Original Article
Independent Clonal Origins of Distinct Tumor Foci in Multifocal Papillary Thyroid Carcinoma
N Engl J Med 2005; 352:2406-2412June 9, 2005
- Abstract
Background
Papillary thyroid carcinoma is frequently multifocal. We investigated whether noncontiguous tumor foci arise from intraglandular metastases from a single primary tumor or originate as unrelated clones derived from independent precursors.
Methods
Using a polymerase-chain-reaction assay involving the human androgen receptor gene (HUMARA), we analyzed the patterns of X-chromosome inactivation of multiple distinct foci of well-differentiated multifocal papillary thyroid cancer from 17 women.
Results
Multiple thyroid tumor foci from 10 of 17 patients yielded DNA of adequate quality and were heterozygous for the HUMARA polymorphism and hence suitable for analysis. A single X chromosome was inactivated in each focus, consistent with its monoclonality. When the specific monoclonal configurations of each patient's discrete tumor foci were compared, discordant patterns indicative of independent origins were observed among the tumors from five patients; results in the remaining five were consistent with either a shared or independent clonal origin.
Conclusions
Individual tumor foci in patients with multifocal papillary thyroid cancer often arise as independent tumors.
Media in This Article
Figure 1
Discordant Patterns of X-Chromosome Inactivation in Distinct Tumor Foci from a Single Patient with Multifocal Papillary Thyroid Carcinoma, as Revealed by Methylation-Specific PCR.Figure 2
Distinct Tumors with Opposing Patterns of X-Chromosome Inactivation in a Single Patient, as Revealed by Methylation-Sensitive Enzyme Digestion.Article Activity
- Article
Papillary thyroid carcinoma is the most common cancer of the thyroid gland,1,2 with approximately 20,000 cases annually in the United States. Papillary cancer often presents as a thyroid nodule that does not take up radioactive iodine or as an enlarged lymph node containing a metastasis. The pathogenesis of papillary thyroid cancer involves participation of the RET, NTRK1, RAS, and BRAF genes.3-13
In patients undergoing surgical treatment for papillary thyroid cancer, pathological analysis commonly identifies multiple noncontiguous tumor foci in individual glands. Estimates of the frequency of such multicentric tumors vary, depending on the techniques used, and range between 18 and 87 percent.14-19 A “primary” tumor greater than 1 cm in diameter is typical; most of the additional foci measure less than 1 cm in diameter and are termed “microcarcinomas.”19,20 Multifocal tumors have been associated with increased risks of lymph-node and distant metastases, persistent local disease after initial treatment, and regional recurrence.14,16,17,19,21 All these features suggest that patients with multifocal papillary thyroid cancer should receive aggressive treatment.22
Despite attempts to establish whether multiple intrathyroidal tumors are metastases of a primary thyroid tumor or arise independently,16,19,23,24 the question remains unresolved.25 The phenomenon of X-chromosome inactivation, in which either the maternal or paternal X chromosome in women is inactivated, makes it possible to determine whether cells in separate tumor foci arose from a single source or from different precursors.26 Patterns of X-chromosome inactivation can be used to determine whether a tumor arose from one or multiple progenitor cells because the inactivated X chromosome is stably transmitted from parent cell to progeny cell. For this reason, all the cells in a clonal population have the same inactivated X chromosome — maternal or paternal.27
The event that randomly inactivates the maternal or paternal X chromosome occurs early in embryogenesis, long before the onset of tumor formation; the inactivation is stable in tumor cells and not ordinarily subject to selection during tumorigenesis. Consequently, for the purpose of determining the origins of tumor cells, studies of patterns of X-chromosome inactivation have advantages over methods that compare specific changes in DNA or gene expression in papillary carcinoma. Such changes could arise as late events in separate subclones of one original tumor13,28 and lead to the mistaken interpretation that clonally related tumor foci are unrelated.
Analyses of papillary thyroid cancers involving patterns of X-chromosome inactivation29 and reports of unique clonal genetic alterations, such as RET and NTRK1 gene rearrangements and BRAF mutations,3,6-8,13,30,31 have established that many (and probably all) such tumors are monoclonal neoplasms. To investigate whether distinct tumors in multifocal papillary thyroid cancer arise independently, we compared the specific patterns of monoclonal X-chromosome inactivation of tumor foci in patients with this cancer.
