Original Article
Brief Report
Mutation of CEBPA in Familial Acute Myeloid Leukemia
N Engl J Med 2004; 351:2403-2407December 2, 2004
- Abstract
We describe a family in whom three members affected by acute myeloid leukemia (AML) had an identical, 212delC mutation in CEBPA, the gene encoding the granulocytic differentiation factor C/EBPα. Unaffected family members did not have this mutation. Latent periods of 10, 18, and 30 years elapsed before the onset of overt leukemia in the three patients. One of them had a second CEBPA mutation, but only at the time of diagnosis. All three patients are currently well, with no abnormalities in the bone marrow. CEBPA mutation is apparently the primary event in the development of AML in this family.
Media in This Article
Figure 1
Schematic Representation of CEBPA. Figure 2
The Patients' Family Tree.Article Activity
- Article
Inherited acute myeloid leukemia (AML) has been reported in only a few families outside of a syndromic setting such as trisomy 21 or a disorder involving defective DNA repair. True nonsyndromic familial AML, a heterogeneous group of disorders, includes autosomal recessive forms that become manifest during childhood in association with myelodysplasia and monosomy 7, as well as autosomal dominant forms that are preceded by various types of a dysplastic phase and that vary in morphologic subtype. The only genetic abnormality that has been identified in these disorders is one identified in the syndrome called familial platelet disorder with predisposition to AML: mutations in the gene encoding runt-related transcription factor 1 (RUNX1) have been found in 11 kindreds with this syndrome.1 Acquired mutations have been identified both in RUNX1 and in CEBPA, the gene that encodes CCAAT enhancer binding protein α (C/EBPα) in sporadic, nonfamilial AML.2,3
CEBPA is a single-exon gene in the chromosomal region 19q13.1. C/EBPα, a granulocytic differentiation factor and a member of the bZIP family, consists of N-terminal transactivating domains, a basic region necessary for specific DNA sequence binding, and a leucine-zipper region necessary for dimerization at the C-terminal end (Figure 1AFigure 1
Schematic Representation of CEBPA. ). C/EBPα is important in the regulation of myeloid differentiation. Its presence is a characteristic feature of early myeloid cells, and it regulates a number of granulocyte-specific genes by activating promoters for myeloid-specific growth-factor receptors, such as the granulocyte colony-stimulating factor receptor, and neutrophil granule proteins.4 C/EBPα synergizes with other proteins necessary for the regulation of myelopoiesis, such as RUNX1.5 CEBPA-knockout mice have an early block in myeloid maturation6 and a phenotype similar to AML with differentiation (French–American–British [FAB] subtype M2).7 In this report, we describe a family in which multiple members were affected by AML associated with an identical mutation in CEBPA. A somatic mutation on the second allele of CEBPA was also found in one of the patients.
Case Reports
Two siblings were referred to St. Bartholomew's Hospital, London, within an interval of two weeks, for treatment of AML. Their father had had AML during childhood but was currently in remission. All the other family members were alive and well, with no medical history of note (Figure 2Figure 2
The Patients' Family Tree.).The father, Patient II-3, had received the diagnosis of AML in September 1963, at the age of 10 years. The marrow aspirate was reported to be hypercellular, with 95 percent myeloperoxidase-positive blast cells — a finding that confirmed the diagnosis of AML without maturation (FAB subtype M1). Karyotypic evaluation was not performed. He was treated with prednisolone and mercaptopurine and entered a complete remission. He had a relapse in January 1965 and was treated with prednisolone and methotrexate; the result was a short-lived second remission. He had another relapse, in July 1965, and was treated with cyclophosphamide and prednisolone. This treatment was stopped in October 1965 because of hemorrhagic cystitis. He then entered a lasting remission despite having received inadequate therapy by current standards.
A son, Patient III-1, presented in February 2003, at the age of 30 years. His marrow was hypercellular, with 30 percent myeloperoxidase-positive blast cells containing Auer rods and aberrantly expressed CD7. There were increased numbers of eosinophil precursors — a finding consistent with a diagnosis of AML, subtype M2 with eosinophilia (M2Eo). Cytogenetic evaluation and fluorescence in situ hybridization for the detection of the t(8;21)(q22;q22) translocation both revealed no abnormalities.
A daughter, Patient III-5, who was 18 years of age, saw her general practitioner the week after her brother's admission to the hospital. Her marrow was normocellular but contained 35 percent myeloperoxidase-positive blast cells with Auer rods and aberrantly expressed CD7. The finding that eosinophil precursors were present in increased numbers indicated, as it had in her brother, a diagnosis of AML, subtype M2Eo. Cytogenetic evaluation revealed no abnormalities.
