Original Article
Cytoplasmic Nucleophosmin in Acute Myelogenous Leukemia with a Normal Karyotype
N Engl J Med 2005; 352:254-266January 20, 2005
- Abstract
Background
Nucleophosmin (NPM), a nucleocytoplasmic shuttling protein with prominent nucleolar localization, regulates the ARF-p53 tumor-suppressor pathway. Translocations involving the NPM gene cause cytoplasmic dislocation of the NPM protein.
Methods
We used immunohistochemical methods to study the subcellular localization of NPM in bone marrow–biopsy specimens from 591 patients with primary acute myelogenous leukemia (AML). We then correlated the presence of cytoplasmic NPM with clinical and biologic features of the disease.
Results
Cytoplasmic NPM was detected in 208 (35.2 percent) of the 591 specimens from patients with primary AML but not in 135 secondary AML specimens or in 980 hematopoietic or extrahematopoietic neoplasms other than AML. It was associated with a wide spectrum of morphologic subtypes of the disease, a normal karyotype, and responsiveness to induction chemotherapy, but not with recurrent genetic abnormalities. There was a high frequency of FLT3 internal tandem duplications and absence of CD34 and CD133 in AML specimens with a normal karyotype and cytoplasmic dislocation of NPM, but not in those in which the protein was restricted to the nucleus. AML specimens with cytoplasmic NPM carried mutations of the NPM gene that were predicted to alter the protein at its C-terminal; this mutant gene caused cytoplasmic localization of NPM in transfected cells.
Conclusions
Cytoplasmic NPM is a characteristic feature of a large subgroup of patients with AML who have a normal karyotype, NPM gene mutations, and responsiveness to induction chemotherapy.
Media in This Article
Figure 1
Specific Association of Cytoplasmic Expression of Nucleophosmin with a Large Subgroup of AML.Figure 2
Association between Cytoplasmic Expression of Nucleophosmin (NPM) and CD34 Negativity.Article Activity
- Article
Acute myelogenous leukemia (AML), the most common form of acute leukemia in adults, is a heterogeneous group of diseases that are curable in about 30 percent of cases. Cytogenetic analysis assigns AML to different prognostic groups1; some subtypes, such as acute promyelocytic leukemia with a t(15;17) translocation (subtype M3 according to the French–American–British [FAB] classification), are amenable to specific therapies. However, no chromosomal abnormality is visible by conventional karyotyping in 40 to 50 percent of cases. Attempts to stratify such cases on the basis of microarrays of complementary DNA2,3 have succeeded in associating gene-expression patterns with differences in responses to treatment, but no specific genetic subgroups have emerged from these studies.
Nucleophosmin (NPM), a protein that shuttles between the nucleus and cytoplasm,4 is most prominent in nucleoli.5 NPM is a molecular chaperone6 that may prevent protein aggregation in the nucleolus and regulate the assembly and transport of preribosomal particles through the nuclear membrane.4 It is also a target of CDK2–cyclin E complexes in centrosome duplication7 and has been implicated in the regulation of the alternate-reading-frame protein (ARF)–p53 tumor-suppressor pathway.8-10
The NPM gene is a partner in the chromosomal translocations of leukemias and lymphomas that result in fusion proteins containing only the NPM N-terminal region11,12 — namely, NPM–anaplastic lymphoma kinase (NPM-ALK),13 NPM–retinoic acid receptor α (NPM-RARα),14 and NPM–myeloid leukemia factor 1 (NPM-MLF1).15 NPM appears to contribute to oncogenesis by activating the oncogenic potential of the fused protein partner (ALK, MLF1, or RARα).16 Since NPM is thought to have a tumor-suppressor function, perturbations in its movement from the nucleus to the cytoplasm may be critical for malignant transformation. Such changes in the subcellular distribution of NPM and NPM-containing fusion protein can be detected by immunohistochemical methods.12,17
In this study, we identified a large subgroup of patients with AML who had cytoplasmic NPM in leukemic blasts, a mutated NPM gene, a normal karyotype, and a relatively good response to induction chemotherapy.
Methods
Tumor Samples
Immunohistochemical studies were performed on 1835 paraffin-embedded tumor specimens from the following patients: 591 patients (15 to 60 years of age) with primary AML other than FAB subtype M3 who had been enrolled in Italy either in the Gruppo Italiano Malattie Ematologiche dell'Adulto (GIMEMA) Leucemia Acuta Mieloide Protocollo begun in 1999 (LAM99P) (316 patients), or in the GIMEMA/European Organization for Research and Treatment of Cancer (GIMEMA/EORTC) AML12 trials (275 patients) (details available from the National Auxiliary Publications Service [NAPS]); 129 patients with primary AML (including 70 with FAB subtype M3), and 135 with secondary AML who had not been participants in the GIMEMA study (details available from NAPS); and 980 with hematopoietic and extrahematopoietic neoplasms other than AML. Specimens from 25 patients with AML were investigated by immunohistochemistry, both at diagnosis and at remission.
After written informed consent had been obtained at each participating center, a bone marrow–biopsy specimen from each patient was fixed for 2.5 hours in B5, transferred to a 70 percent alcohol solution, and delivered to the Institute of Hematology at the University of Perugia, Perugia, Italy. The specimens were decalcified and processed for paraffin embedment.
Antibodies
Immunohistochemical studies were performed with the use of monoclonal antibodies against ALK and NPM,5,11,12 including two new anti-NPM monoclonal antibodies (clones 322 and 376) that produce strong staining in paraffin sections. Other monoclonal antibodies used were antinucleolin (anti-C23) (Santa Cruz Biotechnology), antiglycophorin, anti-CD34 (DakoCytomation), and anti-CD133 (Miltenyi Biotec).
Immunohistochemical Staining
Immunostaining was performed with use of the alkaline phosphatase monoclonal anti–alkaline phosphatase technique18 (details available from NAPS). The subcellular distribution of NPM (i.e., restriction to the nucleus or presence in the cytoplasm) was assessed without knowledge of the FAB subtype, cytogenetic features, or molecular findings. Cases were classified as either NPMc+ (positive for cytoplasmic NPM) or NPMc– (negative for cytoplasmic NPM). All sections were stained in parallel for nucleolin (C23), another nucleolar antigen, which in NPMc+ cases was required to be restricted to the nucleus.
Cytogenetic and Molecular Analyses
Cytogenetic investigations were performed after short-term culture. Karyotypes, analyzed after G-banding, were described according to the International System for Human Cytogenetic Nomenclature.19 Fluorescence in situ hybridization (FISH) investigations were carried out as previously described.20 The following analyses were also carried out as previously described: reverse-transcriptase–polymerase-chain-reaction (RT-PCR) analysis for promyelocytic leukemia (PML)–RARα, acute myelogenous leukemia 1–eight twenty-one (AML1-ETO), core binding factor B–myosin heavy chain 11 (CBFB-MYH11), breakpoint cluster region–v-Abl Abelson murine leukemia viral oncogene homologue 1 (BCR-ABL), and DEK–nucleoporin 214 kD (DEK-CAN); Southern blotting and FISH for rearrangements in the mixed-lineage leukemia gene (MLL); and mutational analysis of the Fms-like tyrosine kinase gene (FLT3) and MLL.21-24
Mutational Analysis of NPM
We investigated 161 specimens for NPM mutations: 52 specimens of NPMc+ AML, 56 of NPMc– AML, 9 of chronic myelogenous leukemia, and 44 of lymphoid neoplasms (Table 1Table 1
NPM Mutations in 161 Specimens of Myelogenous Leukemias and Lymphoid Neoplasms.). Specimens from five patients with NPMc+ AML were analyzed both at diagnosis and at remission.For the NPM coding-region analysis, 1 μg of RNA was retrotranscribed with use of the Thermoscript RT-PCR System (Invitrogen). Then cDNA sequences were amplified with primers NPM1_25F (5'GGTTGTTCTCTGGAGCAGCGTTC3') and NPM1_1112R (5'CCTGGACAACATTTATCAAACACGGTA3') with use of the Expand High-FidelityPLUS PCR System (Roche Applied Science). To amplify the sequence of NPM1 exon 12 from genomic DNA, two oligonucleotides were designed to anneal to the flanking intron sequences (NPM1-F [5'TTAACTCTCTGGTGGTAGAATGAA3'] and NPM1-R [5'CAAGACTATTTGCCATTCCTAAC3']). PCR products, purified by standard methods, were sequenced directly from both strands. Mutations were confirmed by assessing independent PCR products and, in representative cases, by cloning with pGEM-T Easy Vector Systems (Promega) and sequencing.
Expression Vectors and Transfection Assays
Antihuman NPM monoclonal antibodies also react with NPM from other species (including mouse). To track the localization of exogenous NPM, we generated plasmids expressing wild-type (pEGFPc1-NPMwt) or mutant (pEGFPc1-NPMmA) NPM alleles fused to the enhanced green fluorescent protein (EGFP). NPM cDNA sequences in an NPMc+ AML specimen from a patient carrying a heterozygous mutation in exon 12 were amplified with the use of primers NPM1_89F_BamHI (GCCACGGATCCGAAGATTCGATGGAC) and NPM1_ 1044R_EcoRI (ATCAAGAATTCCAGAAATGAAATAAGACG) and subcloned in frame into the pEGFPc1 vector (BD Biosciences Clontech). Sequencing analysis confirmed that there were no Taq-introduced errors in either plasmid.
NIH-3T3 cells were transiently transfected with pEGFPc1-NPMwt, pEGFPc1-NPMmA, and empty pEGFPc1 vector with the use of Lipofectamine 2000 reagents (Invitrogen). Transfection efficiency was monitored by Western blotting. Images were obtained with a confocal microscope (Bio-Rad MRC-1024), with the use of Imaris software for three-dimensional reconstruction.
Statistical Analysis
Chi-square analysis with two-way contingency tables was used to test the association between categorical variables. Statistical differences between means were analyzed by the t-test. A multivariate logistic model was used to analyze associations among the white-cell count at presentation, subcellular NPM localization, FLT3 mutations, and the response to induction therapy in 126 assessable patients with AML and a normal karyotype (79 NPMc+ and 47 NPMc–) who were treated according to the GIMEMA LAM99P protocol (induction, consolidation, and postconsolidation therapy [as described in Supplementary Appendix 1A, available with the full text of this article at www.nejm.org]). Analyses were performed with SAS software (version 8.2). Two-sided P values of less than 0.05 were considered to indicate statistical significance.
Results
Cytoplasmic Dislocation of NPM
Of the 591 specimens from patients with AML in the GIMEMA LAM99P and GIMEMA/EORTC AML12 trials, 208 (35.2 percent) were NPMc+ (Figure 1AFigure 1
Specific Association of Cytoplasmic Expression of Nucleophosmin with a Large Subgroup of AML. and Figure 1B). All the other tumors were NPMc– (Figure 1B). In NPMc+ leukemic cells, nucleolin (C23) remained restricted to the nucleus (Figure 1A). Cytoplasmic NPM was usually found in all leukemic cells, except in FAB subtype M5b (monocytic leukemia) specimens, where it was detected in 30 to 60 percent of the most immature cells of monocytic lineage (data not shown). NPMc– AML specimens contained only a few NPMc+ leukemic cells, usually tumor cells undergoing mitosis (Figure 1A).The NPMc+ pattern was found at diagnosis and in relapse in the 25 patients studied at those times. The NPMc+ pattern also was seen only in those with primary AML; specimens from the 135 patients with secondary AML contained NPM restricted exclusively to the nucleus (Figure 1B).
Features of NPMc+ AML
Morphology
The NPMc+ pattern was found in AML specimens of all FAB subtypes except M3 (acute promyelocytic leukemia), M4eo (acute myelomonocytic leukemia with eosinophilia), and M7 (acute megakaryocytic leukemia) (Figure 1C). The frequency of the finding ranged from 13.6 percent in M0 tumors (minimally differentiated AML) to 87.5 percent in M5b specimens (acute monocytic leukemia). Most NPMc+ AML tumors of the M5b and M6 subtypes (acute erythroid leukemia) and about 30 percent of NPMc+ tumors of the M1 (AML without maturation), M2 (AML with maturation), and M4 (acute myelomonocytic leukemia) subtypes showed cytoplasmic NPM in erythroid precursors, particularly proerythroblasts (Figure 1D), and less frequently in megakaryocytes (data not shown).
This multilineage distribution of the NPMc+ pattern prompted an investigation of CD34 and CD133 antigens, which occur on hematopoietic stem cells. Twelve of 159 NPMc+ AML specimens (7.5 percent) contained at least 20 percent CD34-positive cells, as compared with 227 of 317 NPMc– AML specimens (71.6 percent) (P<0.001) (Figure 2A through 2EFigure 2
Association between Cytoplasmic Expression of Nucleophosmin (NPM) and CD34 Negativity.). CD34-negative NPMc+ AML specimens also did not contain CD133 (Figure 2F).Karyotypes
Cytogenetic data were available for 493 of the 591 patients with AML (166 NPMc+ and 327 NPMc–). The karyotype was normal in 142 of the 166 patients with NPMc+ AML (85.5 percent), as compared with 88 of the 327 patients with NPMc– AML (26.9 percent) (P<0.001) (Figure 3AFigure 3
Association between Acute Myelogenous Leukemia (AML) with Cytoplasmic Expression of Nucleophosmin (NPM) and a Normal Karyotype.; details available from NAPS). Thus, 142 of the 230 AML specimens with a normal karyotype (61.7 percent) were NPMc+ (Figure 3B). Of the 24 specimens of NPMc+ AML with an abnormal karyotype, 12 had cells in normal and abnormal metaphase (details available from NAPS). No case of AML associated with specific genetic abnormalities was NPMc+ (Figure 3B, Figure 3C, and Figure 3D) (details available from NAPS).FLT3 Mutations
Internal tandem duplication of the FLT3 gene was detected in 59 of 219 patients with AML who had a normal karyotype (26.9 percent), and a mutation at aspartic acid residue 835 (D835) in FLT3 was detected in 13 of 202 such patients (6.4 percent). One patient carried both an internal tandem duplication and the D835 mutation. Internal tandem duplication of this gene was twice as frequent in cases of NPMc+ disease as it was in cases of NPMc– disease (P<0.003) (see Supplementary Appendix 1B). A multivariate logistic-regression model adjusted for age and cytogenetic features established an independent association between cytoplasmic NPM (the dependent variable) and internal tandem duplication in FLT3. No statistical association was found between D835 mutations in FLT3 and the subcellular localization of NPM, possibly because of the small number of cases involving a D835 mutation.
Response to Induction Therapy
Between 1999 and 2002, 539 patients with AML were enrolled in the GIMEMA LAM99P trial. All the patients received the same induction therapy (see Supplementary Appendix 1A). The association between the subcellular localization of NPM and the response to induction therapy was evaluated in 126 patients with a normal karyotype for whom NPM immunostaining and clinical information were available. There were 63 men and 63 women, the median age at diagnosis was 49 years (range, 19 to 60), and the median white-cell count at diagnosis was 28.4×103 per cubic millimeter (range, 0.6×103 to 400.0×103). The distribution of FAB subtypes was as follows: M0 (5 patients), M1 (23), M2 (42), M4 (25), M5 (28), and M6 (3). An FLT3 mutation was present in 45 patients (36 percent), and cytoplasmic NPM was present in 79 (63 percent).
The median ages of patients with NPMc+ and NPMc– tumors were 51.8 and 41.9 years, respectively (P<0.001). There were no significant differences between the two groups at presentation in terms of sex, white-cell count, FAB subtypes, FLT3 status, and clinical features.
Of the 126 patients, 90 (71 percent) had complete remission after induction therapy. In a univariate analysis, a lower white-cell count at presentation was associated with a higher rate of complete response (78 percent among patients with a white-cell count of 80×103 per cubic millimeter or below vs. 50 percent among those with a white-cell count above 80×103 per cubic millimeter) (P<0.003). There was no statistically significant difference in the rates of complete response between patients with NPMc+ tumors (77 percent) and those with NPMc– tumors (62 percent) (P=0.070). There was resistance to treatment in 9 percent of patients with NPMc+ tumors and in 23 percent of those with NPMc– tumors. Sex, age, FAB subtype, and FLT3 status were not associated with the rate of complete response.
A multivariate logistic-regression model that included the white-cell count, age, NPM localization (nuclear or cytoplasmic), and the presence or absence of an FLT3 mutation showed that a lower white-cell count and cytoplasmic expression of NPM are independent prognostic factors for a complete remission. A white-cell count above 80×103 per cubic millimeter was found to have a negative effect (P=0.006; odds ratio, 0.27 [95 percent confidence interval, 0.11 to 0.68]) and the NPMc+ pattern to have a positive effect (P=0.019; odds ratio, 2.98 [95 percent confidence interval, 1.2 to 7.43]) (Table 2Table 2
Logistic-Regression Analysis of the Effect of Prognostic Factors for a Response to Induction Therapy in 126 Patients with Acute Myelogenous Leukemia.).Mutations in NPM Exon 12 in NPMc+ AML
In none of the NPMc+ AML specimens was NPM-ALK,13 NPM-RARα,14 NPM-MLF1,15 or any other NPM-containing fusion protein found. Transcripts of the corresponding fusion genes were not found by FISH or RT-PCR, and FISH did not detect other NPM translocations. Western blotting showed only the expected 38-kD NPM polypeptide. The finding of cytoplasmic positivity with a monoclonal antibody directed against the NPM C-terminal (which is not retained in NPM fusion proteins)5 further supported the presence of full-length NPM in the cytoplasm of leukemic cells.
RT-PCR and direct sequencing of the NPM coding region revealed mutations affecting exon 12 in all but one case of NPMc+ disease (Table 1 and Supplementary Appendix 1C). Figure 4Figure 4
Mutations in Exon 12 of the Nucleophosmin (NPM) Gene and in the Encoded Protein. shows a schematic diagram of the NPM gene and summarizes the mutations. Six sequence variants were observed, all leading to a frame shift in the region encoding the C-terminal of the NPM protein. The most frequent mutation (which we have called mutation A) was a duplication of a TCTG tetranucleotide at positions 956 through 959 of the reference sequence (GenBank accession number NM_002520) (Figure 4B and Figure 4C); the resulting shift in the reading frame is predicted to alter the C-terminal portion of the NPM protein by replacing the last seven amino acids (WQWRKSL, where the amino acids are designated by their single-letter codes) with 11 different residues (CLAVEEVSLRK). Three additional mutations (called B, C, and D) included distinct 4-bp insertions at position 960, resulting in the same frame shift as mutation A. In the last two mutations (called E and F), nucleotides 965 through 969 (GGAGG) were deleted and two different 9-bp sequences were inserted, leading to the same frame shift and to a distinct C-terminal consisting of nine amino acids. All six NPM mutant proteins showed mutations in at least one of the tryptophan residues at positions 288 and 290 and shared the same last five amino acid residues (VSLRK) (Figure 4B). Thus, despite genetic heterogeneity, all NPM gene mutations result in a distinct sequence in the NPM protein C-terminal. The sequences of the six mutated NPM alleles have been deposited in the National Center for Biotechnology Information database (GenBank accession numbers AY740634 through AY740639).Mutations in exon 12 of NPM and their specific association with cases of NPMc+ AML were confirmed by sequence analysis of genomic DNA in 11 available specimens. The mutations were heterozygous and were related only to the malignant clone, since they were not present in bone marrow specimens from the five patients in complete remission. Mutations were observed in a wide variety of FAB categories of NPMc+ AML and even in cases with abnormal karyotypes or CD34 expression (Table 1 and Supplementary Appendix 1C). All NPMc– AML tumors and neoplasms other than AML had wild-type NPM sequences.
Transfection of Mutated NPM
To test whether mutations in NPM exon 12 caused cytoplasmic dislocation of NPM, NIH-3T3 cells were transiently transfected with expression vectors encoding wild-type and mutant alleles fused with EGFP. Confocal microscopy showed nucleolar localization of the EGFP–NPM wild-type protein. The mutant form of NPM was dislocated into the cytoplasm (Figure 4D and Supplementary Appendix 1D) — a finding that suggested that the genetic event correlated with the subcellular localization of NPM.
Discussion
We found that cytoplasmic NPM is the hallmark of a distinct type of AML that constitutes about one third of the cases of primary AML in adults (excluding FAB subtype M3). Patients with this type of AML have a normal karyotype, a mutant NPM gene, and a relatively good response to induction chemotherapy. Moreover, of the patients with AML who had a normal karyotype, cytoplasmic NPM was found in about 60 percent. Our findings are important because no chromosomal rearrangement is visible by standard karyotyping in 40 to 50 percent of cases of AML,1 and uncertainty clouds some of the biologic and clinical features in these patients.
Mutations in NPM exon 12 and the resulting shift of NPM into the cytoplasm are the most specific and frequent events we have found in AML with a normal karyotype. Mutations of the FLT3 25,26 and CEBPA 27 genes or MLL self-fusion28 also occurs in primary AML with a normal karyotype or recurrent genetic abnormalities23,29 and in secondary AML.30 The chromosomal abnormalities we found in about 14 percent of cases of NPMc+ AML are probably secondary, as indicated by the frequent occurrence of cells with an abnormal karyotype as subclones within the population with a normal karyotype and similarity with the type and incidence of secondary chromosomal changes in AML with recurrent genetic abnormalities.31
Internal tandem duplication of FLT3 was seen twice as often in cases of NPMc+ AML as it was in cases of NPMc– AML, suggesting that the FLT3 and NPM mutations are mechanistically linked. NPMc+ AML is CD34-negative, has a wide morphologic spectrum, and demonstrates multilineage involvement. These features might reflect derivation of this type of AML from the few lineage-marker–negative, CD34-negative, CD38-negative hematopoietic stem cells in bone marrow.32 Alternatively, CD34 might be down-regulated as result of the leukemic transformation.