Methods
Tumor Samples
Tumor samples from women who underwent thyroidectomy for the treatment of papillary thyroid carcinoma were obtained in accordance with protocols approved by the institutional review board of each center. Patients provided informed consent as dictated by these protocols. Patients with multiple distinct foci of papillary thyroid cancer were selected for study, and identification of tumor tissue and normal tissue in each sample was determined by one endocrine pathologist. The sizes and locations of distinct tumor foci for all 10 patients suitable for analysis are shown in Table 1Table 1
Specific Clonal X-Chromosome Patterns and Characteristics of Multifocal Papillary Thyroid Carcinomas.. Paraffin blocks were cut into 12-μm sections and placed on clean, uncoated microscope slides. Samples were deparaffinized in xylene and rehydrated in graded ethanol. Large tumors in which the tumor margins could easily be visualized were microdissected grossly from the slide, whereas small tumors or those with substantial inflammatory or stromal components were subjected to laser-capture microdissection (Pix Cell II, Arcturus) to capture an enriched population of neoplastic cells.DNA Extraction
Grossly dissected tissue was incubated in 100 to 200 μl of TE9 (0.5 M TRIS, 0.2 M EDTA, 0.01 M sodium chloride, and 1 percent sodium dodecyl sulfate; pH 9.0) plus 0.2 mg of proteinase K (Invitrogen) for four nights at 55°C. Fresh proteinase K was added daily. Laser-capture microdissection caps were incubated upside down for two nights at 37°C, centrifuged, and subjected to digestion for two additional days at 55°C. Fresh proteinase K was added daily. Chelex 100 resin (Bio-Rad) was added to each sample and incubated for one hour, and the supernatant was removed. DNA was extracted with the use of phenol–chloroform and concentrated by means of ethanol precipitation. The DNA was resuspended in TRIS–EDTA (10 mM TRIS hydrochloride and 1 mM EDTA; pH 8.0).
HUMARA Digestion Assay
We used a polymerase-chain-reaction (PCR) assay for X-chromosome inactivation based on the X-linked human androgen receptor gene (HUMARA). In a monoclonal tumor from a woman, all tumor cells have the same combination of active and inactive X chromosomes. These maternally and paternally inherited chromosomes can be distinguished by polymorphisms — in this case a marked variation in the number of tandemly repeated CAG units within HUMARA. With the use of primers that flank the CAG repeats, two PCR products of different size can be amplified from a heterozygous patient's genomic DNA. The primers that flank the HUMARA CAG repeat sequence also flank a HpaII restriction site (CCGG) that is methylated and thereby protected from digestion when present on an inactive X chromosome, but unmethylated and thereby susceptible to cleavage when on an active X chromosome. Therefore, when HpaII-treated DNA is subjected to PCR with these HUMARA primers, most copies of the inactive allele remain intact and are amplified, whereas most copies of the active allele are cleaved by HpaII and thus unable to yield a PCR product.
Most women in the general population are heterozygous at the polymorphic site and thus amenable to analysis, and the small size of the HUMARA region containing the polymorphism and the restriction site makes it possible to analyze fixed and paraffin-embedded tissue samples by means of PCR. In DNA from a monoclonal tumor, one of the HUMARA alleles is preferentially unmethylated and therefore lost, and clonally related metastases from such a tumor have the same pattern of X-chromosome inactivation as the primary tumor. If, however, multiple tumor foci arise independently, the maternal X chromosome will be inactivated in some foci and the paternal X will be inactivated in others.
Half the DNA from each sample was digested in a 20-μl reaction mixture with 12 U of HpaII (New England Biolabs) at 37°C for 12 to 16 hours. The other half was subjected to mock digestion without the enzyme. After incubation, the restriction enzyme was inactivated at 95°C for 10 minutes.
A 50-μl PCR reaction mixture contained 1× PCR buffer (15 mM TRIS hydrochloride, pH 8.0, and 50 mM potassium chloride), 1.5 mM magnesium chloride, 200 μM of each deoxynucleotide triphosphate, 40 pmol of each primer, 2 U of Amplitaq Gold DNA Polymerase (Applied Biosystems), and 5.0 μl of the digested or mock-digested DNA. Primers used were 5'TCCTATGACACCATTTGGG3' bearing a fluorescent TET tag on the 5' end and 5'CTCTACGATGGGCTTGGGAGAAC3'. Thermocycling consisted of denaturation at 95°C for 10 minutes; 30 cycles at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; and a final extension at 72°C for 10 minutes. Samples underwent electrophoresis on an ABI Prism 377 Sequencer, and data were analyzed with the use of GeneScan and Genotyper software (Applied Biosystems).
To account for differences in gel loading and PCR-amplification efficiency, a ratio of the heights of the allele peaks in the tumor and the normal samples was calculated with the use of the following formula: (peak 1 height of undigested sample ÷ peak 2 height of undigested sample) ÷ (peak 1 height of digested sample ÷ peak 2 height of digested sample). A ratio of more than 2.0 or less than 0.5, representing a preferential loss of intensity in the digested sample of 50 percent of one of the two alleles present in the normal sample, was scored as a monoclonal pattern, and the unmethylated allele was noted.
Sodium Bisulfite Treatment and Methylation-Specific PCR
A methylation-specific PCR assay was also used to examine clonality at the HUMARA locus. Sodium bisulfite treatment of DNA converts unmethylated cytosine to uracil but does not affect methylated cytosine. This conversion results in a difference in the sequence of methylated and unmethylated alleles. In DNA from a monoclonal tumor, PCR amplification with the use of primer sets specific for these different nucleotides makes it possible to determine which of two HUMARA alleles, which differ in the number of CAG-repeat units, is methylated and which allele is unmethylated.
