Original Article

Brief Report

Myostatin Mutation Associated with Gross Muscle Hypertrophy in a Child

Markus Schuelke, M.D., Kathryn R. Wagner, M.D., Ph.D., Leslie E. Stolz, Ph.D., Christoph Hübner, M.D., Thomas Riebel, M.D., Wolfgang Kömen, M.D., Thomas Braun, M.D., Ph.D., James F. Tobin, Ph.D., and Se-Jin Lee, M.D., Ph.D.

N Engl J Med 2004; 350:2682-2688June 24, 2004

Article

Muscle wasting and weakness are among the most common inherited and acquired disorders and include the muscular dystrophies, cachexia, and age-related wasting. Since there is no generally accepted treatment to improve muscle bulk and strength, these conditions pose a substantial burden to patients as well as to public health. Consequently, there has been considerable interest in a recently described inhibitor of muscle growth, myostatin, or growth/differentiation factor 8 (GDF-8), which belongs to the transforming growth factor β superfamily of secreted proteins that control the growth and differentiation of tissues throughout the body. The myostatin gene is expressed almost exclusively in cells of skeletal-muscle lineage throughout embryonic development as well as in adult animals and functions as a negative regulator of muscle growth.1,2 Targeted disruption of the myostatin gene in mice doubles skeletal-muscle mass.1 Conversely, systemic overexpression of the myostatin gene leads to a wasting syndrome characterized by extensive muscle loss.3 In adult animals, myostatin appears to inhibit the activation of satellite cells, which are stem cells resident in skeletal muscle.4,5

The potential relevance of myostatin to the treatment of disease in humans has been suggested by studies involving mdx mice, which carry a mutation in the dystrophin gene and therefore serve as a genetic model of Duchenne's and Becker's muscular dystrophy.6 For example, mdx mice that lacked myostatin were found not only to be stronger and more muscular than their mdx counterparts with normal myostatin, but also to have reduced fibrosis and fatty remodeling, suggesting improved regeneration of muscle.7 Furthermore, injection of neutralizing monoclonal antibodies directed against myostatin into either wild-type or mdx mice increases muscle mass and specific force, suggesting that myostatin plays an important role in regulating muscle growth in adult animals.8,9

The function of myostatin appears to be conserved across species, since mutations in the myostatin gene have been shown to be responsible for the “double-muscling” phenotype in cattle.10-13 The phenotypes of mice and cattle lacking myostatin and the high degree of sequence conservation of the predicted myostatin protein in many mammalian species have raised the possibility that myostatin may help regulate muscle growth in humans. We report the identification of a myostatin mutation in a child with muscle hypertrophy, thereby providing strong evidence that myostatin does play an important role in regulating muscle mass in humans.

Case Report

A healthy woman who was a former professional athlete gave birth to a son after a normal pregnancy. The identity of the child's father was not revealed. The child's birth weight was in the 75th percentile. Stimulus-induced myoclonus developed several hours after birth, and the infant was admitted to the neonatal ward for assessment. He appeared extraordinarily muscular, with protruding muscles in his thighs (Figure 1AFigure 1Photographs of the Child at the Ages of Six Days and Seven Months (Panel A), Ultrasonograms (Panel B) and Morphometric Analysis (Panel C) of the Muscles of the Patient and a Control Infant, and the Patient's Pedigree (Panel D).) and upper arms. With the exception of increased tendon reflexes, the physical examination was normal. Hypoglycemia and increased levels of testosterone and insulin-like growth factor I were excluded. Muscular hypertrophy was verified by ultrasonography when the infant was six days of age (Figure 1B and Figure 1C). Doppler echocardiography and electrocardiography performed soon after birth and every six months thereafter were consistently normal. At 4.3 years of age (body-surface area, 0.78 m²), the child had a pulse rate of 95 beats per minute, a left ventricular ejection fraction of 70 percent, fractional shortening at the midwall of 56 percent, and a cardiac output of 2.81 liters per minute, with a left ventricular measurement of 3.42 cm during diastole (50th percentile) and 1.99 cm (25th percentile) during systole and respective septal measurements of 0.59 cm (75th percentile) and 0.81 cm (75th percentile).

The stimulus-induced myoclonus gradually subsided after two months. The child's motor and mental development has been normal. Now, at 4.5 years of age, he continues to have increased muscle bulk and strength, and he is able to hold two 3-kg dumbbells in horizontal suspension with his arms extended.

Several family members (Figure 1D) have been reported to be unusually strong. Family member II-3 was a construction worker who was able to unload curbstones by hand. The 24-year-old mother of the child (III-5) appeared muscular, though not to the extent observed in her son; she did not report any health problems. No family members aside from the mother were available to provide samples for genetic analysis.

Methods

The study was approved by the institutional ethics review committee of the Charité, University Medical Center Berlin. Written informed consent was obtained from the child's mother as well as from the parents of all control subjects. Investigations were conducted in accordance with the Declaration of Helsinki (2000).

All three exons of myostatin and flanking intron sequences (GenBank NT_022197) were amplified from genomic DNA by means of the polymerase chain reaction (PCR) with the following oligonucleotides: exon 1 forward primer, 5'ATTCACTGGTGTGGCAAGTTG3'; exon 1 reverse primer, 5'CAGCAGAACTGTTGATATACACTAATAGG3'; exon 2 forward primer, 5'GTTAATGGGAAATAATTTCAGCAAC3'; exon 2 reverse primer, 5'AGGTTATTATAATGTTATTTTCAGTTATCAC3'; exon 3 forward primer, 5'CAGGCCTATTGATATTACTGATTGTTC3'; and exon 3 reverse primer, 5'GACTGTAGCATACTCTAGGCCTATAGCC3'. The samples were then subjected to bidirectional automatic sequencing (BigDye Terminator, Applied Biosystems), and the presence of the g.IVS1+5 g→a mutation was verified by a primer-induced restriction assay with the forward primer 5'CAAAGCTCCTCCACTCCGG3' and the reverse-mismatch primer (mismatch underlined) 5'CAGCAGAACTGTTCATATACACTAATAGGTCTA3'. Total RNA was extracted from Epstein–Barr virus (EBV)– immortalized lymphoblastoid cells with TRIzol and reverse-transcribed with Superscript III (Invitrogen). Several primer combinations across the boundary between exon 1 and exon 2 were used: 5'CATGCAAAAACTGCAACTCTGTGT3' (P1F), 5'AAATGAGAACAGTGAGCAA3' (P2F), 5'CAAAGCTCCTCCACTCCGG3' (P3R), and 5'ATCCATAGTTGGGCCTTTACTACTTTA3' (P4R). As the reverse-transcribed control, HPRT was coamplified in a multiplex PCR (primers, 5'CCTGCTGGATTACATTAAAGCACTG3' and 5'CCTGAAGTATTCATTATAGTCAAGG3').

An 8.4-kb DNA fragment spanning the entire human myostatin gene from the 5' end of the messenger RNA (mRNA) to a site 1.4 kb downstream of the polyadenylation signal was cloned into pCMV5 and MDAF2 vectors, and the mutation was introduced by site-directed mutagenesis. COS-7, Chinese-hamster–ovary, and A204 rhabdomyosarcoma cells were transiently transfected with wild-type or mutant plasmids. Cells were cotransfected with plasmid containing a secreted myc-tagged protein as a transfection-efficiency control and with an expression construct for the furin protease paired dibasic amino acid–cleaving enzyme to improve processing of the precursor myostatin protein.14 Conditioned medium was concentrated, separated by reducing sodium dodecyl sulfate–polyacrylamide-gel electrophoresis, and transferred onto a membrane. Myostatin was detected with the use of polyclonal antibodies against a C-terminal domain.1 The control myc-tagged protein was detected with the use of a monoclonal antibody against myc.

RNA from transiently transfected cells was treated with DNase I (Invitrogen) and amplified by means of reverse-transcriptase PCR with P2F and P4R primers. Wild-type and mutant bands were excised from the agarose gel, purified, and sequenced. The relative abundance of the wild-type and mutant bands was determined by measuring the relative fluorescence after amplification with a FAM-labeled P4R primer on an ABI 3100 gene scanner (Applied Biosystems).

For immunoprecipitation and Western blotting, JA-16–coupled beads (directed against a C-terminal peptide of myostatin) were prepared and myostatin was immunoprecipitated by incubating 60 μl of packed beads with 0.5 ml of serum.15 After washing, bound myostatin was eluted and further separated by sodium dodecyl sulfate–polyacrylamide-gel electrophoresis, blotted on a membrane, and probed with the polyclonal rabbit antibody L8825 against myostatin propeptide.

Results

Imaging

Ultrasonography showed that the cross-sectional plane of the patient's quadriceps muscle was 7.2 SD above the mean (±SD) value for 10 age- and sex-matched controls (6.72 cm² vs. 3.13±0.49 cm²). Moreover, the thickness of his subcutaneous fat pad was 2.88 SD below the mean value for controls (0.18 cm vs. 0.36±0.06 cm). There was no significant difference in the diameter of the femoral bone between the patient and the controls (0.57 cm vs. 0.50±0.13 cm). The echogenicity of the muscle was normal, with no indication of fibrosis or deposition of fat tissue (Figure 1B and Figure 1C).

Molecular Biology

The phenotype of our patient was reminiscent of the increased muscling and decreased adiposity reported in mice1,16-18 and cattle10-13 with loss-of-function mutations in the myostatin gene. Therefore, we sequenced all exons and flanking intron regions of the gene in the patient and his mother. Although no mutations were detected in the coding region, a g→a transition at nucleotide g.IVS1+5 was present in both alleles of the patient and one allele of his mother. The mutation was confirmed by restriction analysis (Figure 2AFigure 2Mutation Analysis.) and was absent in 200 alleles from control subjects with a similar ethnic background, thus excluding a common polymorphism.

The presence of this mutation raised the possibility of missplicing of the myostatin precursor mRNA in the patient, since the +5 position at the splice donor site is a common location for splice-site mutations in humans.19 When we applied the scoring method of Shapiro and Senapathy20 to analyze the degree of matching between the sequence of the splice donor site of intron 1 with the corresponding consensus sequence (AG//gtrag), the score dropped from 79.4 (wild type, GT//gtaagt) to 65.0 (mutant, GT//gtaaat), indicating that missplicing is likely.

In order to investigate the effect of this mutation on the maturation of the myostatin mRNA, we generated genomic wild-type and mutant constructs for the expression of human myostatin mRNA in cultured muscle and nonmuscle cells and performed reverse-transcriptase PCR on RNA isolated from the transfected cells. PCR across the boundary between exon 1 and exon 2 yielded a single band of 405 bp for the wild-type construct. For the mutant construct, however, we detected two PCR products, a faint band equivalent in size to that obtained after transfection of the wild-type construct and a major novel product of higher molecular weight (Figure 2C). This product contained an insertion of the first 108 bp of intron 1 (including the g.IVS1+5 g→a mutation) and resulted from the activation of a cryptic splice site within intron 1 (at//gtaagt) (Figure 2D). Quantification of the relative intensities of the major and minor bands obtained from these PCR reactions showed that 68.8±0.032 percent (three samples) of the myostatin mRNA from the mutant construct was misspliced (Figure 2C). The misspliced mRNA is predicted to give rise to a severely truncated protein, since the 108-bp insertion adds a single lysine residue followed by a premature termination codon.

Consistent with the results of RNA analysis, myostatin protein was detected only in the conditioned medium from COS-7 cells transfected with the wild-type construct, whereas it was virtually absent in cells transfected with the mutant construct (Figure 3AFigure 3Results of Western Blotting and Immunoprecipitation.). Similar results were obtained with other cell lines, including Chinese-hamster–ovary cells and A204 rhabdomyosarcoma cells (data not shown).

