Original Article
Brief Report
Inherited Perforin and Fas Mutations in a Patient with Autoimmune Lymphoproliferative Syndrome and Lymphoma
N Engl J Med 2004; 351:1419-1424September 30, 2004
- Abstract
A 27-year-old man with the autoimmune lymphoproliferative syndrome and a large-B-cell lymphoma had heterozygous mutations in the Fas and perforin (Prf1) genes. The Fas mutation was inherited from his healthy father and was also carried by his healthy brother, whereas the Prf1 mutation was inherited from his healthy mother. The combined effect of the two mutant genes may have contributed to the development of the autoimmune lymphoproliferative syndrome and lymphoma in this patient.
Media in This Article
Figure 1
Pedigree of the Patient.Figure 2
Results of Gel Electrophoresis of PCR Products from the Patient's cDNA (Panel A) and Fas Transcripts in the Patient (Panel B).Article Activity
- Article
The autoimmune lymphoproliferative syndrome (ALPS) is a rare disorder in children that is characterized by splenomegaly and massive lymphadenopathy with autoimmune manifestations and an accumulation of double-negative (CD3+CD4–CD8–) T cells with α/β T-cell receptors in the blood.1-6 In some patients, solid or hematologic cancers,5,6 including Hodgkin's and non-Hodgkin's lymphomas, also develop.7 The genetic defect responsible for this syndrome is in most cases a mutation in the Fas gene.1,2
Fas (also called Apo-1 and CD95), a member of the superfamily of tumor necrosis factor and nerve growth factor receptors, induces apoptosis of lymphocytes when triggered by its ligand (FasL).8 The interaction between Fas and FasL causes trimerization of Fas and the formation of the death-inducing signaling complex, which initiates a cascade of caspases that culminates in the apoptotic death of the cell.9 The Fas–FasL system maintains lymphocyte homeostasis8,9: loss-of-function mutations in the Fas (TNFRSF6) or FasL gene results in the accumulation of lymphocytes, as seen in mice with lpr and gld mutations10 and in patients with ALPS.1,6 Most patients with ALPS have mutations in Fas and are classified as having ALPS type Ia6; others have mutations in FasL (ALPS type Ib) or caspase 10 (ALPS type II).6,11,12 Autosomal recessive inheritance has been described in a minority of patients with ALPS in whom both Fas alleles are mutated. The form of inheritance of ALPS associated with a heterozygous Fas mutation is less clear, since some heterozygous carriers are asymptomatic.6 This variability in the patterns of inheritance may be due to mutations in other genes.
The mechanism of lymphomagenesis in patients with ALPS is also unclear. Defective Fas-mediated apoptosis may impair the body's ability to protect against B-cell cancers,7 but faulty immune surveillance may also be responsible.13 In this regard, the integrity of the perforin–granzyme pathway of cell-mediated killing appears to be critical.14 Perforin, a pore-forming molecule in granules of cytotoxic lymphocytes, is indispensable in the granule–exocytosis pathway of killing, and is thought to have a role in protection against viral infections and tumors that is mediated by T cells and natural killer cells.14 Indeed, an increased incidence of lymphomas has been associated with perforin deficiency in mice.15 We describe a patient with ALPS and mutations in Fas and the perforin gene (Prf1) in whom a non-Hodgkin's lymphoma developed.
Case Report
A 27-year-old man presented with bulky cervical lymphadenopathy. Splenomegaly had been identified when he was three years old. Four years later, intestinal obstruction due to mesenteric lymphadenopathy and severe thrombocytopenia requiring splenectomy developed. At the age of 18 years, he received a diagnosis of chronic hepatitis C infection, but viremia persisted despite treatment with interferon alfa. At the age of 25 years, he underwent a biopsy of a cervical lymph node because of adenopathy, which disclosed reactive follicular hyperplasia; a bone marrow biopsy did not reveal lymphoma. ALPS was diagnosed, and the patient underwent excision of cervical lymph nodes. Two years later, cervical lymphadenopathy recurred, with fever, weight loss, and itching; a lymph-node biopsy was diagnostic of a T-cell–rich, histiocyte-rich, diffuse large-B-cell lymphoma, according to the World Health Organization classification. Staging demonstrated multiple sites of involvement, including the liver and bone marrow. After two cycles of doxorubicin, prednisone, and vincristine and two cycles of dexamethasone, cytarabine, and cisplatin, worsening liver function precluded further chemotherapy. Shortly thereafter, the patient died of progressive lymphoma.