Both Patient III-1 and Patient III-5 received four courses of combination chemotherapy. Both entered a complete remission after the first course of therapy. Shortly after the final course of therapy and discharge, both patients presented with arthralgias, fever, and malaise. Their white-cell counts were high (28,200 per cubic millimeter in Patient III-1 and 20,400 per cubic millimeter in Patient III-5); neither was still receiving granulocyte colony-stimulating factor, and neither had overt sepsis. In both patients the increase in leukocytes was primarily a neutrophilia, with small numbers of myelocytes and promyelocytes in Patient III-5 and mild eosinophilia in Patient III-1. The abnormalities in both patients resolved without medical intervention. Currently, more than 20 months since diagnosis, both patients are well and have normal blood counts.
Methods
We received approval from the local research ethics committee to study the three patients, and written informed consent was obtained from the patients before evaluation. Samples of mononuclear-cell–enriched peripheral blood obtained at diagnosis were available from Patients III-1 and III-5, and peripheral-blood samples and buccal mucosal swab specimens obtained during remission were available from Patients II-3, III-1, and III-5. DNA was extracted with phenol–chloroform.
The entire coding region of CEBPA in all three patients was screened in four overlapping fragments with the use of overlapping sets of primers and under conditions described elsewhere.8 All polymerase-chain-reaction (PCR) fragments were sequenced directly with the use of an ABI 377 DNA sequencer (Applied Biosystems). The sequences of the mutant genes were confirmed by cloning the PCR fragments with a TOPO TA Cloning kit (Invitrogen) and by sequence analysis. Long-range PCR of the biallelic mutation in Patient III-1 was carried out with the use of a TaKaRa LA Taq Kit (Takara Bio). An initial denaturation step at 95°C for 1 minute was followed by 35 cycles of denaturation at 98°C for 15 seconds, a combined annealing-and-extension step at 62°C for 12 minutes, and a final extension step at 72°C for 10 minutes. The primers for the first-round PCR step were designed from the CEBPA bacterial artificial chromosome sequence (GenBank accession number AC008738, clone CTD-2540B15); they were CHR19P1 (5'TTGCCCAGATGAAACTGCTTCTTTACTGCG3'), aligned from 173,185 to 173,156, and CHR19P4 (5'CTGGAATTAGCACTGAACTCAGAGGGTTTG3'), aligned from nucleotide numbers 167,755 to 167,784, to generate a 5.4-kb fragment. The second, nested PCR step involved the use of the previously published primer pair3 — PP1F (5'TCGCCATGCCGGGAGAACTCTAAC3') and PP6R (5'CACGGTCTGGGCAAGCCTCGAGAT3') — to amplify a 1.2-kb fragment containing the entire CEBPA coding region. Position numbering is based on the GenBank DNA sequence number Y11525 and Swiss-Prot protein sequence number P49715.
Results
Patient III-1 was found to have a mutation involving the deletion of a cytosine residue at nucleotide 212 of CEBPA (212delC) in DNA extracted from a peripheral-blood sample obtained at the time of diagnosis (Figure 3Figure 3
Sequence Analysis of a Portion of CEBPA in Patient III-1.). The corresponding protein is predicted to terminate prematurely, at codon 158. His sister, Patient III-5, had an identical CEBPA mutation in DNA extracted from a diagnostic peripheral-blood sample. DNA extracted from peripheral-blood samples obtained during remission and germ-line DNA from buccal-swab specimens from both these patients and from their father (Patient II-3) also had the 212delC CEBPA mutation.CEBPA in the diagnostic blood sample from Patient III-1 also had a 36-bp duplication, which comprised nucleotides 1050 to 1085 and resulted in an internal tandem duplication of amino acids 302 to 313 (KAKQRNVETQQK [where amino acids are denoted by their single-letter codes]) (Figure 1C). Long-range PCR and cloning confirmed that the two mutations were on separate alleles. The duplication was not found in DNA from blood cells taken from this patient during a remission or in DNA from his buccal-swab specimen (germ-line DNA); it also was not found in any of the samples from Patients II-3 and III-5. No other mutations were identified in screened exons or motifs of KRAS, NRAS, KIT, PTPN11, FES, FLT3, or RUNX1 from DNA samples taken at the time of diagnosis from Patient III-1 or III-5 (data not shown).
After these results were obtained, screening for the 212delC mutation was offered to all members of this kindred. After pretest counseling and with the involvement of the Genetics Department of St. Bartholomew's Hospital, written informed consent for mutation analysis was obtained from five healthy family members: II-1, II-2, III-2, III-3, and III-4. Direct sequencing of CEBPA from DNA extracted from peripheral-blood mononuclear cells confirmed the presence of the wild-type sequence in these five family members. All the other family members declined testing.
