Original Article
Expression of Human Herpesvirus 8 in Primary Pulmonary Hypertension
N Engl J Med 2003; 349:1113-1122September 18, 2003
- Abstract
Background
Severe pulmonary hypertension constitutes a group of diseases characterized by complex, lumen-occluding vascular lesions that develop in genetically susceptible persons. The only viral infection associated with severe pulmonary hypertension has been that due to human immunodeficiency virus type 1, but neither the viral genome nor viral antigens have been demonstrated in pathologic lesions.
Methods
We examined lung-tissue samples from 16 patients with sporadic primary pulmonary hypertension and 14 patients with secondary pulmonary hypertension for evidence of infection with human herpesvirus 8 (HHV-8). HHV-8 infection was ascertained immunohistochemically with use of an antibody directed against latency-associated nuclear antigen 1 (LANA-1), and a polymerase-chain-reaction (PCR) assay was performed on lung DNA to detect the viral cyclin gene of HHV-8. Sequence analysis was also performed.
Results
In lung tissue from 10 of 16 patients with primary pulmonary hypertension (62 percent), cells within the plexiform lesions as well as cells outside the lesions were positive for LANA-1 on immunohistochemical analysis. Tissue from the same 10 patients contained viral cyclin on PCR analysis. No LANA-1 was detected in lung tissue from patients with secondary pulmonary hypertension, although one such patient had PCR evidence of viral cyclin. Plexiform lesions from patients with primary pulmonary hypertension had a histologic and immunohistochemical resemblance to cutaneous Kaposi's sarcoma lesions.
Conclusions
The spectrum of trigger factors and molecular mechanisms leading to severe pulmonary hypertension and the formation of plexiform lesions is apparently wide, including both genetic and epigenetic factors. Our data suggest that infection with the vasculotropic virus HHV-8 may have a pathogenetic role in primary pulmonary hypertension.
Media in This Article
Figure 1
Plexiform Lesions from One Patient with Primary Pulmonary Hypertension (Panels A, B, C, D, and E) and a Kaposi's Sarcoma Skin Lesion from One Patient Infected with Human Immunodeficiency Virus Type 1 (Panels F, G, H, I, and J).Figure 2
Detection of a Human Herpesvirus 8 Gene by Means of Polymerase-Chain-Reaction Amplification of Viral Cyclin Encoded by Open Reading Frame 72 (ORF72).Article Activity
- Article
Severe pulmonary hypertension constitutes a group of pulmonary vascular abnormalities characterized clinically by marked elevation of the pulmonary-artery pressure and the development of right ventricular failure. Primary (idiopathic) pulmonary hypertension occurs sporadically and in a familial form, in which germ-line mutations of bone morphogenetic protein receptor 2 (BMPR2) have been identified.1 Although the clinical spectrum of severe pulmonary hypertension is large and includes primary forms and secondary forms (e.g., in association with congenital cardiac abnormalities, pulmonary embolism, portal hypertension, various collagen vascular disorders, sarcoidosis, and human immunodeficiency virus type 1 [HIV-1] infection), the histologic features, characterized by complex, lumen-occluding vascular lesions (plexiform lesions), are shared and are therefore not specific for any of the clinical associations.2,3
Analysis of lung tissue from patients with primary pulmonary hypertension has established that the endothelial cells of the plexiform lesions proliferate in a monoclonal fashion4 and that they can have somatic mutations of the BMPR2 and BAX genes.5 Although the histopathological findings are not specific, the molecular pathological characteristics of the various forms of severe pulmonary hypertension are distinct, as suggested by the fact that the gene-expression profile of whole-lung tissue can distinguish between patients with sporadic and those with familial primary pulmonary hypertension.6 However, not all plexiform lesions from patients with primary pulmonary hypertension have somatic mutations, and only 50 percent of patients with familial primary pulmonary hypertension have BMPR2 mutations.1,5 Therefore, additional molecular factors must be involved in the acquisition of the selective growth advantage of endothelial cells in patients with severe pulmonary hypertension.