Our transfection experiments established a causal relationship between NPM mutations and NPM cytoplasmic dislocation, in keeping with data from mutant rat NPM showing that the C-terminal region (in particular, the tryptophan residues at positions 286 and 288) is necessary for nucleolar localization of NPM.33 All predicted proteins encoded by the six variant mutations in our patients were altered in at least one of the critical tryptophan residues at positions 288 and 290.
NPMc+ AML might originate from a small, undetectable subset of pluripotent hematopoietic stem cells that normally harbor a mutated form of NPM. It is more likely, however, that mutation of NPM and cytoplasmic dislocation of NPM are primary leukemogenic events. The mutation might interfere with normal NPM functions — including stabilization of p53 in the nucleus when DNA is damaged9,10 and direct interaction with the tumor-suppressor gene ARF to regulate the cell cycle34 — by sequestering the protein in the cytoplasm. The mutation might also perturb other NPM functions that have been mapped within its C-terminal region, such as nucleic acid binding,35 ATP binding,36 and stimulation of DNA polymerase α activity.37
Our findings have several diagnostic and prognostic implications. Detection of cytoplasmic NPM by a sensitive, specific, simple, inexpensive, and rapid assay done on paraffin sections from bone marrow trephine specimens or marrow clots could be used to rule out recurrent chromosomal abnormalities. Cytoplasmic NPM also appears to be a reliable predictor of mutations in NPM exon 12 in AML with a normal karyotype.
The identification of the NPMc+ AML genetic subtype within the heterogeneous World Health Organization category of primary AML “not otherwise characterized”38 may have repercussions for AML classification. Cases of AML are currently assigned to prognostic groups according to cytogenetic and molecular findings.1,25,39 AML with a normal karyotype that cannot be classified by cytogenetic means (as in about 20 percent of the cases in this study) because of the lack of a specimen, deterioration of the specimen, or absence of mitoses could be assigned to the intermediate-risk category by detection of cytoplasmic NPM. Moreover, the association of cytoplasmic NPM with primary AML has prognostic significance, since secondary AMLs usually carry a poor prognosis.
Finally, cytoplasmic NPM is associated with responsiveness to induction therapy, although its role (alone or in combination with FLT3) in predicting the outcome of AML with a normal karyotype after remission remains to be defined. Immunohistochemistry plus mutational analysis of NPM may assist in the monitoring of minimal residual disease in a setting (normal karyotype and CD34 negativity) in which no molecular or immunophenotypic markers are available. Understanding the mechanisms leading to leukemogenesis in NPMc+ AML may lead to more specific antileukemia therapies.40
Supported by the Associazione Italiana per la Ricerca sul Cancro, the Associazione Italiana contro le Leucemie, and the Ministero Istruzione Università e Ricerca and by a Livia Benedetti grant (to Dr. Tiacci). Dr. Pasqualucci is a Special Fellow of the Leukemia and Lymphoma Society. Drs. Falini and Mecucci have applied for an Italian patent regarding clinical applications of nucleophosmin mutations.
NAPS See NAPS document no. PC0002 for 17 pages of supplementary material. To order, contact NAPS, c/o Burrows Systems, P.O. Box 3976, New Hyde Park, NY 11040.
Drs. Tiacci, Alcalay, and Rosati contributed equally to this article.
We are indebted to Marco Mancini, Antonio Cuneo, Nicoletta Testoni, and Giovanna Rege-Cambrin for conventional cytogenetic analyses; to Fabrizio Pane for molecular studies on recurrent translocations and FLT3 mutational status; to Paolo Gorello for help with the analysis of NPM mutations; to Vladan Miljkovic for assistance with DNA sequencing; to Alessia Tabarrini and Federica Frenguelli for histologic and immunohistological studies; to Francesca Paoloni, Simona Iacobelli, and Stefano Ricci for statistical contributions; to Marco Fizzotti, Pier-Luigi Orvietani, and Barbara Verducci for Western blotting studies; to Ildo Nicoletti for the confocal microscopical analysis; and to Claudia Tibidò for assistance in the preparation of the manuscript. This article is dedicated to the memory of Carlo Falini.
Source Information
From the Institute of Hematology (B.F., C.M., E.T., R.R., L.P., R.L.S., A.S., B.B., R.P., A.P., M.F.M.) and the Department of Biochemistry and Molecular Biotechnology (V.P.), University of Perugia, Perugia, Italy; the European Institute of Oncology, Milan, Italy (M.A., E.C., N.M., P.-G.P.); the Institute for Cancer Genetics, Columbia University, New York (L.P.); the Institute of Hematology, University La Sapienza, Rome (D.D., F.M.); the Institute of Hematology, University of Foggia, Foggia, Italy (A.L.); the Gruppo Italiano Malattie Ematologiche dell'Adulto (GIMEMA) Data Center, Rome (M.V., P.F.); the Division of Internal Medicine and Hematology, Ospedale S. Luigi, Orbassano-Turin, Italy (G.S.); and the Department of Biopathology, University of Tor Vergata, Rome (F.L.-C.).
Address reprint requests to Dr. Falini at the Institute of Hematology, Policlinico Monteluce, 06122 Perugia, Italy, or at faliniem@unipg.it.
The centers and investigators participating in the GIMEMA Study are listed in the Appendix.
Appendix
The centers and investigators contributing to the GIMEMA Study were as follows (listed in order of the number of cases provided): Istituto di Ematologia, Università La Sapienza, Rome (G. Meloni); Divisione di Ematologia, Ospedale V. Cervello, Palermo (F. Fabbiano); Cattedra di Ematologia, Bari (V. Liso); Divisione di Ematologia, Azienda USL di Pescara, Pescara (M. Sborgia); Ospedale Ferrarotto S. Bambino, Catania (F. Di Raimondo); Divisione di Ematologia, Ospedale S. Eugenio, Rome (A. Venditti); Divisione di Ematologia e Oncologia Clinica, Catanzaro (D. Magro); Dipartimento di Emato-Oncologia, Azienda Ospedaliera Bianchi-Melacrino-Morelli, Reggio Calabria (F. Nobile); Istituto di Ematologia, Università Federico II, Naples (B. Rotoli); Azienda Ospedaliera S.G. Moscati, Avellino (N. Cantore); Divisione di Ematologia, Ospedale Casa Sollievo della Sofferenza, S. Giovanni Rotondo (L. Melillo); Istituto di Ematologia, Ospedale A. Businco, Cagliari (E. Angelucci); Istituto di Ematologia, Policlinico Monteluce, Perugia (A. Tabilio); Cattedra di Ematologia, Ospedale S. Chiara, Pisa (M. Petrini); Policlinico Gemelli, Rome (S. Sica); Università di Ancona, Ancona (P. Leoni); Sezione di Medicina Interna, Oncologia ed Ematologia, Dipartimento Scienze Mediche, Oncologiche e Radiologiche, Modena (G. Torelli); Divisione di Ematologia, Ospedale SS. Antonio e Biagio, Alessandria (A. Levis); Divisione di Ematologia, Fondazione Centro S. Raffaele del Monte Tabor, Milan (L. Camba); Divisione di Ematologia, Ospedale S. Carlo, Potenza (F. Ricciuti); Divisione di Ematologia, Ospedale S. Giovanni Bosco, Naples (E. Miraglia); Azienda Ospedaliera A. Di Summa, Brindisi (G. Quarta); Divisione di Ematologia, Ospedale S. Francesco, Nuoro (A. Gabbas); Divisione di Ematologia con Trapianto Midollo Osseo, Università di Palermo, Palermo (M.E. Mitra); Cattedra di Ematologia–Centro Trapianto Midollo Osseo, Università di Parma, Parma (V. Rizzoli); Divisione Ematologica di Muraglia, Ospedale S. Salvatore, Pesaro (G. Sparaventi); Divisione di Ematologia, Azienda Ospedaliera Cremona, Cremona (S. Moranti); Divisione di Ematologia, Ospedale S. Croce, Cuneo (A. Gallamini); Divisione di Medicina Interna, Ospedale S. Luigi, Orbassano (A. Serra); Sezione Ematologia, Dipartimento Scienze Biomediche, Arcispedale S. Anna, Ferrara (P.-L. Castaldi); Divisione di Ematologia, Università di Sassari, Sassari (F. Dore); Divisione di Medicina, Azienda Ospedaliera E. Morelli, Sondalo (E. Epis); Divisione Medicina 1, Ospedale S. Antonio Abate, Gallarate (R. Mozzana); Divisione Medica, Ospedale Maggiore, Lodi (G. Nalli); Azienda Sanitaria Locale Salerno 1, Medicina Interna, Ematologia–Oncologia, Nocera Inferiore (A.M. D'Arco); Divisione di Ematologia, Policlinico Careggi, Florence (P.-L. Rossi Ferrini); Unità Operativa Ematologia, Ospedale di Foggia, Foggia (M. Monaco); Divisione di Ematologia, Ospedale di Messina, Messina (M. Brugiatelli); and S. Vincenzo, Ospedale di Taormina, Divisione di Ematologia, Taormina (M. Russo) — all in Italy.
- References
References
1
Grimwade D ,Walker H ,Oliver F , et al. The importance of diagnostic cytogenetics on outcome in AML: analysis of 1,612 patients entered into the MRC AML 10 trial. Blood 1998;92:2322-2333
Web of Science | Medline2
Bullinger L ,Dohner K ,Bair E , et al. Use of gene-expression profiling to identify prognostic subclasses in adult acute myeloid leukemia. N Engl J Med 2004;350:1605-1616
Full Text | Web of Science | Medline3
Valk PJ ,Verhaak RG ,Beijen MA , et al. Prognostically useful gene-expression profiles in acute myeloid leukemia. N Engl J Med 2004;350:1617-1628
Full Text | Web of Science | Medline4
Borer RA ,Lehner CF ,Eppenberger HM ,Nigg EA . Major nucleolar proteins shuttle between nucleus and cytoplasm. Cell 1989;56:379-390
CrossRef | Web of Science | Medline5
Cordell JL ,Pulford KA ,Bigerna B , et al. Detection of normal and chimeric nucleophosmin in human cells. Blood 1999;93:632-642
Web of Science | Medline6
Dumbar TS ,Gentry GA ,Olson MO . Interaction of nucleolar phosphoprotein B23 with nucleic acids. Biochemistry 1989;28:9495-9501
CrossRef | Web of Science | Medline7
Okuda M ,Horn HF ,Tarapore P , et al. Nucleophosmin/B23 is a target of CDK2/cyclin E in centrosome duplication. Cell 2000;103:127-140
CrossRef | Web of Science | Medline8
Bertwistle D ,Sugimoto M ,Sherr CJ . Physical and functional interactions of the Arf tumor suppressor protein with nucleophosmin/B23. Mol Cell Biol 2004;24:985-996
CrossRef | Web of Science | Medline9
Colombo E ,Marine JC ,Danovi D ,Falini B ,Pelicci PG . Nucleophosmin regulates the stability and transcriptional activity of p53. Nat Cell Biol 2002;4:529-533
CrossRef | Web of Science | Medline10
Kurki S ,Peltonen K ,Latonen L , et al. Nucleolar protein NPM interacts with HDM2 and protects tumor suppressor protein p53 from HDM2-mediated degradation. Cancer Cell 2004;5:465-475
CrossRef | Web of Science | Medline11
Falini B ,Pileri S ,Zinzani PL , et al. ALK+ lymphoma: clinico-pathological findings and outcome. Blood 1999;93:2697-2706
Web of Science | Medline12
Falini B ,Mason DY . Proteins encoded by genes involved in chromosomal alterations in lymphoma and leukemia: clinical value of their detection by immunocytochemistry. Blood 2002;99:409-426
CrossRef | Web of Science | Medline13
Morris SW ,Kirstein MN ,Valentine MB , et al. Fusion of a kinase gene, ALK, to a nucleolar protein gene, NPM, in non-Hodgkin's lymphoma. Science 1994;263:1281-1284[Erratum, Science 1995;267:316-7.]
CrossRef | Web of Science | Medline14
Redner RL ,Rush EA ,Faas S ,Rudert WA ,Corey SJ . The t(5;17) variant of acute promyelocytic leukemia expresses a nucleophosmin-retinoic acid receptor fusion. Blood 1996;87:882-886
Web of Science | Medline15
Yoneda-Kato N ,Look AT ,Kirstein MN , et al. The t(3;5)(q25.1;q34) of myelodysplastic syndrome and acute myeloid leukemia produces a novel fusion gene, NPM-MLF1. Oncogene 1996;12:265-275
Web of Science | Medline16
Bischof D ,Pulford K ,Mason DY ,Morris SW . Role of the nucleophosmin (NPM) portion of the non-Hodgkin's lymphoma-associated NPM-anaplastic lymphoma kinase fusion protein in oncogenesis. Mol Cell Biol 1997;17:2312-2325
Web of Science | Medline17
Falini B ,Pulford K ,Pucciarini A , et al. Lymphomas expressing ALK fusion protein(s) other than NPM-ALK. Blood 1999;94:3509-3515
Web of Science | Medline18
Cordell JL ,Falini B ,Erber WN , et al. Immunoenzymatic labeling of monoclonal antibodies using immune complexes of alkaline phosphatase and monoclonal anti-alkaline phosphatase (APAAP complexes). J Histochem Cytochem 1984;32:219-229
CrossRef | Web of Science | Medline19
Mitelman F. ISCN 1995: an international system for human cytogenetic nomenclature. Basel, Switzerland: Karger, 1995.
20
Crescenzi B ,Fizzotti M ,Piattoni S , et al. Interphase FISH for Y chromosome, VNTR polymorphisms, and RT-PCR for BCR-ABL in the monitoring of HLA-matched and mismatched transplants. Cancer Genet Cytogenet 2000;120:25-29
CrossRef | Web of Science | Medline21
van Dongen JJ ,Macintyre EA ,Gabert JA , et al. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease: report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia 1999;13:1901-1928
CrossRef | Web of Science | Medline22
Soekarman D ,von Lindern M ,Daenen S , et al. The translocation (6;9)(p23;q34) shows consistent rearrangement of two genes and defines a myeloproliferative disorder with specific clinical features. Blood 1992;79:2990-2997
Web of Science | Medline23
Noguera NI ,Breccia M ,Divona M , et al. Alterations of the FLT3 gene in acute promyelocytic leukemia: association with diagnostic characteristics and analysis of clinical outcome in patients treated with the Italian AIDA protocol. Leukemia 2002;16:2185-2189
CrossRef | Web of Science | Medline24
Cimino G ,Rapanotti MC ,Elia L , et al. ALL-1 gene rearrangements in acute myeloid leukemia: association with M4-M5 French-American-British classification subtypes and young age. Cancer Res 1995;55:1625-1628
Web of Science | Medline25
Schnittger S ,Schoch C ,Dugas M , et al. Analysis of FLT3 length mutations in 1003 patients with acute myeloid leukemia: correlation to cytogenetics, FAB subtype, and prognosis in the AMLCG study and usefulness as a marker for the detection of minimal residual disease. Blood 2002;100:59-66
CrossRef | Web of Science | Medline26
Frohling S ,Schlenk RF ,Breitruck J , et al. Prognostic significance of activating FLT3 mutations in younger adults (16 to 60 years) with acute myeloid leukemia and normal cytogenetics: a study of the AML Study Group Ulm. Blood 2002;100:4372-4380
CrossRef | Web of Science | Medline27
Pabst T ,Mueller BU ,Zhang P , et al. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat Genet 2001;27:263-270
CrossRef | Web of Science | Medline28
Steudel C ,Wermke M ,Schaich M , et al. Comparative analysis of MLL partial tandem duplication and FLT3 internal tandem duplication mutations in 956 adult patients with acute myeloid leukemia. Genes Chromosomes Cancer 2003;37:237-251
CrossRef | Web of Science | Medline29
Carnicer MJ ,Nomdedeu JF ,Lasa A , et al. FLT3 mutations are associated with other molecular lesions in AML. Leuk Res 2004;28:19-23
CrossRef | Web of Science | Medline30
Christiansen DH ,Pedersen-Bjergaard J . Internal tandem duplications of the FLT3 and MLL genes are mainly observed in atypical cases of therapy-related acute myeloid leukemia with a normal karyotype and are unrelated to type of previous therapy. Leukemia 2001;15:1848-1851
CrossRef | Web of Science | Medline31
Slovak ML ,Kopecky KJ ,Cassileth PA , et al. Karyotypic analysis predicts outcome of preremission and postremission therapy in adult acute myeloid leukemia: a Southwest Oncology Group/Eastern Cooperative Oncology Group Study. Blood 2000;96:4075-4083
Web of Science | Medline32
Goodell MA ,Rosenzweig M ,Kim H , et al. Dye efflux studies suggest that hematopoietic stem cells expressing low or undetectable levels of CD34 antigen exist in multiple species. Nat Med 1997;3:1337-1345
CrossRef | Web of Science | Medline33
Nishimura Y ,Ohkubo T ,Furuichi Y ,Umekawa H . Tryptophans 286 and 288 in the C-terminal region of protein B23.1 are important for its nucleolar localization. Biosci Biotechnol Biochem 2002;66:2239-2242
CrossRef | Web of Science | Medline34
Brady SN ,Yu Y ,Maggi LB Jr ,Weber JD . ARF impedes NPM/B23 shuttling in an Mdm2-sensitive tumor suppressor pathway. Mol Cell Biol 2004;24:9327-9338
CrossRef | Web of Science | Medline35
Hingorani K ,Szebeni A ,Olson MO . Mapping the functional domains of nucleolar protein B23. J Biol Chem 2000;275:24451-24457
CrossRef | Web of Science | Medline36
Chang JH ,Lin JY ,Wu MH ,Yung BY . Evidence for the ability of nucleophosmin/B23 to bind ATP. Biochem J 1998;329:539-544
Web of Science | Medline37
Umekawa H ,Sato K ,Takemura M , et al. The carboxyl terminal sequence of nucleolar protein B23.1 is important in its DNA polymerase alpha-stimulatory activity. J Biochem (Tokyo) 2001;130:199-205
Web of Science | Medline38
Jaffe ES, Harris NL, Stein H, Vardiman JW, eds. Pathology and genetics of tumours of haematopoietic and lymphoid tissues. Lyon, France: IARC Press, 2001.