We also sought to confirm the effect of this splice-site mutation in samples from the patient. Because we lacked a muscle-biopsy specimen, we examined myostatin mRNA from the patient's EBV-immortalized lymphoblastoid cells. These cells tend to express low levels of illegitimate transcripts, not normally present in blood cells. Illegitimate transcription proceeds through the normal promoters and may be used for the detection of mutations on the mRNA level if specific tissue is unavailable.21 We did not find any myostatin products in cells from the patient (Figure 2B). We believe that general degradation of mRNA is an unlikely explanation for this negative result, since we were able to detect similar levels of transcripts of a housekeeping gene (HPRT) in the patient and controls. Mutant transcripts may be specifically degraded through nonsense-mediated messenger decay, since the premature termination codon is located upstream of a spliceable exon.22

Finally, we attempted to measure myostatin levels in the patient's serum samples. Myostatin is readily detected by Western blotting in serum samples from mice.3 Similar approaches have proved much more difficult in human serum samples, presumably because humans have lower circulating myostatin levels. Using an antibody against myostatin, we first concentrated myostatin in serum samples by immunoprecipitation and then detected its presence with a second antibody against the propeptide region. We opted for the antibody directed against the propeptide (L8825), since it binds more tightly and picks up smaller amounts of protein than the antibody against mature myostatin. We identified a band at approximately 36 kD in rat serum, corresponding to myostatin propeptide. It was present to a lesser degree in the serum samples from age- and sex-matched control subjects but was absent in the patient's serum (Figure 3B). Since the molar ratio between propeptide and mature myostatin in serum is approximately 1:1,15 we conclude that the absence of the propeptide indicates the absence of mature myostatin in the patient.

Discussion

These results strongly indicate that our patient has a loss-of-function mutation in the myostatin gene, thus suggesting that the inactivation of myostatin has similar effects in humans, mice, and cattle. So far, we have not observed any health problems in the patient. Since myostatin is also expressed in the heart,23 we have closely monitored our patient's cardiac function but have not yet detected any signs of cardiomyopathy or a conduction disturbance. However, at 4.5 years of age, our patient is still too young for such abnormalities to be ruled out definitively. Our results suggest the possibility that muscle bulk and strength could be therapeutically increased by the inactivation of myostatin in patients with muscle-wasting conditions.

Supported by funds from the parents' self-help group Helft dem Muskelkranken Kind, Hamburg e.V. (to Drs. Schuelke and Hübner), and by grants from the National Institutes of Health (R01HD35887 and R01CA88866, to Dr. Lee, and K08NS02212, to Dr. Wagner) and the Muscular Dystrophy Association (to Dr. Wagner). Dr. Hübner is a member of the Network on Muscular Dystrophies (01GM0302), which is funded by the German Ministry of Education and Research, Bonn, Germany.

Drs. Stolz and Tobin are employees of Wyeth Pharmaceuticals. Dr. Tobin reports having equity in Wyeth Pharmaceuticals, and Dr. Lee reports having served as a paid consultant to and having equity in MetaMorphix and is named on multiple patents related to myostatin, which were licensed by Johns Hopkins University to MetaMorphix and sublicensed to Wyeth, and is entitled to a share of sales royalties.

We are indebted to Xiaoli Chang, Antje Gerlach, Christine Gerstenfeld, Heidemarie Neitzel, Thomas Voit, and Angelika Zwirner for their help; to Orest Hurko, Neil Wolfman, and Seamus McDuff for useful discussions; and to Jeremy Nathans for providing the plasmid containing a myc-tagged protein and the monoclonal antibody against the myc epitope.

Source Information

From the Departments of Neuropediatrics (M.S., C.H.), Pediatric Radiology (T.R.), and Neonatology (W.K.), Charité, University Medical Center Berlin, Berlin; the Departments of Neurology (K.R.W.) and Molecular Biology and Genetics (S.-J.L.), Johns Hopkins University School of Medicine, Baltimore; the Department of Cardiovascular and Metabolic Diseases, Wyeth Research, Cambridge, Mass. (L.E.S., J.F.T.); and the Institute of Physiological Chemistry, Martin Luther University, Halle-Wittenberg, Germany (T.B.).

Address reprint requests to Dr. Schuelke at the Department of Neuropediatrics, Charité, University Medical Center Berlin, Augustenburger Platz 1, D-13353 Berlin, Germany, or at markus.schuelke@charite.de.

References

References

1. 1

   McPherron AC, Lawler AM, Lee SJ. Regulation of skeletal muscle mass in mice by a new TGF-β superfamily member. Nature 1997;387:83-90
   CrossRef | Web of Science | Medline

2. 2

   Amthor H, Huang R, McKinnell I, et al. The regulation and action of myostatin as a negative regulator of muscle development during avian embryogenesis. Dev Biol 2002;251:241-257
   CrossRef | Web of Science | Medline

3. 3

   Zimmers TA, Davies MV, Koniaris LG, et al. Induction of cachexia in mice by systemically administered myostatin. Science 2002;296:1486-1488
   CrossRef | Web of Science | Medline

4. 4

   McCroskery S, Thomas M, Maxwell L, Sharma M, Kambadur R. Myostatin negatively regulates satellite cell activation and self-renewal. J Cell Biol 2003;162:1135-1147
   CrossRef | Web of Science | Medline

5. 5

   Mauro A. Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol 1961;9:493-495
   CrossRef | Medline

6. 6

   Sicinski P, Geng Y, Ryder-Cook AS, Barnard EA, Darlison MG, Barnard PJ. The molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science 1989;244:1578-1580
   CrossRef | Web of Science | Medline

7. 7

   Wagner KR, McPherron AC, Winik N, Lee SJ. Loss of myostatin attenuates severity of muscular dystrophy in mdx mice. Ann Neurol 2002;52:832-836
   CrossRef | Web of Science | Medline

8. 8

   Whittemore LA, Song K, Li X, et al. Inhibition of myostatin in adult mice increases skeletal muscle mass and strength. Biochem Biophys Res Commun 2003;300:965-971
   CrossRef | Web of Science | Medline

9. 9

   Bogdanovich S, Krag TOB, Barton ER, et al. Functional improvement of dystrophic muscle by myostatin blockade. Nature 2002;420:418-421
   CrossRef | Web of Science | Medline

10. 10

    Grobet L, Martin LJR, Poncelet D, et al. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat Genet 1997;17:71-74
    CrossRef | Web of Science | Medline

11. 11

    Grobet L, Poncelet D, Royo LJ, et al. Molecular definition of an allelic series of mutations disrupting the myostatin function and causing double-muscling in cattle. Mamm Genome 1998;9:210-213
    CrossRef | Web of Science | Medline

12. 12

    Kambadur R, Sharma M, Smith TP, Bass JJ. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res 1997;7:910-916
    Web of Science | Medline

13. 13

    McPherron AC, Lee SJ. Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci U S A 1997;94:12457-12461
    CrossRef | Web of Science | Medline

14. 14

    Lee SJ, McPherron AC. Regulation of myostatin activity and muscle growth. Proc Natl Acad Sci U S A 2001;98:9306-9311
    CrossRef | Web of Science | Medline

15. 15

    Hill JJ, Davies MV, Pearson AA, et al. The myostatin propeptide and the follistatin-related gene are inhibitory binding proteins of myostatin in normal serum. J Biol Chem 2002;277:40735-40741
    CrossRef | Web of Science | Medline

16. 16

    Szabo G, Dallmann G, Muller G, Patthy L, Soller M, Varga L. A deletion in the myostatin gene causes the compact (Cmpt) hypermuscular mutation in mice. Mamm Genome 1998;9:671-672
    CrossRef | Web of Science | Medline

17. 17

    Lin J, Arnold HB, Della-Fera MA, Azain MJ, Hartzell DL, Baile CA. Myostatin knockout in mice increases myogenesis and decreases adipogenesis. Biochem Biophys Res Commun 2002;291:701-706
    CrossRef | Web of Science | Medline

18. 18

    McPherron AC, Lee SJ. Suppression of body fat accumulation in myostatin-deficient mice. J Clin Invest 2002;109:595-601
    CrossRef | Web of Science | Medline

19. 19

    Krawczak M, Reiss J, Cooper DN. The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum Genet 1992;90:41-54
    CrossRef | Web of Science | Medline

20. 20

    Shapiro MB, Senapathy P. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res 1987;15:7155-7174
    CrossRef | Web of Science | Medline

21. 21

    Chelly J, Gilgenkrantz H, Hugnot JP, et al. Illegitimate transcription: application to the analysis of truncated transcripts of the dystrophin gene in nonmuscle cultured cells from Duchenne and Becker patients. J Clin Invest 1991;88:1161-1166
    CrossRef | Web of Science | Medline

22. 22

    Hentze MW, Kulozik AE. A perfect message: RNA surveillance and nonsense-mediated decay. Cell 1999;96:307-310
    CrossRef | Web of Science | Medline

23. 23

    Sharma M, Kambadur R, Matthews KG, et al. Myostatin, a transforming growth factor-β superfamily member, is expressed in heart muscle and is upregulated in cardiomyocytes after infarct. J Cell Physiol 1999;180:1-9
    CrossRef | Web of Science | Medline

Citing Articles (249)

Citing Articles

1. 1

   Joe N. Kornegay, Martin K. Childers, Daniel J. Bogan, Janet R. Bogan, Peter Nghiem, Jiahui Wang, Zheng Fan, James F. Howard, Scott J. Schatzberg, Jennifer L. Dow, Robert W. Grange, Martin A. Styner, Eric P. Hoffman, Kathryn R. Wagner. (2012) The Paradox of Muscle Hypertrophy in Muscular Dystrophy. Physical Medicine and Rehabilitation Clinics of North America 23:1, 149-172
   CrossRef

2. 2

   Mim A. Bower, Beatrice A. McGivney, Michael G. Campana, Jingjing Gu, Lisa S. Andersson, Elizabeth Barrett, Catherine R. Davis, Sofia Mikko, Frauke Stock, Valery Voronkova, Daniel G. Bradley, Alan G. Fahey, Gabriella Lindgren, David E. MacHugh, Galina Sulimova, Emmeline W. Hill. (2012) The genetic origin and history of speed in the Thoroughbred racehorse. Nature Communications 3, 643
   CrossRef

3. 3

   Chun-Rong Ju, Rong-Chang Chen. (2012) Serum myostatin levels and skeletal muscle wasting in chronic obstructive pulmonary disease. Respiratory Medicine 106:1, 102-108
   CrossRef

4. 4

   Monica G Schick, Lee E Brown, Evan E Schick. (2012) Strength and Conditioning Considerations for Female Mixed Martial Artists. Strength and Conditioning Journal1
   CrossRef

5. 5

   Dawei Wang, Xiaohui Bai, Qingyun Tian, Yongjie Lai, Edward A. Lin, Yongxiang Shi, Xiaodong Mu, Jian Q. Feng, Cathy S. Carlson, Chuan-ju Liu. (2011) GEP constitutes a negative feedback loop with MyoD and acts as a novel mediator in controlling skeletal muscle differentiation. Cellular and Molecular Life Sciences
   CrossRef

6. 6

   Liangyi Xue, Xiaojing Dong, Xiaoju Zhang, Amadou Diallo. (2011) Organization and Functional Analysis of the 5′ Flanking Regions of Myostatin-1 and 2 Genes from Larimichthys crocea. DNA and Cell Biology111207093205007
   CrossRef

7. 7

   Der-Sheng Han, Yung-Ming Chen, Sen-Yung Lin, Hao-Hsiang Chang, Tao-Min Huang, Yu-Chiao Chi, Wei-Shiung Yang. (2011) Serum myostatin levels and grip strength in normal subjects and patients on maintenance haemodialysis. Clinical Endocrinology 75:6, 857-863
   CrossRef

8. 8

   Julie Rodriguez, Barbara Vernus, Mylène Toubiana, Elodie Jublanc, Lionel Tintignac, Serge Leibovitch, Anne Bonnieu. (2011) Myostatin inactivation increases myotube size through regulation of translational initiation machinery. Journal of Cellular Biochemistry 112:12, 3531-3542
   CrossRef

9. 9

   Hongjun Li, Jingfeng Fan, Qing Yang, Guiqiang Mu, Chongbo He. (2011) Characterization of a myostatin gene (MSTN1) from spotted halibut (Verasper variegatus) and association between its promoter polymorphism and individual growth performance. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology
   CrossRef

10. 10

    N. K. LeBrasseur. (2011) Building muscle, browning fat and preventing obesity by inhibiting myostatin. Diabetologia
    CrossRef