Discussion
CEBPA mutations occur in sporadic AML at a frequency of 5 to 10 percent, primarily in patients with normal cytogenetic characteristics and the FAB subtypes M1 and M2. It is therefore notable that the two siblings with AML in the family we studied had a normal karyotype and that they both had an uncommon form of the disease — namely, subtype M2Eo. This subtype of AML is occasionally seen in the 10 to 15 percent of patients with a t(8;21)(q22;q22) translocation, which generates an AML1/ETO fusion product. This chimeric protein is known to suppress C/EBPα expression by inhibiting autoregulation of the CEBPA promoter.9 Hence, the M2Eo subtype may arise from the deregulation of a molecular pathway that includes CEBPA.
The 212delC mutation found in this family has also been reported in two cases of sporadic AML.10 The CEBPA mutation was not found in 32 normal subjects or in 330 samples from patients with other cancers.3,11 Frame-shift mutations, such as the 212delC mutation, cause truncation of the 42-kD C/EBPα protein and overproduction of a 30-kD isoform that lacks the first transactivating domain but retains the bZIP region required for dimerization (Figure 1B). Such transactivating domains are necessary for the activity of C/EBPα in the regulation of its target genes by way of specific promoter sequences. In the absence of the functional 42-kD protein, this shorter isoform predominates and, after dimerization, functions in a dominant negative fashion, causing loss of function of C/EBPα (Figure 4Figure 4
Schematic Representation of the Function of C/EBPα.).3,11 The forced expression of a dominant negative mutant CEBPA in cultures of cord-blood–derived hematopoietic progenitor cells by means of a retroviral vector dramatically inhibits differentiation of both myeloid and erythroid lineages.12 In CEBPA –/– (knockout) mice, a myeloproliferative disease with a block in neutrophilic differentiation develops,13 whereas patients with sporadic AML and a CEBPA mutation tend to have a high white-cell count at presentation.8,14 Hence, after chemotherapy, marrow regeneration by stem cells bearing a dominant negative mutation might result in a proliferative phenotype. Such a scenario could explain the “regeneration leukocytosis” observed in the two siblings we studied, Patients III-1 and III-5, after they completed therapy.
The findings in this kindred are reminiscent of pediatric acute lymphoblastic leukemia in twins,15 in whom there may be a long latent period between birth and the development of disease. In the family we studied, the CEBPA mutation appeared to be fully penetrant: AML developed in all carriers of the 212delC mutation, albeit after a long latency period. This latency period (10 years in Patient II-3, 18 years in Patient III-5, and 30 years in Patient III-1) suggests that one or more additional mutations is necessary for the development of overt acute leukemia. Mutation analysis was extended to include several other genes implicated in the development of AML (KRAS, NRAS, KIT, PTPN11, FES, FLT3, and RUNX1), but no mutations were identified in these genes. However, a mutation in the other CEBPA allele was identified in Patient III-1. This mutation, a duplication, was undetectable during remission and was absent from his germ-line DNA. Such a mutation is predicted to prevent dimerization of C/EBPα because it disrupts the leucine zipper and therefore results in loss of function of the normal allele (Figure 1C).
Three large studies of uniformly treated patients have found that mutation of CEBPA is an independent favorable prognostic factor.10,14,16 Furthermore, CEBPA mutations such as 212delC appear to carry an even better prognosis than bZIP mutations. These data may partly explain why Patient II-3 remains in complete remission after receiving inadequate therapy by today's standards.
Supported by Cancer Research UK.
We are indebted to James Mackay (North East Thames Regional Cancer Genetics Service) for advice on the study, to John Amess and Michael Neat for contributions to the care of these patients, and to Rachael Arch, Janki Rangatia, Mel Greaves, and Vaska Saha for review of the manuscript and constructive comments.
Source Information
From the Medical Oncology Unit, Cancer Research UK, Barts and the London School of Medicine and Dentistry (M.L.S., T.A.L., J.F.); and the Department of Haematology, St. Bartholomew's Hospital ( J.D.C.) — both in London.
Address reprint requests to Dr. Smith at Cancer Research UK, Medical Oncology Unit, St. Bartholomew's Hospital, West Smithfield, London EC1A 7BE, United Kingdom, or at matthew.smith@cancer.org.uk.