DNA was treated with sodium bisulfite overnight, purified with the use of the Wizard DNA Clean-Up System (Promega), and concentrated by means of ethanol precipitation according to the protocol of Frommer et al.32 Two 50-μl PCR reaction mixtures containing 1× PCR buffer, 1.5 mM magnesium chloride, 200 μM of each deoxynucleotide triphosphate, 40 pmol of each primer, 2 U of Amplitaq Gold DNA Polymerase (Applied Biosystems), and 2 μl of sodium bisulfite–treated DNA were performed for each tumor DNA sample. In the first, a fluorescently labeled forward primer specific for the bisulfite-treated, methylated HUMARA DNA sequence was used, and in the second, a forward primer specific for the bisulfite-treated, unmethylated sequence was used. PCR primers were unmethylated forward primer 5'GGTTGTGAGTGTAGTATTTTTTGGT3', methylated forward primer 5'CGAGCGTAGTATTTTTCGGC3', and universal reverse primer 5'TAAAAAAAACCATCCTCACC3'.33 Thermocycling consisted of denaturation for 95°C for 10 minutes; 30 cycles at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; and a final extension at 72°C for 10 minutes. Samples underwent electrophoresis on an ABI Prism 377 Sequencer, and data were analyzed with the use of GeneScan and Genotyper software (Applied Biosystems).
Results
Samples of multifocal papillary thyroid carcinoma from 17 women who underwent thyroidectomy for the treatment of papillary cancer were analyzed. Slides containing paraffin-embedded sections from tumors were microdissected manually or with the use of laser-capture microdissection, depending on the size of the tumor and the amount of stromal and inflammatory components, to ensure that the specimen contained a predominance (typically more than 90 percent by means of visual inspection) of neoplastic cells. Tumor DNA was analyzed for X-chromosome–inactivation status with the use of sodium bisulfite treatment followed by methylation-specific PCR, digestion with methylation-specific restriction enzymes followed by PCR, or both. Seven tumors from five patients yielded interpretable results with both procedures and showed consistent agreement in the resulting patterns of X-chromosome inactivation.
Multiple foci of tumor from 10 patients yielded DNA of adequate quality and quantity and were heterozygous for the analyzed polymorphism in exon 1 of HUMARA and hence suitable for analysis (Table 1). These foci showed monoclonal patterns of X-chromosome inactivation consistent with previous findings of monoclonality in papillary thyroid cancer (and thus also confirmed that our dissection yielded a highly purified population of tumor cells). When the patterns of X-chromosome inactivation were compared among foci from an individual patient, the foci from Patients 8, 9, 10, 12, and 14 had discordant patterns: in some, the maternal X chromosome was inactivated, and in others, it was the paternal X chromosome (Figure 1Figure 1
Discordant Patterns of X-Chromosome Inactivation in Distinct Tumor Foci from a Single Patient with Multifocal Papillary Thyroid Carcinoma, as Revealed by Methylation-Specific PCR. and Figure 2Figure 2Distinct Tumors with Opposing Patterns of X-Chromosome Inactivation in a Single Patient, as Revealed by Methylation-Sensitive Enzyme Digestion.). This finding is strong evidence that these patients' physically distinct papillary thyroid cancer foci arose as separate events from different clonal progenitor cells.In the remaining five sets of samples (from Patients 6, 7, 15, 16, and 17), there were identical monoclonal patterns in each of two or three tumor foci. The interpretation of these findings is less definitive; although such findings are consistent with the presence of a shared clonal relationship, it is equally possible that the small number of foci in these five sample sets had separate clonal origins but happened by chance to share the same inactivated X chromosome. The ability of the assay to detect clonal independence in the latter five cases could have also been overridden by the highly skewed distribution of inactivated maternal and paternal X chromosomes normally found in some women or the possibility that large, contiguous patches of cells in some normal thyroid glands could have the same inactivated X chromosome owing to cell-migration patterns during organogenesis.34
Discussion
The presence of multiple foci of papillary thyroid carcinoma is a common clinical finding, but the origin of these foci is unsettled.25 They may be intraglandular metastases from a single primary tumor, or each tumor may arise from a distinct progenitor cell. Evidence from previous studies has lent support to both arguments.
Multifocal thyroid disease has been associated with distant metastases in some (but not all) studies,14,16,17,19 suggesting that multifocal disease carries an increased risk of metastases. Iida et al. noted that many of the small foci are histologically identical to a larger cancer nodule in the same gland,14 suggesting that the smaller tumors are metastases of the larger tumor. Another factor providing support for this possibility is that the thyroid has a unique lymphatic drainage system, with the two lobes and the isthmus enclosed in a capsule containing an abundant network of intralobular lymphatic vessels. The lymphatic vessels that arise between the thyroid follicles, anastomosing and penetrating into the capsule throughout the gland,35 would allow tumor metastases ready access to other parts of the gland.
