Original Article
Avian Influenza A (H5N1) in 10 Patients in Vietnam
N Engl J Med 2004; 350:1179-1188March 18, 2004
- Abstract
Background
Recent outbreaks of avian influenza A (H5N1) in poultry throughout Asia have had major economic and health repercussions. Human infections with this virus were identified in Vietnam in January 2004.
Methods
We report the clinical features and preliminary epidemiologic findings among 10 patients with confirmed cases of avian influenza A (H5N1) who presented to hospitals in Ho Chi Minh City and Hanoi, Vietnam, in December 2003 and January 2004.
Results
In all 10 cases, the diagnosis of influenza A (H5N1) was confirmed by means of viral culture or reverse transcriptase–polymerase chain reaction with primers specific for H5 and N1. None of the 10 patients (mean age, 13.7 years) had preexisting medical conditions. Nine of them had a clear history of direct contact with poultry (median time before onset of illness, three days). All patients presented with fever (temperature, 38.5 to 40.0°C), respiratory symptoms, and clinically significant lymphopenia (median lymphocyte count, 700 per cubic millimeter). The median platelet count was 75,500 per cubic millimeter. Seven patients had diarrhea. In all patients, there were marked abnormalities on chest radiography. There was no definitive evidence of human-to-human transmission. Eight patients died, one patient has recovered, and one is recovering.
Conclusions
Influenza A (H5N1) infection, characterized by fever, respiratory symptoms, and lymphopenia, carries a high risk of death. Although in all 10 cases the infection appears to have been acquired directly from infected poultry, the potential exists for genetic reassortment with human influenzaviruses and the evolution of human-to-human transmission. Containment of influenza A (H5N1) in poultry throughout Asia is therefore urgently required.
Media in This Article
Figure 1
Map of Vietnam Showing the Reported Cases of Avian Influenza A (H5N1).Figure 2
RT-PCR Specific for the H5 Gene of Influenza A (H5N1) Virus, Performed with the Use of the H5b Primers (Panel A), and RT-PCR Specific for the N1 Gene, Performed with the Use of the Modified N1 Primers (Panel B).Article Activity
- Article
Influenza A virus infects a variety of animals, including humans and birds.1 Although the natural reservoir for all known subtypes of influenza A (hemagglutinins H1 through H15 and neuraminidases N1 through N9) is wild waterfowl, only three subtypes are currently circulating among humans (H1N1, H1N2, and H3N2). However, during the past few years, several subtypes of avian influenza A have been shown to cross the species barrier and infect humans. During an outbreak of a highly pathogenic influenza A (H5N1) virus among poultry in Hong Kong in 1997, 6 of 18 people with confirmed infection died.2 After this outbreak, prevention policies and early detection strategies were put into place, and no new cases of H5N1 were detected in Hong Kong until February 2003, when two cases were reported, one of which resulted in death.1 Possibly as a result of heightened surveillance, avian influenza A (H9N2) viruses were also isolated from children in Hong Kong in 1999, but this infection resulted in only mild, self-limiting illnesses.3,4
A total of 89 human infections with influenza A (H7N7), including 1 resulting in the death of a Dutch veterinarian, occurred during the extensive outbreak in 2003 that decimated the Dutch poultry industry.5,6 During late 2003 and early 2004, there were reports of large outbreaks of H5N1 among poultry throughout Asia (including South Korea, Japan, Indonesia, Vietnam, Thailand, Laos, Cambodia, and China). In January 2004, there was confirmation that influenza A (H5N1) virus had been isolated from patients who had died of a respiratory illness in Hanoi and Ho Chi Minh City, Vietnam. We report the epidemiologic, clinical, and radiographic features in 10 patients with confirmed influenza A (H5N1) infection.
Methods
Patients
We identified 10 patients in Vietnam with avian influenza A (H5N1) virus infection as confirmed by culture or reverse-transcriptase polymerase chain reaction (RT-PCR). Four of the patients (Patients 1, 2, 3, and 4) were admitted to the National Hospital for Pediatrics in Hanoi between December 27, 2003, and January 14, 2004. The other six patients (Patients 5, 6, 7, 8, 9, and 10) were admitted to the Hospital for Tropical Diseases in Ho Chi Minh City between January 20 and January 30, 2004. Epidemiologic data were collected through interviews of the patients and their relatives. Data on vital signs, physical findings, and routine laboratory tests were obtained by means of a retrospective review of the hospital records (for Patients 1, 2, 3, and 4) and from prospectively recorded case notes (for Patients 5, 6, 7, 8, 9, and 10).
Radiologic Assessment
Chest radiographs were obtained in all patients during hospitalization and were reviewed by experienced clinicians. The radiologic findings were categorized with attention to unilateral or bilateral changes; focal, lobar, or patchy consolidation; air-space infiltrates; air bronchograms; pleural effusions; and volume loss with or without shift.
Microbiologic Evaluation
Blood cultures were obtained from all patients on admission to the hospital. Throat and nasal swabs and, when appropriate, tracheal aspirates were collected in viral transport medium (Minimum Essential Medium Eagle with Hanks' salts, supplemented with 0.5 percent gelatin and antibiotics [Sigma-Aldrich]) or phosphate-buffered saline and stored at –80°C. In the four patients in Hanoi, swabs were obtained and stored in a collection and transport system for viruses and chlamydiae (Multi-Microbe Medium Collection and Transport System [M4RT], Remel). Virus was cultured in monolayers of Madin–Darby canine kidney cells. Isolated virus was identified by means of immunofluorescence and hemagglutination-inhibition assays, as previously described.1 Rapid influenza tests (Capillia Flu A/B Test [Nippon Becton Dickinson] or QuickVue [Quidel]) were used according to the manufacturers' instructions to test nose and throat swabs from six patients.
RNA Extraction and RT-PCR
RNA was extracted from 140 μl of nasal and throat swab samples in phosphate-buffered saline or viral transport medium with the use of a viral RNA kit (QIAamp, Qiagen) and a double elution with 2× 40 μl of buffer; 5 μl of the RNA extract was analyzed in the RT-PCR assay. Reverse-transcriptase reactions contained 2 μl of 5× first-strand buffer, 2.5 μM random hexamer primers (Roche Diagnostics), 40 units of RNase inhibitor (RNase OUT, Invitrogen), and 1 μl (200 units) of reverse transcriptase (Superscript II, Invitrogen). Reverse-transcriptase reactions were performed at room temperature for 10 minutes, then at 42°C for 30 minutes and at 70°C for 5 minutes; 2 μl of the cDNA was used for amplification in the PCR assays. The reactions (total volume of 25 μl) contained 2.5 μl of 10× PCR Gold buffer, 2.5 mM magnesium chloride, 0.4 mM deoxynucleoside triphosphates (Roche Diagnostics), 0.8 mM of each of the two primers, and 0.5 unit of AmpliTaq Gold DNA polymerase (Applied Biosystems).
The samples from Patients 1, 2, 3, and 4 were tested with the primer set for the H5 gene (forward primer H5-1: GCCATTCCACAACATACACCC; reverse primer H5-2: TAAATTCTCTATCCTCCTTTCCAA) with an expected product size of 358 bp,2 and the primer set for the N1 gene (forward primer N1-1: TTGCTTGGTCAGCAAGTGCA; reverse primer N1-2: TCTGTCCATCCATTAGGATCC) with an expected product size of 615 bp.7 Thermal cycling for these reactions was performed under the following conditions: 94°C for 3 minutes; 40 cycles of 94°C for 30 seconds, 45°C (for H5) or 55°C (for N1) for 30 seconds, and 72°C for 1 minute; then 72°C for 7 minutes.
The samples from Patients 5, 6, 7, 8, 9, and 10 were tested with two different primer sets that are specific for the influenza A subtype H5 gene: primer pair H5-1 and H5-2 (as described above) and primer pair H5b (forward primer H5/515: CATACCCAACAATAAAGAGG; and reverse primer H5/1220: GTGTTCATTTTGTTAATGAT, with an expected product size of 708 bp). For samples from these six patients, the influenza A N1 gene was amplified with the primers described above, except that there was a modification in the N1-1 primer: TTGCTTGGTCAGCAAGTGCT. All patients were tested for the H1 subtype of influenza A (with the forward primer H1: AGCAAAAGCAGGGGAAAATAA and the reverse primer H1: GCTATTTCTGGGGTGAATCT; expected size of the PCR product, 729 bp) and the H3 subtype of influenza A (with the forward primer H3: AGCAAAAGCAGGGGATAATTC and the reverse primer H3: TGCCTGAAACCGTACCAACC; expected product size, 1143 bp).
Thermal cycling for all amplifications, except for that of the influenza A N1 gene fragment, was 95°C for 10 minutes (preamplification hot start); 10 cycles of 95°C for 30 seconds, 55°C for 30 seconds (decreased by 1°C per cycle), and 72°C for 1 minute; and 40 cycles of 95°C for 30 seconds, 45°C for 30 seconds, and 72°C for 1 minute. For the N1 gene fragment, thermal cycling conditions were 95°C for 10 minutes; 10 cycles of 95°C for 30 seconds, 60°C for 30 seconds (decreased by 1°C per cycle), and 72°C for 1 minute; and 40 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute.
Products were analyzed on a 2 percent agarose gel. Precautions for the avoidance of cross-contamination were strictly observed. All samples were obtained and transported in individual sealed bags. The preparation of RT-PCR mixtures, nucleic acid extractions, and amplification and analysis of PCR products were performed in three separate laboratories. Aerosol-resistant filter tips (A.R.T., Molecular BioProducts) were used throughout all laboratory procedures. Negative controls were included during the RNA extraction, reverse transcription, and PCR amplification.
Results
Patients and Contact History
The mean age of patients (four of whom were female and six male) was 13.7 years (range, 5 to 24); none had any known, clinically significant preexisting medical conditions. Patients 8, 9, and 10 were smokers. The patients were from both rural and urban parts of Vietnam (Figure 1Figure 1
Map of Vietnam Showing the Reported Cases of Avian Influenza A (H5N1).). Seven of the patients were children attending school. Patients 8, 9, and 10 came from the same district in Lam Dong Province, were from the K'hor ethnic group, and worked as subsistence farmers. There was no contact among the patients before hospitalization.For eight of the nine patients in whom a history could be obtained, there was clear evidence of either direct handling of poultry (chickens or ducks) or exposure to sick poultry in the week before the onset of illness (Table 1Table 1
Epidemiologic Data.). The median time between exposure and the onset of illness was 3 days (range, 2 to 4) and the median time between the onset of illness and hospitalization was 5.9 days (range, 3 to 8). None of the patients had been involved in the organized culling of poultry.There were similar illnesses reported in relatives of Patients 1 and 2. Patient 1 became sick on December 25, 2003, was admitted to the hospital on December 27, and died on December 30. Her mother became sick on January 1, 2004, was admitted to the hospital on January 5, and died on January 9. Influenza A (H5N1) infection was confirmed in the mother (who is not included in this report). There was no illness reported in the father or sibling of Patient 1. The seven-year-old sister of Patient 2 reportedly died of a respiratory illness on the day Patient 2 was admitted to the hospital, but no clinical details are available. There was no illness reported in the parents or two other siblings of Patient 2. No illness during the preceding two weeks or during hospitalization was reported in any family member or contacts of the other patients.
Infection-control measures were initiated in both hospitals as soon as it was suspected that this illness was caused by influenza A (H5N1). No negative-pressure isolation facilities were available. Patients 1 and 2 were admitted before influenza A (H5N1) was suspected, and therefore their cases were managed with universal precautions but without additional infection-control measures.