- References
References
1
Song WJ ,Sullivan MG ,Legare RD , et al. Haploinsufficiency of CBFA2 causes familial thrombocytopenia with propensity to develop acute myelogenous leukaemia. Nat Genet 1999;23:166-175
CrossRef | Web of Science | Medline2
Preudhomme C ,Warot-Loze D ,Roumier C , et al. High incidence of biallelic point mutations in the Runt domain of the AML1/PEBP2 alpha B gene in Mo acute myeloid leukemia and in myeloid malignancies with acquired trisomy 21. Blood 2000;96:2862-2869
Web of Science | Medline3
Pabst T ,Mueller BU ,Zhang P , et al. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat Genet 2001;27:263-270
CrossRef | Web of Science | Medline4
Radomska HS ,Huettner CS ,Zhang P ,Cheng T ,Scadden DT ,Tenen DG . CCAAT/enhancer binding protein alpha is a regulatory switch sufficient for induction of granulocytic development from bipotential myeloid progenitors. Mol Cell Biol 1998;18:4301-4314
Web of Science | Medline5
Tenen DG . Disruption of differentiation in human cancer: AML shows the way. Nat Rev Cancer 2003;3:89-101
CrossRef | Web of Science | Medline6
Zhang P ,Nelson E ,Radomska HS , et al. Induction of granulocytic differentiation by 2 pathways. Blood 2002;99:4406-4412
CrossRef | Web of Science | Medline7
Bennett JM ,Catovsky D ,Daniel MT , et al. Proposals for the classification of the acute leukaemias. Br J Haematol 1976;33:451-458
CrossRef | Web of Science | Medline8
Snaddon J ,Smith ML ,Neat M , et al. Mutations of CEBPA in acute myeloid leukemia FAB types M1 and M2. Genes Chromosomes Cancer 2003;37:72-78
CrossRef | Web of Science | Medline9
Pabst T ,Mueller BU ,Harakawa N , et al. AML1-ETO downregulates the granulocytic differentiation factor C/EBPalpha in t(8;21) myeloid leukemia. Nat Med 2001;7:444-451
CrossRef | Web of Science | Medline10
Barjestah van Waalwijk van Doorn-Khosrovani S ,Erpelinck C ,Meijer J , et al. Biallelic mutations in the CEBPA gene and low CEBPA expression levels as prognostic markers in intermediate-risk AML. Hematol J 2003;4:31-40
CrossRef | Medline11
Gombart AF ,Hofmann WK ,Kawano S , et al. Mutations in the gene encoding the transcription factor CCAAT/enhancer binding protein alpha in myelodysplastic syndromes and acute myeloid leukemias. Blood 2002;99:1332-1340
CrossRef | Web of Science | Medline12
Schweiger M ,Lohler J ,Fischer M ,Herwig U ,Tenen DG ,Stocking C . A dominant-negative mutant of C/EBPalpha, associated with acute myeloid leukaemias, inhibits differentiation of myeloid and erythroid progenitors of man but not mouse. Blood 2004;103:2744-2752
CrossRef | Web of Science | Medline13
Iwasaki-Arai J ,Zhang P ,Huettner CS , et al. C/EBP alpha deficiency in hematopoiesis induces accumulation of non-malignant myeloblasts mimicking acute myelogenous leukaemia. Blood 2002;100:Suppl 1:61a-61a abstract.
Web of Science14
Frohling S ,Schlenk RF ,Stolze I , et al. CEBPA mutations in younger adults with acute myeloid leukemia and normal cytogenetics: prognostic relevance and analysis of cooperating mutations. J Clin Oncol 2004;22:624-633
CrossRef | Web of Science | Medline15
Greaves MF ,Maia AT ,Wiemels JL ,Ford AM . Leukemia in twins: lessons in natural history. Blood 2003;102:2321-2333
CrossRef | Web of Science | Medline16
Preudhomme C ,Sagot C ,Boissel N , et al. Favorable prognostic significance of CEBPA mutations in patients with de novo acute myeloid leukemia: a study from the Acute Leukemia French Association (ALFA). Blood 2002;100:2717-2723
CrossRef | Web of Science | Medline
- Citing Articles (63)
Citing Articles
1
Jonathan A. Gutman, Brianna Hoffner. (2012) A novel CCAAT/enhancer binding protein α germline variant in a case of acute myeloid leukemia. Leukemia & Lymphoma1-2
CrossRef2
Valeria Leuci, Giulia Mesiano, Loretta Gammaitoni, Cristina Cammarata, Sonia Capellero, Maja Todorovic, Noela Jordaney, Paola Circosta, Angela Elia, Marina Lesnikova, George E. Georges, Wanda Piacibello, Franca Fagioli, Alessandro Cignetti, Massimo Aglietta, Dario Sangiolo. (2011) Transient proteasome inhibition as a strategy to enhance lentiviral transduction of hematopoietic CD34+ cells and T lymphocytes: Implications for the use of low viral doses and large-size vectors. Journal of Biotechnology 156:3, 218-226