11. 11

    P. Ciarmela, M. S. Islam, F. M. Reis, P. C. Gray, E. Bloise, F. Petraglia, W. Vale, M. Castellucci. (2011) Growth factors and myometrium: biological effects in uterine fibroid and possible clinical implications. Human Reproduction Update 17:6, 772-790
    CrossRef

12. 12

    Shin-ichi Chisada, Hiroyuki Okamoto, Yoshihito Taniguchi, Yoshitaka Kimori, Atsushi Toyoda, Yoshiyuki Sakaki, Shunichi Takeda, Yasutoshi Yoshiura. (2011) Myostatin-deficient medaka exhibit a double-muscling phenotype with hyperplasia and hypertrophy, which occur sequentially during post-hatch development. Developmental Biology 359:1, 82-94
    CrossRef

13. 13

    Gareth D. K. Matthews, Christopher L.-H. Huang, Li Sun, Mone Zaidi. (2011) Translational musculoskeletal science: Is sarcopenia the next clinical target after osteoporosis?. Annals of the New York Academy of Sciences 1237:1, 95-105
    CrossRef

14. 14

    Hansjörg Rindt, Desire M. Buckley, Spencer M. Vale, Megan Krogman, Ferrill F. Rose, Michael L. Garcia, Christian L. Lorson. (2011) Transgenic inactivation of murine myostatin does not decrease the severity of disease in a model of Spinal Muscular Atrophy. Neuromuscular Disorders
    CrossRef

15. 15

    M.-A. Caron, R. Debigaré, P.N.R. Dekhuijzen, F. Maltais. (2011) L’atteinte du diaphragme et du quadriceps dans la BPCO : une manifestation systémique de cette maladie ?. Revue des Maladies Respiratoires
    CrossRef

16. 16

    L.M. Freeman. (2011) Cachexia and Sarcopenia: Emerging Syndromes of Importance in Dogs and Cats. Journal of Veterinary Internal Medicinen/a-n/a
    CrossRef

17. 17

    Dimitrios D. Nikolopoulos, Chara Spiliopoulou, Stamatios E. Theocharis. (2011) Doping and musculoskeletal system: short-term and long-lasting effects of doping agents. Fundamental & Clinical Pharmacology 25:5, 535-563
    CrossRef

18. 18

    Tingting Zhang, Hanjiang Yang, Rui Wang, Kun Xu, Ying Xin, Gang Ren, Gang Zhou, Cunfang Zhang, Ling Wang, Zhiying Zhang. (2011) Oral administration of myostatin-specific whole recombinant yeast Saccharomyces cerevisiae vaccine increases body weight and muscle composition in mice. Vaccine 29:46, 8412-8416
    CrossRef

19. 19

    Maxie Kohler, Wilhelm Schänzer, Mario Thevis. (2011) RNA interference for performance enhancement and detection in doping control. Drug Testing and Analysis 3:10, 661-667
    CrossRef

20. 20

    DAVID L. ALLEN, DUSTIN S. HITTEL, ALEXANDRA C. MCPHERRON. (2011) Expression and Function of Myostatin in Obesity, Diabetes, and Exercise Adaptation. Medicine & Science in Sports & Exercise 43:10, 1828-1835
    CrossRef

21. 21

    Yulong He, Yuehong Wu, Zhigang Lan, Yonggang Liu, Yong Zhang. (2011) Molecular analysis of the first intron in the bovine myostatin gene. Molecular Biology Reports 38:7, 4643-4649
    CrossRef

22. 22

    Yong Soo Kim, Kyung Ho Kim, Chul Jung Kim. (2011) Production of bioactive extracellular domain of pig and chicken activin type IIB receptors in Pichia pastoris. Process Biochemistry
    CrossRef

23. 23

    C. Zhang, C. McFarlane, S. Lokireddy, S. Masuda, X. Ge, P. D. Gluckman, M. Sharma, R. Kambadur. (2011) Inhibition of myostatin protects against diet-induced obesity by enhancing fatty acid oxidation and promoting a brown adipose phenotype in mice. Diabetologia
    CrossRef

24. 24

    Juan F. Santibañez, Miguel Quintanilla, Carmelo Bernabeu. (2011) TGF-β/TGF-β receptor system and its role in physiological and pathological conditions. Clinical Science 121:6, 233-251
    CrossRef

25. 25

    H. J. Huson, A. M. Byers, J. Runstadler, E. A. Ostrander. (2011) An SNP within the Angiotensin-Converting Enzyme Distinguishes between Sprint and Distance Performing Alaskan Sled Dogs in a Candidate Gene Analysis. Journal of Heredity 102:Suppl 1, S19-S27
    CrossRef

26. 26

    Jie Chen, Genlin Wang, Yafei Cai. (2011) High mutation rate in prolactin intron 2 regulates egg-laying performance in Wanjiang white goose. Journal of Applied Animal Research 39:3, 175-180
    CrossRef

27. 27

    Lawrence T. Bish, Meg M. Sleeper, Sean C. Forbes, Kevin J. Morine, Caryn Reynolds, Gretchen E. Singletary, Dennis Trafny, Jennifer Pham, Janet Bogan, Joe N. Kornegay, Krista Vandenborne, Glenn A. Walter, H. Lee Sweeney. (2011) Long-Term Systemic Myostatin Inhibition via Liver-Targeted Gene Transfer in Golden Retriever Muscular Dystrophy. Human Gene Therapy110830064002004
    CrossRef

28. 28

    Stephanie Mosler, Carlos Pankratz, Alexis Seyfried, Marion Piechotta, Patrick Diel. (2011) The anabolic steroid methandienone targets the hypothalamic–pituitary–testicular axis and myostatin signaling in a rat training model. Archives of Toxicology
    CrossRef

29. 29

    Kristian Gundersen. (2011) Excitation-transcription coupling in skeletal muscle: the molecular pathways of exercise. Biological Reviews 86:3, 564-600
    CrossRef

30. 30

    Yves Rolland, Graziano Onder, John E. Morley, Sophie Gillette-Guyonet, Gabor Abellan van Kan, Bruno Vellas. (2011) Current and Future Pharmacologic Treatment of Sarcopenia. Clinics in Geriatric Medicine 27:3, 423-447
    CrossRef

31. 31

    Sang-Hyun Han, In-Cheol Cho, Moon-Suck Ko, Eun-Young Kim, Se-Pill Park, Sung-Soo Lee, Hong-Shik Oh. (2011) A promoter polymorphism of MSTN g.−371T>A and its associations with carcass traits in Korean cattle. Molecular Biology Reports
    CrossRef

32. 32

    E. E. Baron, M. S. Lopes, D. Mendonça, A. da Câmara Machado. (2011) SNP identification and polymorphism analysis in exon 2 of the horse myostatin gene. Animal Geneticsno-no
    CrossRef

33. 33

    Claude Bouchard, Tuomo Rankinen, James A. Timmons. 2011. Genomics and Genetics in the Biology of Adaptation to Exercise. .
    CrossRef

34. 34

    Y Cheng, S Rachigani, J C M Dekkers, M S Mayes, R Tait, J M Reecy. (2011) Mapping genetic loci that interact with myostatin to affect growth traits. Heredity
    CrossRef

35. 35

    C. Zhang, C. McFarlane, S. Lokireddy, S. Bonala, X. Ge, S. Masuda, P. D. Gluckman, M. Sharma, R. Kambadur. (2011) Myostatin-deficient mice exhibit reduced insulin resistance through activating the AMP-activated protein kinase signalling pathway. Diabetologia 54:6, 1491-1501
    CrossRef

36. 36

    A. Stinckens, M. Georges, N. Buys. (2011) Mutations in the Myostatin gene leading to hypermuscularity in mammals: indications for a similar mechanism in fish?. Animal Genetics 42:3, 229-234
    CrossRef

37. 37

    A. Ratkevicius, A. Joyson, I. Selmer, T. Dhanani, C. Grierson, A. M. Tommasi, A. DeVries, P. Rauchhaus, D. Crowther, S. Alesci, P. Yaworsky, F. Gilbert, T. W. Redpath, J. Brady, K. C. H. Fearon, D. M. Reid, C. A. Greig, H. Wackerhage. (2011) Serum Concentrations of Myostatin and Myostatin-Interacting Proteins Do Not Differ Between Young and Sarcopenic Elderly Men. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 66A:6, 620-626
    CrossRef

38. 38

    Il-Hwa Hong, Yeon-Woo Jeong, Taeyoung Shin, Sang-Hwan Hyun, Jin-Kyu Park, Mi-Ran Ki, Seon-Young Han, Se-Il Park, Ji-Hyun Lee, Eun-Mi Lee, Ah-Young Kim, Sang-Young You, Woo-Suk Hwang, Kyu-Shik Jeong. (2011) Morphological abnormalities, impaired fetal development and decrease in myostatin expression following somatic cell nuclear transfer in dogs. Molecular Reproduction and Development 78:5, 337-346
    CrossRef

39. 39

    Zaira Aversa, Andrea Bonetto, Fabio Penna, Paola Costelli, Gaetano Di Rienzo, Angelo Lacitignola, Francesco M. Baccino, Vincenzo Ziparo, Paolo Mercantini, Filippo Rossi Fanelli, Maurizio Muscaritoli. (2011) Changes in Myostatin Signaling in Non-Weight-Losing Cancer Patients. Annals of Surgical Oncology
    CrossRef

40. 40

    Simon S. Wing, Stewart H. Lecker, R. Thomas Jagoe. (2011) Proteolysis in illness-associated skeletal muscle atrophy: from pathways to networks. Critical Reviews in Clinical Laboratory Sciences 48:2, 49-70
    CrossRef

41. 41

    J. G. Jespersen, A. Nedergaard, L. L. Andersen, P. Schjerling, J. L. Andersen. (2011) Myostatin expression during human muscle hypertrophy and subsequent atrophy: increased myostatin with detraining. Scandinavian Journal of Medicine & Science in Sports 21:2, 215-223
    CrossRef

42. 42

    Zaira Aversa, Nima Alamdari, Per-Olof Hasselgren. (2011) Molecules modulating gene transcription during muscle wasting in cancer, sepsis, and other critical illness. Critical Reviews in Clinical Laboratory Sciences 48:2, 71-86
    CrossRef

43. 43

    T. Tozaki, E. W. Hill, K. Hirota, H. Kakoi, H. Gawahara, T. Miyake, S. Sugita, T. Hasegawa, N. Ishida, Y. Nakano, M. Kurosawa. (2011) A cohort study of racing performance in Japanese Thoroughbred racehorses using genome information on ECA18. Animal Geneticsno-no
    CrossRef

44. 44

    Robert H. Mak, Alp T. Ikizler, Csaba P. Kovesdy, Dominic S. Raj, Peter Stenvinkel, Kamyar Kalantar-Zadeh. (2011) Wasting in chronic kidney disease. Journal of Cachexia, Sarcopenia and Muscle
    CrossRef

45. 45

    Emidio E. Pistilli, Sasha Bogdanovich, Marcus D. Goncalves, Rexford S. Ahima, Jennifer Lachey, Jasbir Seehra, Tejvir Khurana. (2011) Targeting the Activin Type IIB Receptor to Improve Muscle Mass and Function in the mdx Mouse Model of Duchenne Muscular Dystrophy. The American Journal of Pathology 178:3, 1287-1297
    CrossRef

46. 46

    Minghan Wang. 2011. Energy Metabolism in Skeletal Muscle and its Link to Insulin Resistance. , 157-176.
    CrossRef

47. 47

    D. Liu, Q. Xu, L. Zang, S. Liang, Y. Wu, S. Wei, Y. Jiang. (2011) Identification and genetic effect of haplotypes in the promoter region of porcine myostatin gene. Animal Genetics 42:1, 6-14
    CrossRef

48. 48

    Hangxing Ren, Li Li, Hongwei Su, Lingyang Xu, Caihong Wei, Li Zhang, Hongbin Li, Wenzhong Liu, Lixin Du. (2011) Histological and transcriptome-wide level characteristics of fetal myofiber hyperplasia during the second half of gestation in Texel and Ujumqin sheep. BMC Genomics 12:1, 411
    CrossRef