That each tumor focus may have an independent origin was suggested in three cases described as “multinodular” papillary thyroid cancer that included an undifferentiated tumor24 and by the finding of transcripts representing distinct RET-PTC rearrangements within such foci.23 However, RET rearrangement may not always be an early, initiating event in sporadic papillary thyroid cancer.13,28 That RET rearrangements can occur late in the evolution of established tumor clones is supported by the finding that several different RET-PTC transcripts can be present within a single tumor focus.23,28 Thus, reported patterns of RET rearrangement have not been a definitive means of determining the origins of multifocal papillary thyroid cancer. Since inactivation of the X chromosome is independent of neoplastic selection and occurs before cell transformation, determination of X-chromosome inactivation can accurately determine whether tumor cells originate from a single precursor or multiple precursors.24,36-39 Our results with methods based on inactivation of the X chromosome in well-characterized, multifocal papillary thyroid carcinomas favor the independent clonal origins of the distinct foci in some (and possibly most) of these cases.
The finding that multifocal tumors in papillary thyroid cancer have independent origins has implications for pathogenesis. Since neoplastic transformation is usually a rare event, it is unlikely that many cells within the same gland would undergo transformation independently without some predisposing influence, such as an environmental insult, a mutation, or polymorphisms. Exposure to radiation is one well-known predisposing factor,40 but the frequent presence of multifocal papillary thyroid cancer in patients who have not been exposed to radiation suggests that there are other influences.
Our findings imply that any thyroid tissue remaining after surgery to treat papillary thyroid cancer in patients with multifocal disease may contain — or be likely to develop — additional foci of cancer that could become recurrences. Establishing that papillary-cancer foci may have independent origins provides theoretical support for the appropriateness of bilateral thyroidectomy and radioablation of remaining tissue.
Supported in part by a grant (T32 GM008607) from the National Institutes of Health Medical Scientist Training Program, the Murray–Heilig Fund in Molecular Medicine, and the Lorraine P. and Thomas R. Williams Endocrine Research Fund.
Source Information
From the Center for Molecular Medicine and Division of Endocrinology and Metabolism, University of Connecticut School of Medicine, Farmington (T.M.S., A.A.); the Department of Pathology, Johns Hopkins Medical Institutions, Baltimore (W.H.W.); and the Division of Endocrinology and Metabolism, Johns Hopkins University School of Medicine, Baltimore (P.W.L.).
Address reprint requests to Dr. Arnold at the Center for Molecular Medicine, University of Connecticut School of Medicine, 263 Farmington Ave., Farmington, CT 06030-3101, or at molecularmedicine@uchc.edu.
- References
References
1
Sherman SI . Thyroid carcinoma. Lancet 2003;361:501-511
CrossRef | Web of Science | Medline2
Grebe SK ,Hay ID . Follicular cell-derived thyroid carcinomas. Cancer Treat Res 1997;89:91-140
CrossRef | Medline3
Grieco M ,Santoro M ,Berlingieri MT , et al. PTC is a novel rearranged form of the ret proto-oncogene and is frequently detected in vivo in human thyroid papillary carcinomas. Cell 1990;60:557-563
CrossRef | Web of Science | Medline4
Bongarzone I ,Butti MG ,Coronelli S , et al. Frequent activation of ret protooncogene by fusion with a new activating gene in papillary thyroid carcinomas. Cancer Res 1994;54:2979-2985
Web of Science | Medline5
Minoletti F ,Butti MG ,Coronelli S , et al. The two genes generating RET/PTC3 are localized in chromosomal band 10q11.2. Genes Chromosomes Cancer 1994;11:51-57
CrossRef | Web of Science | Medline6
Sozzi G ,Bongarzone I ,Miozzo M , et al. A t(10;17) translocation creates the RET/PTC2 chimeric transforming sequence in papillary thyroid carcinoma. Genes Chromosomes Cancer 1994;9:244-250
CrossRef | Web of Science | Medline7
Pierotti MA ,Bongarzone I ,Borrello MG , et al. Rearrangements of TRK proto-oncogene in papillary thyroid carcinomas. J Endocrinol Invest 1995;18:130-133
Web of Science | Medline8