CrossRef3
David Grimwade, Krzysztof Mrózek. (2011) Diagnostic and Prognostic Value of Cytogenetics in Acute Myeloid Leukemia. Hematology/Oncology Clinics of North America 25:6, 1135-1161
CrossRef4
Chezi Ganzel, Jacob M. Rowe. (2011) Prognostic Factors in Adult Acute Leukemia. Hematology/Oncology Clinics of North America 25:6, 1163-1187
CrossRef5
Hua He, Xiaolin Liu, Yulan Gu, Yu Liu, Jing Yang. (2011) Effect of genetic variation of CEBPA gene on body measurement and carcass traits of Qinchuan cattle. Molecular Biology Reports 38:8, 4965-4969
CrossRef6
Michael J. Rauh, Jane Liesveld, W. Richard Burack, John M. Bennett. (2011) Emergence of JAK2-mutant primary myelofibrosis in myelodysplastic syndrome: rare case report, literature review, and implications for clonal progression. Journal of Hematopathology
CrossRef7
Valentina Pierini, Valeria Nofrini, Roberta La Starza, Gianluca Barba, Antonella Vitale, Francesco Di Raimondo, Caterina Matteucci, Barbara Crescenzi, Loredana Elia, Paolo Gorello, Clelia Tiziana Storlazzi, Cristina Mecucci. (2011) Double CEBPE-IGH rearrangement due to chromosome duplication and cryptic insertion in an adult with B-cell acute lymphoblastic leukemia. Cancer Genetics 204:10, 563-568
CrossRef8
A. P. Hsu, E. P. Sampaio, J. Khan, K. R. Calvo, J. E. Lemieux, S. Y. Patel, D. M. Frucht, D. C. Vinh, R. D. Auth, A. F. Freeman, K. N. Olivier, G. Uzel, C. S. Zerbe, C. Spalding, S. Pittaluga, M. Raffeld, D. B. Kuhns, L. Ding, M. L. Paulson, B. E. Marciano, J. C. Gea-Banacloche, J. S. Orange, J. Cuellar-Rodriguez, D. D. Hickstein, S. M. Holland. (2011) Mutations in GATA2 are associated with the autosomal dominant and sporadic monocytopenia and mycobacterial infection (MonoMAC) syndrome. Blood 118:10, 2653-2655
CrossRef9
Pia Ostergaard, Michael A Simpson, Fiona C Connell, Colin G Steward, Glen Brice, Wesley J Woollard, Dimitra Dafou, Tatjana Kilo, Sarah Smithson, Peter Lunt, Victoria A Murday, Shirley Hodgson, Russell Keenan, Daniela T Pilz, Ines Martinez-Corral, Taija Makinen, Peter S Mortimer, Steve Jeffery, Richard C Trembath, Sahar Mansour. (2011) Mutations in GATA2 cause primary lymphedema associated with a predisposition to acute myeloid leukemia (Emberger syndrome). Nature Genetics 43:10, 929-931
CrossRef10
M. Mannstadt, E. Holick, W. Zhao, H. Juppner. (2011) Mutational analysis of GCMB, a parathyroid-specific transcription factor, in parathyroid adenoma of primary hyperparathyroidism. Journal of Endocrinology 210:2, 165-171
CrossRef11
Anurag K. Agrawal, Hua Guo, Carla Golden. (2011) Siblings presenting with progressive congenital aleukemic leukemia cutis. Pediatric Blood & Cancer 57:2, 338-340
CrossRef12
M Stelljes, A Corbacioglu, R F Schlenk, K Döhner, M C Frühwald, C Rossig, K Ehlert, G Silling, C Müller-Tidow, H Juergens, H Döhner, W E Berdel, J Kienast, S Koschmieder. (2011) Allogeneic stem cell transplant to eliminate germline mutations in the gene for CCAAT-enhancer-binding protein α from hematopoietic cells in a family with AML. Leukemia 25:7, 1209-1210
CrossRef13
Alix E. Seif. (2011) Pediatric leukemia predisposition syndromes: clues to understanding leukemogenesis. Cancer Genetics 204:5, 227-244
CrossRef14
Huseyin Atakan Ekiz, Geylani Can, Yusuf Baran. (2011) Role of autophagy in the progression and suppression of leukemias. Critical Reviews in Oncology/Hematology
CrossRef15
Philippe Szankasi, Albert K. Ho, David W. Bahler, Olga Efimova, Todd W. Kelley. (2011) Combined testing for CCAAT/enhancer-binding protein alpha (CEBPA) mutations and promoter methylation in acute myeloid leukemia demonstrates shared phenotypic features. Leukemia Research 35:2, 200-207
CrossRef16
Ulrike Bacher, Sunday Ocheni, Philippe Schafhausen, Anthony Oyekunle, Judith Dierlamm, Axel Rolf Zander, Carsten Bokemeyer, Torsten Haferlach, Nicolaus Kröger. (2011) Unusual Course of Myelodysplastic Syndrome with Presumed Familial Origin. Acta Haematologica 126:4, 234-237
CrossRef17
J. M. Foran. (2010) New Prognostic Markers in Acute Myeloid Leukemia: Perspective from the Clinic. Hematology 2010:1, 47-55
CrossRef18
Eric Schafer, Donald Small. 2010. Non-Cytogenetic Markers and their Impact on Prognosis. , 56-76.