49. 49

    Carlene S Starck, Andrew J Sutherland-Smith. (2011) The C313Y Piedmontese mutation decreases myostatin covalent dimerisation and stability. BMC Research Notes 4:1, 442
    CrossRef

50. 50

    Tyesha N Burks, Ronald D Cohn. (2011) Role of TGF-β signaling in inherited and acquired myopathies. Skeletal Muscle 1:1, 19
    CrossRef

51. 51

    Dwi U Kemaladewi, Willem MH Hoogaars, Sandra H van Heiningen, Samuel Terlouw, David JJ de Gorter, Johan T den Dunnen, Gert Jan B van Ommen, Annemieke Aartsma-Rus, Peter ten Dijke, Peter AC 't Hoen. (2011) Dual exon skipping in myostatin and dystrophin for Duchenne muscular dystrophy. BMC Medical Genomics 4:1, 36
    CrossRef

52. 52

    Silvia Carosio, Maria Grazia Berardinelli, Michela Aucello, Antonio Musarò. (2011) Impact of ageing on muscle cell regeneration. Ageing Research Reviews 10:1, 35-42
    CrossRef

53. 53

    Sang Beum Lee, Mi-Jin Cho, Jeong Hwan Kim, Yong Soo Kim, Hyung-Joo Jin. (2011) Production of Bioactive Rockfish (Sebastes schlegeli) Myostatin-1 Prodomain in an Escherichia coli System. The Protein Journal 30:1, 52-58
    CrossRef

54. 54

    Richard W. Orrell. 2011. Facioscapulohumeral dystrophy and scapuloperoneal syndromes. , 167-180.
    CrossRef

55. 55

    Jagjeet K Kang, Alberto Malerba, Linda Popplewell, Keith Foster, George Dickson. (2011) Antisense-induced Myostatin Exon Skipping Leads to Muscle Hypertrophy in Mice Following Octa guanidine Morpholino Oligomer Treatment. Molecular Therapy 19:1, 159-164
    CrossRef

56. 56

    Maurice Hayot, Julie Rodriguez, Barbara Vernus, Gilles Carnac, Elise Jean, David Allen, Lucie Goret, Philippe Obert, Robin Candau, Anne Bonnieu. (2011) Myostatin up-regulation is associated with the skeletal muscle response to hypoxic stimuli. Molecular and Cellular Endocrinology 332:1-2, 38-47
    CrossRef

57. 57

    K. Tessanne, M.C. Golding, C.R. Long, M.D. Peoples, G. Hannon, M.E. Westhusin. (2011) Production of transgenic calves expressing an shRNA targeting myostatin. Molecular Reproduction and Developmentn/a-n/a
    CrossRef

58. 58

    Flavio Ronzoni, Matilde Bongio, Silvio Conte, Luigi Vercesi, Marco Cassano, Carla Tribioli, Daniela Galli, Riccardo Bellazzi, Giovanni Magenes, Maria Gabriella Cusella De Angelis, Maurilio Sampaolesi. (2011) Localization of Magic-F1 Transgene, Involved in Muscular Hypertrophy, during Early Myogenesis. Journal of Biomedicine and Biotechnology 2011, 1-9
    CrossRef

59. 59

    Masanao Machida, Kohei Takeda, Hiroyuki Yokono, Sachiko Ikemune, Yuka Taniguchi, Hidenori Kiyosawa, Tohru Takemasa. (2011) Reduction of ribosome biogenesis with activation of the mTOR pathway in denervated atrophic muscle. Journal of Cellular Physiologyn/a-n/a
    CrossRef

60. 60

    Yoshihide Sunada. (2011) Anti-myostatin antibody therapy for myopathies. Rinsho Shinkeigaku 51:11, 1157-1159
    CrossRef

61. 61

    Janine Meienberg, Marianne Rohrbach, Stefan Neuenschwander, Katharina Spanaus, Cecilia Giunta, Sira Alonso, Eliane Arnold, Caroline Henggeler, Stephan Regenass, Andrea Patrignani, Silvia Azzarello-Burri, Bernhard Steiner, Anders OH Nygren, Thierry Carrel, Beat Steinmann, Gábor Mátyás. (2010) Hemizygous deletion of COL3A1, COL5A2, and MSTN causes a complex phenotype with aortic dissection: a lesson for and from true haploinsufficiency. European Journal of Human Genetics 18:12, 1315-1321
    CrossRef

62. 62

    M. M. Binns, D. A. Boehler, D. H. Lambert. (2010) Identification of the myostatin locus (MSTN) as having a major effect on optimum racing distance in the Thoroughbred horse in the USA. Animal Genetics 41, 154-158
    CrossRef

63. 63

    Antonios Matsakas, Anthony Otto, Mohamed I. Elashry, Susan C. Brown, Ketan Patel. (2010) Altered Primary and Secondary Myogenesis in the Myostatin-Null Mouse. Rejuvenation Research 13:6, 717-727
    CrossRef

64. 64

    Patrick Diel, Thorsten Schiffer, Stephan Geisler, Torsten Hertrampf, Stephanie Mosler, Sven Schulz, Karl Florian Wintgens, Michael Adler. (2010) Analysis of the effects of androgens and training on myostatin propeptide and follistatin concentrations in blood and skeletal muscle using highly sensitive Immuno PCR. Molecular and Cellular Endocrinology 330:1-2, 1-9
    CrossRef

65. 65

    Thomas E Lloyd. (2010) Novel therapeutic approaches for inclusion body myositis. Current Opinion in Rheumatology 22:6, 658-664
    CrossRef

66. 66

    Ira J. Smith, Zaira Aversa, Nima Alamdari, Victoria Petkova, Per-Olof Hasselgren. (2010) Sepsis downregulates myostatin mRNA levels without altering myostatin protein levels in skeletal muscle. Journal of Cellular Biochemistry 111:4, 1059-1073
    CrossRef

67. 67

    Maxie Kohler, Andreas Thomas, Katja Walpurgis, Wilhelm Schänzer, Mario Thevis. (2010) Mass spectrometric detection of siRNA in plasma samples for doping control purposes. Analytical and Bioanalytical Chemistry 398:3, 1305-1312
    CrossRef

68. 68

    Anna C. DILGER, Michael E. SPURLOCK, Alan L. GRANT, David E. GERRARD. (2010) Myostatin null mice respond differently to dietary-induced and genetic obesity. Animal Science Journal 81:5, 586-593
    CrossRef

69. 69

    Mark W. Hamrick, Phonepasong Arounleut, Ethan Kellum, Matthew Cain, David Immel, Li-Fang Liang. (2010) Recombinant Myostatin (GDF-8) Propeptide Enhances the Repair and Regeneration of Both Muscle and Bone in a Model of Deep Penetrant Musculoskeletal Injury. The Journal of Trauma: Injury, Infection, and Critical Care 69:3, 579-583
    CrossRef

70. 70

    Kathleen J. Savage, Alexandra C. McPherron. (2010) Endurance exercise training in myostatin null mice. Muscle & Nerve 42:3, 355-362
    CrossRef

71. 71

    Xiaolan Zhou, Jin Lin Wang, John Lu, Yanping Song, Keith S. Kwak, Qingsheng Jiao, Robert Rosenfeld, Qing Chen, Thomas Boone, W. Scott Simonet, David L. Lacey, Alfred L. Goldberg, H.Q. Han. (2010) Reversal of Cancer Cachexia and Muscle Wasting by ActRIIB Antagonism Leads to Prolonged Survival. Cell 142:4, 531-543
    CrossRef

72. 72

    J. Han, H. Zhou, R.H. Forrest, J.R. Sedcole, C.M. Frampton, J.G.H. Hickford. (2010) Effect of Myostatin (MSTN) g+6223G>A on Production and Carcass Traits in New Zealand Romney Sheep. Asian-Australasian Journal of Animal Sciences 23:7, 863-866
    CrossRef

73. 73

    Trudy A. McKanna, Helga V. Toriello. (2010) Gene Doping: The Hype and the Harm. Pediatric Clinics of North America 57:3, 719-727
    CrossRef

74. 74

    Jimmy Sundblom, Erik Stålberg, Maria Österdahl, Franz Rücker, Maria Montelius, Hannu Kalimo, Inger Nennesmo, Gunilla Islander, Anja Smits, Niklas Dahl, Atle Melberg. (2010) Bedside diagnosis of rippling muscle disease in CAV3 p.A46T mutation carriers. Muscle & Nerve 41:6, 751-757
    CrossRef

75. 75

    Anna-Maija Tolppanen, Marjukka Kolehmainen, Leena Pulkkinen, Matti Uusitupa. (2010) Tenomodulin gene and obesity-related phenotypes. Annals of Medicine 42:4, 265-275
    CrossRef

76. 76

    Kate T. Murphy, James G. Ryall, Sarah M. Snell, Lawrence Nair, René Koopman, Philip A. Krasney, Chikwendu Ibebunjo, Kathryn S. Holden, Paula M. Loria, Christopher T. Salatto, Gordon S. Lynch. (2010) Antibody-Directed Myostatin Inhibition Improves Diaphragm Pathology in Young but not Adult Dystrophic mdx Mice. The American Journal of Pathology 176:5, 2425-2434
    CrossRef

77. 77

    Julie Dumonceaux, Solenne Marie, Cyriaque Beley, Capucine Trollet, Alban Vignaud, Arnaud Ferry, Gillian Butler-Browne, Luis Garcia. (2010) Combination of Myostatin Pathway Interference and Dystrophin Rescue Enhances Tetanic and Specific Force in Dystrophic mdx Mice. Molecular Therapy 18:5, 881-887
    CrossRef

78. 78

    F. Döring, S. Onur, C. Kürbitz, M. R. Boulay, L. Pérusse, T. Rankinen, R. Rauramaa, B. Wolfarth, C. Bouchard. (2010) Single nucleotide polymorphisms in the myostatin (MSTN) and muscle creatine kinase (CKM) genes are not associated with elite endurance performance. Scandinavian Journal of Medicine & Science in Sportsno-no
    CrossRef

79. 79

    Yan-Kun LOU, Juan LUO, Rong DAI, Ning LI. (2010) Myostatin Gene Knockdown by Myostatin-specific Short Interfering Hairpin RNAs Increases MyoD Expression in C2C12 Myoblasts*. PROGRESS IN BIOCHEMISTRY AND BIOPHYSICS 37:4, 451-459
    CrossRef

80. 80

    Sang Beum Lee, Yong Soo Kim, Mi-Yong Oh, In-hak Jeong, Ki-Baik Seong, Hyung-Joo Jin. (2010) Improving rainbow trout (Oncorhynchus mykiss) growth by treatment with a fish (Paralichthys olivaceus) myostatin prodomain expressed in soluble forms in E. coli. Aquaculture 302:3-4, 270-278
    CrossRef

81. 81

    Wai W. Cheung, Kyung Hoon Paik, Robert H. Mak. (2010) Inflammation and cachexia in chronic kidney disease. Pediatric Nephrology 25:4, 711-724
    CrossRef

82. 82

    Da-Zhi Wang. (2010) MicroRNAs in Cardiac Development and Remodeling. Pediatric Cardiology 31:3, 357-362
    CrossRef

83. 83

    C Baligand, H Gilson, J C Ménard, O Schakman, C Wary, J-P Thissen, P G Carlier. (2010) Functional assessment of skeletal muscle in intact mice lacking myostatin by concurrent NMR imaging and spectroscopy. Gene Therapy 17:3, 328-337
    CrossRef

84. 84

    Viviane P. Muniz, Adriano S. Senkevics, Dinorah Zilbersztajn, Juliana Gurgel-Giannetti, Helga C. Silva, Lydia U. Yamamoto, Rita C.M. Pavanello, Peter L. Pearson, Mayana Zatz, Mariz Vainzof. (2010) Genetic variability in the myostatin gene does not explain the muscle hypertrophy and clinical penetrance in myotonia congenita. Muscle & Nerve 41:3, 427-428
    CrossRef

85. 85

    N.C. Craig Sharp. (2010) The Human Genome and Sport, Including Epigenetics, Gene Doping, and Athleticogenomics. Endocrinology & Metabolism Clinics of North America 39:1, 201-215
    CrossRef