Methods
Flow Cytometry
Lymphocyte subpopulations in peripheral-blood mononuclear cells were analyzed by means of flow cytometry. Fas-mediated apoptosis of phytohemagglutinin A–activated lymphoblasts, which were cultured for 18 days, was evaluated by means of cytofluorimetric determination of the binding of fluorescein isothiocyanate–labeled annexin V (Bender MedSystem) after treatment of the cells with the IgM anti-Fas monoclonal antibody CH-11 (MBL). The perforin content of peripheral-blood mononuclear cells was determined in fixed and permeabilized cells (Cytofix-Cytoperm, BD PharMingen) with the use of a phycoerythrin-conjugated antibody against perforin (BD PharMingen).
Sequencing of the Fas Gene
Peripheral-blood mononuclear cells were obtained from the patient and his first-degree relatives after they had provided written informed consent. Genomic DNA and total RNA were extracted according to standard methods. The Fas gene (exons and intron boundaries) was sequenced with the use of genomic DNA as a substrate for amplification by means of the polymerase chain reaction (PCR). As described previously,16 reverse-transcriptase (RT) PCR was performed from total RNA with the use of primers mapping within exon 5 (5'AAGGAATGCACACTCACCAG3') and exon 9 (5'CAATGTGTCATACGCTTCT3') as forward and reverse primers, respectively. PCR products were subjected to agarose-gel electrophoresis, excised from the gel, and sequenced.
Sequencing of the Perforin Gene
Genomic DNA was isolated from peripheral-blood mononuclear cells, and exons 2 and 3 of the coding region of the Prf1 gene were amplified with the use of standard PCR conditions. The primers used for amplification have been described previously.17 PCR products were purified with the use of Microcon PCR filter units (Millipore) and then sequenced in an automatic sequencer (ABI 3730XL, Applied Biosystems).
Cytotoxicity Assays
The natural killer activity of peripheral-blood mononuclear cells was assessed by means of standard chromium-51–release assays with the use of the K562 cell line, which is sensitive to natural killer cells, as a target. Results are expressed as the percentage of cell-specific lysis. Anti-CD3–dependent cytotoxic activity was measured against Fas-deficient L1210-3 target cells (kindly provided by P. Golstein, Marseille, France), according to a previously described method.17
Results and Discussion
Our patient with ALPS and a non-Hodgkin's lymphoma carried heterozygous mutations of Fas and Prf1, both of which are located on chromosome 10.1,17 The Fas mutation, inherited from his healthy father, was also found in a healthy brother, whereas the Prf1 mutation was detected in his healthy mother (Figure 1Figure 1
Pedigree of the Patient.).The diagnosis of ALPS in this patient was made on the basis of three criteria proposed by the National Institutes of Health ALPS group5: chronic accumulation of nonmalignant lymphoid cells, an increase in double-negative α/β+ T cells in the blood (32 percent of all CD3+ T cells, as compared with less than 2 percent in normal donors), and defective in vitro Fas-mediated apoptosis (3 percent of cells were positive for annexin V, as compared with 33 percent in one healthy subject). The patient's Fas gene had a novel point mutation in intron 7 (the substitution of A for G), affecting a canonical splicing site (IVS7 at nucleotide 1) (Figure 1 and Figure 2Figure 2
Results of Gel Electrophoresis of PCR Products from the Patient's cDNA (Panel A) and Fas Transcripts in the Patient (Panel B).). This mutation causes the skipping of exon 7 and a frame shift in exon 8. The frame shift reveals a stop codon in exon 8. Abnormally spliced products lacking exon 7 were identified by analysis of complementary DNA (cDNA) (Figure 2). The predicted protein would lack the death domain of Fas, which is required for the induction of apoptosis.9 Our patient was therefore classified as having ALPS type Ia. The same Fas mutation was found in his father and brother, who had no evidence of ALPS and were healthy. However, their lymphocytes had impaired Fas-mediated apoptosis in vitro (data not shown), as has been reported in other mutation-positive healthy relatives of patients with ALPS.3 The mutant protein was not detected in the lymphocyte lysate by Western blotting with the use of a monoclonal antibody against the extracellular portion of Fas (data not shown). One explanation for this finding is that the mutant messenger RNA underwent nonsense-mediated decay, a specific RNA-degradation process that is believed to prevent the expression of peptides that could have dominant negative effects on the cell.20 The fact that we detected the mutant cDNA by means of RT-PCR does not vitiate this hypothesis, because we did not use a quantitative approach.