39
Byrd JC ,Mrozek K ,Dodge RK , et al. Pretreatment cytogenetic abnormalities are predictive of induction success, cumulative incidence of relapse, and overall survival in adult patients with de novo acute myeloid leukemia: results from Cancer and Leukemia Group B (CALGB 8461). Blood 2002;100:4325-4336
CrossRef | Web of Science | Medline40
Kau TR ,Way JC ,Silver PA . Nuclear transport and cancer: from mechanism to intervention. Nat Rev Cancer 2004;4:106-117
CrossRef | Web of Science | Medline
- Citing Articles (373)
Citing Articles
1
Courtney D. DiNardo, Selina M. Luger. (2012) Beyond morphology. Current Opinion in Hematology 19:2, 82-88
CrossRef2
H. Nahi, M. Remberger, M. Machaczka, J. Ungerstedt, J. Mattson, O. Ringden, Katarina Le-Blanc, P. Ljungman, H. Hägglund. (2012) Different impact of intermediate and unfavourable cytogenetics at the time of diagnosis on outcome of de novo AML after allo-SCT: a long-term retrospective analysis from a single institution. Medical Oncology
CrossRef3
Li Ding, Timothy J. Ley, David E. Larson, Christopher A. Miller, Daniel C. Koboldt, John S. Welch, Julie K. Ritchey, Margaret A. Young, Tamara Lamprecht, Michael D. McLellan, Joshua F. McMichael, John W. Wallis, Charles Lu, Dong Shen, Christopher C. Harris, David J. Dooling, Robert S. Fulton, Lucinda L. Fulton, Ken Chen, Heather Schmidt, Joelle Kalicki-Veizer, Vincent J. Magrini, Lisa Cook, Sean D. McGrath, Tammi L. Vickery, Michael C. Wendl, Sharon Heath, Mark A. Watson, Daniel C. Link, Michael H. Tomasson, William D. Shannon, Jacqueline E. Payton, Shashikant Kulkarni, Peter Westervelt, Matthew J. Walter, Timothy A. Graubert, Elaine R. Mardis, Richard K. Wilson, John F. DiPersio. (2012) Clonal evolution in relapsed acute myeloid leukaemia revealed by whole-genome sequencing. Nature
CrossRef4
Borae G. Park, Hyun-Sook Chi, Seo-Jin Park, Sook Kyoung Min, Seongsoo Jang, Chan-Jeoung Park, Dae-Young Kim, Jung-Hee Lee, Je-Hwan Lee, Kyoo-Hyung Lee. (2012) Clinical Implications of Non-A-Type NPM1 and FLT3 Mutations in Patients with Normal Karyotype Acute Myeloid Leukemia. Acta Haematologica 127:2, 63-71
CrossRef5
J. M. KLCO, J. S. WELCH, T. T. NGUYEN, M. Y. HURLEY, F. H. KREISEL, A. HASSAN, A. C. LIND, J. L. FRATER. (2011) State of the art in myeloid sarcoma. International Journal of Laboratory Hematology 33:6, 555-565
CrossRef6
David Grimwade, Krzysztof Mrózek. (2011) Diagnostic and Prognostic Value of Cytogenetics in Acute Myeloid Leukemia. Hematology/Oncology Clinics of North America 25:6, 1135-1161
CrossRef7
Chezi Ganzel, Jacob M. Rowe. (2011) Prognostic Factors in Adult Acute Leukemia. Hematology/Oncology Clinics of North America 25:6, 1163-1187
CrossRef8
N. Colovic, D. Tomin, A. Vidovic, N. Suvajdzic, G. Jankovic, V. Palibrk, I. Djunic, V. Djurasinovic, M. Virijevic. (2011) Pretreatment prognostic factors for overall survival in primary resistant acute myeloid leukemia. Biomedicine & Pharmacotherapy
CrossRef9
H-A Hou, Y-Y Kuo, C-Y Liu, M C Lee, J-L Tang, C-Y Chen, W-C Chou, C-F Huang, F-Y Lee, M-C Liu, M Yao, H-F Tien. (2011) Distinct association between aberrant methylation of Wnt inhibitors and genetic alterations in acute myeloid leukaemia. British Journal of Cancer
CrossRef10
H.-A. Hou, Y.-Y. Kuo, C.-Y. Liu, W.-C. Chou, M. C. Lee, C.-Y. Chen, L.-I. Lin, M.-H. Tseng, C.-F. Huang, Y.-C. Chiang, F.-Y. Lee, M.-C. Liu, C.-W. Liu, J.-L. Tang, M. Yao, S.-Y. Huang, B.-S. Ko, S.-C. Hsu, S.-J. Wu, W. Tsay, Y.-C. Chen, H.-F. Tien. (2011) DNMT3A mutations in acute myeloid leukemia-stability during disease evolution and the clinical implication. Blood
CrossRef11
Thomas Kristensen, Michael B. Møller, Lone Friis, Olav J. Bergmann, Birgitte Preiss. (2011) NPM1 mutation is a stable marker for minimal residual disease monitoring in acute myeloid leukaemia patients with increased sensitivity compared to WT1 expression*. European Journal of Haematology 87:5, 400-408
CrossRef12
Elizabeth Hyjek, James W. Vardiman. (2011) Myelodysplastic/myeloproliferative neoplasms. Seminars in Diagnostic Pathology 28:4, 283-297
CrossRef13
Alida Dominietto. (2011) Minimal residual disease markers before and after allogeneic hematopoietic stem cell transplantation in acute myeloid leukemia. Current Opinion in Hematology 18:6, 381-387
CrossRef14
Brunangelo Falini, Ilaria Gionfriddo, Federica Cecchetti, Stelvio Ballanti, Valentina Pettirossi, Maria Paola Martelli. (2011) Acute myeloid leukemia with mutated nucleophosmin (NPM1): Any hope for a targeted therapy?. Blood Reviews 25:6, 247-254
CrossRef15
Kathryn A. Kolquist, Roger A. Schultz, Aubry Furrow, Theresa C. Brown, Jin-Yeong Han, Lynda J. Campbell, Meaghan Wall, Marilyn L. Slovak, Lisa G. Shaffer, Blake C. Ballif. (2011) Microarray-based comparative genomic hybridization of cancer targets reveals novel, recurrent genetic aberrations in the myelodysplastic syndromes. Cancer Genetics 204:11, 603-628
CrossRef16
Chun Qiao, Run Zhang, Ming Hong, Li Wang, Jian-Fu Zhang, Yu-Jie Wu, Hai-Rong Qiu, Hong-Xia Qiu, Si-Xuan Qian, Hua Lu, Su-Jiang Zhang, Jian-Yong Li. (2011) Heterogeneous leukemic clones identified by NPM1 mutation analysis in patient with acute monocytic leukemia. Leukemia & Lymphoma1-11
CrossRef17
F. Buccisano, L. Maurillo, M. I. Del Principe, G. Del Poeta, G. Sconocchia, F. Lo-Coco, W. Arcese, S. Amadori, A. Venditti. (2011) Prognostic and therapeutic implications of minimal residual disease detection in acute myeloid leukemia. Blood
CrossRef18
L. Guery, N. Benikhlef, T. Gautier, C. Paul, G. Jego, E. Dufour, A. Jacquel, R. Cally, B. Manoury, T. Vanden Berghe, P. Vandenabeele, N. Droin, E. Solary. (2011) Fine-tuning nucleophosmin in macrophage differentiation and activation. Blood 118:17, 4694-4704
CrossRef19
C. K. Cheng, L. Li, S. H. Cheng, K. Ng, N. P. H. Chan, R. K. L. Ip, R. S. M. Wong, M. M. K. Shing, C. K. Li, M. H. L. Ng. (2011) Secreted-frizzled related protein 1 is a transcriptional repression target of the t(8;21) fusion protein in acute myeloid leukemia. Blood
CrossRef20
V. Grossmann, E. Tiacci, A. B. Holmes, A. Kohlmann, M. P. Martelli, W. Kern, A. Spanhol-Rosseto, H.-U. Klein, M. Dugas, S. Schindela, V. Trifonov, S. Schnittger, C. Haferlach, R. Bassan, V. A. Wells, O. Spinelli, J. Chan, R. Rossi, S. Baldoni, L. De Carolis, K. Goetze, H. Serve, R. Peceny, K.-A. Kreuzer, D. Oruzio, G. Specchia, F. Di Raimondo, F. Fabbiano, M. Sborgia, A. Liso, L. Farinelli, A. Rambaldi, L. Pasqualucci, R. Rabadan, T. Haferlach, B. Falini. (2011) Whole-exome sequencing identifies mutations of BCOR in acute myeloid leukemia with normal karyotype. Blood
CrossRef21
C M Woolthuis, L Han, R N Verkaik-Schakel, D van Gosliga, P M Kluin, E Vellenga, J J Schuringa, G Huls. (2011) Downregulation of MEIS1 impairs long-term expansion of CD34+ NPM1-mutated acute myeloid leukemia cells. Leukemia
CrossRef22
W.-C. Chou, S.-C. Chou, C.-Y. Liu, C.-Y. Chen, H.-A. Hou, Y.-Y. Kuo, M.-C. Lee, B.-S. Ko, J.-L. Tang, M. Yao, W. Tsay, S.-J. Wu, S.-Y. Huang, S.-C. Hsu, Y.-C. Chen, Y.-C. Chang, Y.-Y. Kuo, K.-T. Kuo, F.-Y. Lee, M.-C. Liu, C.-W. Liu, M.-H. Tseng, C.-F. Huang, H.-F. Tien. (2011) TET2 mutation is an unfavorable prognostic factor in acute myeloid leukemia patients with intermediate-risk cytogenetics. Blood 118:14, 3803-3810
CrossRef23
A. Staffas, M. Kanduri, R. Hovland, R. Rosenquist, H. B. Ommen, J. Abrahamsson, E. Forestier, K. Jahnukainen, O. G. Jonsson, B. Zeller, J. Palle, G. Lonnerholm, H. Hasle, L. Palmqvist, H. Ehrencrona. (2011) Presence of FLT3-ITD and high BAALC expression are independent prognostic markers in childhood acute myeloid leukemia. Blood
CrossRef24
Kristin M. Keck, Lucy F. Pemberton. (2011) Histone chaperones link histone nuclear import and chromatin assembly. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms
CrossRef25
Fabio Forghieri, Monica Morselli, Leonardo Potenza, Monica Maccaferri, Letizia Pedrazzi, Valeria Coluccio, Patrizia Barozzi, Daniela Vallerini, Giovanni Riva, Eleonora Zanetti, Chiara Quarelli, Goretta Bonacorsi, Tullio Artusi, Piera Zaldini, Patrizia Zucchini, Roberto Marasca, Franco Narni, Brunangelo Falini, Giuseppe Torelli, Mario Luppi. (2011) A case of JAK2 V617F-positive myelodysplastic/myeloproliferative neoplasm with unusual morphology, resembling acute promyelocytic leukemia-like disorder with a chronic course. Leukemia & Lymphoma 52:10, 2012-2019
CrossRef26
Andrea Pellagatti, Mario Cazzola, Aristoteles Giagounidis, Janet Perry, Luca Malcovati, Matteo G. Della Porta, Martin Jädersten, Sally Killick, Paresh Vyas, Eva Hellström-Lindberg, James S. Wainscoat, Jacqueline Boultwood. (2011) Marked down-regulation of nucleophosmin-1 is associated with advanced del(5q) myelodysplastic syndrome. British Journal of Haematology 155:2, 272-274
CrossRef27
Steven Knapper. (2011) The clinical development of FLT3 inhibitors in acute myeloid leukemia. Expert Opinion on Investigational Drugs 20:10, 1377-1395
CrossRef28
Dmitriy Ovcharenko, Friedrich Stölzel, David Poitz, Fernando Fierro, Markus Schaich, Andreas Neubauer, Kevin Kelnar, Timothy Davison, Carsten Müller-Tidow, Christian Thiede, Martin Bornhäuser, Gerhard Ehninger, David Brown, Thomas Illmer. (2011) miR-10a overexpression is associated with NPM1 mutations and MDM4 downregulation in intermediate-risk acute myeloid leukemia. Experimental Hematology 39:10, 1030-1042.e7
CrossRef29
I. H. I. M. Hollink, M. M. van den Heuvel-Eibrink, S. T. C. J. M. Arentsen-Peters, M. Pratcorona, S. Abbas, J. E. Kuipers, J. F. van Galen, H. B. Beverloo, E. Sonneveld, G.-J. J. L. Kaspers, J. Trka, A. Baruchel, M. Zimmermann, U. Creutzig, D. Reinhardt, R. Pieters, P. J. M. Valk, C. M. Zwaan. (2011) NUP98/NSD1 characterizes a novel poor prognostic group in acute myeloid leukemia with a distinct HOX gene expression pattern. Blood 118:13, 3645-3656
CrossRef30
B. Falini, M. P. Martelli. (2011) NPM1-mutated AML: targeting by disassembling. Blood 118:11, 2936-2938
CrossRef31
E Tiacci, A Spanhol-Rosseto, M P Martelli, L Pasqualucci, H Quentmeier, V Grossmann, H G Drexler, B Falini. (2011) The NPM1 wild-type OCI-AML2 and the NPM1-mutated OCI-AML3 cell lines carry DNMT3A mutations. Leukemia
CrossRef32
Tomohiko Ohta, Ko Sato, Wenwen Wu. (2011) The BRCA1 ubiquitin ligase and homologous recombination repair. FEBS Letters 585:18, 2836-2844
CrossRef33
Amani H. Kazem, Irene L. Mikhael, Amal M. Ghanem. (2011) Cytoplasmic nucleophosmin (cNPM) in acute myeloid leukaemia: Relation to disease characteristics. Alexandria Journal of Medicine 47:3, 225-235
CrossRef34
N Ånensen, S M Hjelle, W Van Belle, I Haaland, E Silden, J-C Bourdon, R Hovland, K Taskén, S Knappskog, P E Lønning, Ø Bruserud, B T Gjertsen. (2011) Correlation analysis of p53 protein isoforms with NPM1/FLT3 mutations and therapy response in acute myeloid leukemia. Oncogene
CrossRef35
Naveen Pemmaraju, Hagop Kantarjian, Farhad Ravandi, Jorge Cortes. (2011) FLT3 inhibitors in the treatment of acute myeloid leukemia. Cancer 117:15, 3293-3304
CrossRef36
S Schnittger, U Bacher, W Kern, T Alpermann, C Haferlach, T Haferlach. (2011) Prognostic impact of FLT3-ITD load in NPM1 mutated acute myeloid leukemia. Leukemia 25:8, 1297-1304
CrossRef37
Fareed H Barakat, Rajyalakshmi Luthra, C. Cameron Yin, Bedia A Barkoh, Seema Hai, Waqar Jamil, Yaminiben I Bhakta, Su Chen, L. Jeffrey Medeiros, Zhuang Zuo. (2011) Detection of Nucleophosmin 1 Mutations by Quantitative Real-Time Polymerase Chain Reaction Versus Capillary Electrophoresis: A Comparative Study. Archives of Pathology & Laboratory Medicine 135:8, 994-1000
CrossRef38
Luis Villela, Javier Bolaños-Meade. (2011) Acute Myeloid Leukaemia. Drugs 71:12, 1537-1550
CrossRef39
Angela Ferrari, Elena Bussaglia, Josep Úbeda, Luca Facchini, Anna Aventin, Jorge Sierra, Josep F. Nomdedéu. (2011) Immunophenotype distinction between acute promyelocytic leukaemia and CD15− CD34− HLA-DR− acute myeloid leukaemia with nucleophosmin mutations. Hematological Oncologyn/a-n/a
CrossRef40
Phoenix A. Ho, Matthew A. Kutny, Todd A. Alonzo, Robert B. Gerbing, Jason Joaquin, Susana C. Raimondi, Alan S. Gamis, Soheil Meshinchi. (2011) Leukemic mutations in the methylation-associated genes DNMT3A and IDH2 are rare events in pediatric AML: A report from the Children's Oncology Group. Pediatric Blood & Cancer 57:2, 204-209
CrossRef41
Jianda Hu, Minhui Lin, Tingbo Liu, Jing Li, Buyuan Chen, Yingyu Chen. (2011) DIGE-based proteomic analysis identifies nucleophosmin/B23 and nucleolin C23 as over-expressed proteins in relapsed/refractory acute leukemia. Leukemia Research 35:8, 1087-1092
CrossRef42
V. Rockova, S. Abbas, B. J. Wouters, C. A. J. Erpelinck, H. B. Beverloo, R. Delwel, W. L. J. van Putten, B. Lowenberg, P. J. M. Valk. (2011) Risk stratification of intermediate-risk acute myeloid leukemia: integrative analysis of a multitude of gene mutation and gene expression markers. Blood 118:4, 1069-1076
CrossRef43
A M Gruszka, C Martinelli, E Sparacio, P G Pelicci, A de Marco. (2011) The concurrent use of N- and C-terminal antibodies anti-nucleophosmin 1 in immunofluorescence experiments allows for precise assessment of its subcellular localisation in acute myeloid leukaemia patients. Leukemia
CrossRef44
2011. Diseases. , 160-300.
CrossRef45
H J M de Jonge, C M Woolthuis, A Z Vos, A Mulder, E van den Berg, P M Kluin, K van der Weide, E S J M de Bont, G Huls, E Vellenga, J J Schuringa. (2011) Gene expression profiling in the leukemic stem cell-enriched CD34+ fraction identifies target genes that predict prognosis in normal karyotype AML. Leukemia
CrossRef46
Michele Malagola, Cristina Skert, Marco Vignetti, Alfonso Piciocchi, Giovanni Martinelli, Giuliana Alimena, Cristina Mecucci, Nicoletta Testoni, Ilaria Iacobucci, Marino Clavio, Marco Gobbi, Anna Candoni, Daniela Damiani, Monica Bocchia, Francesco Lauria, Alfonso Zaccaria, Patrizio Mazza, Giuseppe Visani, Annalisa Peli, Chiara Colombi, Valeria Cancelli, Marco Mancini, Robin Foà, Massimo Martelli, Nicola Cantore, Francesco Di Raimondo, Mario Petrini, Paolo de Fabritiis, Giuseppe Fioritoni, Francesco Nobile, Francesco Fabbiano, Giorgina Specchia, Michele Baccarani, Francesco Lo Coco, Sergio Amadori, Franco Mandelli, Domenico Russo. (2011) A simple prognostic scoring system for newly diagnosed cytogenetically normal acute myeloid leukemia: retrospective analysis of 530 patients. Leukemia & Lymphoma1-7
CrossRef47
Friederike Schneider, Eva Hoster, Stephanie Schneider, Annika Dufour, Tobias Benthaus, Purvi M. Kakadia, Stefan K. Bohlander, Jan Braess, Achim Heinecke, Maria C. Sauerland, Wolfgang E. Berdel, Thomas Buechner, Bernhard J. Woermann, Michaela Feuring-Buske, Christian Buske, Ursula Creutzig, Christian Thiede, Michel C. Zwaan, Marry M. Heuvel-Eibrink, Dirk Reinhardt, Wolfgang Hiddemann, Karsten Spiekermann. (2011) Age-dependent frequencies of NPM1 mutations and FLT3-ITD in patients with normal karyotype AML (NK-AML). Annals of Hematology
CrossRef48
John F. DiPersio, Anthony D. Ho, Jessie Hanrahan, Frank J. Hsu, Stefan Fruehauf. (2011) Relevance and Clinical Implications of Tumor Cell Mobilization in the Autologous Transplant Setting. Biology of Blood and Marrow Transplantation 17:7, 943-955
CrossRef49
Shinya Tominaga-Sato, Hideki Tsushima, Koji Ando, Hidehiro Itonaga, Yoshitaka Imaizumi, Daisuke Imanishi, Masako Iwanaga, Jun Taguchi, Takuya Fukushima, Shinichiro Yoshida, Tomoko Hata, Yukiyoshi Moriuchi, Kazutaka Kuriyama, Hiroyuki Mano, Masao Tomonaga, Yasushi Miyazaki. (2011) Expression of myeloperoxidase and gene mutations in AML patients with normal karyotype: double CEBPA mutations are associated with high percentage of MPO positivity in leukemic blasts. International Journal of Hematology 94:1, 81-89
CrossRef50
Kaisa J. Teittinen, Pauliina Kärkkäinen, Johanna Salonen, Gunilla Rönnholm, Hanna Korkeamäki, Mauno Vihinen, Nisse Kalkkinen, Olli Lohi. (2011) Nucleolar proteins with altered expression in leukemic cell lines. Leukemia Research
CrossRef51
E Colombo, M Alcalay, P G Pelicci. (2011) Nucleophosmin and its complex network: a possible therapeutic target in hematological diseases. Oncogene 30:23, 2595-2609
CrossRef52
Neemat Kassem, Alaa Abel Hamid, Tarek Attia, Sherif Baathallah, Somaya Mahmoud, Eman Moemen, Ezzat Safwat, Mohamed Khalaf, Olfat Shaker. (2011) Novel mutations of the nucleophosmin (NPM-1) gene in Egyptian patients with acute myeloid leukemia: A pilot study. Journal of the Egyptian National Cancer Institute 23:2, 73-78
CrossRef53
J N Berman, R B Gerbing, T A Alonzo, P A Ho, K Miller, C Hurwitz, N A Heerema, B Hirsch, S C Raimondi, B Lange, J L Franklin, A Gamis, S Meshinchi. (2011) Prevalence and clinical implications of NRAS mutations in childhood AML: a report from the Children's Oncology Group. Leukemia 25:6, 1039-1042
CrossRef54
J. Fos, T. Pabst, V. Petkovic, D. Ratschiller, B. U. Mueller. (2011) Deficient CEBPA DNA binding function in normal karyotype AML patients is associated with favorable prognosis. Blood 117:18, 4881-4884
CrossRef55
Oscar Fuster, Eva Barragán, Pascual Bolufer, Esperanza Such, Ana Valencia, Mariam Ibáñez, Sandra Dolz, Inmaculada Juan, Antonio Jiménez, Maria Teresa Gómez, Ismael Buño, Joaquín Martínez, José Cervera, Pau Montesinos, Federico Moscardó, Miguel Ángel Sanz. (2011) Fragment length analysis screening for detection of CEBPA mutations in intermediate-risk karyotype acute myeloid leukemia. Annals of Hematology
CrossRef56
(2011) Symposium Abstracts. Clinical Chemistry and Laboratory Medicine 49:s1, S16-S154
CrossRef57
Hsi-Che Liu, Lee-Yung Shih, Mei-Ju May Chen, Chien-Chih Wang, Ting-Chi Yeh, Tung-Huei Lin, Chien-Yu Chen, Chih-Jen Lin, Der-Cherng Liang. (2011) Expression of HOXB genes is significantly different in acute myeloid leukemia with a partial tandem duplication of MLL vs. a MLL translocation: a cross-laboratory study. Cancer Genetics 204:5, 252-259
CrossRef58
Stefano A. Pileri, Claudio Agostinelli, Elena Sabattini, Francesco Bacci, Carlo Sagramoso, Alessandro Pileri, Brunangelo Falini, Pier Paolo Piccaluga. (2011) Lymphoma classification: the quiet after the storm. Seminars in Diagnostic Pathology 28:2, 113-123
CrossRef59
P A Greif, S H Eck, N P Konstandin, A Benet-Pagès, B Ksienzyk, A Dufour, A T Vetter, H D Popp, B Lorenz-Depiereux, T Meitinger, S K Bohlander, T M Strom. (2011) Identification of recurring tumor-specific somatic mutations in acute myeloid leukemia by transcriptome sequencing. Leukemia 25:5, 821-827
CrossRef60
Gert J. Ossenkoppele, Arjan A. van de Loosdrecht, Gerrit Jan Schuurhuis. (2011) Review of the relevance of aberrant antigen expression by flow cytometry in myeloid neoplasms. British Journal of Haematology 153:4, 421-436
CrossRef61
Huseyin Atakan Ekiz, Geylani Can, Yusuf Baran. (2011) Role of autophagy in the progression and suppression of leukemias. Critical Reviews in Oncology/Hematology
CrossRef62
Jerald Radich. 2011. The Molecular Biology of Acute Myeloid Leukemia. , 86-102.
