTLA4 blockade with tremelimumab (CP-675,206), a fully human monoclonal antibody. Expert Opinion on Investigational Drugs 17:3, 371-385
CrossRef352
Takayuki Fukui, Tetsuya Mitsudomi. (2008) Mutations in the epidermal growth factor receptor gene and effects of EGFR-tyrosine kinase inhibitors on lung cancers. General Thoracic and Cardiovascular Surgery 56:3, 97-103
CrossRef353
Thomas E. Stinchcombe, David E. Morris, Carrie B. Lee, Dominic T. Moore, D Neil Hayes, Jan S. Halle, M Patricia Rivera, Julian G. Rosenman, Mark A. Socinski. (2008) Induction Chemotherapy with Carboplatin, Irinotecan, and Paclitaxel Followed by High Dose Three-Dimension Conformal Thoracic Radiotherapy (74 Gy) with Concurrent Carboplatin, Paclitaxel, and Gefitinib in Unresectable Stage IIIA and Stage IIIB Non-small Cell Lung Cancer. Journal of Thoracic Oncology 3:3, 250-257
CrossRef354
Hitoshi Miyazawa, Tomoaki Tanaka, Yoshiaki Nagai, Masaru Matsuoka, Akihisa Sutani, Kiyoshi Udagawa, Jialing Zhang, Takashi Hirama, Yoshitake Murayama, Nobuyuki Koyama, Kenji Ikebuchi, Makoto Nagata, Minoru Kanazawa, Toshihiro Nukiwa, Seiichi Takenoshita, Kunihiko Kobayashi, Koichi Hagiwara. (2008) Peptide nucleic acid–locked nucleic acid polymerase chain reaction clamp-based detection test for gefitinib-refractory T790M epidermal growth factor receptor mutation. Cancer Science 99:3, 595-600
CrossRef355
Paul Wheatley-Price, Frances A Shepherd. (2008) Epidermal growth factor receptor inhibitors in the treatment of lung cancer: reality and hopes. Current Opinion in Oncology 20:2, 162-175
CrossRef356
Y Akashi, I Okamoto, T Iwasa, T Yoshida, M Suzuki, E Hatashita, Y Yamada, T Satoh, M Fukuoka, K Ono, K Nakagawa. (2008) Enhancement of the antitumor activity of ionising radiation by nimotuzumab, a humanised monoclonal antibody to the epidermal growth factor receptor, in non-small cell lung cancer cell lines of differing epidermal growth factor receptor status. British Journal of Cancer 98:4, 749-755
CrossRef357
C.-H. Yun, K. E. Mengwasser, A. V. Toms, M. S. Woo, H. Greulich, K.-K. Wong, M. Meyerson, M. J. Eck. (2008) The T790M mutation in EGFR kinase causes drug resistance by increasing the affinity for ATP. Proceedings of the National Academy of Sciences 105:6, 2070-2075
CrossRef358
Y-N Fu, C-L Yeh, H H-Y Cheng, C-H Yang, S-F Tsai, S-F Huang, Y-R Chen. (2008) EGFR mutants found in non-small cell lung cancer show different levels of sensitivity to suppression of Src: implications in targeting therapy. Oncogene 27:7, 957-965
CrossRef359
Shigeki Higashiyama, Hidehiko Iwabuki, Chie Morimoto, Miki Hieda, Hirofumi Inoue, Natsuki Matsushita. (2008) Membrane-anchored growth factors, the epidermal growth factor family: Beyond receptor ligands. Cancer Science 99:2, 214-220
CrossRef360
Martin L. Sos, Thomas Zander, Roman K. Thomas, Andrea Staratschek-Jox, Julia Claasen, Jürgen Wolf. (2008) Expression of Signaling Mediators Downstream of EGF-Receptor Predict Sensitivity to Small Molecule Inhibitors Directed Against the EGF-Receptor Pathway. Journal of Thoracic Oncology 3:2, 170-173
CrossRef361
Lecia V. Sequist, Thomas J. Lynch. (2008) EGFR Tyrosine Kinase Inhibitors in Lung Cancer: An Evolving Story. Annual Review of Medicine 59:1, 429-442
CrossRef362
Jeffrey A Engelman, Jeffrey Settleman. (2008) Acquired resistance to tyrosine kinase inhibitors during cancer therapy. Current Opinion in Genetics & Development 18:1, 73-79
CrossRef363
Katsuyuki Kiura, Nagio Takigawa, Isao Oze, Masayuki Yasugi, Nobuaki Ochi, Daijiro Harada, Mitsune Tanimoto. (2008) Okayama Igakkai Zasshi (Journal of Okayama Medical Association) 119:3, 285-292
CrossRef364
Mitsuo Sato, David S. Shames, Luc Girard, Adi F. Gazdar, John D. Minna. 2008. Molecular Basis of Lung Cancer. , 397-407.
CrossRef365
Afshin Dowlati, Amy Kluge, David Nethery, Balazs Halmos, Jeffrey A. Kern. (2008) SCH66336, inhibitor of protein farnesylation, blocks signal transducer and activators of transcription 3 signaling in lung cancer and interacts with a small molecule inhibitor of epidermal growth factor receptor/human epidermal growth factor receptor 2. Anti-Cancer Drugs 19:1, 9-16
CrossRef366
Zhen Wang, Yi Long Wu, Guo Chun Zhang, Qing Zhou, Chong Rui Xu, Ai Lin Guo. (2008) EGFR/KRAS Mutations and Gefitinib Therapy in Chinese NSCLC Patients. Onkologie 31:4, 174-178
CrossRef367
F. Shoji, T. Yano, I. Yoshino, D. Mori, F. Yamasaki, H. Kohno, Y. Maehara. (2008) The characteristics and failure pattern of gefitinib responders with postoperative recurrence of pulmonary adenocarcinoma. European Journal of Surgical Oncology (EJSO) 34:1, 89-93
CrossRef368
Fotios Loupakis, Enrico Vasile, Daniele Santini, Gianluca Masi, Alfredo Falcone, Francesco Graziano. (2008) EGF-receptor targeting with monoclonal antibodies in colorectal carcinomas: rationale for a pharmacogenomic approach. Pharmacogenomics 9:1, 55-69
CrossRef369
J. Bean, C. Brennan, J.-Y. Shih, G. Riely, A. Viale, L. Wang, D. Chitale, N. Motoi, J. Szoke, S. Broderick, M. Balak, W.-C. Chang, C.-J. Yu, A. Gazdar, H. Pass, V. Rusch, W. Gerald, S.-F. Huang, P.-C. Yang, V. Miller, M. Ladanyi, C.-H. Yang, W. Pao. (2007) MET amplification occurs with or without T790M mutations in EGFR mutant lung tumors with acquired resistance to gefitinib or erlotinib. Proceedings of the National Academy of Sciences 104:52, 20932-20937
CrossRef370
Tetsuya Mitsudomi, Yasushi Yatabe. (2007) Mutations of the epidermal growth factor receptor gene and related genes as determinants of epidermal growth factor receptor tyrosine kinase inhibitors sensitivity in lung cancer. Cancer Science 98:12, 1817-1824
CrossRef371
John Wen-Cheng Chang, Chun-Liang Chou, Shiu-Feng Huang, Hung-Ming Wang, Jia-Juan Hsieh, Todd Hsu, Yun-Chung Cheung. (2007) Erlotinib response of EGFR-mutant gefitinib-resistant non-small-cell lung cancer. Lung Cancer 58:3, 414-417