Clinical and Other Features
The clinical features of the patients with confirmed infection with influenza A (H5N1) virus are summarized in Table 2Table 2
Clinical Characteristics of the Patients on Admission.. All patients presented with fever, shortness of breath, and a cough; in five patients, there was a history of sputum production, and in three of these patients, the sputum was blood-stained. Two patients reported pleuritic pain. Diarrhea was reported in seven of the patients. Bleeding from the nose and gums was noted in one patient on the fourth day of illness. No patient had a sore throat, conjunctivitis, rash, or a runny nose. Physical examination in nine patients revealed fever, rapid respiratory rate (median, 55 breaths per minute; range, 28 to 70), respiratory distress, and crackles on examination of the chest.Laboratory Assessment
The results of the basic laboratory tests performed on admission are shown in Table 3Table 3
Laboratory Values at Presentation.. The median total leukocyte count on admission was 2100 per cubic millimeter (range, 1200 to 3400). The median total lymphocyte count was 700 per cubic millimeter (range, 250 to 1100). The median ratio of CD4-positive cells to CD8-positive cells (measured in Patients 5, 7, 8, 9, and 10) was 0.70 (range, 0.59 to 1.08). The median platelet count was 75,500 per cubic millimeter (range, 45,000 to 174,000). Measurements of alanine aminotransferase and aspartate aminotransferase levels on admission were available in six patients and were elevated in five of them (Patients 1, 4, 5, 6, and 10); one patient (Patient 10) had an elevated serum creatinine concentration on admission. Three patients (Patients 7, 8, and 9) had marked hyperglycemia that developed during hospitalization.Microbiologic Assessment
Blood cultures were all negative. Staphylococcus aureus was isolated from a tracheal aspirate from Patient 1, and Haemophilus influenzae from a tracheal aspirate from Patient 2. The diagnosis of influenza A (H5N1) was confirmed through the isolation of the virus from postmortem lung tissue from Patient 1 and throat swabs from Patient 2. In all other patients, the diagnosis was made by means of RT-PCR with the use of primers specific to H5 and N1 in samples obtained from nasal and throat swabs. Among the patients hospitalized in Ho Chi Minh City, the results on RT-PCR with the use of the H5b (H5/515F and H5/1220R) primer pair were positive in all six patients tested (Figure 2Figure 2
RT-PCR Specific for the H5 Gene of Influenza A (H5N1) Virus, Performed with the Use of the H5b Primers (Panel A), and RT-PCR Specific for the N1 Gene, Performed with the Use of the Modified N1 Primers (Panel B).), whereas the results of RT-PCR with the H5-1 and H5-2 primer pair were positive in four of the six patients tested. None of the patients' samples were positive with the use of primers specific for influenza H1 or influenza H3. The median duration of illness at the time when RT-PCR confirmed the presence of avian influenza A (H5N1) was 6 days (range, 5 to 12).Influenza A antigens were detected in two of the six patients who were tested. In one patient (Patient 2), virus was isolated from a sample obtained on day 7 of illness but could not be isolated from a sample obtained on day 15.
Radiologic Assessment
All chest radiographs were abnormal on admission to the hospital (Figure 3Figure 3
Chest Radiographs.). The major abnormalities included extensive infiltration bilaterally, lobar collapse, focal consolidation, and air bronchograms. No pleural effusions were noted. All patients had dramatic worsening of findings on chest radiography during hospitalization. Pneumothorax developed in Patients 2 and 4 while they were receiving mechanical ventilation.Treatment and Outcome
All patients were treated empirically with broad-spectrum antibiotics on admission. Patients 1, 2, 3, and 4 received 5 mg of methylprednisolone per kilogram of body weight per day, and Patients 5, 7, and 8 received 1 to 2 mg of methylprednisolone per kilogram four times a day for one, three, and four days, respectively. Five patients were treated with the neuraminidase inhibitor oseltamivir (35 mg twice daily in Patient 5 and 75 mg twice daily in Patients 7, 8, 9, and 10) for up to five days. Ribavirin was given to Patient 3 (800 mg three times a day) and Patient 4 (400 mg three times a day). The antiviral treatment was started on day 5 of illness in Patients 4, 7, 9, and 10; day 6 in Patients 6 and 8; day 11 in Patient 3; and day 12 in Patient 5. Patients 5, 6, 7, 8, 9, and 10 received ranitidine.
Patient 5 required continuous positive airway pressure with supplemental oxygen for the first seven days after admission but was subsequently weaned from this support and given maintenance therapy with 40 percent oxygen. Patients 1, 2, 3, 4, 6, 7, 8, and 9 required mechanical ventilation during the first 48 hours after admission. In all these patients, there was a dramatic deterioration of gas exchange despite pressure-controlled ventilation, high end-expiratory pressures, and a fraction of inspired oxygen of 1.0. Patients 7 and 8 were also treated with dopamine and norepinephrine for hypotension. Patient 7 had a small gastrointestinal hemorrhage on the third day of hospitalization. Patients 7 and 8 had marked hyperglycemia requiring insulin treatment to normalize the blood glucose levels.
Despite a prolonged, severe illness, Patient 5 survived with no major sequelae. Eight other patients died, and one patient is recovering, for a case fatality rate of 80 percent among patients in our series. The median time to death from the onset of illness was 9 days (range, 6 to 17). Neither during the period when these patients were hospitalized nor subsequently was any illness reported in a health care worker or laboratory staff member.
Discussion
To date, there have been 20 confirmed cases of human infection with influenza A (H5N1) in Vietnam and Thailand; 16 of the infected patients have died. We describe the clinical features of 10 cases of confirmed avian influenza A (H5N1) in patients admitted to referral hospitals in Vietnam.
The prominent clinical features on admission were those of a severe influenza syndrome with fever, cough, diarrhea, and shortness of breath. The estimated time between the exposure to poultry and the onset of illness suggests an incubation period of two to four days. Diarrhea was present in 7 of the 10 cases. The most striking laboratory findings were marked lymphopenia and thrombocytopenia with a pronounced inversion of the CD4:CD8 ratio in the five patients in whom it could be measured. A recovery of the lymphocyte count and CD4:CD8 ratio was observed only in the two patients who survived. Liver and renal dysfunction or impaired glycemic control was prominent in six of the patients. The patients were all children or young adults.
These clinical presentations were similar to those in the 1997 outbreak of influenza A (H5N1) in Hong Kong, although diarrhea was a more prominent feature in the Vietnamese patients. In addition, the oldest patient in this series was 24 years old, whereas one patient was 54 years old and one was 60 years old in the 1997 outbreak in Hong Kong.2 However, the mortality in our series was significantly higher than that in the 1997 outbreak.
Eight of the nine patients from whom a clear history could be taken reported close contact with poultry during the week before the onset of illness. A retrospective study after the Hong Kong outbreak showed that visiting poultry markets before the onset of illness was the only significant risk factor.8 The contact in six of the current cases involved direct handling of chickens or ducks (holding, killing, or defeathering them or preparing them to be eaten) within the patient's home environment or small homesteads nearby, where a relatively small number of chickens were kept. This finding suggests that direct contact is the primary route of bird-to-human transmission. None of the patients were involved in the organized culling of poultry or worked on large poultry farms. This observation, if confirmed, may have important implications for our understanding of the transmission of this virus and potential immunity to it.
The available information on the two family clusters is compatible with bird-to-human transmission from a common source, but there is currently not enough information to rule out limited human-to-human transmission within the family. There was no illness reported in family members of the other eight patients, even though other family members seemed to have had very similar exposure to poultry — for example, the brother of Patient 5 and the fathers of Patients 7 and 8. There is evidence from the 1997 outbreak in Hong Kong that the avian influenza A (H5N1) virus may have been transmitted from human to human but that transmission could not be sustained among humans.9,10 The absence of any report to date of a similar illness among the health care workers who cared for these patients, despite the lack of full droplet and respiratory infection-control measures early in the outbreak, is reassuring. We cannot rule out the possibility of mild or subclinical infection in persons exposed to either ill poultry or ill persons. Detailed seroepidemiologic studies of the individual family members, health care workers, and others at risk would be necessary in order to assess whether and to what extent human-to-human transmission has occurred.
Oseltamivir was administered to five of the patients, four of whom died. Treatment with the drug may have been started too late to be effective, although one of the two surviving patients did not start oseltamivir therapy until the 12th day of illness. At that point, she was still antigen-positive and PCR-positive for the virus. There seemed to be no benefit from the oral administration of ribavirin (in Patients 3 and 4). In vitro sensitivity testing of a limited number of strains of influenza A (H5N1) virus isolated from patients in Vietnam have shown that they are resistant to amantadine and rimantadine, so these drugs should not be recommended for treatment. Six of the seven patients who were treated with corticosteroids died. This experience is inadequate to permit the establishment of treatment recommendations with respect to corticosteroids; more aggressive treatments may have been used in patients with a greater severity of illness. Our experience suggests that supportive care may be the only option available. Controlled clinical studies are needed to assess the role of antiviral drugs and corticosteroids in the treatment of influenza A (H5N1) virus infections.
Rapid testing for influenza antigens in a small number of patients on admission was less sensitive than RT-PCR for the diagnosis of influenza A (H5N1). Our experience in this small number of cases suggests that the low sensitivity of the rapid diagnostic tests for influenza may limit their usefulness for the reliable detection of influenza A (H5N1) in humans, especially if patients present relatively late in the course of illness and if other strains of influenza A are circulating simultaneously. The H5b primer pair yielded positive RT-PCR results in all six patients tested in this small series, as compared with positive results in four of six with the use of the H5-1 and H5-2 primers on the same samples. The N1 primers used resulted in nonspecific RT-PCR products and required modification to yield specific results. Further evaluation of the two H5 primer systems is being undertaken. The sensitivity of the RT-PCR methods, which were designed for the identification of influenza A (H5N1) virus from culture, is unknown, and we urgently need new, properly evaluated, sensitive diagnostic tests.
The clinical findings (fever, cough, diarrhea, shortness of breath, rapid respiratory rate, lymphopenia, and abnormalities on chest radiography) and a history of close contact with poultry may be more helpful in identifying patients with influenza A (H5N1) infection than the results on rapid diagnostic tests for influenza. We do not know whether the clinical syndrome described on the basis of these 10 patients is representative of the true clinical spectrum of the disease, since each of these patients was admitted to a referral hospital. The extent of mildly symptomatic disease in the community remains unknown. Increasing the availability of serologic tests, molecular diagnostic procedures, and viral culture throughout Asia would help considerably.
As documented in Hong Kong in 1997 and 2003, and now in Vietnam and Thailand, the avian influenza A (H5N1) virus clearly has the ability to jump between species and cause devastating illness in humans. Widespread efforts to control the poultry outbreak and increased surveillance among poultry and humans should therefore be our highest priority. It is reassuring that to date there has been no evidence of efficient human-to-human transmission of influenza A (H5N1) virus in either the 1997 or the 2004 outbreak. However, the continued circulation of virulent avian influenza A (H5N1) virus increases the possibility of the reassortment of this virus with other circulating human influenza A viruses and increases the threat of a global influenza pandemic.
Supported by the Ministry of Health of Vietnam, the World Health Organization, and the Wellcome Trust. Dr. Farrar is a Wellcome Trust Senior Research Fellow.
This article was published at www.nejm.org on February 25, 2004.
We are indebted to the Ministry of Health of Vietnam; to the directors of the Hospital for Tropical Diseases, Ho Chi Minh City; the National Pediatric Hospital, Hanoi; the Pediatric Hospital Number Two, Ho Chi Minh City; the National Institute of Hygiene and Epidemiology, Hanoi; and the Pasteur Institute, Ho Chi Minh City; to Dr. Nguyen The Dung, director of the Health Service of Ho Chi Minh City, for his important contribution to this work; to Dr. Guy Thwaites and Dr. Bridget Wills for reporting the chest radiography results; to Dr. Cameron Simmons and Ms. Bich Cau for the CD4:CD8 ratios; to Dr. Phuong Tuan for advice on statistical analysis; and to Dr. Masaki Imai and Dr. Takehiko Saito for providing the H5b primer set.
Source Information
From the Hospital for Tropical Diseases (T.T.H., N.T.D., P.P.M., N.V.C., D.B.K., N.T. Truong) and the Oxford University Clinical Research Unit at the Hospital for Tropical Diseases (C.D., T.T.T., M.J., C.S., J.F.); Pediatric Hospital Number Two (V.C.D.); Health Service of Ho Chi Minh City (L.T.G.); the Pasteur Institute (N.T.K.T., L.H.S., L.V.T.); and the Preventive Medicine Center (N.D.T., L.H.N.) — all in Ho Chi Minh City, Vietnam; the National Pediatric Hospital (N.T.L., L.T.S., P.T.S., N.T. Thi, L.P.P., C.V.T.); and the National Institute of Hygiene and Epidemiology (H.T.L., L.T.Q.M.) — both in Hanoi, Vietnam; the Government Virus Unit, Department of Health, Hong Kong, China (P.C., W.L.); and the Vietnam Office, World Health Organization, Hanoi, Vietnam (P.H.).