86. 86

    Geoffrey Goldspink, Barbara Wessner, Harald Tschan, Norbert Bachl. (2010) Growth Factors, Muscle Function, and Doping. Endocrinology & Metabolism Clinics of North America 39:1, 169-181
    CrossRef

87. 87

    Etsuko Sawatari, Ryoko Seki, Tomoko Adachi, Hisashi Hashimoto, Susumu Uji, Yuko Wakamatsu, Takahiro Nakata, Masato Kinoshita. (2010) Overexpression of the dominant-negative form of myostatin results in doubling of muscle-fiber number in transgenic medaka (Oryzias latipes). Comparative Biochemistry and Physiology - Part A: Molecular & Integrative Physiology 155:2, 183-189
    CrossRef

88. 88

    J. G. H. Hickford, R. H. Forrest, H. Zhou, Q. Fang, J. Han, C. M. Frampton, A. L. Horrell. (2010) Polymorphisms in the ovine myostatin gene ( MSTN ) and their association with growth and carcass traits in New Zealand Romney sheep. Animal Genetics 41:1, 64-72
    CrossRef

89. 89

    Kevin I. Watt, Richard T. Jaspers, Phillip Atherton, Ken Smith, Michael J. Rennie, Aivaras Ratkevicius, Henning Wackerhage. (2010) SB431542 treatment promotes the hypertrophy of skeletal muscle fibers but decreases specific force. Muscle & NerveNA-NA
    CrossRef

90. 90

    Lisa Vecchione, Jeffrey Miller, Craig Byron, Gregory M. Cooper, Timothy Barbano, James Cray, Joseph E. Losee, Mark W. Hamrick, James J. Sciote, Mark P. Mooney. (2010) Age-Related Changes in Craniofacial Morphology in GDF-8 (Myostatin)-Deficient Mice. The Anatomical Record: Advances in Integrative Anatomy and Evolutionary Biology 293:1, 32-41
    CrossRef

91. 91

    Stefania Dall'Olio, Luca Fontanesi, Leonardo Nanni Costa, Marco Tassinari, Laura Minieri, Adalberto Falaschini. (2010) Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types. Journal of Biomedicine and Biotechnology 2010, 1-12
    CrossRef

92. 92

    Stefania Rossi, Elena Stoppani, Massimiliano Gobbo, Anna Caroli, Alessandro Fanzani. (2010) L6E9 Myoblasts Are Deficient of Myostatin and Additional TGF-β Members Are Candidates to Developmentally Control Their Fiber Formation. Journal of Biomedicine and Biotechnology 2010, 1-10
    CrossRef

93. 93

    Charles R. Long, Kimberly J. Tessanne, Michael C. Golding. (2010) Applications of RNA interference-based gene silencing in animal agriculture. Reproduction, Fertility and Development 22:1, 47
    CrossRef

94. 94

    Irfan Ahmad, Dan Nemet, Alon Eliakim, Robin Koeppel, Donna Grochow, Maria Coussens, Susan Gallitto, Julia Rich, Andria Pontello, Szu-Yun Leu, Dan M. Cooper, Feizal Waffarn. (2010) Body composition and its components in preterm and term newborns: A cross-sectional, multimodal investigation. American Journal of Human Biology 22:1, 69-75
    CrossRef

95. 95

    Sandra Maria Lima RIBEIRO, Marcelo Macedo ROGERO, Reury Frank Pereira BACURAU, Patrícia Lopes de CAMPOS, Silmara dos Santos LUZ, Antonio Herber LANCHA Jr, Julio TIRAPEGUI. (2010) Effects of Different Levels of Protein Intake and Physical Training on Growth and Nutritional Status of Young Rats. Journal of Nutritional Science and Vitaminology 56:3, 177-184
    CrossRef

96. 96

    Xiaoli Hu, Huihui Guo, Yan He, Shan Wang, Lingling Zhang, Shi Wang, Xiaoting Huang, Scott William Roy, Wei Lu, Jingjie Hu, Zhenmin Bao. (2010) Molecular Characterization of Myostatin Gene from Zhikong scallop Chlamys farreri (Jones et Preston 1904). Genes & Genetic Systems 85:3, 207-218
    CrossRef

97. 97

    Sadanand Fulzele, Phonepasong Arounleut, Matthew Cain, Samuel Herberg, Monte Hunter, Karl Wenger, Mark W. Hamrick. (2010) Role of myostatin (GDF-8) signaling in the human anterior cruciate ligament. Journal of Orthopaedic Researchn/a-n/a
    CrossRef

98. 98

    Shengwei Hu, Chuangfu Chen, Jingliang Sheng, Yufang Sun, Xudong Cao, Jun Qiao. (2010) Enhanced Muscle Growth by Plasmid-Mediated Delivery of Myostatin Propeptide. Journal of Biomedicine and Biotechnology 2010, 1-9
    CrossRef

99. 99

    M. W. Hamrick. (2010) Myostatin (GDF-8) as a Therapeutic Target for the Prevention of Osteoporotic Fractures. IBMS BoneKEy 7:1, 8-17
    CrossRef

100. 100

     Walter Sebald, Joachim Nickel, Jin-Li Zhang, Thomas D. Mueller. (2010) Molecular basis of cytokine signalling â theme and variations. FEBS Journal 277:1, 106-118
     CrossRef

101. 101

     Qiang Zhang, Kun Wang, Yong Zhang, Jiao Meng, Fang Yu, Yan Chen, Dahai Zhu. (2010) The myostatin-induced E3 ubiquitin ligase RNF13 negatively regulates the proliferation of chicken myoblasts. FEBS Journal 277:2, 466-476
     CrossRef

102. 102

     Marco Cassano, Mattia Quattrocelli, Stefania Crippa, Ilaria Perini, Flavio Ronzoni, Maurilio Sampaolesi. (2009) Cellular mechanisms and local progenitor activation to regulate skeletal muscle mass. Journal of Muscle Research and Cell Motility 30:7-8, 243-253
     CrossRef

103. 103

     Masatoshi Kurokawa, Fuminori Sato, Shinya Aramaki, Tomoki Soh, Nobuhiko Yamauchi, Masa-aki Hattori. (2009) Monitor of the myostatin autocrine action during differentiation of embryonic chicken myoblasts into myotubes: effect of IGF-I. Molecular and Cellular Biochemistry 331:1-2, 193-199
     CrossRef

104. 104

     I Akpan, M D Goncalves, R Dhir, X Yin, E E Pistilli, S Bogdanovich, T S Khurana, J Ucran, J Lachey, R S Ahima. (2009) The effects of a soluble activin type IIB receptor on obesity and insulin sensitivity. International Journal of Obesity 33:11, 1265-1273
     CrossRef

105. 105

     A. Stinckens, T. Luyten, K. Van den Maagdenberg, S. Janssens, S. De Smet, M. Georges, N. Buys. (2009) Interactions between genes involved in growth and muscularity in pigs: IGF-2, myostatin, ryanodine receptor 1, and melanocortin-4 receptor. Domestic Animal Endocrinology 37:4, 227-235
     CrossRef

106. 106

     K. Sakuma, K. Watanabe, N. Hotta, T. Koike, K. Ishida, K. Katayama, H. Akima. (2009) The adaptive responses in several mediators linked with hypertrophy and atrophy of skeletal muscle after lower limb unloading in humans. Acta Physiologica 197:2, 151-159
     CrossRef

107. 107

     Michael R. Morissette, Janelle C. Stricker, Michael A. Rosenberg, Cattleya Buranasombati, Emily B. Levitan, Murray A. Mittleman, Anthony Rosenzweig. (2009) Effects of myostatin deletion in aging mice. Aging Cell 8:5, 573-583
     CrossRef

108. 108

     MARIA L. URSO. (2009) Disuse Atrophy of Human Skeletal Muscle. Medicine & Science in Sports & Exercise 41:10, 1860-1868
     CrossRef

109. 109

     G. Abellan Van Kan, E. André, H. A. Bischoff-Ferrari, Y. Boirie, G. Onder, M. Pahor, Patrick Ritz, Y. Rolland, C. Sampaio, S. Studenski, M. Visser, B. Vellas. (2009) Carla Task Force on Sarcopenia: Propositions for clinical trials. The Journal of Nutrition, Health and Aging 13:8, 700-707
     CrossRef

110. 110

     Jennifer N Cash, Carlis A Rejon, Alexandra C McPherron, Daniel J Bernard, Thomas B Thompson. (2009) The structure of myostatin:follistatin 288: insights into receptor utilization and heparin binding. The EMBO Journal 28:17, 2662-2676
     CrossRef

111. 111

     C. J. Sumner, C. D. Wee, L. C. Warsing, D. W. Choe, A. S. Ng, C. Lutz, K. R. Wagner. (2009) Inhibition of myostatin does not ameliorate disease features of severe spinal muscular atrophy mice. Human Molecular Genetics 18:17, 3145-3152
     CrossRef

112. 112

     N. K. LeBrasseur, T. M. Schelhorn, B. L. Bernardo, P. G. Cosgrove, P. M. Loria, T. A. Brown. (2009) Myostatin Inhibition Enhances the Effects of Exercise on Performance and Metabolic Outcomes in Aged Mice. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 64A:9, 940-948
     CrossRef

113. 113

     Thomas E. Callis, Kumar Pandya, Hee Young Seok, Ru-Hang Tang, Mariko Tatsuguchi, Zhan-Peng Huang, Jian-Fu Chen, Zhongliang Deng, Bronwyn Gunn, Janelle Shumate, Monte S. Willis, Craig H. Selzman, Da-Zhi Wang. (2009) MicroRNA-208a is a regulator of cardiac hypertrophy and conduction in mice. Journal of Clinical Investigation 119:9, 2772-2786
     CrossRef

114. 114

     Elaine A. Ostrander, Heather J. Huson, Gary K. Ostrander. (2009) Genetics of Athletic Performance. Annual Review of Genomics and Human Genetics 10:1, 407-429
     CrossRef

115. 115

     Henning Wackerhage, Andy Miah, Roger C. Harris, Hugh E. Montgomery, Alun G. Williams. (2009) Genetic research and testing in sport and exercise science: A review of the issues. Journal of Sports Sciences 27:11, 1109-1116
     CrossRef

116. 116

     Angèle Chopard, Steven Hillock, Bernard J. Jasmin. (2009) Molecular events and signalling pathways involved in skeletal muscle disuse-induced atrophy and the impact of countermeasures. Journal of Cellular and Molecular Medicine 13:9b, 3032-3050
     CrossRef

117. 117

     William D.C. Man, Paul Kemp, John Moxham, Michael I. Polkey. (2009) Skeletal muscle dysfunction in COPD: clinical and laboratory observations. Clinical Science 117:7, 251-264
     CrossRef

118. 118

     I. A. Boman, G. Klemetsdal, T. Blichfeldt, O. Nafstad, D. I. Våge. (2009) A frameshift mutation in the coding region of the myostatin gene ( MSTN ) affects carcass conformation and fatness in Norwegian White Sheep ( Ovis aries ). Animal Genetics 40:4, 418-422
     CrossRef

119. 119

     Volker Adams, Sven Möbius-Winkler, Gerhard Schuler. (2009) Basic and translational research: from molecule, to mouse, to man. European Journal of Cardiovascular Prevention & Rehabilitation 16:Supplement 1, S48-S52
     CrossRef

120. 120

     Antonios Matsakas, Keith Foster, Anthony Otto, Raymond Macharia, Mohamed I. Elashry, Simon Feist, Ian Graham, Helen Foster, Paul Yaworsky, Frank Walsh, George Dickson, Ketan Patel. (2009) Molecular, cellular and physiological investigation of myostatin propeptide-mediated muscle growth in adult mice. Neuromuscular Disorders 19:7, 489-499
     CrossRef

121. 121

     Jeremy Paul Loenneke, Thomas Joseph Pujol. (2009) The Use of Occlusion Training to Produce Muscle Hypertrophy. Strength and Conditioning Journal 31:3, 77-84
     CrossRef