CrossRef372
Hidefumi Sasaki, Katsuhiko Endo, Minoru Takada, Masaaki Kawahara, Naoto Kitahara, Hisaichi Tanaka, Meinoshin Okumura, Akihide Matsumura, Keiji Iuchi, Tomoya Kawaguchi, Osamu Kawano, Haruhiro Yukiue, Tomoki Yokoyama, Motoki Yano, Yoshitaka Fujii. (2007) EGFR exon 20 insertion mutation in Japanese lung cancer. Lung Cancer 58:3, 324-328
CrossRef373
Laura Boldrini, Silvia Gisfredi, Silvia Ursino, Tiziano Camacci, Editta Baldini, Franca Melfi, Gabriella Fontanini. (2007) Mutational Analysis in Cytological Specimens of Advanced Lung Adenocarcinoma: A Sensitive Method for Molecular Diagnosis. Journal of Thoracic Oncology 2:12, 1086-1090
CrossRef374
Y. Yarden. (2007) Definition of resistance mechanisms. European Journal of Cancer Supplements 5:9, 18-19
CrossRef375
Natalia V. Sergina, Mark M. Moasser. (2007) The HER family and cancer: emerging molecular mechanisms and therapeutic targets. Trends in Molecular Medicine 13:12, 527-534
CrossRef376
Maria Sibilia, Renate Kroismayr, Beate M. Lichtenberger, Anuradha Natarajan, Manfred Hecking, Martin Holcmann. (2007) The epidermal growth factor receptor: from development to tumorigenesis. Differentiation 75:9, 770-787
CrossRef377
Tae-You Kim, Sae-Won Han, Yung-Jue Bang. (2007) Chasing targets for EGFR tyrosine kinase inhibitors in non-small-cell lung cancer: Asian perspectives. Expert Review of Molecular Diagnostics 7:6, 821-836
CrossRef378
J. Usuda, T. Ohira, Y. Suga, T. Oikawa, S. Ichinose, T. Inoue, K. Ohtani, S. Maehara, K. Imai, M. Kubota, Y. Tsunoda, H. Tsutsui, K. Furukawa, T. Okunaka, Y. Sugimoto, H. Kato. (2007) Breast cancer resistance protein (BCRP) affected acquired resistance to gefitinib in a “never-smoked” female patient with advanced non-small cell lung cancer. Lung Cancer 58:2, 296-299
CrossRef379
Josep M. Llovet. (2007) Clinical and molecular classification of hepatocellular carcinoma. Liver Transplantation 13:S2, S13-S16
CrossRef380
K Shtiegman, B S Kochupurakkal, Y Zwang, G Pines, A Starr, A Vexler, A Citri, M Katz, S Lavi, Y Ben-Basat, S Benjamin, S Corso, J Gan, R B Yosef, S Giordano, Y Yarden. (2007) Defective ubiquitinylation of EGFR mutants of lung cancer confers prolonged signaling. Oncogene 26:49, 6968-6978
CrossRef381
M. Pérol, D. Arpin. (2007) Les inhibiteurs de tyrosine kinase de l’EGFR dans le traitement du CBNPC. Revue des Maladies Respiratoires 24:8, 188-197
CrossRef382
Sophie Sun, Joan H. Schiller, Monica Spinola, John D. Minna. (2007) New molecularly targeted therapies for lung cancer. Journal of Clinical Investigation 117:10, 2740-2750
CrossRef383
Toshiyuki Kozuki, Akiko Hisamoto, Masahiro Tabata, Nagio Takigawa, Katsuyuki Kiura, Yoshihiko Segawa, Masao Nakata, Koichi Mandai, Kenji Eguchi, Hiroshi Ueoka, Mitsune Tanimoto. (2007) Mutation of the epidermal growth factor receptor gene in the development of adenocarcinoma of the lung. Lung Cancer 58:1, 30-35
CrossRef384
Yungan Tao, Valentina Pinzi, Jean Bourhis, Eric Deutsch. (2007) Mechanisms of Disease: signaling of the insulin-like growth factor 1 receptor pathway—therapeutic perspectives in cancer. Nature Clinical Practice Oncology 4:10, 591-602
CrossRef385
E. Bergot, N. Richard, G. Zalcman. (2007) Mécanismes d’action des thérapeutiques ciblées… et mécanismes de résistance. Revue des Maladies Respiratoires 24:8, 180-187
CrossRef386
M. Wislez, M. Antoine, A. Lavolé, V. Gounant, B. Milleron, J. Cadranel. (2007) Prédiction de la réponse à la chimiothérapie dans les CBNPC : applications pratiques. Revue des Maladies Respiratoires 24:8, 206-210
CrossRef387
Cesare Gridelli, Antonio Rossi, Paolo Maione, Giuseppe Colantuoni, Filomena Del Gaizo, Carmine Ferrara, Dario Nicolella, Ciro Guerriero. (2007) Erlotinib in non-small-cell lung cancer. Expert Opinion on Pharmacotherapy 8:15, 2579-2592
CrossRef388
Giovanna Finocchiaro, Luca Toschi, Isabella Garassino, Fabio De Vincenzo, Elisabetta Campagnoli, Paolo Zucali, Raffaele Cavina, Giovanni L Ceresoli, Armando Santoro, Federico Cappuzzo. (2007) EGFR tyrosine kinase inhibitors: a therapy for a few, for the majority or for all non-small cell lung cancer patients?. Expert Opinion on Medical Diagnostics 1:2, 183-191
CrossRef389
Kazuya Takamochi, Kazuya Suzuki, Haruhiko Sugimura, Kazuhito Funai, Hiroki Mori, Abul Hasan Muhammad Bashar, Teruhisa Kazui. (2007) Surgical resection after gefitinib treatment in patients with lung adenocarcinoma harboring epidermal growth factor receptor gene mutation. Lung Cancer 58:1, 149-155
CrossRef390
Alfonso Quintás-Cardama, Hagop Kantarjian, Jorge Cortes. (2007) Flying under the radar: the new wave of BCR–ABL inhibitors. Nature Reviews Drug Discovery 6:10, 834-848
CrossRef391
Daniel B. Costa, Susumu Kobayashi, Daniel G. Tenen, Mark S. Huberman. (2007) Pooled analysis of the prospective trials of gefitinib monotherapy for EGFR-mutant non-small cell lung cancers. Lung Cancer 58:1, 95-103
CrossRef392
T. Raz, V. Nardi, M. Azam, J. Cortes, G. Q. Daley. (2007) Farnesyl transferase inhibitor resistance probed by target mutagenesis. Blood 110:6, 2102-2109
CrossRef393
Marco Volante, Silvia Saviozzi, Ida Rapa, Paolo Ceppi, Susanna Cappia, Raffaele Calogero, Silvia Novello, Piero Borasio, Mauro Papotti, Giorgio V. Scagliotti. (2007) Epidermal growth factor ligand/receptor loop and downstream signaling activation pattern in completely resected nonsmall cell lung cancer. Cancer 110:6, 1321-1328
CrossRef394
Neil P. Shah, Brian J. Skaggs, Susan Branford, Timothy P. Hughes, John M. Nicoll, Ronald L. Paquette, Charles L. Sawyers. (2007) Sequential ABL kinase inhibitor therapy selects for compound drug-resistant BCR-ABL mutations with altered oncogenic potency. Journal of Clinical Investigation 117:9, 2562-2569
CrossRef395