Address reprint requests to Dr. Farrar at the Hospital for Tropical Diseases, 190 Ben Ham Tu, Quan 5, Ho Chi Minh City, Vietnam, or at jeremyjf@hcm.vnn.vn.
Members of the World Health Organization International Avian Influenza Investigative Team are listed in the Appendix.
Appendix
The members of the World Health Organization International Avian Influenza Investigative Team are as follows: N. Bhat (Centers for Disease Control and Prevention), P. Brudon (World Health Organization), P. Calain (World Health Organization), A. Curns (Centers for Disease Control and Prevention), R. Doran (World Health Organization), K. Fukuda (Centers for Disease Control and Prevention), T. Grein (World Health Organization), P. Horby (World Health Organization), S. Itamura (National Institute of Infectious Diseases, Tokyo, Japan), N. Miranda (World Health Organization), T. Uyeki (Centers for Disease Control and Prevention).
- References
References
1
Nicholson KG ,Wood JM ,Zambon M . Influenza. Lancet 2003;362:1733-1745
CrossRef | Web of Science | Medline2
Yuen KY ,Chan PK ,Peiris M , et al. Clinical features and rapid viral diagnosis of human disease associated with avian influenza A H5N1 virus. Lancet 1998;351:467-471
CrossRef | Web of Science | Medline3
Peiris M ,Yuen KY ,Leung CW , et al. Human infection with influenza H9N2. Lancet 1999;354:916-917
CrossRef | Web of Science | Medline4
Chan PK . Outbreak of avian influenza A (H5N1) virus infection in Hong Kong in 1997. Clin Infect Dis 2002;34:Suppl 2:S58-S64
CrossRef | Web of Science | Medline5
van Kolfschooten F . Dutch veterinarian becomes first victim of avian influenza. Lancet 2003;361:1444-1444
CrossRef | Web of Science | Medline6
Fouchier RA ,Schneeberger PM ,Rozendaal FW , et al. Avian influenza A virus (H7N7) associated with human conjunctivitis and a fatal case of acute respiratory distress syndrome. Proc Natl Acad Sci U S A 2004;101:1356-1361
CrossRef | Web of Science | Medline7
Wright KE ,Wilson GA ,Novosad D ,Dimock C ,Tan D ,Weber JM . Typing and subtyping of influenza viruses in clinical samples by PCR. J Clin Microbiol 1995;33:1180-1184
Web of Science | Medline8
Mounts AW ,Kwong H ,Izurieta HS , et al. Case-control study of risk factors for avian influenza A (H5N1) disease, Hong Kong, 1997. J Infect Dis 1999;180:505-508
CrossRef | Web of Science | Medline9
Bridges CB ,Lim W ,Hu-Primmer J , et al. Risk of influenza A (H5N1) infection among poultry workers, Hong Kong, 1997-1998. J Infect Dis 2002;185:1005-1010
CrossRef | Web of Science | Medline10
Katz JM ,Lim W ,Bridges CB , et al. Antibody response in individuals infected with avian influenza A (H5N1) viruses and detection of anti-H5 antibody among household and social contacts. J Infect Dis 1999;180:1763-1770
CrossRef | Web of Science | Medline
- Citing Articles (235)
Citing Articles
1
S. L. Stramer, C. Collins, T. Nugent, X. Wang, M. Fuschino, J. W. Heitman, J. Law, D. E. Krysztof, N. Kiely, D. Todd, N. M. J. Vermeulen, K. Harrington, H. Kamel, D. J. Kelvin, M. P. Busch, K. St. George, I. K. Hewlett, J. M. Linnen, P. J. Norris, . (2012) Sensitive Detection Assays for Influenza RNA Do Not Reveal Viremia in US Blood Donors. Journal of Infectious Diseases
CrossRef2
Yu Li, Jiangning Li, Sarah Belisle, Carole R. Baskin, Terrence M. Tumpey, Michael G. Katze. (2011) Differential microRNA expression and virulence of avian, 1918 reassortant, and reconstructed 1918 influenza A viruses. Virology 421:2, 105-113
CrossRef3
Trong Wisedchanwet, Manoosak Wongpatcharachai, Supanat Boonyapisitsopa, Napawan Bunpapong, Waleemas Jairak, Pravina Kitikoon, Jiroj Sasipreeyajun, Alongkorn Amonsin. (2011) Influenza A Virus Surveillance in Live-Bird Markets: First Report of Influenza A Virus Subtype H4N6, H4N9, and H10N3 in Thailand. Avian Diseases 55:4, 593-602
CrossRef4
Chunling Xuan, Yi Shi, Jianxun Qi, Wei Zhang, Haixia Xiao, George F. Gao. (2011) Structural vaccinology: structure-based design of influenza A virus hemagglutinin subtype-specific subunit vaccines. Protein & Cell 2:12, 997-1005
CrossRef5
Thuy Thi Bich Phung, Ryuichi Sugamata, Kazuko Uno, Yasuaki Aratani, Keiko Ozato, Shoji Kawachi, Liem Thanh Nguyen, Toshinori Nakayama, Kazuo Suzuki. (2011) Key role of RANTES (regulated upon activation normal T-cell expressed and secreted), nonstructural protein1 and myeloperoxidase in cytokine storm induced by influenza virus PR-8(A/H1N1) infection in A549 bronchial epithelial cells. Microbiology and Immunologyno-no
CrossRef6
Kozue Hotta, Hiroki Takakuwa, Quynh Mai Thi Le, Song Lien Phuong, Toshiyuki Murase, Etsuro Ono, Toshihiro Ito, Koichi Otsuki, Tetsu Yamashiro. (2011) Isolation and characterization of H6N1 and H9N2 avian influenza viruses from Ducks in Hanoi, Vietnam. Virus Research
CrossRef7
James G. Donahue, Laura A. Coleman, Jeffrey Bender, Debra Kempf, Mary F. Vandermause, Paul J. McGraw, Dale C. Lauer, Edward A. Belongia. (2011) Prospective Study of Avian Influenza Infection in Backyard Poultry Flocks and Flock Handlers in Wisconsin. Vector-Borne and Zoonotic Diseases 11:9, 1293-1297
CrossRef8
Hyeok-il Kwon, Min-Suk Song, Philippe Noriel Q. Pascua, Yun Hee Baek, Jun Han Lee, Seung-Pyo Hong, Jong-Bok Rho, Jeong-Ki Kim, Haryoung Poo, Chul-Joong Kim, Young Ki Choi. (2011) Genetic characterization and pathogenicity assessment of highly pathogenic H5N1 avian influenza viruses isolated from migratory wild birds in 2011, South Korea. Virus Research 160:1-2, 305-315
CrossRef9
Hiroaki Kiyohara, Chikara Ichino, Yuka Kawamura, Takayuki Nagai, Noriko Sato, Haruki Yamada, Maha M. Salama, Essam Abdel-Sattar. (2011) In vitro anti-influenza virus activity of a cardiotonic glycoside from Adenium obesum (Forssk.). Phytomedicine
CrossRef10
Yu-Na Lee, Hyun-Jeong Lee, Dong-Hun Lee, Jung-Hyun Kim, Hee-Myung Park, Sang-Soep Nahm, Joong-Bok Lee, Seung-Yong Park, In-Soo Choi, Chang-Seon Song. (2011) Severe canine influenza in dogs correlates with hyperchemokinemia and high viral load. Virology 417:1, 57-63
CrossRef11
Ilyse Darwish, Samira Mubareka, W Conrad Liles. (2011) Immunomodulatory therapy for severe influenza. Expert Review of Anti-infective Therapy 9:7, 807-822
CrossRef12
M. Campos, J.M. Juarez, J. Palma, R. Marin, F. Palacios. (2011) Avian influenza: Temporal modeling of a human to human transmission case. Expert Systems with Applications 38:7, 8865-8885
CrossRef13
Ni Luh Putu Indi Dharmayant, Fera Ibrahim, . Darminto, Amin Soebandrio. (2011) Influenza H5N1 Virus of Birds Surrounding H5N1 Human Cases Have Specific Characteristics on the Matrix Protein. HAYATI Journal of Biosciences 18:2, 82-90
CrossRef14
Gabriele Neumann, Yoshihiro Kawaoka. (2011) The first influenza pandemic of the new millennium. Influenza and Other Respiratory Viruses 5:3, 157-166
CrossRef15
R. B. Belshe, S. E. Frey, I. Graham, M. J. Mulligan, S. Edupuganti, L. A. Jackson, A. Wald, G. Poland, R. Jacobson, H. L. Keyserling, P. Spearman, H. Hill, M. Wolff, . (2011) Safety and Immunogenicity of Influenza A H5 Subunit Vaccines: Effect of Vaccine Schedule and Antigenic Variant. Journal of Infectious Diseases 203:5, 666-673
CrossRef16
M. Montalvo-Corral, G. López-Robles, J. Hernández. (2011) Avian Influenza Survey in Migrating Waterfowl in Sonora, Mexico. Transboundary and Emerging Diseases 58:1, 63-68
CrossRef17
T. Aoyagi, N. Yamamoto, M. Hatta, D. Tanno, A. Miyazato, K. Ishii, K. Suzuki, T. Nakayama, M. Taniguchi, H. Kunishima, Y. Hirakata, M. Kaku, K. Kawakami. (2011) Activation of pulmonary invariant NKT cells leads to exacerbation of acute lung injury caused by LPS through local production of IFN- and TNF- by Gr-1+ monocytes. International Immunology 23:2, 97-108
CrossRef18
Hana M. Dobrovolny, Ronald Gieschke, Brian E. Davies, Nelson L. Jumbe, Catherine A.A. Beauchemin. (2011) Neuraminidase inhibitors for treatment of human and avian strain influenza: A comparative modeling study. Journal of Theoretical Biology 269:1, 234-244
CrossRef19
Ji-Won Ha, Kevin M. Downard. (2011) Evolution of H5N1 influenza virus through proteotyping of hemagglutinin with high resolution mass spectrometry. The Analyst 136:16, 3259
CrossRef20
Hiroyuki Furuya, Shoji Kawachi, Mika Shigematsu, Kazuo Suzuki, Tetsu Watanabe. (2011) Clinical factors associated with severity in hospitalized children infected with avian influenza (H5N1). Environmental Health and Preventive Medicine 16:1, 64-68
CrossRef21
Ji Eun Kim, Siegfried Bauer, Kyong Suk La, Kee Hyoung Lee, Ji Tae Choung, Kyoung Ho Roh, Chang Kyu Lee, Young Yoo. (2011) CD4+/CD8+ T lymphocytes imbalance in children with severe 2009 pandemic influenza A (H1N1) pneumonia. Korean Journal of Pediatrics 54:5, 207
CrossRef22
Tetsuo NAKAYAMA. (2011) Influenza Vaccine and Adjuvant. YAKUGAKU ZASSHI 131:12, 1723-1731
CrossRef23
Jiri Beran, Ibrahim A. Abdel-Messih, Jolana Raupachova, Lenka Hobzova, Elena Fragapane. (2010) A phase III, randomized, open-label study to assess the tolerability and immunogenicity of an H5N1 influenza vaccine administered to healthy adults with a 1-, 2-, 3-, or 6-week interval between first and second doses. Clinical Therapeutics 32:13, 2186-2197
CrossRef24
Yuta Kanai, Malinee Chittaganpitch, Izuru Nakamura, Gui-Mei Li, Gui-Rong Bai, Yong-Gang Li, Kazuyoshi Ikuta, Pathom Sawanpanyalert. (2010) Distinct propagation efficiencies of H5N1 influenza virus Thai isolates in newly established murine respiratory region-derived cell clones. Virus Research 153:2, 218-225
CrossRef25
P. HORBY, H. SUDOYO, V. VIPRAKASIT, A. FOX, P. Q. THAI, H. YU, S. DAVILA, M. HIBBERD, S. J. DUNSTAN, Y. MONTEERARAT, J. J. FARRAR, S. MARZUKI, N. T. HIEN. (2010) What is the evidence of a role for host genetics in susceptibility to influenza A/H5N1?. Epidemiology and Infection 138:11, 1550-1558
CrossRef26
J. Herington. (2010) Securitization of infectious diseases in Vietnam: the cases of HIV and avian influenza. Health Policy and Planning 25:6, 467-475
CrossRef27
Thomas W. Vahlenkamp, Jens P. Teifke, Timm C. Harder, Martin Beer, Thomas C. Mettenleiter. (2010) Systemic influenza virus H5N1 infection in cats after gastrointestinal exposure. Influenza and Other Respiratory Viruses 4:6, 379-386
CrossRef28
Haiyan Chang, Xiaoman Li, Yong Teng, Yan Liang, Bo Peng, Fang Fang, Ze Chen. (2010) Comparison of Adjuvant Efficacy of Chitosan and Aluminum Hydroxide for Intraperitoneally Administered Inactivated Influenza H5N1 Vaccine. DNA and Cell Biology 29:9, 563-568
CrossRef29
Julian W. Tang, Nandini Shetty, Tommy T.Y. Lam, K.L. Ellis Hon. (2010) Emerging, Novel, and Known Influenza Virus Infections in Humans. Infectious Disease Clinics of North America 24:3, 603-617
CrossRef30
Karthik Viswanathan, Aarthi Chandrasekaran, Aravind Srinivasan, Rahul Raman, V. Sasisekharan, Ram Sasisekharan. (2010) Glycans as receptors for influenza pathogenesis. Glycoconjugate Journal 27:6, 561-570
CrossRef31
W.-C. Tseng, H.-A. Li, W.-C. Huang, L.-H. Liang. (2010) Potential number of human cases of H5N1 avian influenza in Egypt. Public Health 124:8, 452-459
CrossRef32
Elpis Mantadakis, Evangelia Farmaki, Stavros Thomaidis, Aggelos Tsalkidis, Athanassios Chatzimichael. (2010) A Case of Immune Thrombocytopenic Purpura After Influenza Vaccination. Journal of Pediatric Hematology/Oncology 32:6, e227-e229
CrossRef33
P. Rabinowitz, M. Perdue, E. Mumford. (2010) Contact Variables for Exposure to Avian Influenza H5N1 Virus at the Human-Animal Interface. Zoonoses and Public Health 57:4, 227-238
CrossRef34
Isabelle Meunier, Stéphane Pillet, J. Neil Simonsen, Veronika von Messling. (2010) Influenza pathogenesis: Lessons learned from animal studies with H5N1, H1N1 Spanish, and pandemic H1N1 2009 influenza. Critical Care Medicine 38, e21-e29
CrossRef35
Seon Do Hwang, Jin Soo Shin, Keun Bon Ku, Hyun Soo Kim, Sung Whan Cho, Sang Heui Seo. (2010) Protection of pregnant mice, fetuses and neonates from lethality of H5N1 influenza viruses by maternal vaccination. Vaccine 28:17, 2957-2964
CrossRef36
Nancy J. Cox, Gabriele Neumann, Ruben O. Donis, Yoshihiro Kawaoka. 2010. Orthomyxoviruses: Influenza. .