122. 122

     Xiaoxiang Hu, Yu Gao, Chungang Feng, Qiuyue Liu, Xiaobo Wang, Zhuo Du, Qingsong Wang, Ning Li. (2009) Advanced technologies for genomic analysis in farm animals and its application for QTL mapping. Genetica 136:2, 371-386
     CrossRef

123. 123

     MATTHEW A. KOSTEK, THEODORE J. ANGELOPOULOS, PRISCILLA M. CLARKSON, PAUL M. GORDON, NIALL M. MOYNA, PAUL S. VISICH, ROBERT F. ZOELLER, THOMAS B. PRICE, RICHARD L. SEIP, PAUL D. THOMPSON, JOSEPH M. DEVANEY, HEATHER GORDISH-DRESSMAN, ERIC P. HOFFMAN, LINDA S. PESCATELLO. (2009) Myostatin and Follistatin Polymorphisms Interact with Muscle Phenotypes and Ethnicity. Medicine & Science in Sports & Exercise 41:5, 1063-1071
     CrossRef

124. 124

     S.-W. Chong, V. Korzh, Y.-J. Jiang. (2009) Myogenesis and molecules- insights from zebrafish Danio rerio. Journal of Fish Biology 74:8, 1693-1755
     CrossRef

125. 125

     Bruria Funkenstein, Viki Balas, Yanai Rebhan, Anna Pliatner. (2009) Characterization and functional analysis of the 5′ flanking region of Sparus aurata myostatin-1 gene. Comparative Biochemistry and Physiology - Part A: Molecular & Integrative Physiology 153:1, 55-62
     CrossRef

126. 126

     Chiara Mozzetta, Giulia Minetti, Pier Lorenzo Puri. (2009) Regenerative pharmacology in the treatment of genetic diseases: The paradigm of muscular dystrophy. The International Journal of Biochemistry & Cell Biology 41:4, 701-710
     CrossRef

127. 127

     Kishore M. Lakshman, Shalender Bhasin, Christopher Corcoran, Lisa A. Collins-Racie, Lioudmila Tchistiakova, S. Bradley Forlow, Katie St. Ledger, Michael E. Burczynski, Andrew J. Dorner, Edward R. LaVallie. (2009) Measurement of myostatin concentrations in human serum: Circulating concentrations in young and older men and effects of testosterone administration. Molecular and Cellular Endocrinology 302:1, 26-32
     CrossRef

128. 128

     Li Huang, Li-Li Wang, Mei Liu, Xiao-Song Gu. (2009) Preparation and application of rat myostatin antiserum. Neuroscience Bulletin 25:2, 54-60
     CrossRef

129. 129

     Hassan M.E. Azzazy, Mai M.H. Mansour, Robert H. Christenson. (2009) Gene doping: Of mice and men. Clinical Biochemistry 42:6, 435-441
     CrossRef

130. 130

     Keith Foster, Ian R. Graham, Anthony Otto, Helen Foster, Capucine Trollet, Paul J. Yaworsky, Frank S. Walsh, Dale Bickham, Nancy A. Curtin, Susannah L. Kawar, Ketan Patel, George Dickson. (2009) Adeno-Associated Virus-8-Mediated Intravenous Transfer of Myostatin Propeptide Leads to Systemic Functional Improvements of Slow but Not Fast Muscle. Rejuvenation Research 12:2, 85-94
     CrossRef

131. 131

     Paolo Prontera, Laura Bernardini, Gabriela Stangoni, Anna Capalbo, Daniela Rogaia, Carmela Ardisia, Antonio Novelli, Bruno Dallapiccola, Emilio Donti. (2009) 2q31.2q32.3 deletion syndrome: Report of an adult patient. American Journal of Medical Genetics Part A 149A:4, 706-712
     CrossRef

132. 132

     Xiang-Ren MENG. (2009) Variation of <I>MSTN</I> gene UTR in eleven sheep breeds. Hereditas (Beijing) 30:12, 1585-1590
     CrossRef

133. 133

     Stephan von Haehling, Mitja Lainscak, Jochen Springer, Stefan D. Anker. (2009) Cardiac cachexia: A systematic overview. Pharmacology & Therapeutics 121:3, 227-252
     CrossRef

134. 134

     F. F. Rose, V. B. Mattis, H. Rindt, C. L. Lorson. (2009) Delivery of recombinant follistatin lessens disease severity in a mouse model of spinal muscular atrophy. Human Molecular Genetics 18:6, 997-1005
     CrossRef

135. 135

     Lisa S. Krivickas, Ronan Walsh, Anthony A. Amato. (2009) Single muscle fiber contractile properties in adults with muscular dystrophy treated with MYO-029. Muscle & Nerve 39:1, 3-9
     CrossRef

136. 136

     Kumaran Chandraskeharan, Paul T. Martin. (2009) Embryonic overexpression of Galgt2 inhibits skeletal muscle growth via activation of myostatin signaling. Muscle & Nerve 39:1, 25-41
     CrossRef

137. 137

     Hisanori Yuzawa, Daizo Koinuma, Shingo Maeda, Kengo Yamamoto, Keiji Miyazawa, Takeshi Imamura. (2009) Arkadia represses the expression of myoblast differentiation markers through degradation of Ski and the Ski-bound Smad complex in C2C12 myoblasts. Bone 44:1, 53-60
     CrossRef

138. 138

     B. A. O' Rourke, J. A. Dennis, P. J. Healy, W. A. McKiernan, P. L. Greenwood, L. M. Cafe, D. Perry, K. H. Walker, I. Marsh, P. F. Parnell, P. F. Arthur. (2009) Quantitative analysis of performance, carcass and meat quality traits in cattle from two Australian beef herds in which a null myostatin allele is segregating. Animal Production Science 49:4, 297
     CrossRef

139. 139

     Chunping Qiao, Juan Li, Hui Zheng, Janet Bogan, Jianbin Li, Zhenhua Yuan, Cheng Zhang, Dan Bogan, Joe Kornegay, Xiao Xiao. (2009) Hydrodynamic Limb Vein Injection of Adeno-Associated Virus Serotype 8 Vector Carrying Canine Myostatin Propeptide Gene into Normal Dogs Enhances Muscle Growth. Human Gene Therapy 20:1, 1-10
     CrossRef

140. 140

     Ethan Kellum, Harlan Starr, Phonepasong Arounleut, David Immel, Sadanand Fulzele, Karl Wenger, Mark W. Hamrick. (2009) Myostatin (GDF-8) deficiency increases fracture callus size, Sox-5 expression, and callus bone volume. Bone 44:1, 17-23
     CrossRef

141. 141

     Yamila Carpio, Jannel Acosta, Reynold Morales, Yaimín Santisteban, Aniel Sanchéz, Mario Pablo Estrada. (2009) Regulation of body mass growth through activin type IIB receptor in teleost fish. General and Comparative Endocrinology 160:2, 158-167
     CrossRef

142. 142

     A. Stinckens, T. Luyten, J. Bijttebier, K. Van den Maagdenberg, D. Dieltiens, S. Janssens, S. De Smet, M. Georges, N. Buys. (2008) Characterization of the complete porcine MSTN gene and expression levels in pig breeds differing in muscularity. Animal Genetics 39:6, 586-596
     CrossRef

143. 143

     Elisabet Zamora, Amparo Galán, Rafael Simó. (2008) Papel de la miostatina en la afectación muscular asociada a las enfermedades crónicas. Medicina Clínica 131:15, 585-590
     CrossRef

144. 144

     Y REBHAN, B FUNKENSTEIN. (2008) Inhibition of fish myostatin activity by recombinant fish follistatin and myostatin prodomain: Potential implications for enhancing muscle growth in farmed fish. Aquaculture 284:1-4, 231-238
     CrossRef

145. 145

     Kathryn R. Wagner. (2008) Approaching a new age in Duchenne muscular dystrophy treatment. Neurotherapeutics 5:4, 583-591
     CrossRef

146. 146

     Thurman M. Wheeler. (2008) Myotonic dystrophy: Therapeutic strategies for the future. Neurotherapeutics 5:4, 592-600
     CrossRef

147. 147

     Y. Rolland, S. Czerwinski, G. Abellan Kan, J. E. Morley, M. Cesari, G. Onder, J. Woo, R. Baumgartner, F. Pillard, Y. Boirie, W. M. C. Chumlea, B. Vellas. (2008) Sarcopenia: Its assessment, etiology, pathogenesis, consequences and future perspectives. The Journal of Nutrition Health and Aging 12:7, 433-450
     CrossRef

148. 148

     Tomasz Sadkowski, Michał Jank, Lech Zwierzchowski, Eulalia Siadkowska, Jolanta Oprządek, Tomasz Motyl. (2008) Gene expression profiling in skeletal muscle of Holstein-Friesian bulls with single-nucleotide polymorphism in the myostatin gene 5’-flanking region. Journal of Applied Genetics 49:3, 237-250
     CrossRef

149. 149

     Craig McFarlane, Mridula Sharma, Ravi Kambadur. (2008) Myostatin is a procachectic growth factor during postnatal myogenesis. Current Opinion in Clinical Nutrition and Metabolic Care 11:4, 422-427
     CrossRef

150. 150

     P. Costelli, M. Muscaritoli, A. Bonetto, F. Penna, P. Reffo, M. Bossola, G. Bonelli, G. B. Doglietto, F. M. Baccino, F. Rossi Fanelli. (2008) Muscle myostatin signalling is enhanced in experimental cancer cachexia. European Journal of Clinical Investigation 38:7, 531-538
     CrossRef

151. 151

     Chunping Qiao, Juan Li, Hui Zheng, Janet Bogan, Jianbin Li, Zhenhua Yuan, Cheng Zhang, Dan Bogan, Joe Kornegay, Xiao Xiao. (2008) Hydrodynamic limb vein injection of AAV8 canine myostatin propeptide gene in normal dogs enhances muscle growth. Human Gene Therapy 0:ja, 081015093227032
     CrossRef

152. 152

     Thomas E. Callis, Da-Zhi Wang. (2008) Taking microRNAs to heart. Trends in Molecular Medicine 14:6, 254-260
     CrossRef

153. 153

     D J Wells. (2008) Gene doping: the hype and the reality. British Journal of Pharmacology 154:3, 623-631
     CrossRef

154. 154

     N.K. Bobbili, Y.S. Kim, M.A. Dunn, J. Yang, A. Ong. (2008) Effects of maternal immunisation against myostatin on post-natal growth and skeletal muscle mass of offspring in mice. Food and Agricultural Immunology 19:2, 93-106
     CrossRef

155. 155

     Valentina Guasconi, Pier Lorenzo Puri. (2008) Epigenetic drugs in the treatment of skeletal muscle atrophy. Current Opinion in Clinical Nutrition and Metabolic Care 11:3, 233-241
     CrossRef

156. 156

     Kathryn R. Wagner, James L. Fleckenstein, Anthony A. Amato, Richard J. Barohn, Katharine Bushby, Diana M. Escolar, Kevin M. Flanigan, Alan Pestronk, Rabi Tawil, Gil I. Wolfe, Michelle Eagle, Julaine M. Florence, Wendy M. King, Shree Pandya, Volker Straub, Paul Juneau, Kathleen Meyers, Cristina Csimma, Tracey Araujo, Robert Allen, Stephanie A. Parsons, John M. Wozney, Edward R. LaVallie, Jerry R. Mendell. (2008) A phase I/IItrial of MYO-029 in adult subjects with muscular dystrophy. Annals of Neurology 63:5, 561-571
     CrossRef

157. 157

     Hiroyuki Awano, Yasuhiro Takeshima, Yo Okizuka, Kayoko Saiki, Mariko Yagi, Masafumi Matsuo. (2008) Wide ranges of serum myostatin concentrations in Duchenne muscular dystrophy patients. Clinica Chimica Acta 391:1-2, 115-117
     CrossRef

158. 158

     Osquel Barroso, Irene Mazzoni, Olivier Rabin. (2008) Hormone abuse in sports: the antidoping perspective. Asian Journal of Andrology 10:3, 391-402
     CrossRef

159. 159

     Vik R. Rajan, William E. Mitch. (2008) Muscle wasting in chronic kidney disease: the role of the ubiquitin proteasome system and its clinical impact. Pediatric Nephrology 23:4, 527-535
     CrossRef