Ulrich Steidl, Christian Steidl, Alexander Ebralidze, Björn Chapuy, Hye-Jung Han, Britta Will, Frank Rosenbauer, Annegret Becker, Katharina Wagner, Steffen Koschmieder, Susumu Kobayashi, Daniel B. Costa, Thomas Schulz, Karen B. O’Brien, Roel G.W. Verhaak, Ruud Delwel, Detlef Haase, Lorenz Trümper, Jürgen Krauter, Terumi Kohwi-Shigematsu, Frank Griesinger, Daniel G. Tenen. (2007) A distal single nucleotide polymorphism alters long-range regulation of the PU.1 gene in acute myeloid leukemia. Journal of Clinical Investigation 117:9, 2611-2620
CrossRef396
Venkateshappa Chandregowda, Gudapati Venkateswara Rao, Goukanapalli Chandrasekara Reddy. (2007) Improved Synthesis of Gefitinib and Erlotinib Hydrochloride‐ Anticancer Agents. Synthetic Communications 37:19, 3409-3415
CrossRef397
Victoria A Joshi, Raju Kucherlapati. (2007) Pharmacogenomics of lung cancer: with a view to address EGFR-targeted therapies. Pharmacogenomics 8:9, 1211-1220
CrossRef398
D Irmer, J O Funk, A Blaukat. (2007) EGFR kinase domain mutations – functional impact and relevance for lung cancer therapy. Oncogene 26:39, 5693-5701
CrossRef399
A C Hsieh, M M Moasser. (2007) Targeting HER proteins in cancer therapy and the role of the non-target HER3. British Journal of Cancer 97:4, 453-457
CrossRef400
Georgios Giamas, Justin Stebbing, Constantinos E Vorgias, Uwe Knippschild. (2007) Protein kinases as targets for cancer treatment. Pharmacogenomics 8:8, 1005-1016
CrossRef401
Dongqing Gu, William A. Scaringe, Kai Li, Juan-Sebastian Saldivar, Kathleen A. Hill, Zhenbin Chen, Kelly D. Gonzalez, Steve S. Sommer. (2007) Database of somatic mutations in EGFR with analyses revealing indel hotspots but no smoking-associated signature. Human Mutation 28:8, 760-770
CrossRef402
Hongtao Zhang, Alan Berezov, Qiang Wang, Geng Zhang, Jeffrey Drebin, Ramachandran Murali, Mark I. Greene. (2007) ErbB receptors: from oncogenes to targeted cancer therapies. Journal of Clinical Investigation 117:8, 2051-2058
CrossRef403
Daniel B. Costa. (2007) To re-treat or not with gefitinib/erlotinib: This is the question for tyrosine kinase inhibitor-responsive lung cancers that progress. Lung Cancer 57:2, 251-252
CrossRef404
Y Minami, T Shimamura, K Shah, T LaFramboise, K A Glatt, E Liniker, C L Borgman, H J Haringsma, W Feng, B A Weir, A M Lowell, J C Lee, J Wolf, G I Shapiro, K-K Wong, M Meyerson, R K Thomas. (2007) The major lung cancer-derived mutants of ERBB2 are oncogenic and are associated with sensitivity to the irreversible EGFR/ERBB2 inhibitor HKI-272. Oncogene 26:34, 5023-5027
CrossRef405
Kiwamu Akagi, Hiroshi Sakai, Junko Sudo, Yasuo Hommura, Futoshi Kurimoto, Hiroshi Komagata, Hirohiko Akiyama, Shuichi Yoneda. (2007) Simple method to detect important epidermal growth factor receptor gene mutations with bronchoscopic specimens of lung cancer patients for gefitinib treatment. Targeted Oncology 2:3, 145-151
CrossRef406
Maria Gabriela Raso, Ignacio I. Wistuba. (2007) Molecular Pathogenesis of Early-Stage Non-small Cell Lung Cancer and a Proposal for Tissue Banking to Facilitate Identification of New Biomarkers. Journal of Thoracic Oncology 2:Supplement 3, S128-S135
CrossRef407
Jeffrey Settleman, Jonathan M. Kurie. (2007) Drugging the Bad “AKT-TOR” to Overcome TKI-Resistant Lung Cancer. Cancer Cell 12:1, 6-8
CrossRef408
Danan Li, Takeshi Shimamura, Hongbin Ji, Liang Chen, Henry J. Haringsma, Kate McNamara, Mei-Chih Liang, Samanthi A. Perera, Sara Zaghlul, Christa L. Borgman, Shigeto Kubo, Masaya Takahashi, Yanping Sun, Lucian R. Chirieac, Robert F. Padera, Neal I. Lindeman, Pasi A. Jänne, Roman K. Thomas, Matthew L. Meyerson, Michael J. Eck, Jeffrey A. Engelman, Geoffrey I. Shapiro, Kwok-Kin Wong. (2007) Bronchial and Peripheral Murine Lung Carcinomas Induced by T790M-L858R Mutant EGFR Respond to HKI-272 and Rapamycin Combination Therapy. Cancer Cell 12:1, 81-93
CrossRef409
Katsuyuki Hotta, Katsuyuki Kiura, Shinichi Toyooka, Nagio Takigawa, Junichi Soh, Yoshiro Fujiwara, Masahiro Tabata, Hiroshi Date, Mitsune Tanimoto. (2007) Clinical Significance of Epidermal Growth Factor Receptor Gene Mutations on Treatment Outcome after First-line Cytotoxic Chemotherapy in Japanese Patients with Non-small Cell Lung Cancer. Journal of Thoracic Oncology 2:7, 632-637
CrossRef410
Junichi Soh, Shinichi Toyooka, Shuji Ichihara, Hiroshi Suehisa, Naruyuki Kobayashi, Sachio Ito, Masaomi Yamane, Motoi Aoe, Yoshifumi Sano, Katsuyuki Kiura, Hiroshi Date. (2007) EGFR mutation status in pleural fluid predicts tumor responsiveness and resistance to gefitinib. Lung Cancer 56:3, 445-448
CrossRef411
Michael Baumann, Mechthild Krause, Ekkehard Dikomey, Klaus Dittmann, Wolfgang Dörr, Ulla Kasten-Pisula, H. Peter Rodemann. (2007) EGFR-targeted anti-cancer drugs in radiotherapy: Preclinical evaluation of mechanisms. Radiotherapy and Oncology 83:3, 238-248
CrossRef412
Rafael Rosell, Miquel Taron, Jose Javier Sanchez, Luis Paz-Ares. (2007) Setting the benchmark for tailoring treatment with EGFR tyrosine kinase inhibitors. Future Oncology 3:3, 277-283
CrossRef413
Carlos L Arteaga. (2007) HER3 and mutant EGFR meet MET. Nature Medicine 13:6, 675-677
CrossRef414
A. Ray, S. W. Cowan-Jacob, P. W. Manley, J. Mestan, J. D. Griffin. (2007) Identification of BCR-ABL point mutations conferring resistance to the Abl kinase inhibitor AMN107 (nilotinib) by a random mutagenesis study. Blood 109:11, 5011-5015
CrossRef415
Alison ARMOUR. (2007) Gefitinib in advanced non-small cell lung cancer: Clinical experience in patients of Asian origin. Asia-Pacific Journal of Clinical Oncology 3:2, 66-78
CrossRef416
Yasushi Yatabe, Tetsuya Mitsudomi. (2007) Epidermal growth factor receptor mutations in lung cancers. Pathology International 57:5, 233-244
CrossRef417
Rafal Dziadziuszko, Barbara Szostakiewicz, Fred R. Hirsch. 2007. Epidermal Growth Factor Receptor Targeted Therapy—Markers of Sensitivity and Response. , 97-122.