CrossRef37
Xiaoming Song, Jian Chen, Kedsirin Sakwiwatkul, Ruili Li, Songhua Hu. (2010) Enhancement of immune responses to influenza vaccine (H3N2) by ginsenoside Re. International Immunopharmacology 10:3, 351-356
CrossRef38
Olivier Guionie, Cécile Guillou-Cloarec, David Courtois, Stéphanie Bougeard, Michel Amelot, Véronique Jestin. (2010) Experimental Infection of Muscovy Ducks with Highly Pathogenic Avian Influenza Virus (H5N1) Belonging to Clade 2.2. Avian Diseases 54:s1, 538-547
CrossRef39
Burke A. Cunha. (2010) Swine Influenza (H1N1) Pneumonia: Clinical Considerations. Infectious Disease Clinics of North America 24:1, 203-228
CrossRef40
Nurettin Erben, Elif Doyuk Kartal, Saygin Nayman Alpat, Ilhan Ozgunes, Gaye Usluer. (2010) A case of pneumonia following human infection with avian influenza a (H5N1). Central European Journal of Medicine 5:1, 59-61
CrossRef41
W.H. Mady, A.A. Sanousi, H.M. Amer, I.M. El-Sabagh, A.M. Khafagy, M.S. Saber. (2010) First Year of the Highly Pathogenic Avian Influenza H5N1 Outbreak in Egypt: Rapid Antigenic/Molecular Diagnosis and Virus Isolation. International Journal of Virology 6:2, 73-81
CrossRef42
S. Babiuk, R. Albrecht, Y. Berhane, P. Marszal, J. A. Richt, A. Garcia-Sastre, J. Pasick, H. Weingartl. (2010) 1918 and 2009 H1N1 influenza viruses are not pathogenic in birds. Journal of General Virology 91:2, 339-342
CrossRef43
A. Handel, I. M. Longini, R. Antia. (2010) Towards a quantitative understanding of the within-host dynamics of influenza A infections. Journal of The Royal Society Interface 7:42, 35-47
CrossRef44
Xiaoping Kang, Yongqiang Li, Honghe Sun, Weili Wu, Hong Liu, Fang Lin, Chenfeng Qing, Guohui Chang, Qingyu Zhu, Weijun Chen, Yinhui Yang. (2010) Subtype identification of the novel A H1N1 and other human influenza A viruses using an oligonucleotide microarray. Archives of Virology 155:1, 55-61
CrossRef45
Jean-Michel Garcia, Nadège Lagarde, Edward S.K. Ma, Menno D. de Jong, J.S. Malik Peiris. (2010) Optimization and evaluation of an influenza A (H5) pseudotyped lentiviral particle-based serological assay. Journal of Clinical Virology 47:1, 29-33
CrossRef46
W.R.J. Taylor, E. Burhan, H. Wertheim, P.Z. Soepandi, P. Horby, A. Fox, R. Benamore, L. de Simone, T.T. Hien, F. Chappuis. (2010) Avian influenza – A review for doctors in travel medicine. Travel Medicine and Infectious Disease 8:1, 1-12
CrossRef47
Ruiqin SUN, Jing LUO, Yunying GAO, Hongxuan HE. (2009) Different infection routes of avian influenza A (H5N1) virus in mice. Integrative Zoology 4:4, 402-408
CrossRef48
Yoshitaka Kashima, Mizuho Ikeda, Yasushi Itoh, Yoshihiro Sakoda, Tomoya Nagata, Taichiro Miyake, Kosuke Soda, Hiroichi Ozaki, Misako Nakayama, Hitomi Shibuya, Masatoshi Okamatsu, Hirohito Ishigaki, Hideaki Ishida, Toshihiro Sawai, Yoshihiro Kawaoka, Hiroshi Kida, Kazumasa Ogasawara. (2009) Intranasal administration of a live non-pathogenic avian H5N1 influenza virus from a virus library confers protective immunity against H5N1 highly pathogenic avian influenza virus infection in mice: Comparison of formulations and administration routes of vaccines. Vaccine 27:52, 7402-7408
CrossRef49
Rui P. Moreno, Andrew Rhodes, Jean-Daniel Chiche. (2009) The ongoing H1N1 flu pandemic and the intensive care community: challenges, opportunities, and the duties of scientific societies and intensivists. Intensive Care Medicine 35:12, 2005-2008
CrossRef50
Hiroshi Ohara, Nguyen Viet Hung, Truong Anh Thu. (2009) Fact-finding survey of nosocomial infection control in hospitals in Vietnam and application to training programs. Journal of Infection and Chemotherapy 15:6, 384-389
CrossRef51
Harald Brüssow. (2009) Europe, the bull and the Minotaur: the biological legacy of a Neolithic love story. Environmental Microbiology 11:11, 2778-2788
CrossRef52
Hyung Jae Jeong, Young Bae Ryu, Su-Jin Park, Jang Hoon Kim, Hyung-Jun Kwon, Jin Hyo Kim, Ki Hun Park, Mun-Chual Rho, Woo Song Lee. (2009) Neuraminidase inhibitory activities of flavonols isolated from Rhodiola rosea roots and their in vitro anti-influenza viral activities. Bioorganic & Medicinal Chemistry 17:19, 6816-6823
CrossRef53
P. Q. Minh, B. Schauer, M. Stevenson, G. Jones, R. S. Morris, A. Noble. (2009) Association Between Human Cases and Poultry Outbreaks of Highly Pathogenic Avian Influenza in Vietnam From 2003 to 2007: A Nationwide Study. Transboundary and Emerging Diseases 56:8, 311-320
CrossRef54
Terrence M. Tumpey, Jessica A. Belser. (2009) Resurrected Pandemic Influenza Viruses*. Annual Review of Microbiology 63:1, 79-98
CrossRef55
H. Marshall, P. Ryan, D. Roberton, J. Street, M. Watson. (2009) Pandemic Influenza and Community Preparedness. American Journal of Public Health 99:S2, S365-S371
CrossRef56
R. Smith, J.M. Brown. (2009) Simultaneous ventilation of two healthy subjects with a single ventilator. Resuscitation 80:9, 1087
CrossRef57
Pan Tao, Mengcheng Luo, Dandan Zhu, Sanfu Qu, Zhenhua Yang, Meng Gao, Deyin Guo, Zishu Pan. (2009) Virus-Like Particle Vaccine Comprised of the HA, NA, and M1 Proteins of an Avian Isolated H5N1 Influenza Virus Induces Protective Immunity Against Homologous and Heterologous Strains in Mice. Viral Immunology 22:4, 273-281
CrossRef58
Marguerite Pappaioanou. (2009) Highly pathogenic H5N1 avian influenza virus: Cause of the next pandemic?. Comparative Immunology, Microbiology and Infectious Diseases 32:4, 287-300
CrossRef59
Gabriele Neumann, Takeshi Noda, Yoshihiro Kawaoka. (2009) Emergence and pandemic potential of swine-origin H1N1 influenza virus. Nature 459:7249, 931-939
CrossRef60
P. Kim, P. Sorcar, S. Um, H. Chung, Y. S. Lee. (2009) Effects of episodic variations in web-based avian influenza education: influence of fear and humor on perception, comprehension, retention and behavior. Health Education Research 24:3, 369-380
CrossRef61
A. Maxmen. (2009) Jeremy Farrar: When disaster strikes. Journal of Experimental Medicine 206:1, 4-5
CrossRef62
Joel R. Haynes, Leslie Dokken, James A. Wiley, Andrew G. Cawthon, John Bigger, Allen G. Harmsen, Charles Richardson. (2009) Influenza-pseudotyped Gag virus-like particle vaccines provide broad protection against highly pathogenic avian influenza challenge. Vaccine 27:4, 530-541
CrossRef63
Jian-Xin Chen, Hui-Jun Xue, Wen-Cai Ye, Bing-Hu Fang, Ya-Hong Liu, Shao-Hua Yuan, Pei Yu, Yu-Qiang Wang. (2009) Activity of Andrographolide and Its Derivatives against Influenza Virus in Vivo and in Vitro. Biological & Pharmaceutical Bulletin 32:8, 1385-1391
CrossRef64
S. Herold, M. Steinmueller, W. von Wulffen, L. Cakarova, R. Pinto, S. Pleschka, M. Mack, W. A. Kuziel, N. Corazza, T. Brunner, W. Seeger, J. Lohmeyer. (2008) Lung epithelial apoptosis in influenza virus pneumonia: the role of macrophage-expressed TNF-related apoptosis-inducing ligand. Journal of Experimental Medicine 205:13, 3065-3077
CrossRef65
Phoupasong Somphou, Takehito Takano, Keiko Nakamura. (2008) Cohabitation with farm animals in urban households with and without occupational farm work: associations between participation in educational activities and good hygiene practices in at-risk households cohabiting with farm animals. Environmental Health and Preventive Medicine 13:6, 322-331
CrossRef66
Kenneth W. TSANG, Thomas M. FILE Jr. (2008) Respiratory infections unique to Asia. Respirology 13:7, 937-949
CrossRef67
Menno D. de Jong. (2008) H5N1 Transmission and Disease. The Pediatric Infectious Disease Journal 27:Supplement, S54-S56
CrossRef68
Nega Ali Goji, Carrie Nolan, Heather Hill, Mark Wolff, Diana L. Noah, Tracy B. Williams, Thomas Rowe, John J. Treanor. (2008) Immune Responses of Healthy Subjects to a Single Dose of Intramuscular Inactivated Influenza A/Vietnam/1203/2004 (H5N1) Vaccine after Priming with an Antigenic Variant. The Journal of Infectious Diseases 198:5, 635-641
CrossRef69
J. Marschall, B. Schulz, K. Hartmann. (2008) Evaluation of a Point-of-Care Influenza Antigen Test for the Detection of Highly Pathogenic Avian Influenza H5N1 Virus in Cats. Transboundary and Emerging Diseases 55:7, 315-317
CrossRef70
Xiaonan Yang, Hongliang Yang, Gangqiao Zhou, Guo-Ping Zhao. (2008) Infectious Disease in the Genomic Era. Annual Review of Genomics and Human Genetics 9:1, 21-48
CrossRef71
Hao-tai Chen, Jie Zhang, De-hui Sun, Ji-le Zhang, Xue-peng Cai, Xiang-tao Liu, Yao-zhong Ding, Li-na Ma, Sheng-hai Yang, Lei Jin, Yongsheng Liu. (2008) Rapid discrimination of H5 and H9 subtypes of avian influenza viruses and Newcastle disease virus by multiplex RT-PCR. Veterinary Research Communications 32:6, 491-498
CrossRef72
A. Kongchanagul, O. Suptawiwat, P. Kanrai, M. Uiprasertkul, P. Puthavathana, P. Auewarakul. (2008) Positive selection at the receptor-binding site of haemagglutinin H5 in viral sequences derived from human tissues. Journal of General Virology 89:8, 1805-1810
CrossRef73
Yong-Gang Li, Pranee Thawatsupha, Malinee Chittaganpitch, Kamonthip Rungrojcharoenkit, Gui-Mei Li, Takaaki Nakaya, Wattana Auwanit, Kazuyoshi Ikuta, Pathom Sawanpanyalert. (2008) Higher in vitro susceptibility of human T cells to H5N1 than H1N1 influenza viruses. Biochemical and Biophysical Research Communications 371:3, 484-489