Pierotti MA ,Vigneri P ,Bongarzone I . Rearrangements of RET and NTRK1 tyrosine kinase receptors in papillary thyroid carcinomas. Recent Results Cancer Res 1998;154:237-247
Medline9
Hara H ,Fulton N ,Yashiro T ,Ito K ,DeGroot LJ ,Kaplan EL . N-ras mutation: an independent prognostic factor for aggressiveness of papillary thyroid carcinoma. Surgery 1994;116:1010-1016
Web of Science | Medline10
Cohen Y ,Xing M ,Mambo E , et al. BRAF mutation in papillary thyroid carcinoma. J Natl Cancer Inst 2003;95:625-627
CrossRef | Web of Science | Medline11
Fukushima T ,Suzuki S ,Mashiko M , et al. BRAF mutations in papillary carcinomas of the thyroid. Oncogene 2003;22:6455-6457
CrossRef | Web of Science | Medline12
Kimura ET ,Nikiforova MN ,Zhu Z ,Knauf JA ,Nikiforov YE ,Fagin JA . High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res 2003;63:1454-1457
Web of Science | Medline13
Fagin JA . Challenging dogma in thyroid cancer molecular genetics -- role of RET/PTC and BRAF in tumor initiation. J Clin Endocrinol Metab 2004;89:4264-4266
CrossRef | Web of Science | Medline14
Iida F ,Yonekura M ,Miyakawa M . Study of intraglandular dissemination of thyroid cancer. Cancer 1969;24:764-771
CrossRef | Web of Science | Medline15
Hawk WA ,Hazard JB . The many appearances of papillary carcinoma of the thyroid. Cleve Clin Q 1976;43:207-215
Medline16
Carcangiu ML ,Zampi G ,Rosai J . Papillary thyroid carcinoma: a study of its many morphologic expressions and clinical correlates. Pathol Annu 1985;20:1-44
Medline17
Tscholl-Ducommun J ,Hedinger CE . Papillary thyroid carcinomas: morphology and prognosis. Virchows Arch A Pathol Anat Histol 1982;396:19-39
CrossRef | Web of Science | Medline18
Russell WO ,Ibanez ML ,Clark RL ,White EC . Thyroid carcinoma classification, intraglandular dissemination, and clinicopathological study based upon whole organ section of 80 glands. Cancer 1963;16:1425-1460
CrossRef | Web of Science | Medline19
Katoh R ,Sasaki J ,Kurihara H ,Suzuki K ,Iida Y ,Kawaoi A . Multiple thyroid involvement (intraglandular metastasis) in papillary thyroid carcinoma: a clinicopathologic study of 105 consecutive patients. Cancer 1992;70:1585-1590
CrossRef | Web of Science | Medline20
Hedinger C ,Williams ED ,Sobin LH . The WHO histological classification of thyroid tumors: a commentary on the second edition. Cancer 1989;63:908-911
CrossRef | Web of Science | Medline21
Mazzaferri EL ,Jhiang S . Long-term impact of initial surgical and medical therapy on papillary and follicular thyroid cancer. Am J Med 1994;97:418-428[Erratum, Am J Med 1995;98:215.]
CrossRef | Web of Science | Medline22
Ringel MD ,Ladenson PW . Controversies in the follow-up and management of well-differentiated thyroid cancer. Endocr Relat Cancer 2004;11:97-116
CrossRef | Web of Science | Medline23
Sugg SL ,Ezzat S ,Rosen IB ,Freeman JL ,Asa SL . Distinct multiple RET/PTC gene rearrangements in multifocal papillary thyroid neoplasia. J Clin Endocrinol Metab 1998;83:4116-4122
CrossRef | Web of Science | Medline24
Moniz S ,Catarino AL ,Marques AR ,Cavaco B ,Sobrinho L ,Leite V . Clonal origin of non-medullary thyroid tumours assessed by non-random X-chromosome inactivation. Eur J Endocrinol 2002;146:27-33
CrossRef | Web of Science | Medline25
Pacini F, De Groot LJ. Thyroid cancer. In: De Groot LJ, ed. The thyroid and its diseases. (Accessed May 13, 2005, at http://www.thyroidmanager.org/Chapter18/18-nodu-cancer.htm.)
26
Williams GT ,Wynford-Thomas D . How may clonality be assessed in human tumours? Histopathology 1994;24:287-292
CrossRef | Web of Science | Medline27
Fey MF ,Tobler A . Tumour heterogeneity and clonality -- an old theme revisited. Ann Oncol 1996;7:121-128
Web of Science | Medline28
Unger K ,Zitzelsberger H ,Salvatore G , et al. Heterogeneity in the distribution of RET/PTC rearrangements within individual post-Chernobyl papillary thyroid carcinomas. J Clin Endocrinol Metab 2004;89:4272-4279
CrossRef | Web of Science | Medline29
Kim H ,Piao Z ,Park C ,Chung WY ,Park CS . Clinical significance of clonality in thyroid nodules. Br J Surg 1998;85:1125-1128
CrossRef | Web of Science | Medline30
Santoro M ,Carlomagno F ,Hay ID , et al. Ret oncogene activation in human thyroid neoplasms is restricted to the papillary cancer subtype. J Clin Invest 1992;89:1517-1522
CrossRef | Web of Science | Medline31