The particularly aggressive course of the lymphoma in our patient prompted us to look for mutations in other genes besides Fas. Among the candidates we investigated was the Prf1 gene. In our patient, the Prf1 gene had a point mutation in exon 3 (755A→G), causing a change from asparagine to serine at position 252 (N252S). This mutation occurs within the membrane-attack complex, a region critically involved in the pore-forming activity of the molecule.21 The same mutation was found in our patient's healthy mother (Figure 1). Biallelic Prf1 mutations have been found in about 40 percent of cases of familial hemophagocytic lymphohistiocytosis,17,22-24 a rare, life-threatening immune deficiency affecting infants and young adults. A patient with this disorder and the same heterozygous Prf1 mutation as that in our patient has been described.17 This mutation was not found in 25 Italian patients with familial hemophagocytic lymphohistiocytosis or in 50 healthy Italian control subjects (data not shown).
Peripheral-blood mononuclear cells from the above-mentioned patient with familial hemophagocytic lymphohistiocytosis and a heterozygous Prf1 mutation17 had reduced cytotoxic activity and grossly deficient perforin levels, suggesting a second, as yet undetermined, mutation affecting perforin expression.17 By contrast, peripheral-blood mononuclear cells from our patient and his mother had normal intracellular levels of perforin (data not shown), and the levels of activity of natural killer cells and cytotoxic T cells were similar to those in healthy controls (Figure 3Figure 3
Cyotoxic Activity of Peripheral-Blood Mononuclear Cells from the Patient, His Mother, and Two Healthy Controls.). These results were not surprising, given the reported lack of a dominant negative effect of this particular Prf1 mutation17; moreover, the wide range of in vitro cytotoxic activity of normal natural killer cells and cytotoxic T cells makes a partial deficiency — as would be expected in persons who were heterozygous for a Prf1 mutation — difficult to identify.The development of non-Hodgkin's lymphoma in our patient supports the reported increase in the risk of lymphoma among patients with germ-line Fas mutations and ALPS.7 Moreover, clonal somatic Fas mutations have been found in B-cell lymphomas that were not associated with ALPS.25 Our patient, and all other patients with ALPS in whom a lymphoma developed, carried a mutation that altered the intracytoplasmic region of the death domain of Fas. These changes usually cause the greatest defect in Fas-mediated apoptosis, have the highest penetrance, and are associated with the most severe symptoms.7
In conclusion, we propose that ALPS and lymphoma developed in our patient owing to a combined effect of mutations in Fas and Prf1. A perforin mutation may be one of the additional defects contributing to the development of lymphoma in patients with ALPS, possibly in conjunction with other, unknown factors. Defective Fas-mediated apoptosis could allow the prolonged survival of lymphocytes, which might then become targets of transforming events, whereas defects in Fas-mediated killing and in the granule–exocytosis pathway would impair immune surveillance for transformed cells. This proposal is consistent with evidence that immune surveillance prevents the development of lymphomas from clonal B cells in aging mice with lpr and gld mutations.13
Supported in part by grants from the Histiocyte Society and the Istituto di Ricovero e Cura a Carattere Scientifico San Matteo (to Dr. Danesino), the Ministero dell'Università e Ricerca Scientifica e Tecnologica (to Dr. Sabbadini), and Telethon (E1170, to Dr. Umberto Dianzani).
Drs. Ferrarini and Bregni contributed equally to this article.
We are indebted to Sara Deola and M.G. Roncarolo for helpful discussions, to P. Golstein for providing the L1210-3 cell line, and to S. Trifari and A. Moretta for technical support.