CrossRef418
Federico Cappuzzo. (2007) Predictive Factors for Response and for Resistance to Tyrosine Kinase Inhibitor Therapy in Lung Cancer. Journal of Thoracic Oncology 2:Supplement 1, S12-S14
CrossRef419
Mitsuo Sato, David S. Shames, Adi F. Gazdar, John D. Minna. (2007) A Translational View of the Molecular Pathogenesis of Lung Cancer. Journal of Thoracic Oncology 2:4, 327-343
CrossRef420
Andrew S Chi, Patrick Y Wen. (2007) Inhibiting kinases in malignant gliomas. Expert Opinion on Therapeutic Targets 11:4, 473-496
CrossRef421
Erez M Bublil, Yosef Yarden. (2007) The EGF receptor family: spearheading a merger of signaling and therapeutics. Current Opinion in Cell Biology 19:2, 124-134
CrossRef422
Stevan R Hubbard, W Todd Miller. (2007) Receptor tyrosine kinases: mechanisms of activation and signaling. Current Opinion in Cell Biology 19:2, 117-123
CrossRef423
Jimmy A Blair, Daniel Rauh, Charles Kung, Cai-Hong Yun, Qi-Wen Fan, Haridas Rode, Chao Zhang, Michael J Eck, William A Weiss, Kevan M Shokat. (2007) Structure-guided development of affinity probes for tyrosine kinases using chemical genetics. Nature Chemical Biology 3:4, 229-238
CrossRef424
Akihiro Yoshimoto, Kanako Inuzuka, Toshiyuki Kita, Atsuhiro Kawashima, Kazuo Kasahara. (2007) Remarkable Effect of Gefitinib Retreatment in a Patient with Nonsmall Cell Lung Cancer Who Had a Complete Response to Initial Gefitinib. The American Journal of the Medical Sciences 333:4, 221-225
CrossRef425
H Uramoto, T Mitsudomi. (2007) Which biomarker predicts benefit from EGFR-TKI treatment for patients with lung cancer?. British Journal of Cancer 96:6, 857-863
CrossRef426
Shuji Ichihara, Shinichi Toyooka, Yoshiro Fujiwara, Katsuyuki Hotta, Hisayuki Shigematsu, Masaki Tokumo, Junichi Soh, Hiroaki Asano, Kouichi Ichimura, Keisuke Aoe, Motoi Aoe, Katsuyuki Kiura, Kenji Shimizu, Hiroshi Date, Nobuyoshi Shimizu. (2007) The impact of epidermal growth factor receptor gene status on gefitinib-treated Japanese patients with non-small-cell lung cancer. International Journal of Cancer 120:6, 1239-1247
CrossRef427
Cai-Hong Yun, Titus J. Boggon, Yiqun Li, Michele S. Woo, Heidi Greulich, Matthew Meyerson, Michael J. Eck. (2007) Structures of Lung Cancer-Derived EGFR Mutants and Inhibitor Complexes: Mechanism of Activation and Insights into Differential Inhibitor Sensitivity. Cancer Cell 11:3, 217-227
CrossRef428
Sreenath V. Sharma, Daphne W. Bell, Jeffrey Settleman, Daniel A. Haber. (2007) Epidermal growth factor receptor mutations in lung cancer. Nature Reviews Cancer 7:3, 169-181
CrossRef429
Dan Niculescu-Duvaz, Steven Whittaker, Caroline Springer, Richard Marais. (2007) The EGF Receptor Hokey-Cokey. Cancer Cell 11:3, 209-211
CrossRef430
Akiko Uchida, Seiki Hirano, Hiroyuki Kitao, Atsuko Ogino, Kanmei Rai, Shinichi Toyooka, Nagio Takigawa, Masahiro Tabata, Minoru Takata, Katsuyuki Kiura, Mitsune Tanimoto. (2007) Activation of downstream epidermal growth factor receptor (EGFR) signaling provides gefitinib-resistance in cells carrying EGFR mutation. Cancer Science 98:3, 357-363
CrossRef431
Tina Cascone, Erika Martinelli, Maria Pia Morelli, Floriana Morgillo, Teresa Troiani, Fortunato Ciardiello. (2007) Epidermal growth factor receptor inhibitors in non-small-cell lung cancer. Expert Opinion on Drug Discovery 2:3, 335-348
CrossRef432
K. Bencardino, M. Manzoni, S. Delfanti, A. Riccardi, M. Danova, G. R. Corazza. (2007) Epidermal growth factor receptor tyrosine kinase inhibitors for the treatment of non-small-cell lung cancer: results and open issues. Internal and Emergency Medicine 2:1, 3-12
CrossRef433
Hiroaki Kitano. (2007) A robustness-based approach to systems-oriented drug design. Nature Reviews Drug Discovery 6:3, 202-210
CrossRef434
Niklas Pakkasjärvi, Laura Kerosuo, Heidi Nousiainen, Massimiliano Gentile, Juha Saharinen, Satu Suhonen, Hannu Sariola, Leena Peltonen, Marjo Kestilä, Kirmo Wartiovaara. (2007) Neural precursor cells from a fatal human motoneuron disease differentiate despite aberrant gene expression. Developmental Neurobiology 67:3, 270-284
CrossRef435
C W M Reuter, M A Morgan, A Eckardt. (2007) Targeting EGF-receptor-signalling in squamous cell carcinomas of the head and neck. British Journal of Cancer 96:3, 408-416
CrossRef436
Danan Li, Hongbin Ji, Sara Zaghlul, Kate McNamara, Mei-Chih Liang, Takeshi Shimamura, Shigeto Kubo, Masaya Takahashi, Lucian R. Chirieac, Robert F. Padera, Andrew M. Scott, Achim A. Jungbluth, Webster K. Cavenee, Lloyd J. Old, George D. Demetri, Kwok-Kin Wong. (2007) Therapeutic anti-EGFR antibody 806 generates responses in murine de novo EGFR mutant–dependent lung carcinomas. Journal of Clinical Investigation 117:2, 346-352
CrossRef437
Oyewale Abidoye, Mark K Ferguson, Ravi Salgia. (2007) Lung carcinoma in African Americans. Nature Clinical Practice Oncology 4:2, 118-129
CrossRef438
Im Il Na, Hye Jin Kang, Soo Youn Cho, Jae Soo Koh, Jin Kyung Lee, Byeong Cheol Lee, Guk Haeng Lee, Yong Sik Lee, Hyung Jun Yoo, Baek-Yeol Ryoo, Sung Hyun Yang, Yoon Sang Shim. (2007) EGFR mutations and human papillomavirus in squamous cell carcinoma of tongue and tonsil. European Journal of Cancer 43:3, 520-526
CrossRef439
Tomoaki Tanaka, Yoshiaki Nagai, Hitoshi Miyazawa, Nobuyuki Koyama, Suguru Matsuoka, Akihisa Sutani, Kiyoshi Udagawa, Yoshitake Murayama, Makoto Nagata, Yoshihiko Shimizu, Kenji Ikebuchi, Minoru Kanazawa, Kunihiko Kobayashi, Koichi Hagiwara. (2007) Reliability of the peptide nucleic acid-locked nucleic acid polymerase chain reaction clamp-based test for epidermal growth factor receptor mutations integrated into the clinical practice for non-small cell lung cancers. Cancer Science 98:2, 246-252
CrossRef440
Suresh Ramalingam, Chandra P Belani. (2007) Recent advances in targeted therapy for non-small cell lung cancer. Expert Opinion on Therapeutic Targets 11:2, 245-257
CrossRef441
Jian-Hua Mao, Di Wu, Jesus Perez-Losada, Tao Jiang, Qian Li, Richard M. Neve, Joe W. Gray, Wei-Wen Cai, Allan Balmain. (2007) Crosstalk between Aurora-A and p53: Frequent Deletion or Downregulation of Aurora-A in Tumors from p53 Null Mice. Cancer Cell 11:2, 161-173
CrossRef442
Roberto Bianco, Teresa Gelardi, Vincenzo Damiano, Fortunato Ciardiello, Giampaolo Tortora. (2007) Mechanisms of resistance to EGFR inhibitors. Targeted Oncology 2:1, 31-37
CrossRef443
Yukiko Kusama, Tomonobu Koizumi, Michiko Itou, Shintaro Kanda, Hiroshi Yamamoto, Keishi Kubo, Hiroshi Nomura, Seiichiro Eda, Muneharu Hayasaka, Eiichi Gomi. (2007) Re-treatment with Gefitinib for Non-small Cell Lung Cancer. Haigan 47:6, 689-694
CrossRef444
Markus Warmuth, Sungjoon Kim, Xiang-ju Gu, Gang Xia, Francisco Adrián. (2007) Ba/F3 cells and their use in kinase drug discovery. Current Opinion in Oncology 19:1, 55-60