CrossRef63
Jonathan C. Strefford, Nicholas C. P. Cross. 2011. The Leukemia Genome. , 31-45.
CrossRef64
Martin S. Tallman, Ritesh Parajuli, Jessica K. Altman. 2011. Acute Myeloid Leukemia. , 103-126.
CrossRef65
S Schnittger, U Bacher, C Haferlach, T Alpermann, F Dicker, J Sundermann, W Kern, T Haferlach. (2011) Characterization of NPM1-mutated AML with a history of myelodysplastic syndromes or myeloproliferative neoplasms. Leukemia 25:4, 615-621
CrossRef66
Olatoyosi Odenike, Michael J. Thirman, Andrew S. Artz, Lucy A. Godley, Richard A. Larson, Wendy Stock. (2011) Gene Mutations, Epigenetic Dysregulation, and Personalized Therapy in Myeloid Neoplasia: Are We There Yet?. Seminars in Oncology 38:2, 196-214
CrossRef67
George S Vassiliou, Jonathan L Cooper, Roland Rad, Juan Li, Stephen Rice, Anthony Uren, Lena Rad, Peter Ellis, Rob Andrews, Ruby Banerjee, Carolyn Grove, Wei Wang, Pentao Liu, Penny Wright, Mark Arends, Allan Bradley. (2011) Mutant nucleophosmin and cooperating pathways drive leukemia initiation and progression in mice. Nature Genetics 43:5, 470-475
CrossRef68
P. Hokland, H. B. Ommen. (2011) Towards individualized follow-up in adult acute myeloid leukemia in remission. Blood 117:9, 2577-2584
CrossRef69
W.- C. Chou, H.- A. Hou, C.- Y. Liu, C.- Y. Chen, L.- I. Lin, Y.- N. Huang, Y.- C. Chao, C.- A. Hsu, C.- F. Huang, H.- F. Tien. (2011) Sensitive measurement of quantity dynamics of FLT3 internal tandem duplication at early time points provides prognostic information. Annals of Oncology 22:3, 696-704
CrossRef70
Annalisa Pianta, Cinzia Puppin, Nadia Passon, Alessandra Franzoni, Milena Romanello, Gianluca Tell, Carla Di Loreto, Stefania Bulotta, Diego Russo, Giuseppe Damante. (2011) Nucleophosmin Delocalization in Thyroid Tumour Cells. Endocrine Pathology 22:1, 18-23
CrossRef71
F Stölzel, M Pfirrmann, W E Aulitzky, M Kaufmann, H Bodenstein, M Bornhäuser, C Röllig, M Kramer, B Mohr, U Oelschlägel, N Schmitz, S Soucek, C Thiede, G Ehninger, M Schaich. (2011) Risk stratification using a new prognostic score for patients with secondary acute myeloid leukemia: results of the prospective AML96 trial. Leukemia 25:3, 420-428
CrossRef72
Ulrike Bacher, Torsten Haferlach, Tamara Alpermann, Melanie Zenger, Andreas Hochhaus, Dietrich W. Beelen, Michael Uppenkamp, Mathias Rummel, Wolfgang Kern, Susanne Schnittger, Claudia Haferlach. (2011) Subclones with the t(9;22)/BCR-ABL1 rearrangement occur in AML and seem to cooperate with distinct genetic alterations. British Journal of Haematology 152:6, 713-720
CrossRef73
S. Schnittger, F. Dicker, W. Kern, N. Wendland, J. Sundermann, T. Alpermann, C. Haferlach, T. Haferlach. (2011) RUNX1 mutations are frequent in de novo AML with noncomplex karyotype and confer an unfavorable prognosis. Blood 117:8, 2348-2357
CrossRef74
Philippe Szankasi, Albert K. Ho, David W. Bahler, Olga Efimova, Todd W. Kelley. (2011) Combined testing for CCAAT/enhancer-binding protein alpha (CEBPA) mutations and promoter methylation in acute myeloid leukemia demonstrates shared phenotypic features. Leukemia Research 35:2, 200-207
CrossRef75
J. Nomdedeu, E. Bussaglia, N. Villamor, C. Martinez, J. Esteve, M. Tormo, C. Estivill, M.P. Queipo, R. Guardia, M. Carricondo, M. Hoyos, A. Llorente, J. Juncà, M. Gallart, A. Domingo, J. Bargay, M. Mascaró, J.M. Moraleda, L. Florensa, J.M. Ribera, D. Gallardo, S. Brunet, A. Aventin, J. Sierra. (2011) Immunophenotype of acute myeloid leukemia with NPM mutations: Prognostic impact of the leukemic compartment size. Leukemia Research 35:2, 163-168
CrossRef76
W-C Chou, W-C Lei, B-S Ko, H-A Hou, C-Y Chen, J-L Tang, M Yao, W Tsay, S-J Wu, S-Y Huang, S-C Hsu, Y-C Chen, Y-C Chang, K-T Kuo, F-Y Lee, M-C Liu, C-W Liu, M-H Tseng, C-F Huang, H-F Tien. (2011) The prognostic impact and stability of Isocitrate dehydrogenase 2 mutation in adult patients with acute myeloid leukemia. Leukemia 25:2, 246-253
CrossRef77
Hui-Yuan Shao, Zong-Yu Miao, Hui-Chen, Feng-Xian Qin, Xian-Chun Chen, Shi Tan, Hui-Juan Zhang, Li Wang, Yu-Jie Gao, Zai-Lin Yang, Ling Zhang. (2011) Nucleophosmin gene mutations promote NIH3T3 cell migration and invasion through CXCR4 and MMPs. Experimental and Molecular Pathology 90:1, 38-44
CrossRef78
B. Falini, M. P. Martelli, N. Bolli, P. Sportoletti, A. Liso, E. Tiacci, T. Haferlach. (2011) Acute myeloid leukemia with mutated nucleophosmin (NPM1): is it a distinct entity?. Blood 117:4, 1109-1120
CrossRef79
Seung-Dok Hong, Yeo-Kyeoung Kim, Hee-Nam Kim, Se Ryeon Lee, Jae-Sook Ahn, Deok-Hwan Yang, Je-Jung Lee, Il-Kwon Lee, Myung-Geun Shin, Hyeoung-Joon Kim. (2011) Treatment outcome of all- trans retinoic acid/anthracycline combination chemotherapy and the prognostic impact of FLT3 /ITD mutation in acute promyelocytic leukemia patients. The Korean Journal of Hematology 46:1, 24
CrossRef80
Shinichiro Takahashi. (2011) Downstream molecular pathways of FLT3 in the pathogenesis of acute myeloid leukemia: biology and therapeutic implications. Journal of Hematology & Oncology 4:1, 13
CrossRef81
Shinichiro Takahashi. (2011) Current findings for recurring mutations in acute myeloid leukemia. Journal of Hematology & Oncology 4:1, 36
CrossRef82
Mikael S. Lindström. (2011) NPM1/B23: A Multifunctional Chaperone in Ribosome Biogenesis and Chromatin Remodeling. Biochemistry Research International 2011, 1-16
CrossRef83
Stephen D. Nimer. (2011) An Update on the Molecular Pathogenesis of Myelodysplastic Syndromes. Biology of Blood and Marrow Transplantation 17:1, S11-S14
CrossRef84
Susanne Schnittger, Ulrike Bacher, Christiane Eder, Peter Lohse, Claudia Haferlach, Wolfgang Kern, Torsten Haferlach. (2011) A copy number repeat polymorphism in the transactivation domain of the CEPBA gene is possibly associated with a protective effect against acquired CEBPA mutations: an analysis in 1135 patients with AML and 187 healthy controls. Experimental Hematology 39:1, 87-94
CrossRef85
Timothy A. Graubert, Elaine R. Mardis. (2011) Genomics of Acute Myeloid Leukemia. The Cancer Journal 17:6, 487-491
CrossRef86
Hady Ghanem, Niki Tank, Imad A. Tabbara. (2011) Prognostic implications of genetic aberrations in acute myelogenous leukemia with normal cytogenetics. American Journal of Hematologyn/a-n/a
CrossRef87
Jae-Woo Chung, Hyun-Sook Chi, Eun-Hye Lee, Seongsoo Jang, Eul-Ju Seo, Chan-Jeoung Park. (2011) Serial Determination of FLT3-ITD and NPM1 Mutations and Its Clinical Significance in Patients with MDS at Diagnosis and After Progression to AML with Myelodysplasia-related Changes. Laboratory Medicine Online 1:3, 138
CrossRef88
Biljana Jekic, Vera Bunjevacki, Valerija Dobricic, Ivana Novakovic, Jelena Milasin, Branka Popovic, Tatjana Damnjanovic, Nela Maksimovic, V. Perovic, Ljiljana Lukovic. (2011) NPM1 gene mutations in children with Myelodysplastic syndromes. Archives of Biological Sciences 63:3, 649-653
CrossRef89
S. Schnittger, C. Haferlach, M. Ulke, T. Alpermann, W. Kern, T. Haferlach. (2010) IDH1 mutations are detected in 6.6% of 1414 AML patients and are associated with intermediate risk karyotype and unfavorable prognosis in adults younger than 60 years and unmutated NPM1 status. Blood 116:25, 5486-5496
CrossRef90
Ley, Timothy J., Ding, Li, Walter, Matthew J., McLellan, Michael D., Lamprecht, Tamara, Larson, David E., Kandoth, Cyriac, Payton, Jacqueline E., Baty, Jack, Welch, John, Harris, Christopher C., Lichti, Cheryl F., Townsend, R. Reid, Fulton, Robert S., Dooling, David J., Koboldt, Daniel C., Schmidt, Heather, Zhang, Qunyuan, Osborne, John R., Lin, Ling, O'Laughlin, Michelle, McMichael, Joshua F., Delehaunty, Kim D., McGrath, Sean D., Fulton, Lucinda A., Magrini, Vincent J., Vickery, Tammi L., Hundal, Jasreet, Cook, Lisa L.Conyers, Joshua J.Swift, Gary W., Reed, Jerry P., Alldredge, Patricia A., Wylie, Todd, Walker, Jason, Kalicki, Joelle, Watson, Mark A., Heath, SharonShannon, William D., Varghese, Nobish, Nagarajan, Rakesh, Westervelt, Peter, Tomasson, Michael H., Link, Daniel C., Graubert, Timothy A., DiPersio, John F., Mardis, Elaine R., Wilson, Richard K., . (2010) DNMT3A Mutations in Acute Myeloid Leukemia. New England Journal of Medicine 363:25, 2424-2433
Full Text91
T. Kindler, D. B. Lipka, T. Fischer. (2010) FLT3 as a therapeutic target in AML: still challenging after all these years. Blood 116:24, 5089-5102
CrossRef92
Julia Starkova, Blanka Zamostna, Ester Mejstrikova, Roman Krejci, Harry A. Drabkin, Jan Trka. (2010) HOX gene expression in phenotypic and genotypic subgroups and low HOXA gene expression as an adverse prognostic factor in pediatric ALL. Pediatric Blood & Cancer 55:6, 1072-1082
CrossRef93
K. Haslam, N. Chadwick, J. Kelly, P. Browne, E. Vandenberghe, C. Flynn, E. Conneally, S. E. Langabeer. (2010) Incidence and significance of FLT3-ITD and NPM1 mutations in patients with normal karyotype acute myeloid leukaemia. Irish Journal of Medical Science 179:4, 507-510
CrossRef94
J. M. Foran. (2010) New Prognostic Markers in Acute Myeloid Leukemia: Perspective from the Clinic. Hematology 2010:1, 47-55
CrossRef95
Karen WL Yee, Armand Keating. (2010) Older patients with acute myeloid leukemia. Expert Review of Hematology 3:6, 755-774
CrossRef96
Wolfgang Kern, Torsten Haferlach, Susanne Schnittger, Claudia Haferlach, Ulrike Bacher. 2010. Presentation and Diagnosis: Novel Molecular Markers and their Role in the Prognosis and Therapy of Acute Myeloid Leukemia. , 115-124.
CrossRef97
W.-C. Chou, H.-H. Huang, H.-A. Hou, C.-Y. Chen, J.-L. Tang, M. Yao, W. Tsay, B.-S. Ko, S.-J. Wu, S.-Y. Huang, S.-C. Hsu, Y.-C. Chen, Y.-N. Huang, Y.-C. Chang, F.-Y. Lee, M.-C. Liu, C.-W. Liu, M.-H. Tseng, C.-F. Huang, H.-F. Tien. (2010) Distinct clinical and biological features of de novo acute myeloid leukemia with additional sex comb-like 1 (ASXL1) mutations. Blood 116:20, 4086-4094
CrossRef98
M. P. Martelli, V. Pettirossi, C. Thiede, E. Bonifacio, F. Mezzasoma, D. Cecchini, R. Pacini, A. Tabarrini, R. Ciurnelli, I. Gionfriddo, N. Manes, R. Rossi, L. Giunchi, U. Oelschlagel, L. Brunetti, M. Gemei, M. Delia, G. Specchia, A. Liso, M. Di Ianni, F. Di Raimondo, F. Falzetti, L. Del Vecchio, M. F. Martelli, B. Falini. (2010) CD34+ cells from AML with mutated NPM1 harbor cytoplasmic mutated nucleophosmin and generate leukemia in immunocompromised mice. Blood 116:19, 3907-3922
CrossRef99
Vincenza Barresi, Alessandra Romano, Nicolò Musso, Carmela Capizzi, Carla Consoli, Maria Paola Martelli, Giuseppe Palumbo, Francesco Di Raimondo, Daniele F. Condorelli. (2010) Broad copy neutral-loss of heterozygosity regions and rare recurring copy number abnormalities in normal karyotype-acute myeloid leukemia genomes. Genes, Chromosomes and Cancer 49:11, 1014-1023
CrossRef100
Christopher D Watt, Adam Bagg. (2010) Molecular diagnosis of acute myeloid leukemia. Expert Review of Molecular Diagnostics 10:8, 993-1012
CrossRef101
Ulrike Bacher, Susanne Schnittger, Torsten Haferlach. (2010) Molecular genetics in acute myeloid leukemia. Current Opinion in Oncology 22:6, 646-655
CrossRef102
Martino Introna, Alice Pievani, Gianmaria Borleri, Chiara Capelli, Alessandra Algarotti, Caterina Micò, Anna Grassi, Elena Oldani, Josée Golay, Alessandro Rambaldi. (2010) Feasibility and Safety of Adoptive Immunotherapy with CIK Cells after Cord Blood Transplantation. Biology of Blood and Marrow Transplantation 16:11, 1603-1607
CrossRef103
George S Vassiliou, Anthony R Green. 2010. The Molecular Basis of Leukaemia and Lymphoma. , 380-394.
CrossRef104
Barbara J Bain, Torsten Haferlach. 2010. Laboratory Diagnosis of Haematological Neoplasms. , 395-414.
CrossRef105
S. M. Leong, B. X. Tan, B. Bte Ahmad, T. Yan, L. Y. Chee, S. T. Ang, K. G. Tay, L. P. Koh, A. E. J. Yeoh, E. S.-C. Koay, Y.-K. Mok, T. M. Lim. (2010) Mutant nucleophosmin deregulates cell death and myeloid differentiation through excessive caspase-6 and -8 inhibition. Blood 116:17, 3286-3296
CrossRef106
M. Miesner, C. Haferlach, U. Bacher, T. Weiss, K. Macijewski, A. Kohlmann, H.-U. Klein, M. Dugas, W. Kern, S. Schnittger, T. Haferlach. (2010) Multilineage dysplasia (MLD) in acute myeloid leukemia (AML) correlates with MDS-related cytogenetic abnormalities and a prior history of MDS or MDS/MPN but has no independent prognostic relevance: a comparison of 408 cases classified as "AML not otherwise specified" (AML-NOS) or "AML with myelodysplasia-related changes" (AML-MRC). Blood 116:15, 2742-2751
CrossRef107
H Gréen, I J Falk, K Lotfi, E Paul, M Hermansson, R Rosenquist, C Paul, H Nahi. (2010) Association of ABCB1 polymorphisms with survival and in vitro cytotoxicty in de novo acute myeloid leukemia with normal karyotype. The Pharmacogenomics Journal
CrossRef108
Lei Wang, Wei-lai Xu, Hai-tao Meng, Wen-bin Qian, Wen-yuan Mai, Hong-yan Tong, Li-ping Mao, Yin Tong, Jie-jing Qian, Yin-jun Lou, Zhi-mei Chen, Yun-gui Wang, Jie Jin. (2010) FLT3 and NPM1 mutations in Chinese patients with acute myeloid leukemia and normal cytogenetics. Journal of Zhejiang University SCIENCE B 11:10, 762-770
CrossRef109
Tanja Stahl, Anita Badbaran, Nicolaus Kröger, Evgeny Klyuchnikov, Tatjana Zabelina, Silke Zeschke, Philippe Schafhausen, Waltraud Schultz, Svetlana Asenova, Anna Smirnova, Christine Wolschke, Francis Ayuk, Axel R. Zander, Boris Fehse, Ulrike Bacher. (2010) Minimal residual disease diagnostics in patients with acute myeloid leukemia in the post-transplant period: comparison of peripheral blood and bone marrow analysis. Leukemia & Lymphoma 51:10, 1837-1843
CrossRef110
U Oelschlaegel, S Koch, B Mohr, M Schaich, B Falini, G Ehninger, C Thiede. (2010) Rapid flow cytometric detection of aberrant cytoplasmic localization of nucleophosmin (NPMc) indicating mutant NPM1 gene in acute myeloid leukemia. Leukemia 24:10, 1813-1816
CrossRef111
Mar Tormo, Isabel Marugán, Marisa Calabuig. (2010) Myelodysplastic syndromes: an update on molecular pathology. Clinical and Translational Oncology 12:10, 652-661
CrossRef112
F. Buccisano, L. Maurillo, A. Spagnoli, M. I. Del Principe, D. Fraboni, P. Panetta, T. Ottone, M. I. Consalvo, S. Lavorgna, P. Bulian, E. Ammatuna, D. F. Angelini, A. Diamantini, S. Campagna, L. Ottaviani, C. Sarlo, V. Gattei, G. Del Poeta, W. Arcese, S. Amadori, F. Lo Coco, A. Venditti. (2010) Cytogenetic and molecular diagnostic characterization combined to postconsolidation minimal residual disease assessment by flow cytometry improves risk stratification in adult acute myeloid leukemia. Blood 116:13, 2295-2303
CrossRef113
A. M. Gruszka, S. Lavorgna, M. I. Consalvo, T. Ottone, C. Martinelli, M. Cinquanta, G. Ossolengo, G. Pruneri, F. Buccisano, M. Divona, M. Cedrone, E. Ammatuna, A. Venditti, A. de Marco, F. Lo-Coco, P. G. Pelicci. (2010) A monoclonal antibody against mutated nucleophosmin 1 for the molecular diagnosis of acute myeloid leukemias. Blood 116:12, 2096-2102
CrossRef114
Brunangelo Falini, Maria Paola Martelli, Enrico Tiacci, Stefano Ascani, Christian Thiede, Stefano A. Pileri. (2010) Immunohistochemical Surrogates for Genetic Alterations of CCDN1, PML, ALK, and NPM1 Genes in Lymphomas and Acute Myeloid Leukemia. Best Practice & Research Clinical Haematology 23:3, 417-431
CrossRef115
Nada Krstovski, Natasa Tosic, Dragana Janic, Lidija Dokmanovic, Milos Kuzmanovic, Vesna Spasovski, Sonja Pavlovic. (2010) Incidence of FLT3 and nucleophosmin gene mutations in childhood acute myeloid leukemia: Serbian experience and the review of the literature. Medical Oncology 27:3, 640-645
CrossRef116
Nicolaus Kröger, Ulrike Bacher, Peter Bader, Sebastian Böttcher, Michael J. Borowitz, Peter Dreger, Issa Khouri, Homer Macapintac, Eduardo Olavarria, Jerald Radich, Wendy Stock, Julie M. Vose, Daniel Weisdorf, Andre Willasch, Sergio Giralt, Michael R. Bishop, Alan S. Wayne. (2010) NCI First International Workshop on the Biology, Prevention, and Treatment of Relapse after Allogeneic Hematopoietic Stem Cell Transplantation: Report from the Committee on Disease-Specific Methods and Strategies for Monitoring Relapse following Allogeneic Stem Cell Transplantation. Part I: Methods, Acute Leukemias, and Myelodysplastic Syndromes. Biology of Blood and Marrow Transplantation 16:9, 1187-1211
CrossRef117
Michael Hafez, Fei Ye, Keith Jackson, Zhe Yang, Judith E. Karp, Emmanuel Labourier, Christopher D. Gocke. (2010) Performance and Clinical Evaluation of a Sensitive Multiplex Assay for the Rapid Detection of Common NPM1 Mutations. The Journal of Molecular Diagnostics 12:5, 629-635
CrossRef118
Wolfgang Kern, Ulrike Bacher, Claudia Haferlach, Susanne Schnittger, Torsten Haferlach. (2010) The role of multiparameter flow cytometry for disease monitoring in AML. Best Practice & Research Clinical Haematology 23:3, 379-390
CrossRef119
Amparo Verdeguer. (2010) Genetic alterations in children and adolescents with acute myeloid leukaemia. Clinical and Translational Oncology 12:9, 590-596
CrossRef120
Cláudia Malheiros Coutinho-Camillo, Silvia Vanessa Lourenço, Inês Nobuko Nishimoto, Luiz Paulo Kowalski, Fernando Augusto Soares. (2010) Nucleophosmin, p53, and Ki-67 expression patterns on an oral squamous cell carcinoma tissue microarray. Human Pathology 41:8, 1079-1086
CrossRef121
Ellen Christina Obermann, Caroline Arber, Martine Jotterand, Andre Tichelli, Petra Hirschmann, Alexandar Tzankov. (2010) Expression of pSTAT5 predicts FLT3 internal tandem duplications in acute myeloid leukemia. Annals of Hematology 89:7, 663-669
CrossRef122
Ulrike Bacher, Claudia Haferlach, Susanne Schnittger, Alexander Kohlmann, Wolfgang Kern, Torsten Haferlach. (2010) Mutations of the TET2 and CBL genes: novel molecular markers in myeloid malignancies. Annals of Hematology 89:7, 643-652
CrossRef123
Annalisa Pianta, Cinzia Puppin, Alessandra Franzoni, Dora Fabbro, Carla Di Loreto, Stefania Bulotta, Marta Deganuto, Igor Paron, Gianluca Tell, Efisio Puxeddu, Sebastiano Filetti, Diego Russo, Giuseppe Damante. (2010) Nucleophosmin is overexpressed in thyroid tumors. Biochemical and Biophysical Research Communications 397:3, 499-504
CrossRef124
Felicetto Ferrara, Tiziana Izzo, Clelia Criscuolo, Cira Riccardi, Giada Muccioli, Assunta Viola, Fabrizio Pane, Salvatore Palmieri. (2010) Favorable Outcome in Patients with Acute Myelogenous Leukemia with the Nucleophosmin Gene Mutation Autografted after Conditioning with High-Dose Continuous Infusion of Idarubicin and Busulfan. Biology of Blood and Marrow Transplantation 16:7, 1018-1024
CrossRef125
A Kohlmann, L Bullinger, C Thiede, M Schaich, S Schnittger, K Döhner, M Dugas, H-U Klein, H Döhner, G Ehninger, T Haferlach. (2010) Gene expression profiling in AML with normal karyotype can predict mutations for molecular markers and allows novel insights into perturbed biological pathways. Leukemia 24:6, 1216-1220
CrossRef126
B. Falini, K. Macijewski, T. Weiss, U. Bacher, S. Schnittger, W. Kern, A. Kohlmann, H.-U. Klein, M. Vignetti, A. Piciocchi, P. Fazi, M. P. Martelli, A. Vitale, S. Pileri, M. Miesner, A. Santucci, C. Haferlach, F. Mandelli, T. Haferlach. (2010) Multilineage dysplasia has no impact on biologic, clinicopathologic, and prognostic features of AML with mutated nucleophosmin (NPM1). Blood 115:18, 3776-3786
CrossRef127
Giovanni Del Poeta, Emanuele Ammatuna, Serena Lavorgna, Giovanni Capelli, Serena Zaza, Fabrizio Luciano, Tiziana Ottone, Maria Ilaria Del Principe, Francesco Buccisano, Luca Maurillo, Paola Panetta, Paolo de Fabritiis, Roberto Stasi, Adriano Venditti, Sergio Amadori, Francesco Lo Coco. (2010) The genotype nucleophosmin mutated and FLT3 -ITD negative is characterized by high bax/bcl-2 ratio and favourable outcome in acute myeloid leukaemia. British Journal of Haematology 149:3, 383-387
CrossRef128
N. Bolli, E. M. Payne, C. Grabher, J. S. Lee, A. B. Johnston, B. Falini, J. P. Kanki, A. T. Look. (2010) Expression of the cytoplasmic NPM1 mutant (NPMc+) causes the expansion of hematopoietic cells in zebrafish. Blood 115:16, 3329-3340
CrossRef129
K. Cheng, P. Sportoletti, K. Ito, J. G. Clohessy, J. Teruya-Feldstein, J. L. Kutok, P. P. Pandolfi. (2010) The cytoplasmic NPM mutant induces myeloproliferation in a transgenic mouse model. Blood 115:16, 3341-3345
CrossRef130
W. C. Chou, H. A. Hou, C. Y. Chen, J. L. Tang, M. Yao, W. Tsay, B. S. Ko, S. J. Wu, S. Y. Huang, S. C. Hsu, Y. C. Chen, Y. N. Huang, Y. C. Chang, F. Y. Lee, M. C. Liu, C. W. Liu, M. H. Tseng, C. F. Huang, H. F. Tien. (2010) Distinct clinical and biologic characteristics in adult acute myeloid leukemia bearing the isocitrate dehydrogenase 1 mutation. Blood 115:14, 2749-2754
CrossRef131
2010. Acute Leukaemia: Integration of Morphological, Immunophenotypic and Genetic Information and the WHO Classification. , 114-218.