Nikiforova MN ,Kimura ET ,Gandhi M , et al. BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. J Clin Endocrinol Metab 2003;88:5399-5404
CrossRef | Web of Science | Medline32
Frommer M ,McDonald LE ,Millar DS , et al. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A 1992;89:1827-1831
CrossRef | Web of Science | Medline33
Uchida T ,Ohashi H ,Aoki E , et al. Clonality analysis by methylation-specific PCR for the human androgen-receptor gene (HUMARA-MSP). Leukemia 2000;14:207-212
CrossRef | Web of Science | Medline34
Jovanovic L ,Delahunt B ,McIver B ,Eberhardt NL ,Grebe SK . Thyroid gland clonality revisited: the embryonal patch size of the normal human thyroid gland is very large, suggesting X-chromosome inactivation tumor clonality studies of thyroid tumors have to be interpreted with caution. J Clin Endocrinol Metab 2003;88:3284-3291
CrossRef | Web of Science | Medline35
Reinhoff WF Jr . Lymphatic vessels of thyroid gland in dog and man. Arch Surg 1931;23:783-80436
Namba H ,Matsuo K ,Fagin JA . Clonal composition of benign and malignant human thyroid tumors. J Clin Invest 1990;86:120-125
CrossRef | Web of Science | Medline37
Arnold A ,Staunton CE ,Kim HG ,Gaz RD ,Kronenberg HM . Monoclonality and abnormal parathyroid hormone genes in parathyroid adenomas. N Engl J Med 1988;318:658-662
Full Text | Web of Science | Medline38
Arnold A ,Brown MF ,Urena P ,Gaz RD ,Sarfati E ,Drueke TB . Monoclonality of parathyroid tumors in chronic renal failure and in primary parathyroid hyperplasia. J Clin Invest 1995;95:2047-2053
CrossRef | Web of Science | Medline39
Sidransky D ,Frost P ,Von Eschenbach A ,Oyasu R ,Preisinger AC ,Vogelstein B . Clonal origin of bladder cancer. N Engl J Med 1992;326:737-740
Full Text | Web of Science | Medline40
Schneider AB . Radiation-induced thyroid tumors. Endocrinol Metab Clin North Am 1990;19:495-508
Web of Science | Medline
- Citing Articles (45)
Citing Articles
1
Li Xu, Phi C. Doan, Qingyi Wei, Yanhong Liu, Guojun Li, Erich M. Sturgis. (2012) Association of BRCA1 Functional Single Nucleotide Polymorphisms with Risk of Differentiated Thyroid Carcinoma. Thyroid 22:1, 35-43
CrossRef2
Ioannis Vasileiadis, Efthimios Karakostas, Georgios Charitoudis, Anna Stavrianaki, Stylianos Kapetanakis, Gregory Kouraklis, Theodore Karatzas. (2011) Papillary thyroid microcarcinoma: clinicopathological characteristics and implications for treatment in 276 patients. European Journal of Clinical Investigationno-no
CrossRef3
Weibin Wang, Wenhe Zhao, Haiyong Wang, Xiaodong Teng, Haohao Wang, Xiangheng Chen, Zhongqi Li, Xiongfei Yu, Thomas J. Fahey, Lisong Teng. (2011) Poorer Prognosis and Higher Prevalence of BRAF V600E Mutation in Synchronous Bilateral Papillary Thyroid Carcinoma. Annals of Surgical Oncology
CrossRef4
Christoph Reiners, Heribert Hänscheid, Markus Luster, Michael Lassmann, Frederik A. Verburg. (2011) Radioiodine for remnant ablation and therapy of metastatic disease. Nature Reviews Endocrinology 7:10, 589-595
CrossRef5
Sheng-Fong Kuo, Tzu-Chieh Chao, Hung-Yu Chang, Chuen Hsueh, Chung-Han Yang, Jen-Der Lin. (2011) Prognostic Evaluation of Patients With Multicentric Papillary Thyroid Microcarcinoma. Journal of the Formosan Medical Association 110:8, 511-517
CrossRef6
Luca Giovanella, Frederik A. Verburg. (2011) Ruling Out 131 I Ablation in Low-Risk Differentiated Thyroid Carcinoma Basing on Thyroglobulin Measurement. Thyroid 21:7, 809-810
CrossRef7
Haggi Mazeh, Yacov Samet, David Hochstein, Ido Mizrahi, Ilana Ariel, Ahmed Eid, Herbert R. Freund. (2011) Multifocality in well-differentiated thyroid carcinomas calls for total thyroidectomy. The American Journal of Surgery 201:6, 770-775
CrossRef8
Frederik A. Verburg, Boudewijn Brans, Felix Mottaghy. (2011) Molecular nuclear therapies for thyroid carcinoma. Methods
CrossRef9
Celso Ubirajara Moretto Friguglietti, Simone Elisa Dutenhefner, Lenine Garcia Brandão, Marco Aurélio Vamondes Kulcsar. (2011) Classification of papillary thyroid microcarcinoma according to size and fine-needle aspiration cytology: Behavior and therapeutic implications. Head & Neck 33:5, 696-701
CrossRef10
Markus Dietlein, F. A. Verburg, M. Luster, C. Reiners, F. Pitoia, H. Schicha. (2011) One should not just read what one believes: the nearly irresolvable issue of producing truly objective, evidence-based guidelines for the management of differentiated thyroid cancer. European Journal of Nuclear Medicine and Molecular Imaging 38:5, 793-798