160. 160

     M. N. Fedoruk, J. L. Rupert. (2008) Myostatin inhibition: a potential performance enhancement strategy?. Scandinavian Journal of Medicine & Science in Sports 18:2, 123-131
     CrossRef

161. 161

     B. H. L. Tan, D. A. C. Deans, R. J. E. Skipworth, J. A. Ross, K. C. H. Fearon. (2008) Biomarkers for cancer cachexia: is there also a genetic component to cachexia?. Supportive Care in Cancer 16:3, 229-234
     CrossRef

162. 162

     Sasha Bogdanovich, Elizabeth M. McNally, Tejvir S. Khurana. (2008) Myostatin blockade improves function but not histopathology in a murine model of limb-girdle muscular dystrophy 2C. Muscle & Nerve 37:3, 308-316
     CrossRef

163. 163

     Chunping Qiao, Jianbin Li, Jiangang Jiang, Xiaodong Zhu, Bing Wang, Juan Li, Xiao Xiao. (2008) Myostatin Propeptide Gene Delivery by Adeno-Associated Virus Serotype 8 Vectors Enhances Muscle Growth and Ameliorates Dystrophic Phenotypes in mdx Mice. Human Gene Therapy 19:3, 241-254
     CrossRef

164. 164

     Tyrone C. Spady, Elaine A. Ostrander. (2008) Canine Behavioral Genetics: Pointing Out the Phenotypes and Herding up the Genes. The American Journal of Human Genetics 82:1, 10-18
     CrossRef

165. 165

     Craig McFarlane, Alex Hennebry, Mark Thomas, Erin Plummer, Nicholas Ling, Mridula Sharma, Ravi Kambadur. (2008) Myostatin signals through Pax7 to regulate satellite cell self-renewal. Experimental Cell Research 314:2, 317-329
     CrossRef

166. 166

     Kunihiro TSUCHIDA, Masashi NAKATANI, Akiyoshi UEZUMI, Tatsuya MURAKAMI, Xueling CUI. (2008) Signal Transduction Pathway through Activin Receptors as a Therapeutic Target of Musculoskeletal Diseases and Cancer. Endocrine Journal 55:1, 11-21
     CrossRef

167. 167

     Michael R. Graham, Julien S. Baker, Peter Evans, Andrew Kicman, David Cowan, David Hullin, Non Thomas, Bruce Davies. (2008) Physical Effects of Short-Term Recombinant Human Growth Hormone Administration in Abstinent Steroid Dependency. Hormone Research 69:6, 343-354
     CrossRef

168. 168

     Z.-L. Zhang, J.-W. He, Y.-J. Qin, Y.-Q. Hu, M. Li, H. Zhang, W.-W. Hu, Y.-J. Liu, J.-M. Gu. (2008) Association between myostatin gene polymorphisms and peak BMD variation in Chinese nuclear families. Osteoporosis International 19:1, 39-47
     CrossRef

169. 169

     2007. Exercise and Protein Metabolism. , 23-106.
     CrossRef

170. 170

     Juha J. Hulmi, Vuokko Kovanen, Inna Lisko, Harri Selänne, Antti A. Mero. (2007) The effects of whey protein on myostatin and cell cycle-related gene expression responses to a single heavy resistance exercise bout in trained older men. European Journal of Applied Physiology 102:2, 205-213
     CrossRef

171. 171

     Tone-Kari K. Østbye, Ola F. Wetten, Ave Tooming-Klunderud, Kjetill S. Jakobsen, Anat Yafe, Shulamit Etzioni, Thomas Moen, Øivind Andersen. (2007) Myostatin (MSTN) gene duplications in Atlantic salmon (Salmo salar): Evidence for different selective pressure on teleost MSTN-1 and -2. Gene 403:1-2, 159-169
     CrossRef

172. 172

     Brendan Maher. (2007) Personal genomics: His daughter's DNA. Nature 449:7164, 773-776
     CrossRef

173. 173

     S. Zanotti, S. Saredi, A. Ruggieri, M. Fabbri, F. Blasevich, S. Romaggi, L. Morandi, M. Mora. (2007) Altered extracellular matrix transcript expression and protein modulation in primary Duchenne muscular dystrophy myotubes. Matrix Biology 26:8, 615-624
     CrossRef

174. 174

     Se-Jin Lee. (2007) Sprinting without myostatin: a genetic determinant of athletic prowess. Trends in Genetics 23:10, 475-477
     CrossRef

175. 175

     LingZhi Yu, Hui Tang, JiYing Wang, Ying Wu, LiLi Zou, YunLiang Jiang, ChangXin Wu, Ning Li. (2007) Polymorphisms in the 5′ regulatory region of myostatin gene are associated with early growth traits in Yorkshire pigs. Science in China Series C: Life Sciences 50:5, 642-647
     CrossRef

176. 176

     G. Diane Shelton, Eva Engvall. (2007) Gross muscle hypertrophy in whippet dogs is caused by a mutation in the myostatin gene. Neuromuscular Disorders 17:9-10, 721-722
     CrossRef

177. 177

     Rong Du, XiaoRong An, YongFu Chen, Jian Qin. (2007) Functional analysis of the Myostatin gene promoter in sheep. Science in China Series C: Life Sciences 50:5, 648-654
     CrossRef

178. 178

     M. Ron, J. I. Weller. (2007) From QTL to QTN identification in livestock - winning by points rather than knock-out: a review. Animal Genetics 38:5, 429-439
     CrossRef

179. 179

     Geoffrey Goldspink. (2007) Loss of Muscle Strength During Aging Studied at the Gene Level. Rejuvenation Research 10:3, 397-406
     CrossRef

180. 180

     Rik Derynck, Rosemary J. Akhurst. (2007) Differentiation plasticity regulated by TGF-β family proteins in development and disease. Nature Cell Biology 9:9, 1000-1004
     CrossRef

181. 181

     Zipora Yablonka-Reuveni. (2007) Myostatin Blockade: A New Way to Enhance Skeletal Muscle Repair in Old Age?. Molecular Therapy 15:8, 1407-1409
     CrossRef

182. 182

     Gary R. Gaffney, Robin Parisotto. (2007) Gene Doping: A Review of Performance-Enhancing Genetics. Pediatric Clinics of North America 54:4, 807-822
     CrossRef

183. 183

     Kurt Samson. (2007) Myostatin Protein Inhibition Edges Forward as Potential Therapy for Neuromuscular Disorders. Neurology Today 7:14, 1,12-13
     CrossRef

184. 184

     M.W. Hamrick, X. Shi, W. Zhang, C. Pennington, H. Thakore, M. Haque, B. Kang, C.M. Isales, S. Fulzele, K.H. Wenger. (2007) Loss of myostatin (GDF8) function increases osteogenic differentiation of bone marrow-derived mesenchymal stem cells but the osteogenic effect is ablated with unloading. Bone 40:6, 1544-1553
     CrossRef

185. 185

     Joseph Baker. (2007) Nature and nurture interact to create expert performers. High Ability Studies 18:1, 57-58
     CrossRef

186. 186

     T OSTBYE, T BARDAL, A VEGUSDAL, O FRANG, E KJORSVIK, O ANDERSEN. (2007) Molecular cloning of the Atlantic salmon activin receptor IIB cDNA – Localization of the receptor and myostatin in vivo and in vitro in muscle cells. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics 2:2, 101-111
     CrossRef

187. 187

     M Bartoli, J Poupiot, A Vulin, F Fougerousse, L Arandel, N Daniele, C Roudaut, F Noulet, L Garcia, O Danos, I Richard. (2007) AAV-mediated delivery of a mutated myostatin propeptide ameliorates calpain 3 but not α-sarcoglycan deficiency. Gene Therapy 14:9, 733-740
     CrossRef

188. 188

     Fabian Filipp. (2007) Is science killing sport? Gene therapy and its possible abuse in doping. EMBO reports 8:5, 433-435
     CrossRef

189. 189

     Anna Nogalska, Slawomir Wojcik, W. King Engel, Janis McFerrin, Valerie Askanas. (2007) Endoplasmic reticulum stress induces myostatin precursor protein and NF-κB in cultured human muscle fibers: Relevance to inclusion body myositis. Experimental Neurology 204:2, 610-618
     CrossRef

190. 190

     S. Wojcik, A. Nogalska, J. McFerrin, W. K. Engel, G. Oledzka, V. Askanas. (2007) Myostatin precursor protein is increased and associates with amyloid-? precursor protein in inclusion-body myositis culture model. Neuropathology and Applied Neurobiology 33:2, 238-242
     CrossRef

191. 191

     Ronald D. Cohn, Hsin-Yueh Liang, Reena Shetty, Theodore Abraham, Kathryn R. Wagner. (2007) Myostatin does not regulate cardiac hypertrophy or fibrosis. Neuromuscular Disorders 17:4, 290-296
     CrossRef

192. 192

     Matthew Kostek, Monica J. Hubal, Linda S. Pescatello. (2007) Genetic Roles in Muscle Strength. ACSM's Health & Fitness Journal 11:2, 18-23
     CrossRef

193. 193

     Deri L.I. Helterline, Dilip Garikipati, Deborah L. Stenkamp, Buel D. Rodgers. (2007) Embryonic and tissue-specific regulation of myostatin-1 and -2 gene expression in zebrafish. General and Comparative Endocrinology 151:1, 90-97
     CrossRef

194. 194

     Gordon S. Lynch, Jonathan D. Schertzer, James G. Ryall. (2007) Therapeutic approaches for muscle wasting disorders. Pharmacology & Therapeutics 113:3, 461-487
     CrossRef

195. 195

     JUHA J. HULMI, JUHA P. AHTIAINEN, TUOMAS KAASALAINEN, EIJA P??LLANEN, KEIJO HAKKINEN, MARKKU ALEN, HARRI SELANNE, VUOKKO KOVANEN, ANTTI A. MERO. (2007) Postexercise Myostatin and Activin IIb mRNA Levels. Medicine & Science in Sports & Exercise 39:2, 289-297
     CrossRef

196. 196

     H. Amthor, R. Macharia, R. Navarrete, M. Schuelke, S. C. Brown, A. Otto, T. Voit, F. Muntoni, G. Vrbova, T. Partridge, P. Zammit, L. Bunger, K. Patel. (2007) Lack of myostatin results in excessive muscle growth but impaired force generation. Proceedings of the National Academy of Sciences 104:6, 1835-1840
     CrossRef

197. 197

     Naoki Suzuki, Yuko Miyagoe-Suzuki, Shin’ichi Takeda. (2007) Gene therapy for Duchenne muscular dystrophy. Future Neurology 2:1, 87-96
     CrossRef

198. 198

     Vernon G Coffey, John A Hawley. (2007) The Molecular Bases of Training Adaptation. Sports Medicine 37:9, 737-763
     CrossRef

199. 199

     H. Nielens, M.-P. Hermans. (2007) Dopaje y patologa osteoarticular: fisiologa y riesgos. EMC - Aparato Locomotor 40:2, 1-8
     CrossRef

200. 200

     Xingming Shi, Mark Hamrick, Carlos M. Isales. (2007) Energy Balance, Myostatin, and GILZ: Factors Regulating Adipocyte Differentiation in Belly and Bone. PPAR Research 2007, 1-12
     CrossRef

201. 201

     Matthew A. Saunders, Jeffrey M. Good, Elizabeth C. Lawrence, Robert E. Ferrell, Wen-Hsiung Li, Michael W. Nachman. (2006) Human Adaptive Evolution at Myostatin (GDF8), a Regulator of Muscle Growth. The American Journal of Human Genetics 79:6, 1089-1097
     CrossRef

202. 202

     Yutaka Ohsawa, Hiroki Hagiwara, Masashi Nakatani, Akihiro Yasue, Keiji Moriyama, Tatsufumi Murakami, Kunihiro Tsuchida, Sumihare Noji, Yoshihide Sunada. (2006) Muscular atrophy of caveolin-3–deficient mice is rescued by myostatin inhibition. Journal of Clinical Investigation 116:11, 2924-2934
     CrossRef