CrossRef74
D. M. FLEMING, A. J. ELLIOT. (2008) Lessons from 40 years' surveillance of influenza in England and Wales. Epidemiology and Infection 136:07,
CrossRef75
Toshihiro Sawai, Yasushi Itoh, Hiroichi Ozaki, Norikazu Isoda, Kiyoko Okamoto, Yoshitaka Kashima, Yoshihiro Kawaoka, Yoshihiro Takeuchi, Hiroshi Kida, Kazumasa Ogasawara. (2008) Induction of cytotoxic T-lymphocyte and antibody responses against highly pathogenic avian influenza virus infection in mice by inoculation of apathogenic H5N1 influenza virus particles inactivated with formalin. Immunology 124:2, 155-165
CrossRef76
Diana Hans, Erin Kelly, Krista Wilhelmson, Eric D. Katz. (2008) Rapidly Fatal Infections. Emergency Medicine Clinics of North America 26:2, 259-279
CrossRef77
Christine Korteweg, Jiang Gu. (2008) Pathology, Molecular Biology, and Pathogenesis of Avian Influenza A (H5N1) Infection in Humans. The American Journal of Pathology 172:5, 1155-1170
CrossRef78
Bülent ÖZBAY, Bunyamin SERTOĞULLARİNDAN, Murat TEKIN, Orhan ALTINOZ. (2008) Influenza-associated pneumonia in a Turkish area with endemic avian influenza. Respirology 13:3, 444-446
CrossRef79
David A. Boltz, Jerold E. Rehg, Jennifer McClaren, Robert G. Webster, Elena A. Govorkova. (2008) Oseltamivir Prophylactic Regimens Prevent H5N1 Influenza Morbidity and Mortality in a Ferret Model. The Journal of Infectious Diseases 197:9, 1315-1323
CrossRef80
M.-S. Song, T.-K. Oh, H. J. Moon, D.-W. Yoo, E. H. Lee, J.-S. Lee, C.-J. Kim, G.-J. Yoo, H. Kim, Y.-K. Choi. (2008) Ecology of H3 avian influenza viruses in Korea and assessment of their pathogenic potentials. Journal of General Virology 89:4, 949-957
CrossRef81
Andrea Gambotto, Simon M Barratt-Boyes, Menno D de Jong, Gabriele Neumann, Yoshihiro Kawaoka. (2008) Human infection with highly pathogenic H5N1 influenza virus. The Lancet 371:9622, 1464-1475
CrossRef82
Prasert Auewarakul, Arunee Thitithanyanont, Anucha Apisarnthanarak, Pokrath Hansasuta, Porntippa Lekcharoensuk, Pilaipan Puthvathana. (2008) Bangkok International Conference on Avian Influenza 2008. Expert Review of Vaccines 7:3, 293-298
CrossRef83
Nguyen Tran Hien, Jeremy Farrar, Peter Horby. (2008) Person-to-person transmission of influenza A (H5N1). The Lancet 371:9622, 1392-1394
CrossRef84
David I. Bernstein, Kathryn M. Edwards, Cornelia L. Dekker, Robert Belshe, Helen K. B. Talbot, Irene L. Graham, Diana L. Noah, Fenhua He, Heather Hill. (2008) Effects of Adjuvants on the Safety and Immunogenicity of an Avian Influenza H5N1 Vaccine in Adults. The Journal of Infectious Diseases 197:5, 667-675
CrossRef85
Timothy M. UYEKI. (2008) Global epidemiology of human infections with highly pathogenic avian influenza A (H5N1) viruses. Respirology 13:s1, S2-S9
CrossRef86
David S.C. HUI. (2008) Influenza A/H5N1 infection: Other treatment options and issues. Respirology 13:s1, S22-S26
CrossRef87
Tadamasa Shibuya, Tetsu Yamashiro, Yuka Masaike, Masanobu Ohuchi, Gen-ichiro Uechi, Akira Nishizono. (2008) Identification of a human monoclonal Fab with neutralizing activity against H3N2 influenza A strain from a newly constructed human Fab library. Microbiology and Immunology 52:3, 162-170
CrossRef88
David S.-C. HUI. (2008) Review of clinical symptoms and spectrum in humans with influenza A/H5N1 infection. Respirology 13:s1, S10-S13
CrossRef89
Marie-Anne Rameix-Welti, Sylvie van der Werf, Nadia Naffakh. (2008) Sensitivity of H5N1 influenza viruses to oseltamivir: an update. Future Virology 3:2, 157-165
CrossRef90
Alex J Elliot, Douglas M Fleming. (2008) Influenza and respiratory syncytial virus in the elderly. Expert Review of Vaccines 7:2, 249-258
CrossRef91
Curtis N. SESSLER, Nicole D. GRAY. (2008) Intensive care management of life-threatening avian influenza A (H5N1). Respirology 13:s1, S27-S32
CrossRef92
Pallavi Somvanshi, Vijay Singh, P.K. Seth. (2008) Prediction of Epitopes in Hemagglutinin and Neuraminidase Proteins of Influenza A Virus H5N1 Strain: A Clue for Diagnostic and Vaccine Development. OMICS: A Journal of Integrative Biology 12:1, 61-69
CrossRef93
Gunilla B. Karlsson Hedestam, Ron A.M. Fouchier, Sanjay Phogat, Dennis R. Burton, Joseph Sodroski, Richard T. Wyatt. (2008) The challenges of eliciting neutralizing antibodies to HIV-1 and to influenza virus. Nature Reviews Microbiology 6:2, 143-155
CrossRef94
Viroj Wiwanitkit. (2008) Hemostatic disorders in bird flu infection. Blood Coagulation & Fibrinolysis 19:1, 5-6
CrossRef95
Sean P. Elliott, C. George Ray. 2008. Viral Infections of the Lower Respiratory Tract. , 481-489.
CrossRef96
Yasushi Itoh, Hiroichi Ozaki, Hideaki Tsuchiya, Kiyoko Okamoto, Ryuzo Torii, Yoshihiro Sakoda, Yoshihiro Kawaoka, Kazumasa Ogasawara, Hiroshi Kida. (2008) A vaccine prepared from a non-pathogenic H5N1 avian influenza virus strain confers protective immunity against highly pathogenic avian influenza virus infection in cynomolgus macaques. Vaccine 26:4, 562-572
CrossRef97
Hee Yun Seol, Ji Ryang Kim, Jung Ha Mok, Bo Ran Kwon, Sun-Hee Lee, Im Soo Kwak, Jin Woo Jung, Jeong-su Kim, Ock Bae Ko, En Hi Cho, Seong Sun Kim, Sang Sook Shin, Sang Won Lee. (2008) A Hospital-based Tabletop Exercise for Pandemic Influenza Preparedness: Design and Evaluation. Infection and Chemotherapy 40:2, 83
CrossRef98
G C Gray, W S Baker. (2007) The Importance of Including Swine and Poultry Workers in Influenza Vaccination Programs. Clinical Pharmacology & Therapeutics 82:6, 638-641
CrossRef99
Richard Vaille Lee. (2007) Transmission of influenza A in human beings. The Lancet Infectious Diseases 7:12, 760-761
CrossRef100
A. Apisarnthanarak, D. K. Warren, V. J. Fraser. (2007) Issues Relevant to the Adoption and Modification of Hospital Infection-Control Recommendations for Avian Influenza (H5N1 Infection) in Developing Countries. Clinical Infectious Diseases 45:10, 1338-1342
CrossRef101
LoRanee E. Braun, Deena E. Sutter, Maryna C. Eichelberger, Lioubov Pletneva, John F. Kokai-Kun, Jorge C.G. Blanco, Gregory A. Prince, Martin G. Ottolini. (2007) Co-infection of the cotton rat (Sigmodon hispidus) with Staphylococcus aureus and influenza A virus results in synergistic disease. Microbial Pathogenesis 43:5-6, 208-216
CrossRef102
Shigefumi Okamoto, Hironori Yoshii, Takami Akagi, Mitsuru Akashi, Toyokazu Ishikawa, Yoshinobu Okuno, Michiaki Takahashi, Koichi Yamanishi, Yasuko Mori. (2007) Influenza hemagglutinin vaccine with poly(γ-glutamic acid) nanoparticles enhances the protection against influenza virus infection through both humoral and cell-mediated immunity. Vaccine 25:49, 8270-8278
CrossRef103
Wai Fong Chan, Thomas KS Wong. (2007) Preparing for pandemic influenza: revisit the basics. Journal of Clinical Nursing 16:10, 1858-1864
CrossRef104
YUKIYOSHI SHIRASAKA, LE DUC HINH, PHAN HONG MINH, WAKIRO SATO. (2007) Causes of childhood epilepsy in Vietnam: cases in Bach Mai Hospital. Pediatrics International 49:5, 584-588
CrossRef105
Landis MacKellar. (2007) Pandemic Influenza: A Review. Population and Development Review 33:3, 429-451
CrossRef106
Susan Shoshana Weisberg. (2007) Influenza. Disease-a-Month 53:9, 435-446
CrossRef107
Dirk U. Pfeiffer, Phan Q. Minh, Vincent Martin, Michael Epprecht, Martin J. Otte. (2007) An analysis of the spatial and temporal patterns of highly pathogenic avian influenza occurrence in Vietnam using national surveillance data. The Veterinary Journal 174:2, 302-309
CrossRef108
X. Chen, G.J.D. Smith, B. Zhou, C. Qiu, W.L. Wu, Y. Li, P. Lu, L. Duan, S. Liu, J. Yuan, G. Yang, H. Wang, J. Cheng, H. Jiang, J.S.M. Peiris, H. Chen, K.Y. Yuen, N. Zhong, Y. Guan. (2007) Avian influenza A (H5N1) infection in a patient in China, 2006. Influenza and Other Respiratory Viruses 1:5-6, 207-213
CrossRef109
Jindrich Cinatl, Martin Michaelis, Hans W. Doerr. (2007) The threat of avian influenza A (H5N1). Part III: antiviral therapy. Medical Microbiology and Immunology 196:4, 203-212
CrossRef110
R. Salomon, E. Hoffmann, R. G. Webster. (2007) Inhibition of the cytokine response does not protect against lethal H5N1 influenza infection. Proceedings of the National Academy of Sciences 104:30, 12479-12481
CrossRef111
Philippe Buchy, Sek Mardy, Sirenda Vong, Tetsuya Toyoda, Jean-Thierry Aubin, Megge Miller, Sok Touch, Ly Sovann, Jean-Baptiste Dufourcq, Beat Richner, Phan Van Tu, Nguyen Thi Kim Tien, Wilina Lim, J.S. Malik Peiris, Sylvie Van der Werf. (2007) Influenza A/H5N1 virus infection in humans in Cambodia. Journal of Clinical Virology 39:3, 164-168
CrossRef112
Alison Whiteley, Diane Major, Isabelle Legastelois, Laura Campitelli, Isabella Donatelli, Catherine I. Thompson, Maria C. Zambon, John M. Wood, Wendy S. Barclay. (2007) Generation of candidate human influenza vaccine strains in cell culture – rehearsing the European response to an H7N1 pandemic threat. Influenza and Other Respiratory Viruses 1:4, 157-166
CrossRef113
Robin B. McFee. (2007) Avian Influenza: The Next Pandemic?. Disease-a-Month 53:7, 348-387
CrossRef114