CrossRef445
Jiro Okami, Kazuya Taniguchi, Masahiko Higashiyama, Jun Maeda, Kazuyuki Oda, Naoki Orita, Kyoko Koizumi, Ken Kodama, Kikuya Kato. (2007) Prognostic Factors for Gefitinib-Treated Postoperative Recurrence in Non-Small Cell Lung Cancer. Oncology 72:3-4, 234-242
CrossRef446
Sanja Dacic. (2007) Molecular profiling of lung carcinoma: identifying clinically useful tumor markers for diagnosis and prognosis. Expert Review of Molecular Diagnostics 7:1, 77-86
CrossRef447
Hidetaka Uramoto, Kenji Sugio, Tsunehiro Oyama, Masakazu Sugaya, Takeshi Hanagiri, Kosei Yasumoto. (2006) Resistance to gefitinib. International Journal of Clinical Oncology 11:6, 487-491
CrossRef448
Naoko Sueoka, Akemi Sato, Hidetaka Eguchi, Kazutoshi Komiya, Toru Sakuragi, Masahiro Mitsuoka, Toshimi Satoh, Shinichiro Hayashi, Kei Nakachi, Eisaburo Sueoka. (2006) Mutation profile of EGFR gene detected by denaturing high-performance liquid chromatography in Japanese lung cancer patients. Journal of Cancer Research and Clinical Oncology 133:2, 93-102
CrossRef449
H Yokoyama, Y Ikehara, Y Kodera, S Ikehara, Y Yatabe, Y Mochizuki, M Koike, M Fujiwara, A Nakao, M Tatematsu, H Nakanishi. (2006) Molecular basis for sensitivity and acquired resistance to gefitinib in HER2-overexpressing human gastric cancer cell lines derived from liver metastasis. British Journal of Cancer 95:11, 1504-1513
CrossRef450
Nicholas W Choong, Ezra EW Cohen. (2006) Forthcoming receptor tyrosine kinase inhibitors. Expert Opinion on Therapeutic Targets 10:6, 793-797
CrossRef451
Michalis V. Karamouzis, Athanasios G. Papavassiliou. (2006) The IGF-1 network in lung carcinoma therapeutics. Trends in Molecular Medicine 12:12, 595-602
CrossRef452
Lauren M.F. Merlo, John W. Pepper, Brian J. Reid, Carlo C. Maley. (2006) Cancer as an evolutionary and ecological process. Nature Reviews Cancer 6:12, 924-935
CrossRef453
Antonio Jimeno, Manuel Hidalgo. (2006) Pharmacogenomics of epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1766:2, 217-229
CrossRef454
Francesco Caponigro, Amalia Milano, Alessandro Ottaiano, Rosario Vincenzo Iaffaioli. (2006) Epidermal growth factor receptor as a major anticancer drug target. Expert Opinion on Therapeutic Targets 10:6, 877-888
CrossRef455
Federico Cappuzzo. (2006) Should every lung cancer patient be tested for EGFR mutation?. Expert Opinion on Therapeutic Targets 10:6, 789-791
CrossRef456
Bruce E. Johnson, David Jackman, Pasi A. Jänne. (2006) Impact of EGFR mutations on treatment of non-small cell lung cancer. Cancer Chemotherapy and Pharmacology 58:S1, 5-9
CrossRef457
Ulrich Steidl, Frank Rosenbauer, Roel G W Verhaak, Xuesong Gu, Alexander Ebralidze, Hasan H Otu, Steffen Klippel, Christian Steidl, Ingmar Bruns, Daniel B Costa, Katharina Wagner, Manuel Aivado, Guido Kobbe, Peter J M Valk, Emmanuelle Passegué, Towia A Libermann, Ruud Delwel, Daniel G Tenen. (2006) Essential role of Jun family transcription factors in PU.1 knockdown–induced leukemic stem cells. Nature Genetics 38:11, 1269-1277
CrossRef458
Mukesh K. Nyati, Meredith A. Morgan, Felix Y. Feng, Theodore S. Lawrence. (2006) Integration of EGFR inhibitors with radiochemotherapy. Nature Reviews Cancer 6:11, 876-885
CrossRef459
M.A. Alaoui-Jamali. (2006) Protein tyrosine kinase signaling diversity and susceptibility to targeted kinase inhibitors. Biomedicine & Pharmacotherapy 60:9, 629-632
CrossRef460
Bing Liu, Brandon Bernard, Jian Hui Wu. (2006) Impact of EGFR point mutations on the sensitivity to gefitinib: Insights from comparative structural analyses and molecular dynamics simulations. Proteins: Structure, Function, and Bioinformatics 65:2, 331-346
CrossRef461
Tefurumi KATO, Kazuto NISHIO. (2006) Clinical aspects of epidermal growth factor receptor inhibitors: Benefit and risk. Respirology 11:6, 693-698
CrossRef462
Shinichi Toyooka, Junichi Soh, Hisayuki Shigematsu, Motoi Aoe, Hiroshi Date. (2006) The impact and role of EGFR gene mutation on non-small cell lung cancer. Cancer Chemotherapy and Pharmacology 58:S1, 25-31
CrossRef463
William Pao. (2006) Defining clinically relevant molecular subsets of lung cancer. Cancer Chemotherapy and Pharmacology 58:S1, 11-15
CrossRef464
Neil P. Shah. (2006) Improving upon the promise of targeted therapy of human malignancy: chronic myeloid leukemia as a paradigm. Cancer Chemotherapy and Pharmacology 58:S1, 49-53
CrossRef465
Michael Davies, Bryan Hennessy, Gordon B Mills. (2006) Point mutations of protein kinases and individualised cancer therapy. Expert Opinion on Pharmacotherapy 7:16, 2243-2261
CrossRef466
Yoshihiko Segawa, Katsuyuki Hotta, Shigeki Umemura, Yoshiro Fujiwara, Tetsu Shinkai, Hiroshi Ueoka, Nagio Takigawa, Masahiro Tabata, Katsuyuki Kiura, Mitsune Tanimoto. (2006) Clinical factors affecting acquired resistance to gefitinib in previously treated Japanese patients with advanced nonsmall cell lung cancer. Cancer 107:8, 1866-1872
CrossRef467
Brian P Rubin, Anette Duensing. (2006) Mechanisms of resistance to small molecule kinase inhibition in the treatment of solid tumors. Laboratory Investigation 86:10, 981-986
CrossRef468
John Marshall. (2006) Clinical implications of the mechanism of epidermal growth factor receptor inhibitors. Cancer 107:6, 1207-1218
CrossRef469
Richard M. Weinshilboum, Liewei Wang. (2006) Pharmacogenetics and Pharmacogenomics: Development, Science, and Translation. Annual Review of Genomics and Human Genetics 7:1, 223-245
CrossRef470
Lecia V. Sequist, Rafal Dziadziuszko. (2006) Update on Epidermal Growth Factor Receptor Inhibitor Development in Lung Cancer. Journal of Thoracic Oncology 1:7, 740-743
CrossRef471
Dae Ho Lee, Ji-Youn Han, Heung Tae Kim, Jin Soo Lee. (2006) Gefitinib is of more benefit in chemotherapy-naive patients with good performance status and adenocarcinoma histology: Retrospective analysis of 575 Korean patients. Lung Cancer 53:3, 339-345
CrossRef472
Naozumi Hashimoto, Kazuyoshi Imaizumi, Toyohiro Honda, Tsutomu Kawabe, Tetsuro Nagasaka, Kaoru Shimokata, Yoshinori Hasegawa. (2006) Successful re-treatment with gefitinib for carcinomatous meningitis as disease recurrence of non-small-cell lung cancer. Lung Cancer 53:3, 387-390
CrossRef473
Kohzoh Imai, Akinori Takaoka. (2006) Comparing antibody and small-molecule therapies for cancer. Nature Reviews Cancer 6:9, 714-727
CrossRef474
I Bernard Weinstein, Andrew K Joe. (2006) Mechanisms of Disease: oncogene addiction—a rationale for molecular targeting in cancer therapy. Nature Clinical Practice Oncology 3:8, 448-457
CrossRef475
Juan-Sebastian Saldivar, Zhenbin Chen, Steve Sommer. 2006. EGF Receptor Testing for Non-Small Cell Lung Carcinomas. .