203. 203

     Craig McFarlane, Erin Plummer, Mark Thomas, Alex Hennebry, Murray Ashby, Nicholas Ling, Heather Smith, Mridula Sharma, Ravi Kambadur. (2006) Myostatin induces cachexia by activating the ubiquitin proteolytic system through an NF-κB-independent, FoxO1-dependent mechanism. Journal of Cellular Physiology 209:2, 501-514
     CrossRef

204. 204

     J KOPPLE, A COHEN, H WANG, D QING, Z TANG, M FOURNIER, M LEWIS, R CASABURI, T STORER. (2006) Effect of Exercise on mRNA Levels for Growth Factors in Skeletal Muscle of Hemodialysis Patients. Journal of Renal Nutrition 16:4, 312-324
     CrossRef

205. 205

     Thomas R. Magee, Jorge N. Artaza, Monica G. Ferrini, Dolores Vernet, Freddi I. Zuniga, Liliana Cantini, Suzanne Reisz-Porszasz, Jacob Rajfer, Nestor F. Gonzalez-Cadavid. (2006) Myostatin short interfering hairpin RNA gene transfer increases skeletal muscle mass. The Journal of Gene Medicine 8:9, 1171-1181
     CrossRef

206. 206

     Fulvio Lauretani, Stefania Bandinelli, Benedetta Bartali, Angelo Di Iorio, Vittoria Giacomini, Anna Maria Corsi, Jack M. Guralnik, Luigi Ferrucci. (2006) Axonal degeneration affects muscle density in older men and women. Neurobiology of Aging 27:8, 1145-1154
     CrossRef

207. 207

     Joulia-Ekaza Dominique, Cabello Gérard. (2006) Myostatin regulation of muscle development: Molecular basis, natural mutations, physiopathological aspects. Experimental Cell Research 312:13, 2401-2414
     CrossRef

208. 208

     Marco Toigo, Urs Boutellier. (2006) New fundamental resistance exercise determinants of molecular and cellular muscle adaptations. European Journal of Applied Physiology 97:6, 643-663
     CrossRef

209. 209

     Alex Clop, Fabienne Marcq, Haruko Takeda, Dimitri Pirottin, Xavier Tordoir, Bernard Bibé, Jacques Bouix, Florian Caiment, Jean-Michel Elsen, Francis Eychenne, Catherine Larzul, Elisabeth Laville, Françoise Meish, Dragan Milenkovic, James Tobin, Carole Charlier, Michel Georges. (2006) A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nature Genetics 38:7, 813-818
     CrossRef

210. 210

     D F Sun, Y Chen, R Rabkin. (2006) Work-induced changes in skeletal muscle IGF-1 and myostatin gene expression in uremia. Kidney International
     CrossRef

211. 211

     Arimantas Lionikas, David A. Blizard, David J. Vandenbergh, Joseph T. Stout, George P. Vogler, Gerald E. McClearn, Lars Larsson. (2006) Genetic determinants of weight of fast- and slow-twitch skeletal muscles in old mice. Mammalian Genome 17:6, 615-628
     CrossRef

212. 212

     Espen E. Spangenburg, Frank W. Booth. (2006) Leukemia inhibitory factor restores the hypertrophic response to increased loading in the LIF(−/−) mouse. Cytokine 34:3-4, 125-130
     CrossRef

213. 213

     M W Hamrick, C Pennington, C N Webb, C M Isales. (2006) Resistance to body fat gain in ‘double-muscled’ mice fed a high-fat diet. International Journal of Obesity 30:5, 868-870
     CrossRef

214. 214

     Jonathan B. Strober. (2006) Therapeutics in Duchenne muscular dystrophy. NeuroRX 3:2, 225-234
     CrossRef

215. 215

     Jinzeng Yang, Baoping Zhao. (2006) Postnatal expression of myostatin propeptide cDNA maintained high muscle growth and normal adipose tissue mass in transgenic mice fed a high-fat diet. Molecular Reproduction and Development 73:4, 462-469
     CrossRef

216. 216

     J. Jespersen, M. Kjaer, P. Schjerling. (2006) The possible role of myostatin in skeletal muscle atrophy and cachexia. Scandinavian Journal of Medicine and Science in Sports 16:2, 74-82
     CrossRef

217. 217

     Henning Wackerhage, Michael J. Rennie. (2006) How nutrition and exercise maintain the human musculoskeletal mass. Journal of Anatomy 208:4, 451-458
     CrossRef

218. 218

     Geoffrey Goldspink. (2006) Impairment of IGF-I gene splicing and MGF expression associated with muscle wasting. The International Journal of Biochemistry & Cell Biology 38:3, 481-489
     CrossRef

219. 219

     Sabine Strassburg, Stefan D. Anker. (2006) Metabolic and immunologic derangements in cardiac cachexia: where to from here?. Heart Failure Reviews 11:1, 57-64
     CrossRef

220. 220

     Kunihiro Tsuchida. (2006) The role of myostatin and bone morphogenetic proteins in muscular disorders. Expert Opinion on Biological Therapy 6:2, 147-154
     CrossRef

221. 221

     M. GEORGES, A. CLOP, F. MARCQ, H. TAKEDA, D. PIROTTIN, S. HIARD, X. TORDOIR, F. CAIMENT, F. MEISH, B. BIBÉ, J. BOUIX, J.M. ELSEN, F. EYCHENNE, E. LAVILLE, C. LARZUL, D. MILENKOVIC, J. TOBIN, AND C. CHARLIER. (2006) Polymorphic Polymorphic MicroRNA?Target Interactions: A Novel Source of Phenotypic Variation. Cold Spring Harbor Symposia on Quantitative Biology 71:1, 343-350
     CrossRef

222. 222

     Shigeo Kawada, Makoto Okuno, Naokata Ishii. (2006) Testosterone Causes Decrease in the Content of Skeletal Muscle Myostatin. International Journal of Sport and Health Science 4, 44-48
     CrossRef

223. 223

     Jonathan B. Strober. (2006) Therapeutics in Duchenne muscular dystrophy. Neurotherapeutics 3:2, 225
     CrossRef

224. 224

     A.E. Larsen, R.J. Tunstall, K.A. Carey, G. Nicholas, R. Kambadur, T.C. Crowe, D. Cameron-Smith. (2006) Actions of Short-Term Fasting on Human Skeletal Muscle Myogenic and Atrogenic Gene Expression. Annals of Nutrition and Metabolism 50:5, 476-481
     CrossRef

225. 225

     J.A. Stockman. (2006) Myostatin Mutation Associated With Gross Muscle Hypertrophy in a Child. Yearbook of Pediatrics 2006, 319-321
     CrossRef

226. 226

     Markus Ruegg, Stefanie Possekel, Thomas Meier. 2005. Peripheral Signaling Pathways Involved in Muscle Loss. , 543-564.
     CrossRef

227. 227

     Kathryn R Wagner. (2005) Muscle regeneration through myostatin inhibition. Current Opinion in Rheumatology 17:6, 720-724
     CrossRef

228. 228

     Baoping Zhao, Robert J. Wall, Jinzeng Yang. (2005) Transgenic expression of myostatin propeptide prevents diet-induced obesity and insulin resistance. Biochemical and Biophysical Research Communications 337:1, 248-255
     CrossRef

229. 229

     Hassan M.E. Azzazy, Mai M.H. Mansour, Robert H. Christenson. (2005) Doping in the recombinant era: Strategies and counterstrategies. Clinical Biochemistry 38:11, 959-965
     CrossRef

230. 230

     Sabine Strassburg, Jochen Springer, Stefan D. Anker. (2005) Muscle wasting in cardiac cachexia. The International Journal of Biochemistry & Cell Biology 37:10, 1938-1947
     CrossRef

231. 231

     Geoffrey Goldspink. (2005) Impairment of IGF-I gene splicing and MGF expression associated with muscle wasting. The International Journal of Biochemistry & Cell Biology 37:10, 2012-2022
     CrossRef

232. 232

     Erynn S. Gordon, Heather A. Gordish Dressman, Eric P. Hoffman. (2005) The genetics of muscle atrophy and growth: The impact and implications of polymorphisms in animals and humans. The International Journal of Biochemistry & Cell Biology 37:10, 2064-2074
     CrossRef

233. 233

     Amy Bishop, Ravi Kambadur, Mridula Sharma. (2005) The therapeutic potential of agents that inactivate myostatin. Expert Opinion on Investigational Drugs 14:9, 1099-1106
     CrossRef

234. 234

     Nadine Bakkar, Henning Wackerhage, Denis C. Guttridge. (2005) Myostatin and NF-κB Regulate Skeletal Myogenesis Through Distinct Signaling Pathways. Signal Transduction 5:4, 202-210
     CrossRef

235. 235

     Sławomir Wójcik, W. King Engel, Janis McFerrin, Valerie Askanas. (2005) Myostatin is increased and complexes with amyloid-β within sporadic inclusion-body myositis muscle fibers. Acta Neuropathologica 110:2, 173-177
     CrossRef

236. 236

     Thomas Kubin, Maren Tomars, Christian Fach, Stefan Hein, Peter Bramlage, Gil-Jin Shim, Dimitri Scholz, Sawa Kostin, René Zimmermann, Albrecht Elsässer, Wolfgang Schaper, Jutta Schaper. (2005) Transforming growth factor-β1 downregulates beating frequency and remodeling of cultured rat adult cardiomyocytes. Cell and Tissue Research 321:1, 57-66
     CrossRef

237. 237

     Guido R. Zanni, Jeannette Y. Wick. (2005) Understanding Sarcopenia in the Elderly. The Consultant Pharmacist 20:7, 568-582
     CrossRef

238. 238

     SHIGEO KAWADA, NAOKATA ISHII. (2005) Skeletal Muscle Hypertrophy after Chronic Restriction of Venous Blood Flow in Rats. Medicine & Science in Sports & Exercise 37:7, 1144-1150
     CrossRef

239. 239

     Basma F. Benabdallah, Manaf Bouchentouf, Jacques P. Tremblay. (2005) Improved Success of Myoblast Transplantation in mdx Mice by Blocking the Myostatin Signal. Transplantation 79:12, 1696-1702
     CrossRef

240. 240

     John E. Morley, Moon Jong Kim, Matthew T. Haren. (2005) Frailty and Hormones. Reviews in Endocrine and Metabolic Disorders 6:2, 101-108
     CrossRef

241. 241

     Kenneth R. Chien, Gerard Karsenty. (2005) Longevity and Lineages: Toward the Integrative Biology of Degenerative Diseases in Heart, Muscle, and Bone. Cell 120:4, 533-544
     CrossRef

242. 242

     Ketan Patel, Helge Amthor. (2005) The function of Myostatin and strategies of Myostatin blockade—new hope for therapies aimed at promoting growth of skeletal muscle. Neuromuscular Disorders 15:2, 117-126
     CrossRef

243. 243

     Wei Yang, Yong Zhang, Guoda Ma, Xinyi Zhao, Yan Chen, Dahai Zhu. (2005) Identification of gene expression modifications in myostatin-stimulated myoblasts. Biochemical and Biophysical Research Communications 326:3, 660-666
     CrossRef

244. 244

     S. Kawada. (2005) What phenomena do occur in blood flow-restricted muscle?. International Journal of KAATSU Training Research 1:2, 37-44
     CrossRef

245. 245

     JAMES G. TIDBALL, MICHELLE WEHLING-HENRICKS. (2004) Evolving Therapeutic Strategies for Duchenne Muscular Dystrophy: Targeting Downstream Events. Pediatric Research 56:6, 831-841
     CrossRef

246. 246

     Geoffrey Goldspink, Stephen D.R. Harridge. (2004) Growth factors and muscle ageing. Experimental Gerontology 39:10, 1433-1438
     CrossRef

247. 247

     (2004) Myostatin Mutation Associated with Gross Muscle Hypertrophy in a Child. New England Journal of Medicine 351:10, 1030-1031
     Full Text

248. 248

     Helen Pearson. (2004) Muscles release secret of strength. news@nature
     CrossRef

249. 249

     McNally, Elizabeth M., . (2004) Powerful Genes — Myostatin Regulation of Human Muscle Mass. New England Journal of Medicine 350:26, 2642-2644
     Full Text

Letters