Hang L.K. Nguyen, Reiko Saito, Ha K. Ngiem, Makoto Nishikawa, Yugo Shobugawa, Doan C. Nguyen, Long T. Hoang, Lien P. Huynh, Hiroshi Suzuki. (2007) Epidemiology of influenza in Hanoi, Vietnam, from 2001 to 2003. Journal of Infection 55:1, 58-63
CrossRef115
Takeshi Ichinohe, Noriyo Nagata, Peter Strong, Shin-ichi Tamura, Hidehiro Takahashi, Ai Ninomiya, Masaki Imai, Takato Odagiri, Masato Tashiro, Hirofumi Sawa, Joe Chiba, Takeshi Kurata, Tetsutaro Sata, Hideki Hasegawa. (2007) Prophylactic effects of chitin microparticles on highly pathogenic H5N1 influenza virus. Journal of Medical Virology 79:6, 811-819
CrossRef116
Liangzhi You, Xinshen Diao. (2007) Assessing the Potential Impact of Avian Influenza on Poultry in West Africa: A Spatial Equilibrium Analysis. Journal of Agricultural Economics 58:2, 348-367
CrossRef117
Anna M. Likos, David J. Kelvin, Cheryl M. Cameron, Thomas Rowe, Matthew J. Kuehnert, Philip J. Norris, . (2007) Influenza viremia and the potential for blood-borne transmission. Transfusion 47:6, 1080-1088
CrossRef118
Ai Ninomiya, Masaki Imai, Masato Tashiro, Takato Odagiri. (2007) Inactivated influenza H5N1 whole-virus vaccine with aluminum adjuvant induces homologous and heterologous protective immunities against lethal challenge with highly pathogenic H5N1 avian influenza viruses in a mouse model. Vaccine 25:18, 3554-3560
CrossRef119
Yaseen Arabi, Charles D. Gomersall, Qanta A. Ahmed, Bruce R. Boynton, Ziad A. Memish. (2007) The critically ill avian influenza A (H5N1) patient*. Critical Care Medicine 35:5, 1397-1403
CrossRef120
Masaki Imai, Ai Ninomiya, Harumi Minekawa, Tsugunori Notomi, Toru Ishizaki, Phan Van Tu, Nguyen Thi Kim Tien, Masato Tashiro, Takato Odagiri. (2007) Rapid diagnosis of H5N1 avian influenza virus infection by newly developed influenza H5 hemagglutinin gene-specific loop-mediated isothermal amplification method. Journal of Virological Methods 141:2, 173-180
CrossRef121
Kanta Subbarao, Tomy Joseph. (2007) Scientific barriers to developing vaccines against avian influenza viruses. Nature Reviews Immunology 7:4, 267-278
CrossRef122
Hideki Hasegawa, Takeshi Ichinohe, Shin-ichi Tamura, Takeshi Kurata. (2007) Development of a mucosal vaccine for influenza viruses: preparation for a potential influenza pandemic. Expert Review of Vaccines 6:2, 193-201
CrossRef123
K. Bragstad, P. H. Jørgensen, K. J. Handberg, A. Fomsgaard. (2007) Genome characterisation of the newly discovered avian influenza A H5N7 virus subtype combination. Archives of Virology 152:3, 585-593
CrossRef124
Leslie T. Cooper, George A. Mensah, Larry M. Baddour, Sandra B. Dunbar, Edward L. Kaplan, Walter R. Wilson, Prediman K. Shah. (2007) Task Force III: Prevention and Control of Cardiovascular Complications of Emerging Infectious Diseases and Potential Biological Terrorism Agents and Diseases. Journal of the American College of Cardiology 49:12, 1398-1406
CrossRef125
Youn-Jeong Lee, Jin-Young Shin, Min-Suk Song, Young-Min Lee, Jun-Gu Choi, Eun-Kyoung Lee, Ok-Mi Jeong, Haan-Woo Sung, Jae-Hong, Kim, Yong-Kuk Kwon, Jun-Hun Kwon, Chul-Joong Kim, Richard J. Webby, Robert G. Webster, Young Ki Choi. (2007) Continuing evolution of H9 influenza viruses in Korean poultry. Virology 359:2, 313-323
CrossRef126
Richard A Martinello. (2007) Preparing for avian influenza. Current Opinion in Pediatrics 19:1, 64-70
CrossRef127
Ali Bay, Ömer Etlik, A. Faik Öner, Özkan Ünal, Halil Arslan, Aydın Bora, Ramazan Davran, Sevil Arı Yuca, Murat Dogan. (2007) Radiological and clinical course of pneumonia in patients with avian influenza H5N1. European Journal of Radiology 61:2, 245-250
CrossRef128
H. Gras-Masse, N. Willand. (2007) Les inhibiteurs de neuraminidase face au risque de grippe aviaire. Annales Pharmaceutiques Françaises 65:1, 50-57
CrossRef129
Agostino Pugliese, Tiziana Beltramo, Donato Torre. (2007) Emerging and re-emerging viral infections in Europe. Cell Biochemistry and Function 25:1, 1-13
CrossRef130
Salin Chutinimitkul, Kamol Suwannakarn, Thaweesak Chieochansin, Le Quynh Mai, Sudarat Damrongwatanapokin, Arunee Chaisingh, Alongkorn Amonsin, Olfert Landt, Thaweesak Songserm, Apiradee Theamboonlers, Yong Poovorawan. (2007) H5N1 Oseltamivir-resistance detection by real-time PCR using two high sensitivity labeled TaqMan probes. Journal of Virological Methods 139:1, 44-49
CrossRef131
J.H.C.M. Kreijtz, R. Bodewes, G. van Amerongen, T. Kuiken, R.A.M. Fouchier, A.D.M.E. Osterhaus, G.F. Rimmelzwaan. (2007) Primary influenza A virus infection induces cross-protective immunity against a lethal infection with a heterosubtypic virus strain in mice. Vaccine 25:4, 612-620
CrossRef132
John S. Oxford. (2007) Antivirals for the treatment and prevention of epidemic and pandemic influenza. Influenza and Other Respiratory Viruses 1:1, 27-34
CrossRef133
Julia Romanova. (2006) The fight against new types of influenza virus. Biotechnology Journal 1:12, 1381-1392
CrossRef134
Kandun, I. Nyoman, Wibisono, Hariadi, Sedyaningsih, Endang R., Yusharmen, Hadisoedarsuno, Widarso, Purba, Wilfried, Santoso, Hari, Septiawati, Chita, Tresnaningsih, Erna, Heriyanto, Bambang, Yuwono, Djoko, Harun, Syahrial, Soeroso, Santoso, Giriputra, Sardikin, Blair, Patrick J., Jeremijenko, Andrew, Kosasih, Herman, Putnam, Shannon D., Samaan, Gina, Silitonga, Marlinggom, Chan, K.H., Poon, Leo L.M., Lim, Wilina, Klimov, Alexander, Lindstrom, Stephen, Guan, Yi, Donis, Ruben, Katz, Jacqueline, Cox, Nancy, Peiris, Malik, Uyeki, Timothy M., . (2006) Three Indonesian Clusters of H5N1 Virus Infection in 2005. New England Journal of Medicine 355:21, 2186-2194
Full Text135
Oner, Ahmet Faik, Bay, Ali, Arslan, Sukru, Akdeniz, Hayrettin, Sahin, Huseyin Avni, Cesur, Yasar, Epcacan, Serdar, Yilmaz, Neziha, Deger, Ibrahim, Kizilyildiz, Baran, Karsen, Hasan, Ceyhan, Mehmet, . (2006) Avian Influenza A (H5N1) Infection in Eastern Turkey in 2006. New England Journal of Medicine 355:21, 2179-2185
Full Text136
B. A. Cunha. (2006) Amantadine May Be Lifesaving In Severe Influenza A. Clinical Infectious Diseases 43:10, 1372-1373
CrossRef137
Masaki Imai, Ai Ninomiya, Harumi Minekawa, Tsugunori Notomi, Toru Ishizaki, Masato Tashiro, Takato Odagiri. (2006) Development of H5-RT-LAMP (loop-mediated isothermal amplification) system for rapid diagnosis of H5 avian influenza virus infection. Vaccine 24:44-46, 6679-6682
CrossRef138
Robert L. Atmar, Wendy A. Keitel, Shital M. Patel, Jacqueline M. Katz, Dewei She, Hana El Sahly, Justine Pompey, Thomas R. Cate, Robert B. Couch. (2006) Safety and Immunogenicity of Nonadjuvanted and MF59‐Adjuvanted Influenza A/H9N2 Vaccine Preparations. Clinical Infectious Diseases 43:9, 1135-1142
CrossRef139
Nagmi R. Qureshi, Tran T. Hien, Jeremy Farrar, Fergus V. Gleeson. (2006) The Radiologic Manifestations of H5N1 Avian Influenza. Journal of Thoracic Imaging 21:4, 259-264
CrossRef140
Menno D de Jong, Cameron P Simmons, Tran Tan Thanh, Vo Minh Hien, Gavin J D Smith, Tran Nguyen Bich Chau, Dang Minh Hoang, Nguyen Van Vinh Chau, Truong Huu Khanh, Vo Cong Dong, Phan Tu Qui, Bach Van Cam, Do Quang Ha, Yi Guan, J S Malik Peiris, Nguyen Tran Chinh, Tran Tinh Hien, Jeremy Farrar. (2006) Fatal outcome of human influenza A (H5N1) is associated with high viral load and hypercytokinemia. Nature Medicine 12:10, 1203-1207
CrossRef141
K. Bragstad, P.H. Jørgensen, K.J. Handberg, A. Fomsgaard. (2006) An emerging avian influenza A virus H5N7 is a genetic reassortant of highly pathogenic genes. Vaccine 24:44-46, 6736-6741
CrossRef142
Taisuke Horimoto, Yoshihiro Kawaoka. (2006) Strategies for developing vaccines against H5N1 influenza A viruses. Trends in Molecular Medicine 12:11, 506-514
CrossRef143
E. Hak, M.J. Meijboom, E. Buskens. (2006) Modelling the health-economic impact of the next influenza pandemic in The Netherlands. Vaccine 24:44-46, 6756-6760
CrossRef144
Alan W Hampson. (2006) Avian influenza: A pandemic waiting in the wings?. Emergency Medicine Australasia 18:5-6, 420-429
CrossRef145
T. T. Bauer, S. Ewig, A. C. Rodloff, E. E. Muller. (2006) Acute Respiratory Distress Syndrome and Pneumonia: A Comprehensive Review of Clinical Data. Clinical Infectious Diseases 43:6, 748-756
CrossRef146
Frederick G. Hayden. (2006) Antivirals for influenza: Historical perspectives and lessons learned. Antiviral Research 71:2-3, 372-378
CrossRef147
Richard J. Scarfone, Sharon Alexander, Susan E. Coffin, Keith H. St. John, Frank Sullivan, Jacqueline Wagner, Theoklis Zaoutis. (2006) Emergency Preparedness for Pandemic Influenza. Pediatric Emergency Care 22:9, 661-668
CrossRef148
Kenneth W. Tsang, Young-Soo Shim, Thomas K. S. Wong, C. K. Liam, Philip Eng, W. K. Lam, W. H. Seto. (2006) Possible case scenarios and logistic issues in H5N1 pandemic. Respirology 11:5, 520-522
CrossRef149
Viroj Wiwanitkit. (2006) Letters to the Editor. The Journal of Trauma: Injury, Infection, and Critical Care 61:3, 768-769
CrossRef150
Yanbing Li, Chengjun Li, Liling Liu, Hongwei Wang, Chuanbin Wang, Guobing Tian, Robert G. Webster, Kangzhen Yu, Hualan Chen. (2006) Characterization of An Avian Influenza Virus of Subtype H7N2 Isolated from Chickens in Northern China. Virus Genes 33:1, 117-122
CrossRef151