CrossRef19
Chris Pepper, Duncan M Baird. (2010) Shortened telomeres: a driving force behind leukemia?. Future Oncology 6:11, 1681-1686
CrossRef20
Gerben Bouma, Phil J. Ancliff, Adrian J. Thrasher, Siobhan O. Burns. (2010) Recent advances in the understanding of genetic defects of neutrophil number and function. British Journal of Haematology 151:4, 312-326
CrossRef21
Klaus Wethmar, Jeske J. Smink, Achim Leutz. (2010) Upstream open reading frames: Molecular switches in (patho)physiology. BioEssays 32:10, 885-893
CrossRef22
Jane E. Churpek, Kenan Onel. (2010) Heritability of Hematologic Malignancies: From Pedigrees to Genomics. Hematology/Oncology Clinics of North America 24:5, 939-972
CrossRef23
Sahar Mansour, Fiona Connell, Colin Steward, Pia Ostergaard, Glen Brice, Sarah Smithson, Peter Lunt, Steve Jeffery, Inderjeet Dokal, Tom Vulliamy, Brenda Gibson, Shirley Hodgson, Sally Cottrell, Louise Kiely, Lorna Tinworth, Kamini Kalidas, Ghulam Mufti, Jackie Cornish, Russell Keenan, Peter Mortimer, Victoria Murday. (2010) Emberger syndrome-Primary lymphedema with myelodysplasia: Report of seven new cases. American Journal of Medical Genetics Part A 152A:9, 2287-2296
CrossRef24
Catherine L. Carmichael, Ella J. Wilkins, Henrik Bengtsson, Marshall S. Horwitz, Terence P. Speed, Paul C. Vincent, Graham Young, Christopher N. Hahn, Robert Escher, Hamish S. Scott. (2010) Poor prognosis in familial acute myeloid leukaemia with combined biallelic CEBPA mutations and downstream events affecting the ATM, FLT3 and CDX2 genes. British Journal of Haematology 150:3, 382-385
CrossRef25
Duncan M. Baird. (2010) Variation at the TERT locus and predisposition for cancer. Expert Reviews in Molecular Medicine 12,
CrossRef26
Kristian Reckzeh, Jörg Cammenga. (2010) Molecular mechanisms underlying deregulation of C/EBPα in acute myeloid leukemia. International Journal of Hematology 91:4, 557-568
CrossRef27
F. Nakahara, M. Sakata-Yanagimoto, Y. Komeno, N. Kato, T. Uchida, K. Haraguchi, K. Kumano, Y. Harada, H. Harada, J. Kitaura, S. Ogawa, M. Kurokawa, T. Kitamura, S. Chiba. (2010) Hes1 immortalizes committed progenitors and plays a role in blast crisis transition in chronic myelogenous leukemia. Blood 115:14, 2872-2881
CrossRef28
Mikkael A. Sekeres. (2010) The Epidemiology of Myelodysplastic Syndromes. Hematology/Oncology Clinics of North America 24:2, 287-294
CrossRef29
2010. Acute Leukaemia: Integration of Morphological, Immunophenotypic and Genetic Information and the WHO Classification. , 114-218.
CrossRef30
M. J. S. Dyer, T. Akasaka, M. Capasso, P. Dusanjh, Y. F. Lee, E. L. Karran, I. Nagel, I. Vater, G. Cario, R. Siebert. (2010) Immunoglobulin heavy chain locus chromosomal translocations in B-cell precursor acute lymphoblastic leukemia: rare clinical curios or potent genetic drivers?. Blood 115:8, 1490-1499
CrossRef31
R. El Abed, V. Bourdon, L. Huiart, F. Eisinger, A. Khelif, M. Frenay, P. Gesta, L. Demange, H. Dreyfus, V. Bonadona, C. Dugast, H. Zattara, L. Faivre, T. Noguchi, R. Sauvan, Z. Soua, H. Sobol. (2009) Molecular study of CEPBA in familial hematological malignancies. Familial Cancer 8:4, 581-584
CrossRef32
Michael Kirwan, Tom Vulliamy, Anna Marrone, Amanda J. Walne, Richard Beswick, Peter Hillmen, Richard Kelly, Andrew Stewart, David Bowen, Stefan O. Schonland, Annika Maria Whittle, Anthony McVerry, Maria Gilleece, Inderjeet Dokal. (2009) Defining the pathogenic role of telomerase mutations in myelodysplastic syndrome and acute myeloid leukemia. Human Mutation 30:11, 1567-1573
CrossRef33
Matthew J Walter, Timothy A Graubert, John F DiPersio, Elaine R Mardis, Richard K Wilson, Timothy J Ley. (2009) Next-generation sequencing of cancer genomes: back to the future. Personalized Medicine 6:6, 653-662