CrossRef476
Marcus Wiedmann, J??rgen Feisthammel, Thilo Bl??thner, Andrea Tannapfel, Thomas Kamenz, Annett Kluge, Joachim M??ssner, Karel Caca. (2006) Novel targeted approaches to treating biliary tract cancer: the dual epidermal growth factor receptor and ErbB-2 tyrosine kinase inhibitor NVP-AEE788 is more efficient than the epidermal growth factor receptor inhibitors gefitinib and erlotinib. Anti-Cancer Drugs 17:7, 783-795
CrossRef477
Jeffrey A. Engelman, Ji Luo, Lewis C. Cantley. (2006) The evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolism. Nature Reviews Genetics 7:8, 606-619
CrossRef478
Tetsuya Mitsudomi, Takayuki Kosaka, Yasushi Yatabe. (2006) Biological and clinical implications of EGFR mutations in lung cancer. International Journal of Clinical Oncology 11:3, 190-198
CrossRef479
Wei Peng Yong, Federico Innocenti, Mark J. Ratain. (2006) The role of pharmacogenetics in cancer therapeutics. British Journal of Clinical Pharmacology 62:1, 35-46
CrossRef480
Roman K Thomas, Elizabeth Nickerson, Jan F Simons, Pasi A Jänne, Torstein Tengs, Yuki Yuza, Levi A Garraway, Thomas LaFramboise, Jeffrey C Lee, Kinjal Shah, Keith O'Neill, Hidefumi Sasaki, Neal Lindeman, Kwok-Kin Wong, Ana M Borras, Edward J Gutmann, Konstantin H Dragnev, Ralph DeBiasi, Tzu-Hsiu Chen, Karen A Glatt, Heidi Greulich, Brian Desany, Christine K Lubeski, William Brockman, Pablo Alvarez, Stephen K Hutchison, J H Leamon, Michael T Ronan, Gregory S Turenchalk, Michael Egholm, William R Sellers, Jonathan M Rothberg, Matthew Meyerson. (2006) Sensitive mutation detection in heterogeneous cancer specimens by massively parallel picoliter reactor sequencing. Nature Medicine 12:7, 852-855
CrossRef481
Tatsu Shimoyama, Fumiaki Koizumi, Hisao Fukumoto, Katsuyuki Kiura, Mitsune Tanimoto, Nagahiro Saijo, Kazuto Nishio. (2006) Effects of different combinations of gefitinib and irinotecan in lung cancer cell lines expressing wild or deletional EGFR. Lung Cancer 53:1, 13-21
CrossRef482
Nancy E. Hynes, Thomas Schlange. (2006) Targeting ADAMS and ERBBs in lung cancer. Cancer Cell 10:1, 7-11
CrossRef483
Masaki Tokumo, Shinichi Toyooka, Shuji Ichihara, Kadoaki Ohashi, Kazunori Tsukuda, Kouichi Ichimura, Masahiro Tabata, Katsuyuki Kiura, Motoi Aoe, Yoshifumi Sano, Hiroshi Date, Nobuyoshi Shimizu. (2006) Double mutation and gene copy number of EGFR in gefitinib refractory non-small-cell lung cancer. Lung Cancer 53:1, 117-121
CrossRef484
Hideharu Kimura, Yutaka Fujiwara, Takashi Sone, Hideo Kunitoh, Tomohide Tamura, Kazuo Kasahara, Kazuto Nishio. (2006) High sensitivity detection of epidermal growth factor receptor mutations in the pleural effusion of non-small cell lung cancer patients. Cancer Science 97:7, 642-648
CrossRef485
Yasushi Yatabe, Toyoaki Hida, Yoshitsugu Horio, Takayuki Kosaka, Takashi Takahashi, Tetsuya Mitsudomi. (2006) A Rapid, Sensitive Assay to Detect EGFR Mutation in Small Biopsy Specimens from Lung Cancer. The Journal of Molecular Diagnostics 8:3, 335-341
CrossRef486
Shioto Suzuki, Satoshi Igarashi, Mitsuhiko Hanawa, Hirochika Matsubara, Akishi Ooi, Yoh Dobashi. (2006) Diversity of epidermal growth factor receptor-mediated activation of downstream molecules in human lung carcinomas. Modern Pathology 19:7, 986-998
CrossRef487
Talpaz, Moshe, Shah, Neil P., Kantarjian, Hagop, Donato, Nicholas, Nicoll, John, Paquette, Ron, Cortes, Jorge, O'Brien, Susan, Nicaise, Claude, Bleickardt, Eric, Blackwood-Chirchir, M. Anne, Iyer, Vishwanath, Chen, Tai-Tsang, Huang, Fei, Decillis, Arthur P., Sawyers, Charles L., . (2006) Dasatinib in Imatinib-Resistant Philadelphia Chromosome–Positive Leukemias. New England Journal of Medicine 354:24, 2531-2541
Full Text488
Carlos L. Arteaga. (2006) EGF receptor mutations in lung cancer: From humans to mice and maybe back to humans. Cancer Cell 9:6, 421-423
CrossRef489
Hongbin Ji, Danan Li, Liang Chen, Takeshi Shimamura, Susumu Kobayashi, Kate McNamara, Umar Mahmood, Albert Mitchell, Yangping Sun, Ruqayyah Al-Hashem, Lucian R. Chirieac, Robert Padera, Roderick T. Bronson, William Kim, Pasi A. Jänne, Geoffrey I. Shapiro, Daniel Tenen, Bruce E. Johnson, Ralph Weissleder, Norman E. Sharpless, Kwok-Kin Wong. (2006) The impact of human EGFR kinase domain mutations on lung tumorigenesis and in vivo sensitivity to EGFR-targeted therapies. Cancer Cell 9:6, 485-495
CrossRef490
D. Garfield. (2006) Lung Cancer 52:3, 373
CrossRef491
Patrick C Ma, Xiaodong Zhang, Zhenghe J Wang. (2006) High-throughput mutational analysis of the human cancer genome. Pharmacogenomics 7:4, 597-612
CrossRef492
Nagahiro Saijo. (2006) Recent trends in the treatment of advanced lung cancer. Cancer Science 97:6, 448-452
CrossRef493
Yilong Wu, Yan Sun. (2006) Cancer management can be personalized? — Cancer genomic research in China. The Chinese-German Journal of Clinical Oncology 5:3, 156-158
CrossRef494
F B J M Thunnissen, O C J Schuurbiers, M A den Bakker. (2006) A critical appraisal of prognostic and predictive factors for common lung cancers. Histopathology 48:7, 779-786
CrossRef495
Judith S. Sebolt-Leopold, Jessie M. English. (2006) Mechanisms of drug inhibition of signalling molecules. Nature 441:7092, 457-462
CrossRef496
Shingo Matsumoto, Reika Iwakawa, Takashi Kohno, Kenji Suzuki, Yoshihiro Matsuno, Seiichiro Yamamoto, Masayuki Noguchi, Eiji Shimizu, Jun Yokota. (2006) FrequentEGFR mutations in noninvasive bronchioloalveolar carcinoma. International Journal of Cancer 118:10, 2498-2504
CrossRef497
Paul S Mischel, Timothy Cloughesy. (2006) Using molecular information to guide brain tumor therapy. Nature Clinical Practice Neurology 2:5, 232-233
CrossRef498
HAAKON SKOGSETH, ERIK LARSSON, JOSTEIN HALGUNSET. (2006) Urokinase plasminogen activator receptor (uPAR) expression is reduced by tyrosine kinase inhibitors. APMIS 114:4, 307-313
CrossRef499
Cheng-long Huang, Hiroyasu Yokomise, Masakazu Fukushima, Moritoshi Kinoshita. (2006) Tailor-made chemotherapy for non-small cell lung cancer patients. Future Oncology 2:2, 289-299
CrossRef500
Derek Atkins, Detlef Rohde, Stephan Störkel. (2006) Differential expression of EGFR and TGFα in VHL-mutated renal cell carcinomas of the clear cell type: implications for targeted therapeutic approaches. Targeted Oncology 1:2, 71-78
CrossRef501
K Sugio, H Uramoto, K Ono, T Oyama, T Hanagiri, M Sugaya, Y Ichiki, T So, S Nakata, M Morita, K Yasumoto. (2006) Mutations within the tyrosine kinase domain of EGFR gene specifically occur in lung adenocarcinoma patients with a low exposure of tobacco smoking. British Journal of Cancer 94:6, 896-903
CrossRef502
H Eugene LIU, Ken-Hong LIM, Ming-Jer HUANG, Biing-Shiun HUANG. (2006) Targeting epidermal growth factor receptor in lung cancer: Perspective from the Asia-Pacific region. Asia-Pacific Journal of Clinical Oncology 2:1, 22-31
CrossRef503