CrossRef132
Delin Chen, Jing Shan, Wei-Guo Zhu, Jun Qin, Wei Gu. (2010) Transcription-independent ARF regulation in oncogenic stress-mediated p53 responses. Nature 464:7288, 624-627
CrossRef133
F. Scaloni, L. Federici, M. Brunori, S. Gianni. (2010) Deciphering the folding transition state structure and denatured state properties of Nucleophosmin C-terminal domain. Proceedings of the National Academy of Sciences 107:12, 5447-5452
CrossRef134
2010. Myelodysplastic Syndromes. , 141-178.
CrossRef135
D. C. Taussig, J. Vargaftig, F. Miraki-Moud, E. Griessinger, K. Sharrock, T. Luke, D. Lillington, H. Oakervee, J. Cavenagh, S. G. Agrawal, T. A. Lister, J. G. Gribben, D. Bonnet. (2010) Leukemia-initiating cells from some acute myeloid leukemia patients with mutated nucleophosmin reside in the CD34- fraction. Blood 115:10, 1976-1984
CrossRef136
Florian Nolte, Wolf-K Hofmann. (2010) Molecular mechanisms involved in the progression of myelodysplastic syndrome. Future Oncology 6:3, 445-455
CrossRef137
Richard A. Larson. (2010) Micro-RNAs and copy number changes: New levels of gene regulation in acute myeloid leukemia. Chemico-Biological Interactions 184:1-2, 21-25
CrossRef138
S Licciulli, V Cambiaghi, G Scafetta, A M Gruszka, M Alcalay. (2010) Pirin downregulation is a feature of AML and leads to impairment of terminal myeloid differentiation. Leukemia 24:2, 429-437
CrossRef139
Suchitra Swaminathan, Manisha Madkaikar, Kanjaksha Ghosh, Babu Rao Vundinti, Lily Kerketta, Maya Gupta. (2010) Novel immunophenotypic and morphologic presentation in acute myeloid leukemia (AML) with JAK2 V617F mutation. European Journal of Haematology 84:2, 180-182
CrossRef140
Karen S. Rees-Unwin, Robin Faragher, Richard D. Unwin, Julie Adams, Philip J. Brown, Ann-Marie Buckle, Andrew Pettitt, Claire V. Hutchinson, Suzanne M. Johnson, Karen Pulford, Alison H. Banham, Anthony D. Whetton, Guy Lucas, David Y. Mason, John Burthem. (2010) Ribosome-associated nucleophosmin 1: increased expression and shuttling activity distinguishes prognostic subtypes in chronic lymphocytic leukaemia. British Journal of Haematology 148:4, 534-543
CrossRef141
N Carbuccia, V Trouplin, V Gelsi-Boyer, A Murati, J Rocquain, J Adélaïde, S Olschwang, L Xerri, N Vey, M Chaffanet, D Birnbaum, M J Mozziconacci. (2010) Mutual exclusion of ASXL1 and NPM1 mutations in a series of acute myeloid leukemias. Leukemia 24:2, 469-473
CrossRef142
W. Du, Y. Zhou, S. Pike, Q. Pang. (2010) NPM phosphorylation stimulates Cdk1, overrides G2/M checkpoint and increases leukemic blasts in mice. Carcinogenesis 31:2, 302-310
CrossRef143
Hoang Thanh Chi, Hoang Anh Vu, Reo Iwasaki, Fumitaka Nagamura, Arinobu Tojo, Toshiki Watanabe, Yuko Sato. (2010) Detection of exon 12 type A mutation of NPM1 gene in IMS-M2 cell line. Leukemia Research 34:2, 261-262
CrossRef144
H. Dohner, E. H. Estey, S. Amadori, F. R. Appelbaum, T. Buchner, A. K. Burnett, H. Dombret, P. Fenaux, D. Grimwade, R. A. Larson, F. Lo-Coco, T. Naoe, D. Niederwieser, G. J. Ossenkoppele, M. A. Sanz, J. Sierra, M. S. Tallman, B. Lowenberg, C. D. Bloomfield. (2010) Diagnosis and management of acute myeloid leukemia in adults: recommendations from an international expert panel, on behalf of the European LeukemiaNet. Blood 115:3, 453-474
CrossRef145
D Cilloni, S Carturan, C Maffè, F Messa, F Arruga, E Messa, M Pradotto, M Pautasso, C Zanone, P Fornaciari, I Defilippi, A Rotolo, E Greco, I Iacobucci, G Martinelli, F Lo-Coco, E Bracco, G Saglio. (2010) Proteinase 3 (PR3) gene is highly expressed in CBF leukemias and codes for a protein with abnormal nuclear localization that confers drug sensitivity. Leukemia
CrossRef146
H. B. Ommen, S. Schnittger, J. V. Jovanovic, I. B. Ommen, H. Hasle, M. Ostergaard, D. Grimwade, P. Hokland. (2010) Strikingly different molecular relapse kinetics in NPM1c, PML-RARA, RUNX1-RUNX1T1, and CBFB-MYH11 acute myeloid leukemias. Blood 115:2, 198-205
CrossRef147
Maria E. Figueroa, Sanne Lugthart, Yushan Li, Claudia Erpelinck-Verschueren, Xutao Deng, Paul J. Christos, Elizabeth Schifano, James Booth, Wim van Putten, Lucy Skrabanek, Fabien Campagne, Madhu Mazumdar, John M. Greally, Peter J.M. Valk, Bob Löwenberg, Ruud Delwel, Ari Melnick. (2010) DNA Methylation Signatures Identify Biologically Distinct Subtypes in Acute Myeloid Leukemia. Cancer Cell 17:1, 13-27
CrossRef148
Margaret L. Gulley, Thomas C. Shea, Yuri Fedoriw. (2010) Genetic Tests To Evaluate Prognosis and Predict Therapeutic Response in Acute Myeloid Leukemia. The Journal of Molecular Diagnostics 12:1, 3-16
CrossRef149
Giuseppe Cammarata, Luigi Augugliaro, Domenico Salemi, Cecilia Agueli, Maria La Rosa, Lea Dagnino, Gabriele Civiletto, Francesca Messana, Anna Marfia, Maria Grazia Bica, Lucia Cascio, Pietro Michele Floridia, Angelo M. Mineo, Mario Russo, Francesco Fabbiano, Alessandra Santoro. (2010) Differential expression of specific microRNA and their targets in acute myeloid leukemia. American Journal of HematologyNA-NA
CrossRef150
Ulrike Bacher, Claudia Haferlach, Nicolaus Kröger, Susanne Schnittger, Wolfgang Kern, Bettina Wiedemann, Axel Rolf Zander, Torsten Haferlach. (2010) Diagnostic Tools in the Indications for Allogeneic Stem Cell Transplantation in Myelodysplastic Syndromes. Biology of Blood and Marrow Transplantation 16:1, 1-11
CrossRef151
Yeo-Kyeoung Kim, Hee-Nam Kim, Se Ryeon Lee, Jae-Sook Ahn, Deok-Hwan Yang, Je-Jung Lee, Il-Kwon Lee, Myung-Geun Shin, Hyeoung-Joon Kim. (2010) Prognostic significance of nucleophosmin mutations and FLT3 internal tandem duplication in adult patients with cytogenetically normal acute myeloid leukemia. The Korean Journal of Hematology 45:1, 36
CrossRef152
Niels Weinhold, Jerome Moreaux, Marc S. Raab, Dirk Hose, Thomas Hielscher, Axel Benner, Tobias Meißner, Edith Ehrbrecht, Michaela Brough, Anna Jauch, Hartmut Goldschmidt, Bernard Klein, Marion Moos. (2010) NPM1 is overexpressed in hyperdiploid multiple myeloma due to a gain of chromosome 5 but is not delocalized to the cytoplasm. Genes, Chromosomes and CancerNA-NA
CrossRef153
Firoz Ahmad, Swarna Mandava, Bibhu Ranjan Das. (2010) Analysis of FLT3 -ITD and FLT3 -Asp835 Mutations in de novo Acute Myeloid Leukemia: Evaluation of Incidence, Distribution Pattern, Correlation with Cytogenetics and Characterization of Internal Tandem Duplication from Indian Population. Cancer Investigation 28:1, 63-73
CrossRef154
J.-L. Tang, H.-A. Hou, C.-Y. Chen, C.-Y. Liu, W.-C. Chou, M.-H. Tseng, C.-F. Huang, F.-Y. Lee, M.-C. Liu, M. Yao, S.-Y. Huang, B.-S. Ko, S.-C. Hsu, S.-J. Wu, W. Tsay, Y.-C. Chen, L.-I. Lin, H.-F. Tien. (2009) AML1/RUNX1 mutations in 470 adult patients with de novo acute myeloid leukemia: prognostic implication and interaction with other gene alterations. Blood 114:26, 5352-5361
CrossRef155
Luis M. Villela, Javier Bolaños-Meade. (2009) Blood and Bone Marrow Transplantation for Acute Myeloid Leukemia. Clinical Cancer Reviews 3:1, E14-E24
CrossRef156
Claire H. Seedhouse, Monica Pallis, Martin Grundy, Shili Shang, Nigel H. Russell. (2009) FLT3 -ITD expression levels and their effect on STAT5 in AML with and without NPM mutations. British Journal of Haematology 147:5, 653-661
CrossRef157
Rachel Rau, Patrick Brown. (2009) Nucleophosmin ( NPM1 ) mutations in adult and childhood acute myeloid leukaemia: towards definition of a new leukaemia entity. Hematological Oncology 27:4, 171-181
CrossRef158
Weina Chen, Sergej Konoplev, L. Jeffrey Medeiros, Hartmut Koeppen, Vasiliki Leventaki, Saroj Vadhan-Raj, Dan Jones, Hagop M. Kantarjian, Brunangelo Falini, Carlos E. Bueso-Ramos. (2009) Cuplike nuclei (prominent nuclear invaginations) in acute myeloid leukemia are highly associated with FLT3 internal tandem duplication and NPM1 mutation. Cancer 115:23, 5481-5489
CrossRef159
C. Haferlach, M. Vignetti, T. Haferlach, B. Falini. (2009) Response: NPM1-mutated AML is an entity irrespective of whether or not chromosomal aberrations are present. Blood 114:20, 4602-4603
CrossRef160
M. Heuser, L. M. Sly, B. Argiropoulos, F. Kuchenbauer, C. Lai, A. Weng, M. Leung, G. Lin, C. Brookes, S. Fung, P. J. Valk, R. Delwel, B. Lowenberg, G. Krystal, R. K. Humphries. (2009) Modeling the functional heterogeneity of leukemia stem cells: role of STAT5 in leukemia stem cell self-renewal. Blood 114:19, 3983-3993
CrossRef161
Wei Chen, Qin Huang. (2009) Detection of FLT3/ITD, JAK2(V617F) and NPM1 gene mutations in chronic myelomonocytic leukemia. Leukemia Research 33:11, e207-e209
CrossRef162
Christophe Roumier, Meyling H Cheok. (2009) Pharmacogenomics in acute myeloid leukemia. Pharmacogenomics 10:11, 1839-1851
CrossRef163
Francesco Buccisano, Luca Maurillo, Alessandra Spagnoli, Maria Ilaria Del Principe, Eleonora Ceresoli, Francesco Lo Coco, William Arcese, Sergio Amadori, Adriano Venditti. (2009) Monitoring of minimal residual disease in acute myeloid leukemia. Current Opinion in Oncology 21:6, 582-588
CrossRef164
Miguel Sanz, Alan Burnett, Francesco Lo-Coco, Bob Löwenberg. (2009) FLT3 inhibition as a targeted therapy for acute myeloid leukemia. Current Opinion in Oncology 21:6, 594-600
CrossRef165
Youngil Koh, Juwon Park, Kwang-Sung Ahn, Inho Kim, Soo-Mee Bang, Jae-Hoon Lee, Sung-Soo Yoon, Dong Soon Lee, Young Yiul Lee, Seonyang Park, Byung-Kook Kim. (2009) Different clinical importance of FLT3 internal tandem duplications in AML according to FAB classification: possible existence of distinct leukemogenesis involving monocyte differentiation pathway. Annals of Hematology 88:11, 1089-1097
CrossRef166
Brunangelo Falini, Paolo Sportoletti, Maria Paola Martelli. (2009) Acute myeloid leukemia with mutated NPM1: diagnosis, prognosis and therapeutic perspectives. Current Opinion in Oncology 21:6, 573-581
CrossRef167
Ulrike Bacher, Susanne Schnittger, Claudia Haferlach, Torsten Haferlach. (2009) Molecular diagnostics in acute leukemias. Clinical Chemistry and Laboratory Medicine 47:11, 1333-1341
CrossRef168
Sergej Konoplev, Xuelin Huang, Harry A. Drabkin, Hartmut Koeppen, Dan Jones, Hagop M. Kantarjian, Guillermo Garcia-Manero, Weina Chen, L. Jeffrey Medeiros, Carlos E. Bueso-Ramos. (2009) Cytoplasmic localization of nucleophosmin in bone marrow blasts of acute myeloid leukemia patients is not completely concordant with NPM1 mutation and is not predictive of prognosis. Cancer 115:20, 4737-4744
CrossRef169
Ulrike Bacher, Torsten Haferlach, Wolfgang Kern, Tamara Weiss, Susanne Schnittger, Claudia Haferlach. (2009) The impact of cytomorphology, cytogenetics, molecular genetics, and immunophenotyping in a comprehensive diagnostic workup of myelodysplastic syndromes. Cancer 115:19, 4524-4532
CrossRef170
B Falini, N Bolli, A Liso, M P Martelli, R Mannucci, S Pileri, I Nicoletti. (2009) Altered nucleophosmin transport in acute myeloid leukaemia with mutated NPM1: molecular basis and clinical implications. Leukemia 23:10, 1731-1743
CrossRef171
Rupinder K. Kular, Fruma Yehiely, Kumar U. Kotlo, Zoran M. Cilensek, Richa Bedi, Louis P. Deiss. (2009) GAGE, an Antiapoptotic Protein Binds and Modulates the Expression of Nucleophosmin/B23 and Interferon Regulatory Factor 1. Journal of Interferon & Cytokine Research 29:10, 645-656
CrossRef172
C. Haferlach, C. Mecucci, S. Schnittger, A. Kohlmann, M. Mancini, A. Cuneo, N. Testoni, G. Rege-Cambrin, A. Santucci, M. Vignetti, P. Fazi, M. P. Martelli, T. Haferlach, B. Falini. (2009) AML with mutated NPM1 carrying a normal or aberrant karyotype show overlapping biologic, pathologic, immunophenotypic, and prognostic features. Blood 114:14, 3024-3032
CrossRef173
Annie Rousselet. (2009) Inhibiting Crm1 causes the formation of excess acentriolar spindle poles containing NuMA and B23, but does not affect centrosome numbers. Biology of the Cell 101:12, 679-693
CrossRef174
S N Brady, L B Maggi, C L Winkeler, E A Toso, A S Gwinn, C L Pelletier, J D Weber. (2009) Nucleophosmin protein expression level, but not threonine 198 phosphorylation, is essential in growth and proliferation. Oncogene 28:36, 3209-3220
CrossRef175
S. Schnittger, W. Kern, C. Tschulik, T. Weiss, F. Dicker, B. Falini, C. Haferlach, T. Haferlach. (2009) Minimal residual disease levels assessed by NPM1 mutation-specific RQ-PCR provide important prognostic information in AML. Blood 114:11, 2220-2231
CrossRef176
Mardis, Elaine R., Ding, Li, Dooling, David J., Larson, David E., McLellan, Michael D., Chen, Ken, Koboldt, Daniel C., Fulton, Robert S., Delehaunty, Kim D., McGrath, Sean D., Fulton, Lucinda A., Locke, Devin P., Magrini, Vincent J., Abbott, Rachel M., Vickery, Tammi L., Reed, Jerry S., Robinson, Jody S., Wylie, Todd, Smith, Scott M.Carmichael, Lynn, Eldred, James M.Harris, Christopher C., Walker, Jason, Peck, Joshua B., Du, Feiyu, Dukes, Adam F., Sanderson, Gabriel E., Brummett, Anthony M.Clark, EricMcMichael, Joshua F., Meyer, Rick J., Schindler, Jonathan K., Pohl, Craig S., Wallis, John W., Shi, Xiaoqi, Lin, Ling, Schmidt, Heather, Tang, Yuzhu, Haipek, Carrie, Wiechert, Madeline E., Ivy, Jolynda V., Kalicki, Joelle, Elliott, GlendoriaRies, Rhonda E., Payton, Jacqueline E., Westervelt, Peter, Tomasson, Michael H., Watson, Mark A., Baty, Jack, Heath, SharonShannon, William D., Nagarajan, Rakesh, Link, Daniel C., Walter, Matthew J., Graubert, Timothy A., DiPersio, John F., Wilson, Richard K., Ley, Timothy J., . (2009) Recurring Mutations Found by Sequencing an Acute Myeloid Leukemia Genome. New England Journal of Medicine 361:11, 1058-1066
Full Text177
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Rosenberg, Eric S., Cort, Alice M., Ebeling, Sally H.Peters, Christine C., Dey, Bimalangshu R., Spitzer, Thomas R., Hasserjian, Robert P., . (2009) Case 28-2009. New England Journal of Medicine 361:11, 1099-1106
Full Text178
Natalia Meani, Myriam Alcalay. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Review of Anticancer Therapy 9:9, 1283-1294
CrossRef179
Uta Oelschlaegel, Brigitte Mohr, Markus Schaich, Ulrike Schäkel, Frank Kroschinsky, Thomas Illmer, Gerhard Ehninger, Christian Thiede. (2009) HLA-DR neg patients without acute promyelocytic leukemia show distinct immunophenotypic, genetic, molecular, and cytomorphologic characteristics compared to acute promyelocytic leukemia. Cytometry Part B: Clinical Cytometry 76B:5, 321-327
CrossRef180
J. W. Vardiman, J. Thiele, D. A. Arber, R. D. Brunning, M. J. Borowitz, A. Porwit, N. L. Harris, M. M. Le Beau, E. Hellstrom-Lindberg, A. Tefferi, C. D. Bloomfield. (2009) The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes. Blood 114:5, 937-951
CrossRef181
B L Ebert. (2009) Deletion 5q in myelodysplastic syndrome: a paradigm for the study of hemizygous deletions in cancer. Leukemia 23:7, 1252-1256
CrossRef182
Youngil Koh, Juwon Park, Eun-Kyung Bae, Kwang-Sung Ahn, Inho Kim, Soo-Mee Bang, Jae-Hoon Lee, Sung-Soo Yoon, Dong Soon Lee, Young Yiul Lee, Seonyang Park, Byoung Kook Kim. (2009) Non-A type nucleophosmin 1 gene mutation predicts poor clinical outcome in de novo adult acute myeloid leukemia: differential clinical importance of NPM1 mutation according to subtype. International Journal of Hematology 90:1, 1-5
CrossRef183
W Kern, C Haferlach, U Bacher, T Haferlach, S Schnittger. (2009) Flow cytometric identification of acute myeloid leukemia with limited differentiation and NPM1 type A mutation: a new biologically defined entity. Leukemia 23:7, 1361-1364
CrossRef184
P P Piccaluga, E Sabattini, F Bacci, C Agostinelli, S Righi, F Salmi, N Testoni, S Paolini, F Castagnetti, G Martinelli, B Falini, S A Pileri. (2009) Cytoplasmic mutated nucleophosmin (NPM1) in blast crisis of chronic myeloid leukaemia. Leukemia 23:7, 1370-1371
CrossRef185
P. A. Ho, T. A. Alonzo, R. B. Gerbing, J. Pollard, D. L. Stirewalt, C. Hurwitz, N. A. Heerema, B. Hirsch, S. C. Raimondi, B. Lange, J. L. Franklin, J. P. Radich, S. Meshinchi. (2009) Prevalence and prognostic implications of CEBPA mutations in pediatric acute myeloid leukemia (AML): a report from the Children's Oncology Group. Blood 113:26, 6558-6566
CrossRef186