Our understanding of the role of human herpesvirus 8 (HHV-8), a newly discovered gamma herpesvirus, in human disease is evolving. HHV-8 is thought to be the cause of all clinical types of Kaposi's sarcoma7,8 and rare lymphoproliferative disorders associated with HIV-1 infection, such as primary effusion lymphoma and multicentric Castleman's disease.9 Seroepidemiologic studies have established that the prevalence of HHV-8 infection varies geographically and is influenced by behavioral risk factors. In the United States, antibodies against HHV-8 latency-associated nuclear antigen 1 (LANA-1) are present in approximately 33 percent of homosexual men without Kaposi's sarcoma, 8 percent of patients without HIV-1 infection who are attending sexually transmitted disease clinics, and up to 3 percent of blood donors without HIV-1 infection.10,11
Several observations led us to explore the potential relation between HHV-8 infection and primary pulmonary hypertension. First, there is a well-described association between HIV-1 infection and severe pulmonary hypertension,12-14 and although the effect of the coexistence of HHV-8 infection in these patients has not been studied, the prevalence of HHV-8 infection is increased among patients who are infected with HIV-1.11,15 Second, primary pulmonary hypertension has been described in two patients with HHV-8–associated Castleman's disease, and lung tissue from one of these patients was positive for LANA-1.16 Third, elevated levels of inflammatory cytokines are present in the serum of patients with primary pulmonary hypertension,17,18 and T and B lymphocytes are present in plexiform lesions from such patients.19,20 These observations raise the possibility that an immune response to an undefined antigenic stimulus may be present in these patients or may even be involved in the pathogenesis of this disorder. Finally, in the course of evaluating a large number of patients with primary pulmonary hypertension, we noted a histologic resemblance between the plexiform lesions of the disorder and the endothelial abnormalities of cutaneous Kaposi's sarcoma. For these reasons, we examined lung tissue from patients with primary and various secondary forms of severe pulmonary hypertension for evidence of infection with HHV-8.
Methods
Screening Study
In a screening study, we extracted DNA from 15 microdissected plexiform lesions from six patients with primary pulmonary hypertension and 5 skin lesions from five patients with Kaposi's sarcoma, with the use of laser capture microdissection (PixCell II LCM unit, Arcturus Engineering). Only the core of the lesions containing endothelial cells was dissected from serial sections that were 10 μm thick (approximately 100 cells per section). DNA was extracted and amplified with use of a polymerase-chain-reaction (PCR) assay (Expand Long Template PCR System, Roche Diagnostics) in combination with nested PCR in order to amplify DNA from a single tumor cell. PCR analysis of the DNA representing the HHV-8 open reading frame 26 (ORF26)21,22 was performed.
To corroborate the findings, we also analyzed formalin-fixed, paraffin-embedded samples of lung tissue from 30 patients with severe pulmonary hypertension, 4 patients with other lung diseases, and 1 control patient with normal lung tissue. A lymph node from one of the patients with Castleman's disease and primary pulmonary hypertension was analyzed because lung tissue was unavailable. Cutaneous-biopsy specimens from five patients with Kaposi's sarcoma served as positive controls. We examined the tissue sections for HHV-8 LANA-1 using immunohistochemical techniques and for viral cyclin using DNA extraction followed by PCR analysis.
Patients
The institutional review board of the University of Colorado Health Sciences Center approved the study. Patients with severe pulmonary hypertension who were on the waiting list for lung transplantation granted written permission for their explanted lung tissue to be used for investigations, and their next of kin gave written permission to use the tissue samples for a postmortem examination as well as for research. Lung tissue banked at the Pulmonary Hypertension Center of the University of Colorado Health Sciences Center from 30 patients with severe pulmonary hypertension was identified, and the patients' medical history, clinical presentation, and data obtained by right heart catheterization were reviewed (see Supplementary Appendix 1, available with the full text of this article at http://www.nejm.org). Most of the patients had been followed for many years at the center. Some of the archived tissue (e.g., from Patients 7 and 15) had been obtained at autopsy 10 to 20 years earlier. The histologic findings in the lungs and pulmonary vessels were independently reviewed by two pathologists, using tissue sections stained with hematoxylin and eosin.