Source Information
From the Department of Biology and Medical Genetics, University of Pavia, Pavia (R.C., C.D.); the Department of Pediatric Hematology–Oncology (R.C., A. Cometa, R.M., F.L.), Istituto di Ricovero e Cura a Carattere Scientifico Policlinico San Matteo, Pavia; the Department of Oncology–Laboratory of Tumor Immunology (L. Dagna, M.F.), the Unit of Hematology–Bone Marrow Transplantation (F.C., M.B.), the Department of Pathology (M.P.), the Clinical Immunology and Rheumatology Unit (M.G.S.), and the Telethon Institute for Gene Therapy (L. Dupré), Istituto di Ricovero e Cura a Carattere Scientifico Ospedale San Raffaele, Milan; Vita-Salute San Raffaele University School of Medicine, Milan (L. Dagna, M.G.S., C.R.); and the Interdisciplinary Research Center of Autoimmune Diseases and Department of Medical Sciences, A. Avogadro University of Eastern Piedmont, Novara (U.D., I.D., A. Chiocchetti) — all in Italy.
Address reprint requests to Dr. Bregni at the Unit of Hematology–Bone Marrow Transplantation, Istituto Scientifico H. San Raffaele, 20132 Milan, Italy, or at marco.bregni@hsr.it.
- References
References
1
Fisher GH ,Rosenberg FJ ,Straus SE , et al. Dominant interfering Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome. Cell 1995;81:935-946
CrossRef | Web of Science | Medline2
Rieux-Laucat F ,Le Deist F ,Hivroz C , et al. Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science 1995;268:1347-1349
CrossRef | Web of Science | Medline3
Bleesing JJ ,Brown MR ,Straus SE , et al. Immunophenotypic profiles in families with autoimmune lymphoproliferative syndrome. Blood 2001;98:2466-2473
CrossRef | Web of Science | Medline4
Bettinardi A ,Brugnoni D ,Quiros-Roldan E , et al. Missense mutations in the Fas gene resulting in autoimmune lymphoproliferative syndrome: a molecular and immunological analysis. Blood 1997;89:902-909
Web of Science | Medline5
Sneller MC ,Dale JK ,Straus SE . Autoimmune lymphoproliferative syndrome. Curr Opin Rheumatol 2003;15:417-421
CrossRef | Web of Science | Medline6
Rieux-Laucat F ,Fischer A ,Le Deist F . Cell-death signaling and human disease. Curr Opin Immunol 2003;15:325-331
CrossRef | Web of Science | Medline7
Straus SE ,Jaffe ES ,Puck JM , et al. The development of lymphomas in families with autoimmune lymphoproliferative syndrome with germline Fas mutations and defective lymphocyte apoptosis. Blood 2001;98:194-200
CrossRef | Web of Science | Medline8
Nagata S ,Golstein P . The Fas death factor. Science 1995;267:1449-1456
CrossRef | Web of Science | Medline9
Krammer PH . CD95's deadly mission in the immune system. Nature 2000;407:789-795
CrossRef | Web of Science | Medline10
Nagata S ,Suda T . Fas and Fas ligand: lpr and gld mutations. Immunol Today 1995;16:39-43
CrossRef | Medline11
Wu J ,Wilson J ,He J ,Xiang L ,Schur PH ,Mountz JD . Fas ligand mutation in a patient with systemic lupus erythematosus and lymphoproliferative disease. J Clin Invest 1996;98:1107-1113
CrossRef | Web of Science | Medline12
Wang J ,Zheng L ,Lobito A , et al. Inherited human Caspase 10 mutations underlie defective lymphocyte and dendritic cell apoptosis in autoimmune lymphoproliferative syndrome type II. Cell 1999;98:47-58
CrossRef | Web of Science | Medline13
Davidson WF ,Giese T ,Fredrickson TN . Spontaneous development of plasmacytoid tumors in mice with defective Fas-Fas ligand interactions. J Exp Med 1998;187:1825-1838
CrossRef | Web of Science | Medline14