Yukiko Komeno, Jiro Kitaura, Toshio Kitamura. (2009) Molecular bases of myelodysplastic syndromes: Lessons from animal models. Journal of Cellular Physiology 219:3, 529-534
CrossRef187
Ulrike Bacher, Alexander Kohlmann, Claudia Haferlach, Torsten Haferlach. (2009) Gene expression profiling in acute myeloid leukaemia (AML). Best Practice & Research Clinical Haematology 22:2, 169-180
CrossRef188
Ulrike Bacher, Alexander Kohlmann, Torsten Haferlach. (2009) Current status of gene expression profiling in the diagnosis and management of acute leukaemia. British Journal of Haematology 145:5, 555-568
CrossRef189
Firoz Ahmad, Swarna Mandava, Bibhu Ranjan Das. (2009) Mutations of NPM1 gene in de novo acute myeloid leukaemia: determination of incidence, distribution pattern and identification of two novel mutations in Indian population. Hematological Oncology 27:2, 90-97
CrossRef190
F. Schneider, E. Hoster, M. Unterhalt, S. Schneider, A. Dufour, T. Benthaus, G. Mellert, E. Zellmeier, S. K. Bohlander, M. Feuring-Buske, C. Buske, J. Braess, S. Fritsch, A. Heinecke, M. C. Sauerland, W. E. Berdel, T. Buechner, B. J. Woermann, W. Hiddemann, K. Spiekermann. (2009) NPM1 but not FLT3-ITD mutations predict early blast cell clearance and CR rate in patients with normal karyotype AML (NK-AML) or high-risk myelodysplastic syndrome (MDS). Blood 113:21, 5250-5253
CrossRef191
Y.-X. Cui, A. Kerby, F. K. E. McDuff, H. Ye, S. D. Turner. (2009) NPM-ALK inhibits the p53 tumor suppressor pathway in an MDM2 and JNK-dependent manner. Blood 113:21, 5217-5227
CrossRef192
U. Bacher, A. Kohlmann, T. Haferlach. (2009) Perspectives of gene expression profiling for diagnosis and therapy in haematological malignancies. Briefings in Functional Genomics and Proteomics 8:3, 184-193
CrossRef193
U Bacher, C Haferlach, S Schnittger, W Kern, N Kroeger, A R Zander, T Haferlach. (2009) Interactive diagnostics in the indication to allogeneic SCT in AML. Bone Marrow Transplantation 43:10, 745-756
CrossRef194
C. Casnici, G. Volpe, D. Lattuada, K. Crotta, M. Kuka, C. Panuzzo, C. Mastrotto, G. Tonon, V.M. Fazio, G. Saglio. (2009) Out of frame peptides from BCR/ABL alternative splicing are immunogenic in HLA A2.1 transgenic mice. Cancer Letters 276:1, 61-67
CrossRef195
Sebastian Scholl, Hans-Joerg Fricke, Herbert G. Sayer, Klaus Höffken. (2009) Clinical implications of molecular genetic aberrations in acute myeloid leukemia. Journal of Cancer Research and Clinical Oncology 135:4, 491-505
CrossRef196
Andrea Staratschek-Jox, Sabine Classen, Andrea Gaarz, Svenja Debey-Pascher, Joachim L Schultze. (2009) Blood-based transcriptomics: leukemias and beyond. Expert Review of Molecular Diagnostics 9:3, 271-280
CrossRef197
D Dvorakova, M Lengerova, J Pospisilova, I Palasek, J Mayer. (2009) A novel quantitative assessment of minimal residual disease in patients with acute myeloid leukemia carrying NPM1 (nucleophosmin) exon 12 mutations. Leukemia 23:4, 793-796
CrossRef198
Aoi Jo, Ichiro Tsukimoto, Eiichi Ishii, Norio Asou, Sachiyo Mitani, Akira Shimada, Takashi Igarashi, Yasuhide Hayashi, Hitoshi Ichikawa. (2009) Age-associated difference in gene expression of paediatric acute myelomonocytic lineage leukaemia (FAB M4 and M5 subtypes) and its correlation with prognosis. British Journal of Haematology 144:6, 917-929
CrossRef199
Christian Britschgi, Martin F Fey. (2009) Tumor suppressor genes in myeloid differentiation and leukemogenesis. Future Oncology 5:2, 245-257
CrossRef200
N Bolli, M F De Marco, M P Martelli, B Bigerna, A Pucciarini, R Rossi, R Mannucci, N Manes, V Pettirossi, S A Pileri, I Nicoletti, B Falini. (2009) A dose-dependent tug of war involving the NPM1 leukaemic mutant, nucleophosmin, and ARF. Leukemia 23:3, 501-509
CrossRef201
Richard F Schlenk, Konstanze Döhner. (2009) Impact of new prognostic markers in treatment decisions in acute myeloid leukemia. Current Opinion in Hematology 16:2, 98-104
CrossRef202
Sabine Kayser, Richard F. Schlenk. (2009) Tailored therapeutic approaches in acute myeloid leukaemia. memo - Magazine of European Medical Oncology 2:S1, 18-21
CrossRef203
Chih-Cheng Chen, Jyh-Pyng Gau, Jie-Yu You, Kuan-Der Lee, Yuan-Bin Yu, Chang-Hsien Lu, Jen-Tsun Lin, Chieh Lan, Wan-Hsia Lo, Jacqueline Ming Liu, Ching-Fen Yang. (2009) Prognostic significance of β-catenin and topoisomerase IIα in de novo acute myeloid leukemia. American Journal of Hematology 84:2, 87-92
CrossRef204
Guo-Rui Ruan, Jin-Lan Li, Ya-Zhen Qin, Ling-Di Li, Min Xie, Yan Chang, Yan Zhang, Yan-Rong Liu, Bin Jiang, Shan-Shan Chen, Xiao-Jun Huang. (2009) Nucleophosmin mutations in Chinese adults with acute myelogenous leukemia. Annals of Hematology 88:2, 159-166
CrossRef205
Christina Papadaki, Annika Dufour, Marlene Seibl, Stephanie Schneider, Stefan K. Bohlander, Evelyn Zellmeier, Gudrun Mellert, Wolfgang Hiddemann, Karsten Spiekermann. (2009) Monitoring minimal residual disease in acute myeloid leukaemia with NPM1 mutations by quantitative PCR: clonal evolution is a limiting factor. British Journal of Haematology 144:4, 517-523
CrossRef206
I H I M Hollink, C M Zwaan, M Zimmermann, T C J M Arentsen-Peters, R Pieters, J Cloos, G J L Kaspers, S S N de Graaf, J Harbott, U Creutzig, D Reinhardt, M M van den Heuvel-Eibrink, C Thiede. (2009) Favorable prognostic impact of NPM1 gene mutations in childhood acute myeloid leukemia, with emphasis on cytogenetically normal AML. Leukemia 23:2, 262-270
CrossRef207
Pranab Dey, Zubair Baloch. (2009) Cancer nucleus: Morphology and beyond. Diagnostic CytopathologyNA-NA
CrossRef208
Carolyn Owen, Jude Fitzgibbon, Peter Paschka. (2009) The clinical relevance of Wilms Tumour 1 (WT1) gene mutations in acute leukaemia. Hematological Oncologyn/a-n/a
CrossRef209
Annalisa Pianta, Dora Fabbro, Daniela Damiani, Mario Tiribelli, Renato Fanin, Alessandra Franzoni, Milena Romanello, Gianluca Tell, Carla Di Loreto, Giuseppe Damante. (2009) Two novel NPM1 mutations in a therapy-responder AML patient. Hematological Oncologyn/a-n/a
CrossRef210
Ulrike Bacher, Anita Badbaran, Boris Fehse, Tatjana Zabelina, Axel Rolf Zander, Nicolaus Kröger. (2009) Quantitative monitoring of NPM1 mutations provides a valid minimal residual disease parameter following allogeneic stem cell transplantation. Experimental Hematology 37:1, 135-142
CrossRef211
Esbjörn Paul, Esbjörn Paul, Bertil Uggla, Stefan Deneberg, Sofia Bengtzen, Monica Hermansson, Ingrid Dahlman, Richard Rosenquist, Klas G. Wiman, Hareth Nahi. (2009) Low p14ARF expression in de novo acute myeloid leukemia with normal karyotype is associated with poor survival. Leukemia & Lymphoma 50:9, 1512-1518
CrossRef212
Karina Lucrecia Calvo, Mara Jorgelina Ojeda, Emanuele Ammatuna, Serena Lavorgna, Tiziana Ottone, Hector Manuel Targovnik, Francesco Lo-Coco, Nélida Inés Noguera. (2009) Detection of the nucleophosmin gene mutations in acute myelogenous leukemia through RT-PCR and polyacrylamide gel electrophoresis. European Journal of Haematology 82:1, 69-72
CrossRef213
D. Grimwade, R. K. Hills. (2009) Independent prognostic factors for AML outcome. Hematology 2009:1, 385-395
CrossRef214
G Cazzaniga, L Lo Nigro, I Cifola, G Milone, S Schnittger, T Haferlach, E Mirabile, F Costantino, M P Martelli, E Mastrodicasa, F Di Raimondo, F Aversa, A Biondi, B Falini. (2009) Simultaneous occurrence of acute myeloid leukaemia with mutated nucleophosmin (NPM1) in the same family. Leukemia 23:1, 199-203
CrossRef215
Suzanne G. Usher, Alan D. Radford, Elizabeth J. Villiers, Laura Blackwood. (2009) RAS, FLT3, and C-KIT mutations in immunophenotyped canine leukemias. Experimental Hematology 37:1, 65-77
CrossRef216
Mehdi Hamadani, Farrukh T. Awan. (2009) Remission induction, consolidation and novel agents in development for adults with acute myeloid leukaemia. Hematological Oncologyn/a-n/a
CrossRef217
Jacob M. Rowe. (2008) Clinical progress in acute myeloid leukemia. Best Practice & Research Clinical Haematology 21:4, 597-599
CrossRef218
Charles A. Schiffer. (2008) Molecular characterization of AML: A significant advance or just another prognostic factor?. Best Practice & Research Clinical Haematology 21:4, 621-628
CrossRef219
Wenxiu Shu, Yan Chen, Rui Li, Qing Wu, Guohui Cui, Wenjuan Ke, Zi Chen. (2008) Involvement of Regulations of Nucleophosmin and Nucleoporins in Gambogic Acid-Induced Apoptosis in Jurkat Cells. Basic & Clinical Pharmacology & Toxicology 103:6, 530-537
CrossRef220
U. Bacher, A. Kohlmann, C. Haferlach, W. Kern, S. Schnittger, T. Haferlach. (2008) Gene expression analyses in acute myeloid leukaemia (AML): current status and perspectives. memo - Magazine of European Medical Oncology 1:4, 235-241
CrossRef221
M P Martelli, N Manes, A Liso, V Pettirossi, B Verducci Galletti, B Bigerna, A Pucciarini, M F De Marco, M T Pallotta, N Bolli, M Sborgia, F di Raimondo, F Fabbiano, G Meloni, G Specchia, M F Martelli, B Falini. (2008) A western blot assay for detecting mutant nucleophosmin (NPM1) proteins in acute myeloid leukaemia. Leukemia 22:12, 2285-2288
CrossRef222
Claudiu V. Cotta, Raymond R. Tubbs. (2008) Mutations in Myeloid Neoplasms. Diagnostic Molecular Pathology 17:4, 191-199
CrossRef223
K. H. Metzeler, M. Hummel, C. D. Bloomfield, K. Spiekermann, J. Braess, M.-C. Sauerland, A. Heinecke, M. Radmacher, G. Marcucci, S. P. Whitman, K. Maharry, P. Paschka, R. A. Larson, W. E. Berdel, T. Buchner, B. Wormann, U. Mansmann, W. Hiddemann, S. K. Bohlander, C. Buske, . (2008) An 86-probe-set gene-expression signature predicts survival in cytogenetically normal acute myeloid leukemia. Blood 112:10, 4193-4201
CrossRef224
Timothy J. Ley, Elaine R. Mardis, Li Ding, Bob Fulton, Michael D. McLellan, Ken Chen, David Dooling, Brian H. Dunford-Shore, Sean McGrath, Matthew Hickenbotham, Lisa Cook, Rachel Abbott, David E. Larson, Dan C. Koboldt, Craig Pohl, Scott Smith, Amy Hawkins, Scott Abbott, Devin Locke, LaDeana W. Hillier, Tracie Miner, Lucinda Fulton, Vincent Magrini, Todd Wylie, Jarret Glasscock, Joshua Conyers, Nathan Sander, Xiaoqi Shi, John R. Osborne, Patrick Minx, David Gordon, Asif Chinwalla, Yu Zhao, Rhonda E. Ries, Jacqueline E. Payton, Peter Westervelt, Michael H. Tomasson, Mark Watson, Jack Baty, Jennifer Ivanovich, Sharon Heath, William D. Shannon, Rakesh Nagarajan, Matthew J. Walter, Daniel C. Link, Timothy A. Graubert, John F. DiPersio, Richard K. Wilson. (2008) DNA sequencing of a cytogenetically normal acute myeloid leukaemia genome. Nature 456:7218, 66-72
CrossRef225
M Andreeff, V Ruvolo, S Gadgil, C Zeng, K Coombes, W Chen, S Kornblau, A E Barón, H A Drabkin. (2008) HOX expression patterns identify a common signature for favorable AML. Leukemia 22:11, 2041-2047
CrossRef226
Tom Lodewyck, Jan J. Cornelissen. (2008) Allogeneic stem cell transplantation in acute myeloid leukemia: a risk-adapted approach. Blood Reviews 22:6, 293-302
CrossRef227
Masamitsu Yanada, Gautam Borthakur, Guillermo Garcia-Manero, Farhad Ravandi, Stefan Faderl, Sherry Pierce, Hagop Kantarjian, Elihu Estey. (2008) Blood counts at time of complete remission provide additional independent prognostic information in acute myeloid leukemia. Leukemia Research 32:10, 1505-1509
CrossRef228
Maria J. Carnicer, Adriana Lasa, Marcus Buschbeck, Elena Serrano, Maite Carricondo, Salut Brunet, Anna Aventin, Jorge Sierra, Luciano Di Croce, Josep F. Nomdedeu. (2008) K313dup is a recurrent CEBPA mutation in de novo acute myeloid leukemia (AML). Annals of Hematology 87:10, 819-827
CrossRef229
Tobias Benthaus, Friederike Schneider, Gudrun Mellert, Evelyn Zellmeier, Stephanie Schneider, Purvi M. Kakadia, Wolfgang Hiddemann, Stefan K. Bohlander, Michaela Feuring-Buske, Jan Braess, Karsten Spiekermann, Annika Dufour. (2008) Rapid and sensitive screening for CEBPA mutations in acute myeloid leukaemia. British Journal of Haematology 143:2, 230-239
CrossRef230
Florian Nolte, Wolf-K. Hofmann. (2008) Myelodysplastic syndromes: molecular pathogenesis and genomic changes. Annals of Hematology 87:10, 777-795
CrossRef231
Eva Barragan, Juan C. Pajuelo, Sandra Ballester, Oscar Fuster, Jose Cervera, Federico Moscardo, Leonor Senent, Esperanza Such, Miguel A. Sanz, Pascual Bolufer. (2008) Minimal residual disease detection in acute myeloid leukemia by mutant nucleophosmin (NPM1): Comparison with WT1 gene expression. Clinica Chimica Acta 395:1-2, 120-123
CrossRef232
Cinzia Tapinassi, Elvira Gerbino, Omar Malazzi, Carla Micucci, Patrizia Gasparini, Maria J. Najera, Maria J. Calasanz, Maria D. Odero, Pier Giuseppe Pelicci, Elena Belloni. (2008) A new dic(7;12)(p12.21;p12.2) chromosome aberration in a case of acute myeloid leukemia. Cancer Genetics and Cytogenetics 185:2, 102-105
CrossRef233
Tamotsu Nishida, Yoshiji Yamada. (2008) SMT3IP1, a nucleolar SUMO-specific protease, deconjugates SUMO-2 from nucleolar and cytoplasmic nucleophosmin. Biochemical and Biophysical Research Communications 374:2, 382-387
CrossRef234
Manu Gupta, Manoj Raghavan, Rosemary E. Gale, Claude Chelala, Christopher Allen, Gael Molloy, Tracy Chaplin, David C. Linch, Jean-Baptiste Cazier, Bryan D. Young. (2008) Novel regions of acquired uniparental disomy discovered in acute myeloid leukemia. Genes, Chromosomes and Cancer 47:9, 729-739
CrossRef235
Rossanna C. Pezo, Robert H. Singer. (2008) Nuclear microenvironment in cancer diagnosis and treatment. Journal of Cellular Biochemistry 104:6, 1953-1963
CrossRef236
Krzysztof Mrózek. (2008) Cytogenetic, Molecular Genetic, and Clinical Characteristics of Acute Myeloid Leukemia With a Complex Karyotype. Seminars in Oncology 35:4, 365-377
CrossRef237
Ellen Meijer, Jan J. Cornelissen. (2008) Allogeneic Stem Cell Transplantation in Acute Myeloid Leukemia in First or Subsequent Remission: Weighing Prognostic Markers Predicting Relapse and Risk Factors for Non-relapse Mortality. Seminars in Oncology 35:4, 449-457
CrossRef238
U Bacher, A R Zander, T Haferlach, S Schnittger, B Fehse, N Kröger. (2008) Minimal residual disease diagnostics in myeloid malignancies in the post transplant period. Bone Marrow Transplantation 42:3, 145-157
CrossRef239
Verena Gaidzik, Konstanze Döhner. (2008) Prognostic Implications of Gene Mutations in Acute Myeloid Leukemia With Normal Cytogenetics. Seminars in Oncology 35:4, 346-355
CrossRef240
Qin Huang, Wengang Chen, Karl K. Gaal, Marilyn L. Slovak, Anthony Stein, Lawrence M. Weiss. (2008) A rapid, one step assay for simultaneous detection of FLT3 ITD and NPM1 mutations in AML with normal cytogenetics. British Journal of Haematology 142:3, 489-492
CrossRef241
P. Bonetti, T. Davoli, C. Sironi, B. Amati, P. G. Pelicci, E. Colombo. (2008) Nucleophosmin and its AML-associated mutant regulate c-Myc turnover through Fbw7 . The Journal of Cell Biology 182:1, 19-26
CrossRef242
P. P. Di Fiore. (2008) Playing both sides: nucleophosmin between tumor suppression and oncogenesis. The Journal of Cell Biology 182:1, 7-9
CrossRef243
Florette K. Hazard, Shuchun Zhao, Joshua D. Schiffman, Norman J. Lacayo, Gary V. Dahl, Yasodha Natkunam. (2008) Tissue Microarrays from Bone Marrow Aspirates for High-Throughput Assessment of Immunohistologic Markers in Pediatric Acute Leukemia. Pediatric and Developmental Pathology 11:4, 283-290
CrossRef244
L Pasqualucci, S Li, G Meloni, S Schnittger, S Gattenlohner, A Liso, M Di Ianni, M P Martelli, E Pescarmona, R Foa, T Haferlach, R C Skoda, B Falini. (2008) NPM1-mutated acute myeloid leukaemia occurring in JAK2-V617F+ primary myelofibrosis: de-novo origin?. Leukemia 22:7, 1459-1463
CrossRef245
Todd S. Laughlin, Michael W. Becker, Jane L. Liesveld, Deborah A. Mulford, Camille N. Abboud, Patrick Brown, Paul G. Rothberg. (2008) Rapid Method for Detection of Mutations in the Nucleophosmin Gene in Acute Myeloid Leukemia. The Journal of Molecular Diagnostics 10:4, 338-345
CrossRef246
Meilani Syampurnawati, Eiji Tatsumi, Bambang Ardianto, Mariko Takenokuchi, Yuji Nakamachi, Seiji Kawano, Shun-ichi Kumagai, Katsuyasu Saigo, Toshimitsu Matsui, Takayuki Takahashi, Ken-ichi Nagai, Gunadi, Hisahide Nishio, Hiroki Yabe, Shin-ichi Kondo, Yoshitake Hayashi. (2008) DR negativity is a distinctive feature of M1/M2 AML cases with NPM1 mutation. Leukemia Research 32:7, 1141-1143