CrossRef11
Anthony Ciarallo, William Makis, Javier-A. Novales-Diaz. (2011) Incidental Papillary Thyroid Carcinoma in a Patient Presenting With Gravesʼ Hyperthyroidism and Concomitant Obstructive Sequestered Intrathoracic Multinodular Goiter. Clinical Nuclear Medicine 36:2, 145-147
CrossRef12
T. T. Law, Brian Hung-Hin Lang. (2011) Incidental Thyroid Carcinoma by FDG-PET/CT: A Study of Clinicopathological Characteristics. Annals of Surgical Oncology 18:2, 472-478
CrossRef13
Li Xu, Guojun Li, Qingyi Wei, Adel K. El-Naggar, Erich M. Sturgis. (2011) Family history of cancer and risk of sporadic differentiated thyroid carcinoma. Cancern/a-n/a
CrossRef14
András Konrády. (2011) Differenciált pajzsmirigyrák – 2009. Orvosi Hetilap 152:5, 163-170
CrossRef15
Weibin Wang, Haiyong Wang, Xiaodong Teng, Haohao Wang, Chenyu Mao, Rongyue Teng, Wenhe Zhao, Jiang Cao, Thomas J. Fahey, Lisong Teng. (2010) Clonal analysis of bilateral, recurrent, and metastatic papillary thyroid carcinomas. Human Pathology 41:9, 1299-1309
CrossRef16
Celestino P. Lombardi, Rocco Bellantone, Carmela De Crea, Nunzia C. Paladino, Guido Fadda, Massimo Salvatori, Marco Raffaelli. (2010) Papillary Thyroid Microcarcinoma: Extrathyroidal Extension, Lymph Node Metastases, and Risk Factors for Recurrence in a High Prevalence of Goiter Area. World Journal of Surgery 34:6, 1214-1221
CrossRef17
P. A. Beer, F. Delhommeau, J. P. LeCouedic, M. A. Dawson, E. Chen, D. Bareford, R. Kusec, M. F. McMullin, C. N. Harrison, A. M. Vannucchi, W. Vainchenker, A. R. Green. (2010) Two routes to leukemic transformation after a JAK2 mutation-positive myeloproliferative neoplasm. Blood 115:14, 2891-2900
CrossRef18
Ju-Yeon Kim, Eun-Jung Jung, Sang-Ho Jeong, Chi-Young Jeong, Young-Tae Ju, Young-Joon Lee, Soon-Chan Hong, Sang-Kyung Choi, Woo-Song Ha, Soon-Tae Park. (2010) Clinical Characteristics and Prognosis of Multifocal Papillary Thyroid Carcinoma. Journal of the Korean Surgical Society 79:6, 442
CrossRef19
Megan Rist Haymart, Max Cayo, Herbert Chen. (2009) Papillary Thyroid Microcarcinomas: Big Decisions for a Small Tumor. Annals of Surgical Oncology 16:11, 3132-3139
CrossRef20
Erich M. Sturgis, Guojun Li. (2009) Molecular Epidemiology of Papillary Thyroid Cancer: In Search of Common Genetic Associations. Thyroid 19:10, 1031-1034
CrossRef21
Nimmi Arora, Harma K. Turbendian, Meredith A. Kato, Tracy A. Moo, Rasa Zarnegar, Thomas J. Fahey. (2009) Papillary Thyroid Carcinoma and Microcarcinoma: Is There a Need to Distinguish the Two?. Thyroid 19:5, 473-477
CrossRef22
Frederik A. Verburg, Markus Dietlein, Michael Lassmann, Markus Luster, Christoph Reiners. (2009) Why radioiodine remnant ablation is right for most patients with differentiated thyroid carcinoma. European Journal of Nuclear Medicine and Molecular Imaging 36:3, 343-346
CrossRef23
Philip A. Beer, Amy V. Jones, Anthony J. Bench, Andrea Goday-Fernandez, Elaine M. Boyd, Krishna J. Vaghela, Wendy N. Erber, Bassam Odeh, Christine Wright, Mary Frances McMullin, Jonathan Cullis, Brian J. P. Huntly, Claire N. Harrison, Nicholas C. P. Cross, Anthony R. Green. (2009) Clonal diversity in the myeloproliferative neoplasms: independent origins of genetically distinct clones. British Journal of Haematology 144:6, 904-908
CrossRef24
Susan C. Pitt, Rebecca S. Sippel, Herbert Chen. (2009) Contralateral papillary thyroid cancer: does size matter?. The American Journal of Surgery 197:3, 342-347
CrossRef25
Thomas Heiberg Brix, Pia Skov Hansen, Gun Peggy S. Knudsen, Marianne K. Kringen, Kirsten Ohm Kyvik, Karen Helene Ørstavik, Laszlo Hegedüs. (2009) No Link Between X Chromosome Inactivation Pattern and Simple Goiter in Females: Evidence from a Twin Study. Thyroid 19:2, 165-169
CrossRef26
Jong-Kil Lee, Duk-Gyu Lee, Jin-Choon Lee, Byung-Joo Lee, Soo-Geun Wang, Seok-Man Son, In-Ju Kim, Yong-Ki Kim. (2009) Clinical Characteristics of Multifocal Papillary Thyroid Carcinoma. Korean Journal of Otolaryngology-Head and Neck Surgery 52:6, 512
CrossRef27
Matthew Potenza, Jeffrey I Mechanick. (2009) Low-risk thyroid carcinoma: when is the treatment worse than the disease?. Expert Review of Endocrinology & Metabolism 4:1, 5-7
CrossRef28
Ronald A. DeLellis, Yuri E. Nikiforov. 2009. Thyroid and Parathyroid Glands. , 563-646.