CrossRef34
P. A. Ho, T. A. Alonzo, R. B. Gerbing, J. Pollard, D. L. Stirewalt, C. Hurwitz, N. A. Heerema, B. Hirsch, S. C. Raimondi, B. Lange, J. L. Franklin, J. P. Radich, S. Meshinchi. (2009) Prevalence and prognostic implications of CEBPA mutations in pediatric acute myeloid leukemia (AML): a report from the Children's Oncology Group. Blood 113:26, 6558-6566
CrossRef35
Mikkel Bruhn Schuster, Bo Torben Porse. (2009) C/EBPα in leukemogenesis: Identity and origin of the leukemia-initiating cell. BioFactors 35:3, 227-231
CrossRef36
A Renneville, V Mialou, N Philippe, S Kagialis-Girard, V Biggio, M-T Zabot, X Thomas, Y Bertrand, C Preudhomme. (2009) Another pedigree with familial acute myeloid leukemia and germline CEBPA mutation. Leukemia 23:4, 804-806
CrossRef37
Tomoko Nanri, Naokuni Uike, Toshiro Kawakita, Eisaku Iwanaga, Hiroaki Mitsuya, Norio Asou. (2009) A family harboring a germ-line N-terminal C/EBPα mutation and development of acute myeloid leukemia with an additional somatic C-terminal C/EBPα mutation. Genes, Chromosomes and CancerNA-NA
CrossRef38
G Cazzaniga, L Lo Nigro, I Cifola, G Milone, S Schnittger, T Haferlach, E Mirabile, F Costantino, M P Martelli, E Mastrodicasa, F Di Raimondo, F Aversa, A Biondi, B Falini. (2009) Simultaneous occurrence of acute myeloid leukaemia with mutated nucleophosmin (NPM1) in the same family. Leukemia 23:1, 199-203
CrossRef39
C. J. Owen, C. L. Toze, A. Koochin, D. L. Forrest, C. A. Smith, J. M. Stevens, S. C. Jackson, M.-C. Poon, G. D. Sinclair, B. Leber, P. R. E. Johnson, A. Macheta, J. A. L. Yin, M. J. Barnett, T. A. Lister, J. Fitzgibbon. (2008) Five new pedigrees with inherited RUNX1 mutations causing familial platelet disorder with propensity to myeloid malignancy. Blood 112:12, 4639-4645
CrossRef40
M. Raghavan, L.-L. Smith, D. M. Lillington, T. Chaplin, I. Kakkas, G. Molloy, C. Chelala, J.-B. Cazier, J. D. Cavenagh, J. Fitzgibbon, T. A. Lister, B. D. Young. (2008) Segmental uniparental disomy is a commonly acquired genetic event in relapsed acute myeloid leukemia. Blood 112:3, 814-821
CrossRef41
Verena Gaidzik, Konstanze Döhner. (2008) Prognostic Implications of Gene Mutations in Acute Myeloid Leukemia With Normal Cytogenetics. Seminars in Oncology 35:4, 346-355
CrossRef42
A.K. Trivedi, P. Pal, G. Behre, S.M. Singh. (2008) Multiple ways of C/EBPα inhibition in myeloid leukaemia. European Journal of Cancer 44:11, 1516-1523
CrossRef43
R. K. Funk, T. J. Maxwell, M. Izumi, D. Edwin, F. Kreisel, T. J. Ley, J. M. Cheverud, T. A. Graubert. (2008) Quantitative trait loci associated with susceptibility to therapy-related acute murine promyelocytic leukemia in hCG-PML/RARA transgenic mice. Blood 112:4, 1434-1442
CrossRef44
M. H. Tomasson, Z. Xiang, R. Walgren, Y. Zhao, Y. Kasai, T. Miner, R. E. Ries, O. Lubman, D. H. Fremont, M. D. McLellan, J. E. Payton, P. Westervelt, J. F. DiPersio, D. C. Link, M. J. Walter, T. A. Graubert, M. Watson, J. Baty, S. Heath, W. D. Shannon, R. Nagarajan, C. D. Bloomfield, E. R. Mardis, R. K. Wilson, T. J. Ley. (2008) Somatic mutations and germline sequence variants in the expressed tyrosine kinase genes of patients with de novo acute myeloid leukemia. Blood 111:9, 4797-4808
CrossRef45
Ota Fuchs, Dana Provaznikova, Marcela Kocova, Arnost Kostecka, Pavla Cvekova, Radana Neuwirtova, Petr Kobylka, Jaroslav Cermak, Jana Brezinova, Jiri Schwarz, Jana Markova, Peter Salaj, Hana Klamova, Jacqueline Maaloufova, Petr Lemez, Ludmila Novakova, Katerina Benesova. (2008) CEBPA polymorphisms and mutations in patients with acute myeloid leukemia, myelodysplastic syndrome, multiple myeloma and non-Hodgkin's lymphoma. Blood Cells, Molecules, and Diseases 40:3, 401-405