CrossRef247
U. Wedding, J.G. Meran, K. Höffken. (2008) Übertherapie in der Onkologie: Wann ist weniger mehr?. Der Onkologe 14:7, 691-700
CrossRef248
D Cilloni, F Messa, V Rosso, F Arruga, I Defilippi, S Carturan, R Catalano, M Pautasso, C Panuzzo, P Nicoli, E Messa, A Morotti, I Iacobucci, G Martinelli, E Bracco, G Saglio. (2008) Increase sensitivity to chemotherapeutical agents and cytoplasmatic interaction between NPM leukemic mutant and NF-κB in AML carrying NPM1 mutations. Leukemia 22:6, 1234-1240
CrossRef249
C. Langer, M. D. Radmacher, A. S. Ruppert, S. P. Whitman, P. Paschka, K. Mrozek, C. D. Baldus, T. Vukosavljevic, C.-G. Liu, M. E. Ross, B. L. Powell, A. de la Chapelle, J. E. Kolitz, R. A. Larson, G. Marcucci, C. D. Bloomfield. (2008) High BAALC expression associates with other molecular prognostic markers, poor outcome, and a distinct gene-expression signature in cytogenetically normal patients younger than 60 years with acute myeloid leukemia: a Cancer and Leukemia Group B (CALGB) study. Blood 111:11, 5371-5379
CrossRef250
Felicetto Ferrara, Salvatore Palmieri, Franco Leoni. (2008) Clinically useful prognostic factors in acute myeloid leukemia. Critical Reviews in Oncology/Hematology 66:3, 181-193
CrossRef251
A Liso, A Bogliolo, V Freschi, M P Martelli, S A Pileri, M Santodirocco, N Bolli, M F Martelli, B Falini. (2008) In human genome, generation of a nuclear export signal through duplication appears unique to nucleophosmin (NPM1) mutations and is restricted to AML. Leukemia 22:6, 1285-1289
CrossRef252
M T Andersen, M K Andersen, D H Christiansen, J Pedersen-Bjergaard. (2008) NPM1 mutations in therapy-related acute myeloid leukemia with uncharacteristic features. Leukemia 22:5, 951-955
CrossRef253
Gerald Wertheim, Adam Bagg. (2008) Nucleophosmin (NPM1) Mutations in Acute Myeloid Leukemia: An Ongoing (Cytoplasmic) Tale of Dueling Mutations and Duality of Molecular Genetic Testing Methodologies. The Journal of Molecular Diagnostics 10:3, 198-202
CrossRef254
Philippe Szankasi, Mohamed Jama, David W. Bahler. (2008) A New DNA-Based Test for Detection of Nucleophosmin Exon 12 Mutations by Capillary Electrophoresis. The Journal of Molecular Diagnostics 10:3, 236-241
CrossRef255
Tiziana Ottone, Emanuele Ammatuna, Serena Lavorgna, Nélida I. Noguera, Francesco Buccisano, Adriano Venditti, Laura Giannì, Massimiliano Postorino, Giorgio Federici, Sergio Amadori, Francesco Lo-Coco. (2008) An Allele-Specific RT-PCR Assay to Detect Type A Mutation of the Nucleophosmin-1 Gene in Acute Myeloid Leukemia. The Journal of Molecular Diagnostics 10:3, 212-216
CrossRef256
Mehdi Hamadani, Farrukh T. Awan, Edward A. Copelan. (2008) Hematopoietic Stem Cell Transplantation in Adults with Acute Myeloid Leukemia. Biology of Blood and Marrow Transplantation 14:5, 556-567
CrossRef257
A Renneville, C Roumier, V Biggio, O Nibourel, N Boissel, P Fenaux, C Preudhomme. (2008) Cooperating gene mutations in acute myeloid leukemia: a review of the literature. Leukemia 22:5, 915-931
CrossRef258
B Falini. (2008) Therapy-related acute myeloid leukaemia with mutated NPM1: treatment induced or de novo in origin?. Leukemia 22:5, 891-892
CrossRef259
Schlenk, Richard F., Döhner, Konstanze, Krauter, Jürgen, Fröhling, Stefan, Corbacioglu, Andrea, Bullinger, Lars, Habdank, MarianneSpäth, DanielaMorgan, Michael, Benner, Axel, Schlegelberger, Brigitte, Heil, Gerhard, Ganser, Arnold, Döhner, Hartmut, . (2008) Mutations and Treatment Outcome in Cytogenetically Normal Acute Myeloid Leukemia. New England Journal of Medicine 358:18, 1909-1918
Full Text260
Meera Gurumurthy, Chuan Hao Tan, Raymond Ng, Lisa Zeiger, Joanne Lau, Jialing Lee, Anwesha Dey, Robin Philp, Qintong Li, Tit Meng Lim, David H. Price, David P. Lane, Sheng-Hao Chao. (2008) Nucleophosmin Interacts with HEXIM1 and Regulates RNA Polymerase II Transcription. Journal of Molecular Biology 378:2, 302-317
CrossRef261
P. Sportoletti, S. Grisendi, S. M. Majid, K. Cheng, J. G. Clohessy, A. Viale, J. Teruya-Feldstein, P. P. Pandolfi. (2008) Npm1 is a haploinsufficient suppressor of myeloid and lymphoid malignancies in the mouse. Blood 111:7, 3859-3862
CrossRef262
David Wald, Johanna M. Vermaat, Gil Peleg, William Tse. (2008) Genetic abnormalities in acute myelogenous leukemia with normal cytogenetics. Current Hematologic Malignancy Reports 3:2, 83-88
CrossRef263
R. Garzon, M. Garofalo, M. P. Martelli, R. Briesewitz, L. Wang, C. Fernandez-Cymering, S. Volinia, C.-G. Liu, S. Schnittger, T. Haferlach, A. Liso, D. Diverio, M. Mancini, G. Meloni, R. Foa, M. F. Martelli, C. Mecucci, C. M. Croce, B. Falini. (2008) Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proceedings of the National Academy of Sciences 105:10, 3945-3950
CrossRef264
Mauri M. Hämäläinen, Veli Kairisto, Vesa Juvonen, Janita Johansson, Jukka Aurén, Kati Kohonen, Kari Remes, Toivo T. Salmi, Hans Helenius, Tarja-Terttu Pelliniemi. (2008) Wilms tumour gene 1 overexpression in bone marrow as a marker for minimal residual disease in acute myeloid leukaemia. European Journal of Haematology 80:3, 201-207
CrossRef265
Cheryl L. Willman. (2008) Has gene expression profiling improved diagnosis, classification, and outcome prediction in AML?. Best Practice & Research Clinical Haematology 21:1, 21-28
CrossRef266
Stephen D. Nimer. (2008) Is it important to decipher the heterogeneity of “normal karyotype AML”?. Best Practice & Research Clinical Haematology 21:1, 43-52
CrossRef267
U. Bacher, C. Haferlach, W. Kern, T. Haferlach, S. Schnittger. (2008) Prognostic relevance of FLT3-TKD mutations in AML: the combination matters--an analysis of 3082 patients. Blood 111:5, 2527-2537
CrossRef268
Sebastian Scholl, Claudia Theuer, Veit Scheble, Christa Kunert, Anita Heller, Lars-Olof Mügge, Hans-Joerg Fricke, Klaus Höffken, Ulrich Wedding. (2008) Clinical impact of nucleophosmin mutations and Flt3 internal tandem duplications in patients older than 60 yr with acute myeloid leukaemia. European Journal of Haematology 80:3, 208-215
CrossRef269
H. Wandt, U. Schakel, F. Kroschinsky, G. Prange-Krex, B. Mohr, C. Thiede, U. Pascheberg, S. Soucek, M. Schaich, G. Ehninger. (2008) MLD according to the WHO classification in AML has no correlation with age and no independent prognostic relevance as analyzed in 1766 patients. Blood 111:4, 1855-1861
CrossRef270
Michela Palmisano, Tiziana Grafone, Matteo Renzulli, Emanuela Ottaviani, Nicoletta Testoni, Stefania Paolini, Cristina Papayannidis, Michele Baccarani, Giovanni Martinelli. (2008) Molecular and chromosomal alterations: new therapies for relapsed acute myeloid leukemia. Hematology 13:1, 1-12
CrossRef271
A Liso, D Colau, R Benmaamar, A De Groot, W Martin, R Benedetti, G Specchia, M P Martelli, P Coulie, B Falini. (2008) Nucleophosmin leukaemic mutants contain C-terminus peptides that bind HLA class I molecules. Leukemia 22:2, 424-426
CrossRef272
J Pedersen-Bjergaard, M K Andersen, M T Andersen, D H Christiansen. (2008) Genetics of therapy-related myelodysplasia and acute myeloid leukemia. Leukemia 22:2, 240-248
CrossRef273
K J Hatfield, R Hovland, A M Øyan, K H Kalland, A Ryningen, B T Gjertsen, Ø Bruserud. (2008) Release of angiopoietin-1 by primary human acute myelogenous leukemia cells is associated with mutations of nucleophosmin, increased by bone marrow stromal cells and possibly antagonized by high systemic angiopoietin-2 levels. Leukemia 22:2, 287-293
CrossRef274
Falko Fend, Alexandar Tzankov, Karin Bink, Stefan Seidl, Leticia Quintanilla-Martinez, Marcus Kremer, Stephan Dirnhofer. (2008) Modern techniques for the diagnostic evaluation of the trephine bone marrow biopsy: Methodological aspects and applications. Progress in Histochemistry and Cytochemistry 42:4, 203-252
CrossRef275
Elena Serrano, Maria J. Carnicer, Vanesa Orantes, Camino Estivill, Adriana Lasa, Salut Brunet, Anna M. Aventín, Jorge Sierra, Josep F. Nomdedéu. (2008) Uniparental disomy may be associated with microsatellite instability in acute myeloid leukemia (AML) with a normal karyotype. Leukemia & Lymphoma 49:6, 1178-1183
CrossRef276
T. Haferlach. (2008) Molecular Genetic Pathways as Therapeutic Targets in Acute Myeloid Leukemia. Hematology 2008:1, 400-411
CrossRef277
Alfonso Quintás-Cardama, Jorge Cortes, Hagop Kantarjian. 2008. Biology of Chronic and Acute Myeloid Leukemia. , 371-383.
CrossRef278
Wolfgang Kern, Claudia Haferlach, Torsten Haferlach, Susanne Schnittger. (2008) Monitoring of minimal residual disease in acute myeloid leukemia. Cancer 112:1, 4-16
CrossRef279
M P Martelli, N Manes, V Pettirossi, A Liso, R Pacini, R Mannucci, T Zei, N Bolli, F di Raimondo, G Specchia, I Nicoletti, M F Martelli, B Falini. (2008) Absence of nucleophosmin leukaemic mutants in B and T cells from AML with NPM1 mutations: implications for the cell of origin of NPMc+ AML. Leukemia 22:1, 195-198
CrossRef280
Wenxiu Shu, Yan Chen, Qing Wu, Rui Li, Guohui Cui. (2008) Deguelin Represses Both the Expression of Nucleophosmin and some Nucleoporins: Nup88 and Nup214 in Jurkat Cells. Biological & Pharmaceutical Bulletin 31:1, 27-32
CrossRef281
Qi-Fu Li, Song-Lin Shi, Qing-Rong Liu, Jian Tang, Jianye Song, Ying Liang. (2008) Anticancer effects of ginsenoside Rg1, cinnamic acid, and tanshinone IIA in osteosarcoma MG-63 cells: Nuclear matrix downregulation and cytoplasmic trafficking of nucleophosmin. The International Journal of Biochemistry & Cell Biology 40:9, 1918-1929
CrossRef282
Yuichi Ishikawa, Jinglan Xu, Gyosuke Sakashita, Takeshi Urano, Tatsuya Suzuki, Akihiro Tomita, Hitoshi Kiyoi, Shigeo Nakamura, Tomoki Naoe. (2008) Abnormal cytoplasmic dyslocalisation and/or reduction of nucleophosmin protein level rarely occurs in myelodysplastic syndromes. Leukemia & Lymphoma 49:12, 2359-2364
CrossRef283
Rikio Suzuki, Makoto Onizuka, Minoru Kojima, Masako Shimada, Kaori Okamura, Satomi Fukagawa, Kosuke Tsuboi, Ako Kikuchi, Hiroyuki Kobayashi, Ayumi Shintani, Yoshiaki Ogawa, Hiroshi Kawada, Tomomitsu Hotta, Kiyoshi Ando. (2007) Prognostic significance ofFLT3 internal tandem duplication andNPM1 mutations in acute myeloid leukemia in an unselected patient population. International Journal of Hematology 86:5, 422-428
CrossRef284
K Cheng, S Grisendi, J G Clohessy, S Majid, R Bernardi, P Sportoletti, P P Pandolfi. (2007) The leukemia-associated cytoplasmic nucleophosmin mutant is an oncogene with paradoxical functions: Arf inactivation and induction of cellular senescence. Oncogene 26:53, 7391-7400
CrossRef285
Olga Frankfurt, Jonathan D Licht, Martin S Tallman. (2007) Molecular characterization of acute myeloid leukemia and its impact on treatment. Current Opinion in Oncology 19:6, 635-649
CrossRef286
Farhad Ravandi, Alan K. Burnett, Edward D. Agura, Hagop M. Kantarjian. (2007) Progress in the treatment of acute myeloid leukemia. Cancer 110:9, 1900-1910
CrossRef287
Djoke van Gosliga, Hein Schepers, Aleksandra Rizo, Dorina van der Kolk, Edo Vellenga, Jan Jacob Schuringa. (2007) Establishing long-term cultures with self-renewing acute myeloid leukemia stem/progenitor cells. Experimental Hematology 35:10, 1538-1549
CrossRef288
D. C. Link, G. Kunter, Y. Kasai, Y. Zhao, T. Miner, M. D. McLellan, R. E. Ries, D. Kapur, R. Nagarajan, D. C. Dale, A. A. Bolyard, L. A. Boxer, K. Welte, C. Zeidler, J. Donadieu, C. Bellanne-Chantelot, J. W. Vardiman, M. A. Caligiuri, C. D. Bloomfield, J. F. DiPersio, M. H. Tomasson, T. A. Graubert, P. Westervelt, M. Watson, W. Shannon, J. Baty, E. R. Mardis, R. K. Wilson, T. J. Ley. (2007) Distinct patterns of mutations occurring in de novo AML versus AML arising in the setting of severe congenital neutropenia. Blood 110:5, 1648-1655
CrossRef289
C G Mullighan, A Kennedy, X Zhou, I Radtke, L A Phillips, S A Shurtleff, J R Downing. (2007) Pediatric acute myeloid leukemia with NPM1 mutations is characterized by a gene expression profile with dysregulated HOX gene expression distinct from MLL-rearranged leukemias. Leukemia 21:9, 2000-2009
CrossRef290
B Falini, E Albiero, N Bolli, M F De Marco, D Madeo, M Martelli, I Nicoletti, F Rodeghiero. (2007) Aberrant cytoplasmic expression of C-terminal-truncated NPM leukaemic mutant is dictated by tryptophans loss and a new NES motif. Leukemia 21:9, 2052-2054
CrossRef291
S. Scholl, L.-O. Mügge, O. Landt, I.F. Loncarevic, C. Kunert, J.H. Clement, K. Höffken. (2007) Rapid screening and sensitive detection of NPM1 (nucleophosmin) exon 12 mutations in acute myeloid leukaemia. Leukemia Research 31:9, 1205-1211
CrossRef292
Guang-biao ZHOU, Guo LI, Sai-juan CHEN, Zhu CHEN. (2007) From dissection of disease pathogenesis to elucidation of mechanisms of targeted therapies: leukemia research in the genomic era. Acta Pharmacologica Sinica 28:9, 1434-1449
CrossRef293
K. A. Ganapathi, K. M. Austin, C.-S. Lee, A. Dias, M. M. Malsch, R. Reed, A. Shimamura. (2007) The human Shwachman-Diamond syndrome protein, SBDS, associates with ribosomal RNA. Blood 110:5, 1458-1465
CrossRef294
Swetlana Gez, Ben Crossett, Richard I. Christopherson. (2007) Differentially expressed cytosolic proteins in human leukemia and lymphoma cell lines correlate with lineages and functions. Biochimica et Biophysica Acta (BBA) - Proteins & Proteomics 1774:9, 1173-1183
CrossRef295
F Guerrini, S Galimberti, E Ciabatti, S Brizzi, R Testi, A Pollastrini, B Falini, M Petrini. (2007) Molecular detection of GNNK− and GNNK+ c-kit isoforms: a new tool for risk stratification in adult acute myeloid leukaemia. Leukemia 21:9, 2056-2058
CrossRef296
K. Mrózek, P. Paschka, G. Marcussi, S.P. Whitman, C.D. Bloomfield. (2007) E01 Biology, cytogenetics and molecular studies in acute myeloid leukemia. Leukemia Research 31, S3-S7
CrossRef297
H J Lawrence. (2007) Nucleophosmin mutations in acute myeloid leukemia in children. Leukemia 21:9, 1849-1850
CrossRef298
Sebastian Scholl, Joachim Lüftner, Lars-Olof Mügge, Volker Schmidt, Hans-Jörg Fricke, Klaus Höffken. (2007) Sustained expression of nucleophosmin (NPM1) mutation at late relapse presenting as isolated myeloid sarcoma in a patient with acute myeloid leukemia. Annals of Hematology 86:10, 763-765
CrossRef299
B Falini, D Lenze, R Hasserjian, S Coupland, D Jaehne, C Soupir, A Liso, M P Martelli, N Bolli, F Bacci, V Pettirossi, A Santucci, M F Martelli, S Pileri, H Stein. (2007) Cytoplasmic mutated nucleophosmin (NPM) defines the molecular status of a significant fraction of myeloid sarcomas. Leukemia 21:7, 1566-1570
CrossRef300
Yasuo Mori, Goichi Yoshimoto, Takashi Kumano, Toshihiro Miyamoto, Tadafumi Iino, Katsuto Takenaka, Hiromi Iwasaki, Naoki Harada, Naoko Kinukawa, Koji Nagafuji, Takanori Teshima, Kazuya Shimoda, Koichi Akashi, Mine Harada. (2007) Distinctive expression of myelomonocytic markers and down-regulation of CD34 in acute myelogenous leukaemia with FLT3 tandem duplication and nucleophosmin mutation. European Journal of Haematology 79:1, 17-24
CrossRef301
Donal P McLornan, Mary Frances McMullin, Patrick Johnston, Daniel B Longley. (2007) Molecular mechanisms of drug resistance in acute myeloid leukaemia. Expert Opinion on Drug Metabolism & Toxicology 3:3, 363-377
CrossRef302
A Shimada, T Taki, C Kubota, A Tawa, K Horibe, M Tsuchida, R Hanada, I Tsukimoto, Y Hayashi. (2007) No nucleophosmin mutations in pediatric acute myeloid leukemia with normal karyotype: a study of the Japanese Childhood AML Cooperative Study Group. Leukemia 21:6, 1307-1307
CrossRef303
Susan D.P.W.M. de Jonge-Peeters, Folkert Kuipers, Elisabeth G.E. de Vries, Edo Vellenga. (2007) ABC transporter expression in hematopoietic stem cells and the role in AML drug resistance. Critical Reviews in Oncology/Hematology 62:3, 214-226
CrossRef304
Pirjo Koistinen, Riikka Räty, Maija Itälä, Esa Jantunen, Elli Koivunen, Tapio Nousiainen, Tarja-Terttu Pelliniemi, Kari Remes, Tapani Ruutu, Eeva-Riitta Savolainen, Timo Siitonen, Raija Silvennoinen, Liisa Volin, Erkki Elonen, . (2007) Long-term outcome of intensive chemotherapy for adults with de novo acute myeloid leukaemia (AML): the nationwide AML-92 study by the Finnish Leukaemia Group. European Journal of Haematology 78:6, 477-486