Masahiro Ito, Masahiro Watanabe, Naoko Nakagawa, Toshiaki Ihara, Yoshinobu Okuno. (2006) Rapid detection and typing of influenza A and B by loop-mediated isothermal amplification: Comparison with immunochromatography and virus isolation. Journal of Virological Methods 135:2, 272-275
CrossRef152
Y. Li, Z. Lin, J. Shi, Q. Qi, G. Deng, Z. Li, X. Wang, G. Tian, H. Chen. (2006) Detection of Hong Kong 97-like H5N1 influenza viruses from eggs of Vietnamese waterfowl. Archives of Virology 151:8, 1615-1624
CrossRef153
D. Kumar, A. Humar. (2006) Pandemic Influenza and Its Implications for Transplantation.. American Journal of Transplantation 6:7, 1512-1517
CrossRef154
Akira Onose, Shu Hashimoto, Shinichi Hayashi, Shuichiro Maruoka, Fumio Kumasawa, Kenji Mizumura, Itsuro Jibiki, Ken Matsumoto, Yasuhiro Gon, Tomoko Kobayashi, Noriaki Takahashi, Yasuko Shibata, Yoshimitsu Abiko, Toshikatsu Shibata, Kazufumi Shimizu, Takashi Horie. (2006) An inhibitory effect of A20 on NF-κB activation in airway epithelium upon influenza virus infection. European Journal of Pharmacology 541:3, 198-204
CrossRef155
Viroj Wiwanitkit. (2006) Humans infected with bird flu: Is there evidence of cardiac disorder?. Canadian Journal of Cardiology 22:8, 661
CrossRef156
Pascale C. Gruber, Charles D. Gomersall, Gavin M. Joynt. (2006) Avian influenza (H5N1): implications for intensive care. Intensive Care Medicine 32:6, 823-829
CrossRef157
Adnan Mushtaq, Mohamed El-Azizi, Nancy Khardori. (2006) Category C Potential Bioterrorism Agents and Emerging Pathogens. Infectious Disease Clinics of North America 20:2, 423-441
CrossRef158
Z XIE, Y PANG, J LIU, X DENG, X TANG, J SUN, M KHAN. (2006) A multiplex RT-PCR for detection of type A influenza virus and differentiation of avian H5, H7, and H9 hemagglutinin subtypes. Molecular and Cellular Probes 20:3-4, 245-249
CrossRef159
Sandra R. Olson, Gregory C. Gray. (2006) The Trojan Chicken Study, Minnesota. Emerging Infectious Diseases 12:5, 795-799
CrossRef160
Thaweesak Songserm, Rungroj Jam-on, Numdee Sae-Heng, Noppadol Meemak, Diane J. Hulse-Post, Katharine M. Sturm-Ramirez, Robert G. Webster. (2006) Domestic Ducks and H5N1 Influenza Epidemic, Thailand. Emerging Infectious Diseases 12:4, 575-581
CrossRef161
Treanor, John J., Campbell, James D., Zangwill, Kenneth M., Rowe, Thomas, Wolff, Mark, . (2006) Safety and Immunogenicity of an Inactivated Subvirion Influenza A (H5N1) Vaccine. New England Journal of Medicine 354:13, 1343-1351
Full Text162
Jan-Inge Henter, Chun-Bong Chow, Chi-Wai Leung, Yu-Lung Lau. (2006) Cytotoxic therapy for severe avian influenza A (H5N1) infection. The Lancet 367:9513, 870-873
CrossRef163
Adam Meijer, Arnold Bosman, Esther E.H.M. van de Kamp, Berry Wilbrink, Mirna Du Ry van Beest Holle, Marion Koopmans. (2006) Measurement of antibodies to avian influenza virus A(H7N7) in humans by hemagglutination inhibition test. Journal of Virological Methods 132:1-2, 113-120
CrossRef164
Stephen M Ford, John D Grabenstein. (2006) Pandemics, Avian Influenza A (H5N1), and a Strategy for Pharmacists. Pharmacotherapy 26:3, 312-322
CrossRef165
Gary A. Zeitlin, Melanie J. Maslow. (2006) Avian influenza. Current Allergy and Asthma Reports 6:2, 163-170
CrossRef166
David B. Lewis. (2006) Avian Flu to Human Influenza. Annual Review of Medicine 57:1, 139-154
CrossRef167
John L. Hick, Daniel T. O'Laughlin. (2006) Concept of Operations for Triage of Mechanical Ventilation in an Epidemic. Academic Emergency Medicine 13:2, 223-229
CrossRef168
Guus F. Rimmelzwaan, Debby van Riel, Marianne Baars, Theo M. Bestebroer, Geert van Amerongen, Ron A.M. Fouchier, Albert D.M.E. Osterhaus, Thijs Kuiken. (2006) Influenza A Virus (H5N1) Infection in Cats Causes Systemic Disease with Potential Novel Routes of Virus Spread within and between Hosts. The American Journal of Pathology 168:1, 176-183
CrossRef169
Takato ODAGIRI. (2006) Preparedness and international contribution on H5N1 highly pathogenic avian influenza and pandemic-influenza. Uirusu 56:1, 77-84
CrossRef170
Hiroshi Ito, Toshihiro Ito, Muneo Hikida, Junko Yashiro, Akira Otsuka, Hiroshi Kida, Koichi Otsuki. (2006) Outbreak of Highly Pathogenic Avian Influenza in Japan and Anti-Influenza Virus Activity of Povidone-Iodine Products. Dermatology 212:1, 115-118
CrossRef171
Milomir Djokic. (2006) Avian influenza. Vojnosanitetski pregled 63:5, 494-500
CrossRef172
Howard Friel, Harvey Lederman. (2006) A nutritional supplement formula for influenza A (H5N1) infection in humans. Medical Hypotheses 67:3, 578-587
CrossRef173
Shanta Bantia, C. Shane Arnold, Cynthia D. Parker, Ramanda Upshaw, Pooran Chand. (2006) Anti-influenza virus activity of peramivir in mice with single intramuscular injection. Antiviral Research 69:1, 39-45
CrossRef174
José Luis Viejo Bañuelos. (2006) Manifestaciones respiratorias de la gripe aviar. Archivos de Bronconeumología 42, 12-18
CrossRef175
Arnold S. Monto. (2006) Vaccines and Antiviral Drugs in Pandemic Preparedness. Emerging Infectious Diseases 12:1, 55-60
CrossRef176
Catherine J. Luke, Kanta Subbarao. (2006) Vaccines for Pandemic Influenza. Emerging Infectious Diseases 12:1, 66-72
CrossRef177
de Jong, Menno D., Thanh, Tran Tan, Khanh, Truong Huu, Hien, Vo Minh, Smith, Gavin J.D., Chau, Nguyen Vinh, Cam, Bach Van, Qui, Phan Tu, Ha, Do Quang, Guan, Yi, Peiris, J.S. Malik, Hien, Tran Tinh, Farrar, Jeremy, . (2005) Oseltamivir Resistance during Treatment of Influenza A (H5N1) Infection. New England Journal of Medicine 353:25, 2667-2672
Full Text178
Masaji Mase, Tadao Imada, Kikuyasu Nakamura, Nobuhiko Tanimura, Kunitoshi Imai, Kenji Tsukamoto, Shigeo Yamaguchi. (2005) Experimental Assessment of the Pathogenicity of H5N1 Influenza A Viruses Isolated in Japan. Avian Diseases 49:4, 582-584
CrossRef179
Siting Zhao, Meilin Jin, Hongchao Li, Yadi Tan, Guihua Wang, Ruihua Zhang, Huanchun Chen. (2005) Detection of Antibodies to the Nonstructural Protein (NS1) of Avian Influenza Viruses Allows Distinction Between Vaccinated and Infected Chickens. Avian Diseases 49:4, 488-493
CrossRef180
Sandro Cinti, Carol Chenoweth, Arnold S. Monto. (2005) Preparing for Pandemic Influenza: Should Hospitals Stockpile Oseltamivir? • . Infection Control and Hospital Epidemiology 26:11, 852-854
CrossRef181
J.S. Oxford, C. Manuguerra, O. Kistner, A. Linde, M. Kunze, W. Lange, B. Schweiger, G. Spala, H. Rebelo de Andrade, P.R. Pérez Breña, J. Beytout, L. Brydak, D. Caraffa de Stefano, O. Hungnes, J. Kyncl, E. Montomoli, A. Gil de Miguel, R. Vranckx, A. Osterhaus. (2005) A new European perspective of influenza pandemic planning with a particular focus on the role of mammalian cell culture vaccines. Vaccine 23:46-47, 5440-5449
CrossRef182
C DELABARRERA, G REYESTERAN. (2005) Influenza: Forecast for a Pandemic. Archives of Medical Research 36:6, 628-636
CrossRef183
Rick A Bright, Marie-jo Medina, Xiyan Xu, Gilda Perez-Oronoz, Teresa R Wallis, Xiaohong M Davis, Laura Povinelli, Nancy J Cox, Alexander I Klimov. (2005) Incidence of adamantane resistance among influenza A (H3N2) viruses isolated worldwide from 1994 to 2005: a cause for concern. The Lancet 366:9492, 1175-1181
CrossRef184
Guobin Tian, Suhua Zhang, Yanbing Li, Zhigao Bu, Peihong Liu, Jinping Zhou, Chengjun Li, Jianzhong Shi, Kangzhen Yu, Hualan Chen. (2005) Protective efficacy in chickens, geese and ducks of an H5N1-inactivated vaccine developed by reverse genetics. Virology 341:1, 153-162
CrossRef185
The Writing Committee of the World Health Organization (WHO) Consultation on Human Influenza A/H5. (2005) Avian Influenza A (H5N1) Infection in Humans. New England Journal of Medicine 353:13, 1374-1385
Full Text186
John V. Williams. (2005) The Clinical Presentation and Outcomes of Children Infected with Newly Identified Respiratory Tract Viruses. Infectious Disease Clinics of North America 19:3, 569-584
CrossRef187
Michael L. Perdue, David E. Swayne. (2005) Public Health Risk from Avian Influenza Viruses. Avian Diseases 49:3, 317-327
CrossRef188
Edward W.A. Brydon, Susan J. Morris, Clive Sweet. (2005) Role of apoptosis and cytokines in influenza virus morbidity. FEMS Microbiology Reviews 29:4, 837-850
CrossRef189
Taisuke Horimoto, Yoshihiro Kawaoka. (2005) Influenza: lessons from past pandemics, warnings from current incidents. Nature Reviews Microbiology 3:8, 591-600
CrossRef190
Kenneth WT Tsang, Philip Eng, CK Liam, Young-soo Shim, Wah K Lam. (2005) H5N1 influenza pandemic: contingency plans. The Lancet 366:9485, 533-534
CrossRef191
Keiji Kuba, Yumiko Imai, Shuan Rao, Hong Gao, Feng Guo, Bin Guan, Yi Huan, Peng Yang, Yanli Zhang, Wei Deng, Linlin Bao, Binlin Zhang, Guang Liu, Zhong Wang, Mark Chappell, Yanxin Liu, Dexian Zheng, Andreas Leibbrandt, Teiji Wada, Arthur S Slutsky, Depei Liu, Chuan Qin, Chengyu Jiang, Josef M Penninger. (2005) A crucial role of angiotensin converting enzyme 2 (ACE2) in SARS coronavirus–induced lung injury. Nature Medicine 11:8, 875-879
CrossRef192
Gary Adam Zeitlin, Melanie Jane Maslow. (2005) Avian Influenza. Current Infectious Disease Reports 7:3, 193-199
CrossRef193
F. L. Ruben. (2005) Influenza: Getting Our Attention. Clinical Infectious Diseases 40:11, 1697-1698