CrossRef46
A Renneville, C Roumier, V Biggio, O Nibourel, N Boissel, P Fenaux, C Preudhomme. (2008) Cooperating gene mutations in acute myeloid leukemia: a review of the literature. Leukemia 22:5, 915-931
CrossRef47
Peggy Kirstetter, Mikkel B. Schuster, Oksana Bereshchenko, Susan Moore, Heidi Dvinge, Elke Kurz, Kim Theilgaard-Mönch, Robert Månsson, Thomas Å. Pedersen, Thomas Pabst, Evelin Schrock, Bo T. Porse, Sten Eirik W. Jacobsen, Paul Bertone, Daniel G. Tenen, Claus Nerlov. (2008) Modeling of C/EBPα Mutant Acute Myeloid Leukemia Reveals a Common Expression Signature of Committed Myeloid Leukemia-Initiating Cells. Cancer Cell 13:4, 299-310
CrossRef48
M. S. Hasemann, I. Damgaard, M. B. Schuster, K. Theilgaard-Monch, A. B. Sorensen, A. Mrsic, T. Krugers, B. Ylstra, F. S. Pedersen, C. Nerlov, B. T. Porse. (2008) Mutation of C/EBP predisposes to the development of myeloid leukemia in a retroviral insertional mutagenesis screen. Blood 111:8, 4309-4321
CrossRef49
Carolyn Owen, Michael Barnett, Jude Fitzgibbon. (2008) Familial myelodysplasia and acute myeloid leukaemia - a review. British Journal of Haematology 140:2, 123-132
CrossRef50
T Pabst, B U Mueller. (2007) Transcriptional dysregulation during myeloid transformation in AML. Oncogene 26:47, 6829-6837
CrossRef51
Kamaleldin E. Elagib, Adam N. Goldfarb. (2007) Oncogenic pathways of AML1-ETO in acute myeloid leukemia: Multifaceted manipulation of marrow maturation. Cancer Letters 251:2, 179-186
CrossRef52
C. Fonatsch, K. Wimmer. (2007) Familiäre Leukämien. medizinische genetik 19:2, 197-201
CrossRef53
H. Nishizawa, K. Pryor-Koishi, T. Kato, H. Kowa, H. Kurahashi, Y. Udagawa. (2007) Microarray Analysis of Differentially Expressed Fetal Genes in Placental Tissue Derived from Early and Late Onset Severe Pre-eclampsia. Placenta 28:5-6, 487-497
CrossRef54
A K Trivedi, D Bararia, M Christopeit, A A PeerZada, S M Singh, A Kieser, W Hiddemann, H M Behre, G Behre. (2007) Proteomic identification of C/EBP-DBD multiprotein complex: JNK1 activates stem cell regulator C/EBPα by inhibiting its ubiquitination. Oncogene 26:12, 1789-1801
CrossRef55
Sigal Gery, H Phillip Koeffler. (2007) Transcription factors in hematopoietic malignancies. Current Opinion in Genetics & Development 17:1, 78-83
CrossRef56
C R Hake, T A Graubert, T S Fenske. (2007) Does autologous transplantation directly increase the risk of secondary leukemia in lymphoma patients?. Bone Marrow Transplantation 39:2, 59-70
CrossRef57
Mikkel Bruhn Schuster, Bo Torben Porse. (2006) C/EBPα: A tumour suppressor in multiple tissues?. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1766:1, 88-103
CrossRef58
Eric Knoche, Howard L McLeod, Timothy A Graubert. (2006) Pharmacogenetics of alkylator-associated acute myeloid leukemia. Pharmacogenomics 7:5, 719-729
CrossRef59
Kathleen F. Benson, Marshall Horwitz. (2006) Familial leukemia. Best Practice & Research Clinical Haematology 19:2, 269-279
CrossRef60
Beatrice U Mueller, Thomas Pabst. (2006) C/EBPα and the pathophysiology of acute myeloid leukemia. Current Opinion in Hematology 13:1, 7-14
CrossRef61
J Cammenga. (2005) Gatekeeper pathways and cellular background in the pathogenesis and therapy of AML. Leukemia 19:10, 1719-1728
CrossRef62
G S Sellick, H E Spendlove, D Catovsky, K Pritchard-Jones, R S Houlston. (2005) Further evidence that germline CEBPA mutations cause dominant inheritance of acute myeloid leukaemia. Leukemia 19:7, 1276-1278
CrossRef63
Fröhling, Stefan, Döhner, Hartmut, . (2004) Disruption of C/EBPα Function in Acute Myeloid Leukemia. New England Journal of Medicine 351:23, 2370-2372
Full Text