Patients 1, 2, 3, and 4 had recently received a lung transplant; Patients 2, 3, and 4 had done so after the failure of long-term prostacyclin infusion therapy. Patient 13 had died 2.5 years after the development of fenfluramine-induced pulmonary hypertension; Patient 7 had a history of injection-drug abuse. Birefringent crystals, as well as plexiform lesions, were noted in the lung tissue from Patient 7. Patient 6 had initially been treated for sleep-apnea–associated pulmonary hypertension before receiving a diagnosis of primary pulmonary hypertension, and Patient 22 had been given a diagnosis of primary pulmonary hypertension before a skin biopsy documented sarcoidosis. Patient 8 had primary pulmonary hypertension associated with Castleman's disease16; Patients 19, 20, and 21 had pulmonary hypertension associated with HIV-1 infection; and Patients 27, 28, 29, 30, and 31 had been given a diagnosis of severe pulmonary hypertension due to atrial septal or ventricular septal defects. Patient 18 had pulmonary capillary hemangiomatosis. Lung tissue from two patients with cryptogenic organizing pneumonia, one patient with nonspecific interstitial pneumonitis, one patient with smoking-induced emphysema, and one patient with normal lung tissue served as controls (Table 1Table 1
Results of Immunohistochemical (IHC) and Polymerase-Chain-Reaction (PCR) Analysis of Lung Tissue.).Immunohistochemical Analysis
Immunohistochemical staining was performed as previously described to identify the LANA-1 of HHV-8 encoded by ORF73 (dilution, 1:1500; Advanced Biotechnologies).23 For each antigen, skin tissue from the five patients with Kaposi's sarcoma and lung tissues were stained simultaneously. Briefly, after paraffin-embedded blocks had been cut into 5-μm sections and mounted onto slides, the specimens were deparaffinized and rehydrated. High-temperature antigen retrieval involved boiling the slides in citrate buffer (10 mM per liter, pH 6.0) for 20 minutes, followed by incubation with the avidin–biotin–peroxidase complex (Vectastain Elite ABC kit, Vector Laboratories) according to the manufacturer's instructions. For the detection of LANA-1, the samples were incubated with primary antibody (dilution, 1:1500) at room temperature for one hour. The samples were then stained with 3,3'-diaminobenzidine as the chromogen and counterstained with Mayer's hematoxylin. Normal blocking serum without primary antibody was used for the negative control.
For the comparison of Kaposi's sarcoma and plexiform lesions, selected slides were immunostained with an antibody against vascular endothelial growth factor (VEGF) (dilution, 1:300; Dako). An immunofluorescence assay for factor VIII–related antigen was also performed (dilution, 1:1000; Dako) in which the samples were incubated with goat-antirabbit secondary antibody (dilution, 1:200) conjugated to fluorescein (Molecular Probes).
HHV-8 Viral Cyclin Analyses
Formalin-fixed, paraffin-embedded tissue was used for DNA extraction. Five-micrometer sections were cut from each paraffin block and placed in 0.5-ml MicroAmp tubes (Perkin–Elmer Applied Biosystems). The tissue sections were deparaffinized twice in xylene for five minutes each, followed by a two-step rehydration in 100 percent ethanol. The air-dried pellet was then resuspended in buffer with proteinase K, incubated for 18 hours at 37°C and 3 hours at 55°C, and then heat inactivated for 10 minutes at 98°C.