CrossRef194
Constance T. Pachucki. (2005) Rapid tests for influenza. Current Infectious Disease Reports 7:3, 187-192
CrossRef195
K. Bragstad, P.H. Jørgensen, K.J. Handberg, S. Mellergaard, S. Corbet, A. Fomsgaard. (2005) New avian influenza A virus subtype combination H5N7 identified in Danish mallard ducks. Virus Research 109:2, 181-190
CrossRef196
Emil C Reisinger, Carlos Fritzsche, Robert Krause, Guenter J Krejs. (2005) Diarrhea caused by primarily non-gastrointestinal infections. Nature Clinical Practice Gastroenterology & Hepatology 2:5, 216-222
CrossRef197
SR Mehta, VP Singh, Suman Kumar, Rajan Kapoor, R Ananthakrishnan. (2005) Avian flu — A bird's eye view. Medical Journal Armed Forces India 61:2, 167-170
CrossRef198
Ron AM Fouchier, Guus F Rimmelzwaan, Thijs Kuiken, Albert DME Osterhaus. (2005) Newer respiratory virus infections: human metapneumovirus, avian influenza virus, and human coronaviruses. Current Opinion in Infectious Diseases 18:2, 141-146
CrossRef199
Iain Stephenson. (2005) Are we ready for pandemic influenza H5N1?. Expert Review of Vaccines 4:2, 151-155
CrossRef200
Jean Lin Taylor, Brenda J. Roup, David Blythe, Greg K. Reed, Tiffany A. Tate, Kristine A. Moore. (2005) Pandemic Influenza Preparedness in Maryland: Improving Readiness Through a Tabletop Exercise. Biosecurity and Bioterrorism: Biodefense Strategy, Practice, and Science 3:1, 61-69
CrossRef201
Anna Thorson, Karl Ekdahl. (2005) Avian influenza - Is the world on the verge of a pandemic? ... and can it be stopped?. Journal of Contingencies and Crisis Management 13:1, 21-28
CrossRef202
Sigvard Olofsson, Urban Kumlin, Ken Dimock, Niklas Arnberg. (2005) Avian influenza and sialic acid receptors: more than meets the eye?. The Lancet Infectious Diseases 5:3, 184-188
CrossRef203
Sebastian L. Johnston, Fernando Ferrero, Maria Luz Garcia, Regina Dutkowski. (2005) Oral Oseltamivir Improves Pulmonary Function and Reduces Exacerbation Frequency for Influenza-Infected Children With Asthma. The Pediatric Infectious Disease Journal 24:3, 225-232
CrossRef204
de Jong, Menno D., Cam, Bach Van, Qui, Phan Tu, Hien, Vo Minh, Thanh, Tran Tan, Hue, Nguyen Bach, Beld, Marcel, Phuong, Le Thi, Khanh, Truong Huu, Chau, Nguyen Van Vinh, Hien, Tran Tinh, Ha, Do Quang, Farrar, Jeremy, . (2005) Fatal Avian Influenza A (H5N1) in a Child Presenting with Diarrhea Followed by Coma. New England Journal of Medicine 352:7, 686-691
Full Text205
Kulkanya Chokephaibulkit, Mongkol Uiprasertkul, Pilaipan Puthavathana, Pimpanada Chearskul, Prasert Auewarakul, Scott F. Dowell, Nirun Vanprapar. (2005) A Child With Avian Influenza A (H5N1) Infection. The Pediatric Infectious Disease Journal 24:2, 162-166
CrossRef206
Ruth Kandel, Kevan L Hartshorn. (2005) Novel strategies for prevention and treatment of influenza. Expert Opinion on Therapeutic Targets 9:1, 1-22
CrossRef207
&NA;. (2005) Antiviral Drugs for Prophylaxis and Treatment of Influenza. Obstetrics & Gynecology 105:2, 427-429
CrossRef208
Masaji Mase, Kenji Tsukamoto, Tadao Imada, Kunitoshi Imai, Nobuhiko Tanimura, Kikuyasu Nakamura, Yasunori Yamamoto, Toru Hitomi, Takuhiro Kira, Tadayoshi Nakai, Maki Kiso, Taisuke Horimoto, Yoshihiro Kawaoka, Shigeo Yamaguchi. (2005) Characterization of H5N1 influenza A viruses isolated during the 2003–2004 influenza outbreaks in Japan. Virology 332:1, 167-176
CrossRef209
Ungchusak, Kumnuan, Auewarakul, Prasert, Dowell, Scott F., Kitphati, Rungrueng, Auwanit, Wattana, Puthavathana, Pilaipan, Uiprasertkul, Mongkol, Boonnak, Kobporn, Pittayawonganon, Chakrarat, Cox, Nancy J., Zaki, Sherif R., Thawatsupha, Pranee, Chittaganpitch, Malinee, Khontong, Rotjana, Simmerman, James M., Chunsutthiwat, Supamit, . (2005) Probable Person-to-Person Transmission of Avian Influenza A (H5N1). New England Journal of Medicine 352:4, 333-340
Full Text210
A. Apisarnthanarak, S. Erb, I. Stephenson, J. M. Katz, M. Chittaganpitch, S. Sangkitporn, R. Kitphati, P. Thawatsupha, S. Waicharoen, U. Pinitchai, P. Apisarnthanarak, V. J. Fraser, L. M. Mundy. (2005) Seroprevalence of Anti-H5 Antibody among Thai Health Care Workers after Exposure to Avian Influenza (H5N1) in a Tertiary Care Center. Clinical Infectious Diseases 40:2, e16-e18
CrossRef211
Peter Aldhous. (2005) Vietnam's war on flu. Nature 433:7022, 102-104
CrossRef212
Masaji MASE, Yoshihiro KAWAOKA. (2005) Avian Influenza Viruses isolated in Japan. Uirusu 55:2, 231-237
CrossRef213
D. Kaye, C. R. Pringle. (2005) Avian Influenza Viruses and their Implication for Human Health. Clinical Infectious Diseases 40:1, 108-112
CrossRef214
Daniel J. Barnett, Ran D. Balicer, Daniel R. Lucey, George S. Everly, Saad B. Omer, Mark C. Steinhoff, Itamar Grotto. (2005) A Systematic Analytic Approach to Pandemic Influenza Preparedness Planning. PLoS Medicine 2:12, e359
CrossRef215
Kazunori Oishi. (2005) Preparedness against Newly Emerging Viral Respiratory Infections. Nihon Kikan Shokudoka Gakkai Kaiho 56:2, 63-71
CrossRef216
David O. Freedman, Karin Leder. (2005) Influenza: Changing Approaches to Prevention and Treatment in Travelers. Journal of Travel Medicine 12:1, 36-44
CrossRef217
Robert G Webster, David S Fedson. 2005. Lessons for the Future: Pandemic Influenza. , 239-248.
CrossRef218
Hee Jin Cheong. (2005) Avian Influenza. Journal of the Korean Medical Association 48:12, 1195
CrossRef219
A. Wilder-Smith, A. Earnest, N. I. Paton. (2004) Use of Simple Laboratory Features to Distinguish the Early Stage of Severe Acute Respiratory Syndrome from Dengue Fever. Clinical Infectious Diseases 39:12, 1818-1823
CrossRef220
Hien, Tran Tinh, de Jong, Menno, Farrar, Jeremy, . (2004) Avian Influenza — A Challenge to Global Health Care Structures. New England Journal of Medicine 351:23, 2363-2365
Full Text221
William R. Jarvis. (2004) The State of the Science of health care epidemiology, infection control, and patient safety, 2004. American Journal of Infection Control 32:8, 496-503
CrossRef222
Sunchai Payungporn, Piraya Phakdeewirot, Salin Chutinimitkul, Apiradee Theamboonlers, Juthatip Keawcharoen, Kanisak Oraveerakul, Alongkorn Amonsin, Yong Poovorawan. (2004) Single-Step Multiplex Reverse Transcription–Polymerase Chain Reaction (RT-PCR) for Influenza A Virus Subtype H5N1 Detection. Viral Immunology 17:4, 588-593
CrossRef223
Meilin Jin, Guihua Wang, Ruihua Zhang, Siting Zhao, Hongchao Li, Yadi Tan, Huanchun Chen. (2004) Development of Enzyme-Linked Immunosorbent Assay with Nucleoprotein as Antigen for Detection of Antibodies to Avian Influenza Virus. Avian Diseases 48:4, 870-878
CrossRef224
I. A. Leneva, R. G. Glushkov, T. A. Gus’kova. (2004) Drugs for chemotherapy and prophylaxis of influenza: Mechanisms, efficacy, and safety (a review). Pharmaceutical Chemistry Journal 38:11, 590-596
CrossRef225
Frederick G. Hayden. (2004) Pandemic Influenza. The Pediatric Infectious Disease Journal 23:Supplement, S262-S269
CrossRef226
D. G. Maki. (2004) SARS Revisited: The Challenge of Controlling Emerging Infectious Diseases at the Local, Regional, Federal, and Global Levels. Mayo Clinic Proceedings 79:11, 1359-1366
CrossRef227
Leonard R Krilov. (2004) Emerging infectious disease issues in international adoptions: severe acute respiratory syndrome (SARS), avian influenza and measles. Current Opinion in Infectious Diseases 17:5, 391-395
CrossRef228
Scott Krauss, David Walker, S. Paul Pryor, Larry Niles, Li Chenghong, Virginia S. Hinshaw, Robert G. Webster. (2004) Influenza A Viruses of Migrating Wild Aquatic Birds in North America. Vector-Borne and Zoonotic Diseases 4:3, 177-189
CrossRef229
Charles Grose. (2004) Avian Influenza Virus Infection of Children in Vietnam and Thailand. The Pediatric Infectious Disease Journal 23:8, 793-794
CrossRef230
Iain Stephenson, Karl G Nicholson, John M Wood, Maria C Zambon, Jacqueline M Katz. (2004) Confronting the avian influenza threat: vaccine development for a potential pandemic. The Lancet Infectious Diseases 4:8, 499-509
CrossRef231
K. S. Li, Y. Guan, J. Wang, G. J. D. Smith, K. M. Xu, L. Duan, A. P. Rahardjo, P. Puthavathana, C. Buranathai, T. D. Nguyen, A. T. S. Estoepangestie, A. Chaisingh, P. Auewarakul, H. T. Long, N. T. H. Hanh, R. J. Webby, L. L. M. Poon, H. Chen, K. F. Shortridge, K. Y. Yuen, R. G. Webster, J. S. M. Peiris. (2004) Genesis of a highly pathogenic and potentially pandemic H5N1 influenza virus in eastern Asia. Nature 430:6996, 209-213
CrossRef232
Senad Divanovic, Alexander C.K Lai. (2004) Cytokine induction in human cord blood lymphocytes after pulsing with UV-inactivated influenza viruses. Immunology Letters 94:3, 201-207
CrossRef233
Noel JC Snell. (2004) Novel and re-emerging respiratory infections. Expert Review of Anti-infective Therapy 2:3, 405-412
CrossRef234
A. Trampuz, R. M. Prabhu, T. F. Smith, L. M. Baddour. (2004) Avian Influenza: A New Pandemic Threat?. Mayo Clinic Proceedings 79:4, 523-530
CrossRef235
Klempner, Mark S., Shapiro, Daniel S., . (2004) Crossing the Species Barrier — One Small Step to Man, One Giant Leap to Mankind. New England Journal of Medicine 350:12, 1171-1172
Full Text