F. Carlomagno, S. Anaganti, T. Guida, G. Salvatore, G. Troncone, S. M. Wilhelm, M. Santoro. (2006) BAY 43-9006 Inhibition of Oncogenic RET Mutants. JNCI Journal of the National Cancer Institute 98:5, 326-334
CrossRef504
Keunchil Park, Koichi Goto. (2006) A review of the benefit–risk profile of gefitinib in Asian patients with advanced non‐small‐cell lung cancer. Current Medical Research and Opinion 22:3, 561-573
CrossRef505
D. Rohde. (2006) „Multi-targeting drugs“ und „multi-drug targeting“ beim metastasierten Nierenzellkarzinom. Der Urologe 45:3, 356-358
CrossRef506
Jonathan E. Dowell. (2006) Epidermal Growth Factor Receptor Mutations in Non-Small Cell Lung Cancer: A Basic Science Discovery with Immediate Clinical Impact. The American Journal of the Medical Sciences 331:3, 139-149
CrossRef507
Naruo Yoshimura, Shinzoh Kudoh, Tatsuo Kimura, Shigeki Mitsuoka, Kuniomi Matsuura, Kazuto Hirata, Kaoru Matsui, Shunichi Negoro, Kazuhiko Nakagawa, Masahiro Fukuoka. (2006) EKB-569, a new irreversible epidermal growth factor receptor tyrosine kinase inhibitor, with clinical activity in patients with non-small cell lung cancer with acquired resistance to gefitinib. Lung Cancer 51:3, 363-368
CrossRef508
Rafael Rosell, Mauricio Cuello, Fabiana Cecere, Mariacarmela Santarpia, Noemi Reguart, Enriqueta Felip, Miquel Taron. (2006) Treatment of non-small-cell lung cancer and pharmacogenomics: where we are and where we are going. Current Opinion in Oncology 18:2, 135-143
CrossRef509
Dale Chenoweth. (2006) Can single-patient investigational new drug studies hurry slow trains to the fast track?. Drug Discovery Today 11:5-6, 185-186
CrossRef510
Erminia Massarelli, Roy S. Herbst. (2006) Use of Novel Second-Line Targeted Therapies in Non–Small Cell Lung Cancer. Seminars in Oncology 33, 9-16
CrossRef511
Qi-Wen Fan, William A Weiss. (2006) Chemical genetic approaches to the development of cancer therapeutics. Current Opinion in Genetics & Development 16:1, 85-91
CrossRef512
Hisayuki Shigematsu, Adi F. Gazdar. (2006) Somatic mutations of epidermal growth factor receptor signaling pathway in lung cancers. International Journal of Cancer 118:2, 257-262
CrossRef513
Nicola Normanno, Antonella De Luca, Caterina Bianco, Luigi Strizzi, Mario Mancino, Monica R. Maiello, Adele Carotenuto, Gianfranco De Feo, Francesco Caponigro, David S. Salomon. (2006) Epidermal growth factor receptor (EGFR) signaling in cancer. Gene 366:1, 2-16
CrossRef514
Tetsuya Mitsudomi. (2006) Mutations in the Epidermal Growth Factor Receptor Gene And Sensitivity to Tyrosine Kinase Inhibitors. Haigan 46:3, 237-240
CrossRef515
Federica Di Nicolantonio, Alberto Bardelli. (2006) Kinase mutations in cancer: chinks in the enemyʼs armour?. Current Opinion in Oncology 18:1, 69-76
CrossRef516
Athanassios Argiris, Thomas Hensing, Anjana Yeldandi, Smita Patel, Adekunle Raji, Charles Sturgis, Gregory Masters, William Gooding, Michael Pins, Jill Kolesar. (2006) Combined Analysis of Molecular and Clinical Predictors of Gefitinib Activity in Advanced Non???Small Cell Lung Cancer: Epidermal Growth Factor Receptor Mutations Do Not Tell the Whole Story. Journal of Thoracic Oncology 1:1, 52-60
CrossRef517
Adi F. Gazdar. (2006) Rapid Screening for EGFR Mutations. The Cancer Journal 12:1, 17-18
CrossRef518
James A. McCubrey, Linda S. Steelman, Steven L. Abrams, John T. Lee, Fumin Chang, Fred E. Bertrand, Patrick M. Navolanic, David M. Terrian, Richard A. Franklin, Antonio B. D’Assoro, Jeffrey L. Salisbury, Maria Clorinda Mazzarino, Franca Stivala, Massimo Libra. (2006) Roles of the RAF/MEK/ERK and PI3K/PTEN/AKT pathways in malignant transformation and drug resistance. Advances in Enzyme Regulation 46:1, 249-279
CrossRef519
Hideki Shibuya, Tomoko Kutomi, Yoko Sato, Naoki Tashiro, Kei Hara, Tetsuya Hisada. (2006) A Case of Adenocarcinoma of the Lung with a Favorable Response to Retreatment with Gefitinib. Haigan 46:4, 357-362
CrossRef520
Justin Stebbing, Mark Bower. (2006) Comparative pharmacogenomics of antiretroviral and cytotoxic treatments. The Lancet Oncology 7:1, 61-68
CrossRef521
Young-Chul Kim, Kyu-Sik Kim. (2006) Drugs for Lung Cancer Treatment. Tuberculosis and Respiratory Diseases 60:2, 123
CrossRef522
Hidetaka Uramoto, Kenji Sugio, Tsunehiro Oyama, Kenji Ono, Masakazu Sugaya, Takashi Yoshimatsu, Takeshi Hanagiri, Masaru Morita, Kosei Yasumoto. (2006) Epidermal growth factor receptor mutations are associated with gefitinib sensitivity in non-small cell lung cancer in Japanese. Lung Cancer 51:1, 71-77
CrossRef523
Nicholas W Choong, Sascha Dietrich, Tanguy Y Seiwert, Maria S Tretiakova, Vidya Nallasura, Gareth C Davies, Stanley Lipkowitz, Aliya N Husain, Ravi Salgia, Patrick C Ma. (2006) Gefitinib response of erlotinib-refractory lung cancer involving meninges—role of EGFR mutation. Nature Clinical Practice Oncology 3:1, 50-57
CrossRef524
(2006) The Future in Diagnosis and Staging of Lung Cancer – Molecular Techniques. Respiration
CrossRef525
Kazuto Nishio. (2006) Signal Transduction and Drug Sensitivity. Haigan 46:3, 241-244
CrossRef526
Hidefumi Sasaki, Shigeki Shimizu, Katsuhiko Endo, Minoru Takada, Masaaki Kawahara, Hisaichi Tanaka, Akihide Matsumura, Keiji Iuchi, Hiroshi Haneda, Eriko Suzuki, Yoshihiro Kobayashi, Motoki Yano, Yoshitaka Fujii. (2006) EGFR and erbB2 mutation status in Japanese lung cancer patients. International Journal of Cancer 118:1, 180-184
CrossRef527
Takao Yamori. (2006) Overview of molecular target-based drugs. Drug Delivery System 21:1, 18-23
CrossRef528
Hisayuki Shigematsu, Shinichi Toyooka, Makoto Suzuki. (2006) The Need for an Individual Approach to Lung Cancer Treatment. PLoS Medicine 3:4, e206
CrossRef529
Martin J. Edelman. (2005) An Update on the Role of Epidermal Growth Factor Receptor Inhibitors in Non–Small Cell Lung Cancer. Seminars in Oncology 32, 3-8
CrossRef530
Henrik Daub. (2005) Characterisation of kinase-selective inhibitors by chemical proteomics. Biochimica et Biophysica Acta (BBA) - Proteins & Proteomics 1754:1-2, 183-190
CrossRef531
Daphne W Bell, Ira Gore, Ross A Okimoto, Nadia Godin-Heymann, Raffaella Sordella, Roseann Mulloy, Sreenath V Sharma, Brian W Brannigan, Gayatry Mohapatra, Jeff Settleman, Daniel A Haber. (2005) Inherited susceptibility to lung cancer may be associated with the T790M drug resistance mutation in EGFR. Nature Genetics 37:12, 1315-1316
CrossRef532
Avinash Viswanathan, Giancarlo Pillot, Ramaswamy Govindan. (2005) Lack of response to erlotinib after progression on gefitinib in patients with advanced non-small cell lung cancer. Lung Cancer 50:3, 417-418
CrossRef533
Sofia Agelaki, Vassilis Georgoulias. (2005) Epidermal growth factor receptor inhibitors in the treatment of non-small cell lung cancer. Expert Opinion on Emerging Drugs 10:4, 855-874
CrossRef534
Giuseppe Giaccone, Jose Antonio Rodriguez. (2005) EGFR inhibitors: what have we learned from the treatment of lung cancer?. Nature Clinical Practice Oncology 2:11, 554-561