Trapani JA ,Smyth MJ . Functional significance of the perforin/granzyme cell death pathway. Nat Rev Immunol 2002;2:735-747
CrossRef | Web of Science | Medline15
Smyth MJ ,Thia KY ,Street SE ,MacGregor D ,Godfrey DI ,Trapani JA . Perforin-mediated cytotoxicity is critical for surveillance of spontaneous lymphoma. J Exp Med 2000;192:755-760
CrossRef | Web of Science | Medline16
Ramenghi U ,Bonissoni S ,Migliaretti G , et al. Deficiency of the Fas apoptosis pathway without Fas gene mutations is a familial trait predisposing to development of autoimmune diseases and cancer. Blood 2000;95:3176-3182
Web of Science | Medline17
Stepp SE ,Dufourcq-Lagelouse R ,Le Deist F , et al. Perforin gene defects in familial hemophagocytic lymphohistiocytosis. Science 1999;286:1957-1959
CrossRef | Web of Science | Medline18
Cascino I ,Fiucci G ,Papoff G ,Ruberti G . Three functional soluble forms of the human apoptosis-inducing Fas molecule are produced by alternative splicing. J Immunol 1995;154:2706-2713
Web of Science | Medline19
Pignata C ,Alessio M ,Ramenghi U , et al. Clustering of distinct autoimmune diseases associated with functional abnormalities of T cell survival in children. Clin Exp Immunol 2000;121:53-58
CrossRef | Web of Science | Medline20
Vasudevan S ,Peltz SW . Nuclear mRNA surveillance. Curr Opin Cell Biol 2003;15:332-337
CrossRef | Web of Science | Medline21
Lichtenheld MG ,Podack ER . Structure of the human perforin gene: a simple gene organization with interesting potential regulatory sequences. J Immunol 1989;143:4267-4274
Web of Science | Medline22
Ueda I ,Morimoto A ,Inaba T , et al. Characteristic perforin gene mutations of haemophagocytic lymphohistiocytosis patients in Japan. Br J Haematol 2003;121:503-510
CrossRef | Web of Science | Medline23
Feldmann J ,Le Deist F ,Ouachee-Chardin M , et al. Functional consequences of perforin gene mutations in 22 patients with familial haemophagocytic lymphohistiocytosis. Br J Haematol 2002;117:965-972
CrossRef | Web of Science | Medline24
Clementi R ,zur Stadt U ,Savoldi G , et al. Six novel mutations in the PRF1 gene in children with haemophagocytic lymphohistiocytosis. J Med Genet 2001;38:643-646
CrossRef | Web of Science | Medline25
Muschen M ,Rajewsky K ,Kronke M ,Kuppers R . The origin of CD95-gene mutations in B-cell lymphoma. Trends Immunol 2002;23:75-80
CrossRef | Web of Science | Medline
- Citing Articles (18)
Citing Articles
1
Amy P. Hsu, Kennichi C. Dowdell, Joie Davis, Julie E. Niemela, Stacie M. Anderson, Pamela A. Shaw, V. Koneti Rao, Jennifer M. Puck. (2012) Autoimmune lymphoproliferative syndrome due to FAS mutations outside the signal-transducing death domain: molecular mechanisms and clinical penetrance. Genetics in Medicine 14:1, 81-89
CrossRef2
M. Chen, K. Felix, J. Wang. (2011) Critical role for perforin- and Fas-dependent killing of dendritic cells in the control of inflammation. Blood
CrossRef3
K. Zhang, M. B. Jordan, R. A. Marsh, J. A. Johnson, D. Kissell, J. Meller, J. Villanueva, K. A. Risma, Q. Wei, P. S. Klein, A. H. Filipovich. (2011) Hypomorphic mutations in PRF1, MUNC13-4, and STXBP2 are associated with adult-onset familial hemophagocytic lymphohistiocytosis. Blood
CrossRef4
Tamara Y. Chang, Julie Jaffray, Bruce Woda, Peter E. Newburger, G. Naheed Usmani. (2011) Hemophagocytic lymphohistiocytosis with MUNC13-4 gene mutation or reduced natural killer cell function prior to onset of childhood leukemia. Pediatric Blood & Cancer 56:5, 856-858
CrossRef5