CrossRef29
L Jovanovic, B Delahunt, B McIver, NL Eberhardt, SKG Grebe. (2008) Most multifocal papillary thyroid carcinomas acquire genetic and morphotype diversity through subclonal evolution following the intra-glandular spread of the initial neoplastic clone. The Journal of Pathology 215:2, 145-154
CrossRef30
Rebecca L. Brown. (2008) Standard and Emerging Therapeutic Approaches for Thyroid Malignancies. Seminars in Oncology 35:3, 298-308
CrossRef31
Giuseppe Pizzolanti, Leonardo Russo, Pierina Richiusa, Vincenzo Bronte, Rosa Bianca Nuara, Vito Rodolico, Marco C. Amato, Lucia Smeraldi, Pasqua S. Sisto, Miriam Nucera, Alessandra Bommarito, Roberto Citarrella, Renato Lo Coco, Daniela Cabibi, Alessio Lo Coco, Francesco Frasca, Gaspare Gulotta, Mario A. Latteri, Giuseppe Modica, Aldo Galluzzo, Carla Giordano. (2007) Fine-Needle Aspiration Molecular Analysis for the Diagnosis of Papillary Thyroid Carcinoma Through BRAF V600E Mutation and RET/PTC Rearrangement. Thyroid 17:11, 1109-1115
CrossRef32
Kalliopi Pazaitou-Panayiotou, Marco Capezzone, Furio Pacini. (2007) Clinical Features and Therapeutic Implication of Papillary Thyroid Microcarcinoma. Thyroid 17:11, 1085-1092
CrossRef33
Electron Kebebew, Julie Weng, Juergen Bauer, Gustavo Ranvier, Orlo H. Clark, Quan-Yang Duh, Daniel Shibru, Boris Bastian, Ann Griffin. (2007) The Prevalence and Prognostic Value of BRAF Mutation in Thyroid Cancer. Annals of Surgery 246:3, 466-471
CrossRef34
C. Cappelli, M. Castellano, M. Braga, E. Gandossi, I. Pirola, E. De Martino, B. Agosti, E. Agabiti Rosei. (2007) Aggressiveness and outcome of papillary thyroid carcinoma (PTC) versus microcarcinoma (PMC): A mono-institutional experience. Journal of Surgical Oncology 95:7, 555-560
CrossRef35
Alexander Abrosimov, Vladimir Saenko, Tatiana Rogounovitch, Hiroyuki Namba, Evgeny Lushnikov, Norisato Mitsutake, Shunichi Yamashita. (2007) Different structural components of conventional papillary thyroid carcinoma display mostly identicalBRAF status. International Journal of Cancer 120:1, 196-200
CrossRef36
E.L. Mazzaferri. (2007) Molecular Evidence for the Same Clonal Origin of Multifocal Papillary Thyroid Carcinomas. Yearbook of Endocrinology 2007, 276-278
CrossRef37
Joseph Kim, Armando E. Giuliano, Roderick R. Turner, Robyn E. Gaffney, Naoyuki Umetani, Minoru Kitago, David Elashoff, Dave S. B. Hoon. (2006) Lymphatic Mapping Establishes the Role of BRAF Gene Mutation in Papillary Thyroid Carcinoma. Annals of Surgery 244:5, 799-804
CrossRef38
So Yeon Park, Young Joo Park, Yu Jin Lee, Hyun Sook Lee, Sung Hee Choi, Gheeyoung Choe, Hak-Chul Jang, Seong Hoe Park, Do Joon Park, Bo Youn Cho. (2006) Analysis of differential BRAFV600E mutational status in multifocal papillary thyroid carcinoma. Cancer 107:8, 1831-1838
CrossRef39
Chung-Yau Lo, Wai-Fan Chan, Brian Hung-Hin Lang, King-Yin Lam, Koon-Yat Wan. (2006) Papillary Microcarcinoma: Is There Any Difference between Clinically Overt and Occult Tumors?. World Journal of Surgery 30:5, 759-766
CrossRef40
Tetsuo Kondo, Shereen Ezzat, Sylvia L. Asa. (2006) Pathogenetic mechanisms in thyroid follicular-cell neoplasia. Nature Reviews Cancer 6:4, 292-306
CrossRef41
E MAZZAFERRI. (2006) Independent Clonal Origins of Distinct Tumor Foci in Multifocal Papillary Thyroid CarcinomaShattuck TM, Westra WH, Landenson PW, et al (Univ of Connecticut, Farming-ton; Johns Hopkins Med Institutions, Baltimore, Md) N Engl J Med 352:2406–2412, 2005§. Yearbook of Endocrinology 2006, 264-266
CrossRef42
Manuel Sobrinho-Simões, Ana Preto, Ana Sofia Rocha, Patrícia Castro, Valdemar Máximo, Elsa Fonseca, Paula Soares. (2005) Molecular pathology of well-differentiated thyroid carcinomas. Virchows Archiv 447:5, 787-793
CrossRef43
(2005) Multifocal Papillary Thyroid Carcinoma. New England Journal of Medicine 353:10, 1067-1068
Full Text44
Christine Kyme. (2005) The origins of multifocal papillary thyroid tumors. Nature Clinical Practice Oncology 2:9, 433-433
CrossRef45
Utiger, Robert D., . (2005) The Multiplicity of Thyroid Nodules and Carcinomas. New England Journal of Medicine 352:23, 2376-2378
Full Text
- Letters