CrossRef535
Hong-Guang Xie, Felix W Frueh. (2005) Pharmacogenomics steps toward personalized medicine. Personalized Medicine 2:4, 325-337
CrossRef536
Joseph A. Ludwig, John N. Weinstein. (2005) Biomarkers in Cancer Staging, Prognosis and Treatment Selection. Nature Reviews Cancer 5:11, 845-856
CrossRef537
Janine Smith. (2005) Erlotinib: Small-molecule targeted therapy in the treatmentof non-small-cell lung cancer. Clinical Therapeutics 27:10, 1513-1534
CrossRef538
Bert M Klebl, Gerhard Müller. (2005) Second-generation kinase inhibitors. Expert Opinion on Therapeutic Targets 9:5, 975-993
CrossRef539
T. Mukohara, J. A. Engelman, N. H. Hanna, B. Y. Yeap, S. Kobayashi, N. Lindeman, B. Halmos, J. Pearlberg, Z. Tsuchihashi, L. C. Cantley, D. G. Tenen, B. E. Johnson, P. A. Janne. (2005) Differential Effects of Gefitinib and Cetuximab on Non-small-cell Lung Cancers Bearing Epidermal Growth Factor Receptor Mutations. JNCI Journal of the National Cancer Institute 97:16, 1185-1194
CrossRef540
J. D. Minna, M. J. Peyton, A. F. Gazdar. (2005) Gefitinib Versus Cetuximab in Lung Cancer: Round One. JNCI Journal of the National Cancer Institute 97:16, 1168-1169
CrossRef541
Julia Kirchheiner, Uwe Fuhr, Jürgen Brockmöller. (2005) Opinion: Pharmacogenetics-based therapeutic recommendations — ready for clinical practice?. Nature Reviews Drug Discovery 4:8, 639-647
CrossRef542
Giuseppe Giaccone. (2005) Targeting HER1/EGFR in cancer therapy: experience with erlotinib. Future Oncology 1:4, 449-460
CrossRef543
Richard F Riedel, Phillip G Febbo. (2005) Epidermal growth factor receptor mutations predict sensitivity to gefitinib in patients with non-small-cell lung cancer. Future Oncology 1:4, 461-466
CrossRef544
K. Spiekermann, W. Hiddemann. (2005) Molekulare Zielstrukturen in der Onkologie. Der Internist 46:8, 847-860
CrossRef545
Krause, Daniela S., Van Etten, Richard A., . (2005) Tyrosine Kinases as Targets for Cancer Therapy. New England Journal of Medicine 353:2, 172-187
Full Text546
Shih, Jin-Yuan, Gow, Chien-Hung, Yang, Pan-Chyr, . (2005) EGFR Mutation Conferring Primary Resistance to Gefitinib in Non–Small-Cell Lung Cancer. New England Journal of Medicine 353:2, 207-208
Full Text547
Jan Cools, Chantal Maertens, Peter Marynen. (2005) Resistance to tyrosine kinase inhibitors: Calling on extra forces. Drug Resistance Updates 8:3, 119-129
CrossRef548
Rafael Rosell, Enriqueta Felip, Noemí Reguart, Teresa Moran. (2005) Crossing the rubicon in lung adenocarcinoma: the conundrum of EGFR tyrosine kinase mutations. Future Oncology 1:3, 319-322
CrossRef549
Kenji Tamura, Masahiro Fukuoka. (2005) Gefitinib in non-small cell lung cancer. Expert Opinion on Pharmacotherapy 6:6, 985-993
CrossRef550
Giuseppe Giaccone. (2005) EGFR point mutation confers resistance to gefitinib in a patient with non-small-cell lung cancer. Nature Clinical Practice Oncology 2:6, 296-297
CrossRef551
(2005) EGFR Mutation and Response of Lung Cancer to Gefitinib. New England Journal of Medicine 352:20, 2136-2136
Full Text552
F. J. Kaye. (2005) A Curious Link Between Epidermal Growth Factor Receptor Amplification and Survival: Effect of "Allele Dilution" on Gefitinib Sensitivity?. JNCI Journal of the National Cancer Institute 97:9, 621-623
CrossRef553
Jonathan Dowell, John D. Minna, Peter Kirkpatrick. (2005) Erlotinib hydrochloride. Nature Reviews Drug Discovery 4:5, S14-S15
CrossRef554
G. Kesava Reddy, Daniel A. Haber, Chandra P. Belani. (2005) Role of Epidermal Growth Factor Receptor Mutations in Predicting Sensitivity or Resistance to Targeted Agents in Non–Small-Cell Lung Cancer. Clinical Lung Cancer 6:6, 338-339
CrossRef555
(2005) Mechanism of drug resistance in non-small-cell lung cancer. Nature Clinical Practice Oncology 2:4, 177-177
CrossRef556
Wilfried Eberhardt. (2005) Tyrannosaurus Rex revisited – will it survive?. Future Oncology 1:2, 141-143
CrossRef557
Dowell, Jonathan E., Minna, John D., . (2005) Chasing Mutations in the Epidermal Growth Factor in Lung Cancer. New England Journal of Medicine 352:8, 830-832
Full Text558
Paul Workman. (2005) Genomics and the second golden era of cancer drug development. Molecular BioSystems 1:1, 17
CrossRef559
H. VARMUS, W. PAO, K. POLITI, K. PODSYPANINA, Y.-C.N. DU. (2005) Oncogenes Come of Age. Cold Spring Harbor Symposia on Quantitative Biology 70:1, 1-9
CrossRef560
Jia-Lin Yang, Xian-Jun Qu, Pamela J. Russell, David Goldstein. (2005) Interferon-α Promotes the Anti-Proliferative Effect of Gefitinib (ZD1839) on Human Colon Cancer Cell Lines. Oncology 69:3, 224-238
CrossRef561
Chien-Hung Gow, Jin-Yuan Shih, Yih-Leong Chang, Chong-Jen Yu. (2005) Acquired Gefitinib-Resistant Mutation of EGFR in a Chemonaive Lung Adenocarcinoma Harboring Gefitinib-Sensitive Mutation L858R. PLoS Medicine 2:9, e269
CrossRef562
Jan Stöhlmacher. (2005) Pharmacogenetics in Gastrointestinal Tumors. Onkologie 28:8-9, 435-440
CrossRef563
Adi F. Gazdar, John D. Minna. (2005) Inhibition of EGFR Signaling: All Mutations Are Not Created Equal. PLoS Medicine 2:11, e377
CrossRef564
Apurva A Desai, Mark J Ratain. (2005) EGFR Pharmacogenomics. American Journal of PharmacoGenomics 5:2, 137-139
CrossRef565
P.A. FUTREAL, R. WOOSTER, M.R. STRATTON. (2005) Somatic Mutations in Human Cancer: Insights from Resequencing the Protein Kinase Gene Family. Cold Spring Harbor Symposia on Quantitative Biology 70:1, 43-49
CrossRef566
P. WORKMAN. (2005) Drugging the Cancer Kinome: Progress and Challenges in Developing Personalized Molecular Cancer Therapeutics. Cold Spring Harbor Symposia on Quantitative Biology 70:1, 499-515
CrossRef567
R.K. THOMAS, H. GREULICH, Y. YUZA, J.C. LEE, T. TENGS, W. FENG, T.-H. CHEN, E. NICKERSON, J. SIMONS, M. EGHOLM, J.M. ROTHBERG, W.R. SELLERS, M.L. MEYERSON. (2005) Detection of Oncogenic Mutations in the EGFR Gene in Lung Adenocarcinoma with Differential Sensitivity to EGFR Tyrosine Kinase Inhibitors. Cold Spring Harbor Symposia on Quantitative Biology 70:1, 73-81
CrossRef568
D.A. HABER, D.W. BELL, R. SORDELLA, E.L. KWAK, N. GODIN-HEYMANN, S.V. SHARMA, T.J. LYNCH, J. SETTLEMAN. (2005) Molecular Targeted Therapy of Lung Cancer: EGFR Mutations and Response to EGFR Inhibitors. Cold Spring Harbor Symposia on Quantitative Biology 70:1, 419-426
CrossRef569
C.F.B. KIM, E.L. JACKSON, D.G. KIRSCH, J. GRIMM, A.T. SHAW, K. LANE, J. KISSIL, K.P. OLIVE, A. SWEET-CORDERO, R. WEISSLEDER, T. JACKS. (2005) Mouse Models of Human Non-Small-Cell Lung Cancer: Raising the Bar. Cold Spring Harbor Symposia on Quantitative Biology 70:1, 241-250
CrossRef570
Heidi Greulich, Tzu-Hsiu Chen, Whei Feng, Pasi A. Jänne, James V. Alvarez, Mauro Zappaterra, Sara E. Bulmer, David A. Frank, William C. Hahn, William R. Sellers, Matthew Meyerson. (2005) Oncogenic Transformation by Inhibitor-Sensitive and -Resistant EGFR Mutants. PLoS Medicine 2:11, e313
CrossRef
- Letters