Liyun Yang, Hongxing Liu, Jun Zhao, Wanming Da, Jingchen Zheng, Lixiang Wang, Gong Li, Ping Zhu. (2011) Mutations of perforin gene in Chinese patients with acute lymphoblastic leukemia. Leukemia Research 35:2, 196-199
CrossRef6
Rim El Abed, Violaine Bourdon, Ilia Voskoboinik, Halima Omri, Yosra Youssef, Mohamed Laatiri, Laetitia Huiart, François Eisinger, Laetitia Rabayrol, Marc Frenay, Paul Gesta, Liliane Demange, Hélène Dreyfus, Valérie Bonadona, Catherine Dugast, Hélène Zattara, Laurence Faivre, Monia Zaier, Saloua Jemni, Testsuro Noguchi, Hagay Sobol, Zohra Soua. (2011) Molecular study of the perforin gene in familial hematological malignancies. Hereditary Cancer in Clinical Practice 9:1, 9
CrossRef7
Rita Clementi. (2009) Request for Clarifications on paper published. Acta Paediatrica 98:12, 1864-1865
CrossRef8
Helen C. Su, Michael J. Lenardo. (2008) Genetic Defects of Apoptosis and Primary Immunodeficiency. Immunology and Allergy Clinics of North America 28:2, 329-351
CrossRef9
Samir Kumar Patra. (2008) Dissecting lipid raft facilitated cell signaling pathways in cancer. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1785:2, 182-206
CrossRef10
Elisa Zavattaro, Barbara Azzimonti, Michele Mondini, Marco De Andrea, Cinzia Borgogna, Valentina Dell'Oste, Massimo Ferretti, Stefania Nicola, Giuseppe Cappellano, Adriana Carando, Giorgio Leigheb, Santo Landolfo, Umberto Dianzani, Marisa Gariglio. (2008) Identification of Defective Fas Function and Variation of the Perforin Gene in an Epidermodysplasia Verruciformis Patient Lacking EVER1 and EVER2 Mutations. Journal of Investigative Dermatology 128:3, 732-735
CrossRef11
V. Mateo, M. Menager, G. de Saint-Basile, M.-C. Stolzenberg, B. Roquelaure, N. Andre, B. Florkin, F. le Deist, C. Picard, A. Fischer, F. Rieux-Laucat. (2007) Perforin-dependent apoptosis functionally compensates Fas deficiency in activation-induced cell death of human T lymphocytes. Blood 110:13, 4285-4292
CrossRef12
K. Zhang, J. A. Johnson, J. Biroschak, J. Villanueva, S. Molleran Lee, J. J. Bleesing, K. A. Risma, R. J. Wenstrup, A. H. Filipovich. (2007) Familial haemophagocytic lymphohistiocytosis in patients who are heterozygous for the A91V perforin variation is often associated with other genetic defects. International Journal of Immunogenetics 34:4, 231-233
CrossRef13
Michael Borte, Bodo Grimbacher, Tim Niehues, Ellen Renner, Joachim Roesler, Volker Schuster. 2007. Immundefekte. , 667-706.
CrossRef14
P A Mehta, S M Davies, A Kumar, M Devidas, S Lee, T Zamzow, J Elliott, J Villanueva, J Pullen, Y Zewge, A Filipovich. (2006) Perforin polymorphism A91V and susceptibility to B-precursor childhood acute lymphoblastic leukemia: a report from the Children's Oncology Group. Leukemia 20:9, 1539-1541
CrossRef15
Nicolas Bidère, Helen C. Su, Michael J. Lenardo. (2006) GENETIC DISORDERS OF PROGRAMMED CELL DEATH IN THE IMMUNE SYSTEM *. Annual Review of Immunology 24:1, 321-352
CrossRef16
Robert Brawura-Biskupski-Samaha, Tomasz Grzela. (2006) Autoimmune Lymphoproliferative Syndrome – Impaired Regulation of the Immune Response by Impaired Induction of Apoptosis. Transfusion Medicine and Hemotherapy 33:1, 71-79
CrossRef17
(2005) Autoimmune Lymphoproliferative Syndrome and Perforin. New England Journal of Medicine 352:3, 306-307
Full Text18
Puck, Jennifer M., Straus, Stephen E., . (2004) Somatic Mutations — Not Just for Cancer Anymore. New England Journal of Medicine 351:14, 1388-1390
Full Text
- Letters