CrossRef305
Claudia D. Baldus, Krzysztof Mrózek, Guido Marcucci, Clara D. Bloomfield. (2007) Clinical outcome of de novo acute myeloid leukaemia patients with normal cytogenetics is affected by molecular genetic alterations: a concise review. British Journal of Haematology 137:5, 387-400
CrossRef306
M.A. García, E.F. Meurs, M. Esteban. (2007) The dsRNA protein kinase PKR: Virus and cell control. Biochimie 89:6-7, 799-811
CrossRef307
Chih-Chung Chou, Benjamin Yat-Ming Yung, Chen-Ya Hsu. (2007) Involvement of nPKC-MAPK pathway in the decrease of nucleophosmin/B23 during megakaryocytic differentiation of human myelogenous leukemia K562 cells. Life Sciences 80:22, 2051-2059
CrossRef308
Nina Anensen, Anne M Øyan, Sjur Huseby, Karl-Henning Kalland, Øystein Bruserud, Bjørn T Gjertsen. (2007) Early gene expression of acute myeloid leukemia in response to chemotherapy. Expert Review of Anticancer Therapy 7:5, 741-751
CrossRef309
Anna Rhenen, Bijan Moshaver, Gert J. Ossenkoppele, Gerrit Jan Schuurhuis. (2007) New approaches for the detection of minimal residual disease in acute myeloid leukemia. Current Hematologic Malignancy Reports 2:2, 111-118
CrossRef310
EUN GOO JEONG, SUNG HAK LEE, NAM JIN YOO, SUG HYUNG LEE. (2007) Absence of nucleophosmin 1 (NPM1) gene mutations in common solid cancers. APMIS 115:4, 341-346
CrossRef311
Torsten Haferlach, Ulrike Bacher, Wolfgang Kern, Susanne Schnittger, Claudia Haferlach. (2007) Diagnostic pathways in acute leukemias: a proposal for a multimodal approach. Annals of Hematology 86:5, 311-327
CrossRef312
W-C Chou, J-L Tang, S-J Wu, W Tsay, M Yao, S-Y Huang, K-C Huang, C-Y Chen, C-F Huang, H-F Tien. (2007) Clinical implications of minimal residual disease monitoring by quantitative polymerase chain reaction in acute myeloid leukemia patients bearing nucleophosmin (NPM1) mutations. Leukemia
CrossRef313
Daniela Damiani, Mario Tiribelli, Donatella Raspadori, Angela Michelutti, Alessandro Gozzetti, Elisabetta Calistri, Anna Candoni, Alexsia Chiarvesio, Mariapia Lenoci, Domenico Russo, Renato Fanin. (2007) The role of MDR-related proteins in the prognosis of adult acute myeloid leukaemia (AML) with normal karyotype. Hematological Oncology 25:1, 38-43
CrossRef314
Krzysztof Mrózek, Hartmut Döhner, Clara D Bloomfield. (2007) Influence of new molecular prognostic markers in patients with karyotypically normal acute myeloid leukemia: recent advances. Current Opinion in Hematology 14:2, 106-114
CrossRef315
Mark R Litzow. (2007) Progress and strategies for patients with relapsed and refractory acute myeloid leukemia. Current Opinion in Hematology 14:2, 130-137
CrossRef316
Torsten Haferlach, Ulrike Bacher, Claudia Haferlach, Wolfgang Kern, Susanne Schnittger. (2007) Insight into the molecular pathogenesis of myeloid malignancies. Current Opinion in Hematology 14:2, 90-97
CrossRef317
E Albiero, D Madeo, N Bolli, I Giaretta, E Di Bona, M F Martelli, I Nicoletti, F Rodeghiero, B Falini. (2007) Identification and functional characterization of a cytoplasmic nucleophosmin leukaemic mutant generated by a novel exon-11 NPM1 mutation. Leukemia
CrossRef318
J-P Yun, J Miao, G G Chen, Q-H Tian, C-Q Zhang, J Xiang, J Fu, P B S Lai. (2007) Increased expression of nucleophosmin/B23 in hepatocellular carcinoma and correlation with clinicopathological parameters. British Journal of Cancer 96:3, 477-484
CrossRef319
S A Pileri, S Ascani, M C Cox, C Campidelli, F Bacci, M Piccioli, P P Piccaluga, C Agostinelli, S Asioli, D Novero, M Bisceglia, M Ponzoni, A Gentile, P Rinaldi, V Franco, D Vincelli, A Pileri Jr, R Gasbarra, B Falini, P L Zinzani, M Baccarani. (2007) Myeloid sarcoma: clinico-pathologic, phenotypic and cytogenetic analysis of 92 adult patients. Leukemia 21:2, 340-350
CrossRef320
Kamran Salim, Paul C. Guest, Heather A. Skynner, James G. Bilsland, Timothy P. Bonnert, George McAllister, Ignacio Munoz-Sanjuan. (2007) Identification of Proteomic Changes during Differentiation of Adult Mouse Subventricular Zone Progenitor Cells. Stem Cells and Development 16:1, 143-166
CrossRef321
Hong Chang, Joanna Yeung, Joseph Brandwein, Qi-long Yi. (2007) CD7 expression predicts poor disease free survival and post-remission survival in patients with acute myeloid leukemia and normal karyotype. Leukemia Research 31:2, 157-162
CrossRef322
Kamran Salim, Paul C. Guest, Heather A. Skynner, James G. Bilsland, Timothy P. Bonnert, George McAllister, Ignacio Munoz-Sanjuan. (2007) Identification of Proteomic Changes During Differentiation of Adult Mouse Subventricular Zone Progenitor Cells. Stem Cells and Development 0:0, 071004031550001
CrossRef323
Brunangelo Falini. (2007) Any role for the nucleophosmin ( NPM1 ) gene in myelodysplastic syndromes and acute myeloid leukemia with chromosome 5 abnormalities?. Leukemia & Lymphoma 48:11, 2093-2095
CrossRef324
Yue Zhang, Meirong Zhang, Lin Yang, Zhijian Xiao. (2007) NPM1 mutations in myelodysplastic syndromes and acute myeloid leukemia with normal karyotype. Leukemia Research 31:1, 109-111
CrossRef325
Masayuki Shiseki, Yukiko Kitagawa, Yan-Hua Wang, Kentaro Yoshinaga, Toshiaki Kondo, Hanae Kuroiwa, Michiko Okada, Naoki Mori, Toshiko Motoji. (2007) Lack of nucleophosmin mutation in patients with myelodysplastic syndrome and acute myeloid leukemia with chromosome 5 abnormalities. Leukemia & Lymphoma 48:11, 2141-2144
CrossRef326
Daniel T. Bergstralh, Brian J. Conti, Chris B. Moore, W. June Brickey, Debra J. Taxman, Jenny P.-Y. Ting. (2007) Global functional analysis of nucleophosmin in Taxol response, cancer, chromatin regulation, and ribosomal DNA transcription. Experimental Cell Research 313:1, 65-76
CrossRef327
H. Dohner. (2007) Implication of the Molecular Characterization of Acute Myeloid Leukemia. Hematology 2007:1, 412-419
CrossRef328
J. Pedersen-Bjergaard, M. T. Andersen, M. K. Andersen. (2007) Genetic Pathways in the Pathogenesis of Therapy-Related Myelodysplasia and Acute Myeloid Leukemia. Hematology 2007:1, 392-397
CrossRef329
Torsten Haferlach, Ulrike Bacher, Wolfgang Kern, Susanne Schnittger, Winfried Gassmann, Claudia Haferlach. (2007) A comprehensive approach to the diagnosis of MDS after triage by morphology towards cytogenetics and other techniques. Cancer Treatment Reviews 33, S31-S41
CrossRef330
Sebastian Scholl, Christian Melle, Annett Bleul, Baerbel Spies-Weisshart, Christa Kunert, Klaus Höffken, Ferdinand von Eggeling. (2007) Specific pattern of protein expression in acute myeloid leukemia harboring FLT3-ITD mutations. Leukemia & Lymphoma 48:12, 2418-2423
CrossRef331
Ruth A. Gjerset. (2006) DNA damage, p14ARF, Nucleophosmin (NPM/B23), and cancer. Journal of Molecular Histology 37:5-7, 239-251
CrossRef332
J Pedersen-Bjergaard, D H Christiansen, F Desta, M K Andersen. (2006) Alternative genetic pathways and cooperating genetic abnormalities in the pathogenesis of therapy-related myelodysplasia and acute myeloid leukemia. Leukemia 20:11, 1943-1949
CrossRef333
Elihu Estey, Hartmut Döhner. (2006) Acute myeloid leukaemia. The Lancet 368:9550, 1894-1907
CrossRef334
, D. W. Milligan, D. Grimwade, J. O. Cullis, L. Bond, D. Swirsky, C. Craddock, J. Kell, J. Homewood, K. Campbell, S. McGinley, K. Wheatley, G. Jackson. (2006) Guidelines on the management of acute myeloid leukaemia in adults. British Journal of Haematology 135:4, 450-474
CrossRef335
William Y. Kim, Norman E. Sharpless. (2006) The Regulation of INK4/ARF in Cancer and Aging. Cell 127:2, 265-275
CrossRef336
Tomoki Naoe, Tatsuya Suzuki, Hitoshi Kiyoi, Takeshi Urano. (2006) Nucleophosmin: A versatile molecule associated with hematological malignancies. Cancer Science 97:10, 963-969
CrossRef337
L-I Lin, T-C Lin, W-C Chou, J-L Tang, D-T Lin, H-F Tien. (2006) A novel fluorescence-based multiplex PCR assay for rapid simultaneous detection of CEBPA mutations and NPM mutations in patients with acute myeloid leukemias. Leukemia 20:10, 1899-1903
CrossRef338
F Buccisano, L Maurillo, V Gattei, G Del Poeta, M I Del Principe, M C Cox, P Panetta, M Irno Consalvo, C Mazzone, B Neri, L Ottaviani, D Fraboni, A Tamburini, F Lo-Coco, S Amadori, A Venditti. (2006) The kinetics of reduction of minimal residual disease impacts on duration of response and survival of patients with acute myeloid leukemia. Leukemia 20:10, 1783-1789
CrossRef339
C Thiede, E Creutzig, T Illmer, M Schaich, V Heise, G Ehninger, O Landt. (2006) Rapid and sensitive typing of NPM1 mutations using LNA-mediated PCR clamping. Leukemia 20:10, 1897-1899
CrossRef340
Charles J. Sherr. (2006) Divorcing ARF and p53: an unsettled case. Nature Reviews Cancer 6:9, 663-673
CrossRef341
V Bardet, L D Costa, C Elie, S Malinge, C Demur, J Tamburini, P C Lefebvre, F Witz, B Lioure, E Jourdan, A Pigneux, N Ifrah, M Attal, F Dreyfus, P Mayeux, C Lacombe, A Bennaceur-Griscelli, O A Bernard, D Bouscary, C Récher. (2006) Nucleophosmin status may influence the therapeutic decision in de novo acute myeloid leukemia with normal karyotype. Leukemia 20:9, 1644-1646
CrossRef342
Mireia Camós, Dolors Colomer. (2006) Molecular biology in acute leukemia. Clinical and Translational Oncology 8:8, 550-559
CrossRef343
Elizabeth A. Rush, Kimberly W. Schlesinger, Simon C. Watkins, Robert L. Redner. (2006) The NPM-RAR fusion protein associated with the t(5;17) variant of APL does not interact with PML. Leukemia Research 30:8, 979-986
CrossRef344
A R Mariano, E Colombo, L Luzi, P Martinelli, S Volorio, L Bernard, N Meani, R Bergomas, M Alcalay, P G Pelicci. (2006) Cytoplasmic localization of NPM in myeloid leukemias is dictated by gain-of-function mutations that create a functional nuclear export signal. Oncogene 25:31, 4376-4380
CrossRef345
Silvia Grisendi, Cristina Mecucci, Brunangelo Falini, Pier Paolo Pandolfi. (2006) Nucleophosmin and cancer. Nature Reviews Cancer 6:7, 493-505
CrossRef346
Jonathan S. C. Caudill, Alexander J. Sternberg, Chin-Yang Li, Ayalew Tefferi, Terra L. Lasho, David P. Steensma. (2006) C-terminal nucleophosmin mutations are uncommon in chronic myeloid disorders. British Journal of Haematology 133:6, 638-641
CrossRef347
P Gorello, G Cazzaniga, F Alberti, M G Dell'Oro, E Gottardi, G Specchia, G Roti, R Rosati, M F Martelli, D Diverio, F Lo Coco, A Biondi, G Saglio, C Mecucci, B Falini. (2006) Quantitative assessment of minimal residual disease in acute myeloid leukemia carrying nucleophosmin (NPM1) gene mutations. Leukemia 20:6, 1103-1108
CrossRef348
Giovanni Roti, Roberto Rosati, Rossella Bonasso, Paolo Gorello, Daniela Diverio, Massimo Fabrizio Martelli, Brunangelo Falini, Cristina Mecucci. (2006) Denaturing High-Performance Liquid Chromatography. The Journal of Molecular Diagnostics 8:2, 254-259
CrossRef349
Niccolò Bolli, Sara Galimberti, Maria P Martelli, Alessia Tabarrini, Giovanni Roti, Cristina Mecucci, Massimo F Martelli, Mario Petrini, Brunangelo Falini. (2006) Cytoplasmic nucleophosmin in myeloid sarcoma occurring 20 years after diagnosis of acute myeloid leukaemia. The Lancet Oncology 7:4, 350-352
CrossRef350
E M Rego, D Ruggero, C Tribioli, G Cattoretti, S Kogan, R L Redner, P P Pandolfi. (2006) Leukemia with distinct phenotypes in transgenic mice expressing PML/RARα, PLZF/RARα or NPM/RARα. Oncogene 25:13, 1974-1979
CrossRef351
B Falini, B Bigerna, A Pucciarini, E Tiacci, C Mecucci, S W Morris, N Bolli, R Rosati, S Hanissian, Z Ma, Y Sun, E Colombo, D A Arber, R Pacini, R La Starza, B V Galletti, A Liso, M P Martelli, D Diverio, P-g Pelicci, F L Coco, M F Martelli. (2006) Aberrant subcellular expression of nucleophosmin and NPM-MLF1 fusion protein in acute myeloid leukaemia carrying t(3;5): A comparison with NPMc+ AML. Leukemia 20:2, 368-371
CrossRef352
Colin Kwok, Bernd B. Zeisig, Shuo Dong, Chi Wai Eric So. (2006) Forced homo-oligomerization of RARα leads to transformation of primary hematopoietic cells. Cancer Cell 9:2, 95-108
CrossRef353
R Berger, M Busson, L Baranger, C Hélias, M Lessard, N Dastugue, F Speleman. (2006) Loss of the NPM1 gene in myeloid disorders with chromosome 5 rearrangements. Leukemia 20:2, 319-321
CrossRef354
Sindhu Cherian, Adam Bagg. (2006) The genetics of the myelodysplastic syndromes: Classical cytogenetics and recent molecular insights. Hematology 11:1, 1-13
CrossRef355
E. J. Jabbour, E. Estey, H. M. Kantarjian. (2006) Adult Acute Myeloid Leukemia. Mayo Clinic Proceedings 81:2, 247-260
CrossRef356
Beatrice U Mueller, Thomas Pabst. (2006) C/EBPα and the pathophysiology of acute myeloid leukemia. Current Opinion in Hematology 13:1, 7-14
CrossRef357
L. Kearney. (2006) Multiplex-FISH (M-FISH): technique, developments and applications. Cytogenetic and Genome Research 114:3-4, 189-198
CrossRef358
Tomohiko Taki, Masafumi Taniwaki. (2006) Chromosomal translocations in cancer and their relevance for therapy. Current Opinion in Oncology 18:1, 62-68
CrossRef359
Marcus Kremer, Leticia Quintanilla-Martínez, Jörg Nährig, Christoph Schilling, Falko Fend. (2005) Immunohistochemistry in bone marrow pathology: a useful adjunct for morphologic diagnosis. Virchows Archiv 447:6, 920-937
CrossRef360
June Li, Xiaoling Zhang, Daniel P. Sejas, Qishen Pang. (2005) Negative regulation of p53 by nucleophosmin antagonizes stress-induced apoptosis in human normal and malignant hematopoietic cells. Leukemia Research 29:12, 1415-1423
CrossRef361
W. Hiddemann, K. Spiekermann, C. Buske, M. Feuring-Buske, J. Braess, T. Haferlach, C. Schoch, W. Kern, S. Schnittger, W. Berdel, B. Wörmann, A. Heinecke, C. Sauerland, Th. Büchner. (2005) Towards a pathogenesis-oriented therapy of acute myeloid leukemia. Critical Reviews in Oncology/Hematology 56:2, 235-245
CrossRef362
B Delaval, H Lelièvre, D Birnbaum. (2005) Myeloproliferative disorders: the centrosome connection. Leukemia 19:10, 1739-1744
CrossRef363
H Quentmeier, M P Martelli, W G Dirks, N Bolli, A Liso, R A F MacLeod, I Nicoletti, R Mannucci, A Pucciarini, B Bigerna, M F Martelli, C Mecucci, H G Drexler, B Falini. (2005) Cell line OCI/AML3 bears exon-12 NPM gene mutation-A and cytoplasmic expression of nucleophosmin. Leukemia 19:10, 1760-1767
CrossRef364
Silvia Grisendi, Rosa Bernardi, Marco Rossi, Ke Cheng, Luipa Khandker, Katia Manova, Pier Paolo Pandolfi. (2005) Role of nucleophosmin in embryonic development and tumorigenesis. Nature 437:7055, 147-153
CrossRef365
N I Noguera, E Ammatuna, D Zangrilli, S Lavorgna, M Divona, F Buccisano, S Amadori, C Mecucci, B Falini, F Lo-Coco. (2005) Simultaneous detection of NPM1 and FLT3-ITD mutations by capillary electrophoresis in acute myeloid leukemia. Leukemia 19:8, 1479-1482
CrossRef366
Goberdhan P. Dimri. (2005) What has senescence got to do with cancer?. Cancer Cell 7:6, 505-512
CrossRef367
A. J. BENCH, W. N. ERBER, M. A. SCOTT. (2005) Molecular genetic analysis of haematological malignancies: I. Acute leukaemias and myeloproliferative disorders. Clinical and Laboratory Haematology 27:3, 148-171
CrossRef368
(2005) Nucleophosmin in Acute Myelogenous Leukemia. New England Journal of Medicine 352:17, 1819-1820
Full Text369
Sara Alvarez, Juan C. Cigudosa. (2005) Gains, losses and complex karyotypes in myeloid disorders: a light at the end of the tunnel. Hematological Oncology 23:1, 18-25
CrossRef370
Emma Greenwood. (2005) Leukaemia: Space shuttle. Nature Reviews Cancer 5:3, 157-157
CrossRef371
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Ebeling, Sally H.Ellender, Stacey M.Peters, Christine C., Ballen, Karen K., Hasserjian, Robert P., . (2005) Case 2-2005. New England Journal of Medicine 352:3, 274-283
Full Text372
Grisendi, Silvia, Pandolfi, Pier Paolo, . (2005) NPM Mutations in Acute Myelogenous Leukemia. New England Journal of Medicine 352:3, 291-292
Full Text373
S. GRISENDI, P.P. PANDOLFI. (2005) Two Decades of Cancer Genetics: From Specificity to Pleiotropic Networks. Cold Spring Harbor Symposia on Quantitative Biology 70:1, 83-91
CrossRef
- Letters