The PCR primers were synthesized to amplify the viral cyclin of HHV-8 encoded by ORF72. Primer set KS1 and KS2 (KS1, 5'CGCCTGTAGAACGGAAACAT; KS2, 5'TTGCCCGCCTCTATTATCAG) amplifies a 138-bp fragment of HHV-8. The PCR conditions have been described previously.24
DNA from each PCR product was quantified with the use of ultraviolet photospectrometry, then diluted to a concentration of 20 ng per microliter of water. ORF72-specific primers were diluted to a concentration of 10 μM in water. The samples were sequenced at the Diabetes and Endocrinology Research Center's Molecular Biology Core Facility (Barbara Davis Center, University of Colorado Health Sciences Center). We used the Basic Local Alignment Search Tool 2 (BLAST2) Sequences program of the National Center for Biotechnology Information, which aligns two sequences, to determine the degree of homology between the two sequences.25
Analysis of BMPR2 for Mutations
DNA from the 16 patients with primary pulmonary hypertension was screened for at least seven of the most commonly reported mutations in the BMPR2 gene. Mutations K230fs, I860fs, and R899X have been reported by two or more independent groups.1,26-28 The details of the analysis are provided in Supplementary Appendix 2, available with the full text of this article at http://www.nejm.org.
Results
Screening
In the screening study, 4 of 15 microdissected plexiform lesions from patients with pulmonary hypertension were positive for ORF26 by PCR.
Immunohistochemical Findings
Ten of the 16 patients with primary pulmonary hypertension (62 percent), but none of the 14 patients with secondary pulmonary hypertension, had lung-tissue sections that showed the characteristic nuclear-staining pattern when probed with a monoclonal antibody directed against the LANA-1 of HHV-8 encoded by ORF73 (Table 1 and Figure 1Figure 1
Plexiform Lesions from One Patient with Primary Pulmonary Hypertension (Panels A, B, C, D, and E) and a Kaposi's Sarcoma Skin Lesion from One Patient Infected with Human Immunodeficiency Virus Type 1 (Panels F, G, H, I, and J).). The lymph node from one of the patients with Castleman's disease and primary pulmonary hypertension (Patient 17) was negative for LANA-1. We found that not only cells within the plexiform lesions but also bronchoepithelial cells, inflammatory cells (lymphocytes and macrophages), and endothelial cells lining patent lung vessels were positive for LANA-1. Smooth-muscle cells were consistently negative for LANA-1 (Figure 1C). All specimens from the five controls were negative for LANA-1.HHV-8 Viral Cyclin
On PCR, 10 of the 16 patients with primary pulmonary hypertension (the same 10 who were positive for LANA-1 on immunohistochemical analysis) and 1 of 14 patients with secondary pulmonary hypertension had tissue sections that were positive for the viral cyclin gene of HHV-8 encoded by ORF72. Specimens from all five controls were negative for the viral cyclin gene on PCR (Table 1 and Figure 2Figure 2
Detection of a Human Herpesvirus 8 Gene by Means of Polymerase-Chain-Reaction Amplification of Viral Cyclin Encoded by Open Reading Frame 72 (ORF72).).Sequence analysis of one skin lesion from a patient with Kaposi's sarcoma and four lung samples from patients with pulmonary hypertension who were positive for the HHV-8 viral cyclin gene on PCR analysis showed a high degree of sequence homology with the published full-length HHV-8 sequence. The Kaposi's sarcoma lesion was 91 percent homologous, as was the sample from Patient 2. The sample from Patient 4 was 97 percent homologous, that from Patient 6 was 86 percent homologous, and that from Patient 20 was 98 percent homologous (Figure 3Figure 3
Homology with the Published Human Herpesvirus 8 Sequence in Viral Cyclin Sequences from a Kaposi's Sarcoma Skin Lesion and Lung-Tissue Samples from Three Patients with Primary Pulmonary Hypertension (Patients 2, 4, and 6) and One Patient with Pulmonary Hypertension Due to Infection with Human Immunodeficiency Virus Type 1 (Patient 20).). Long stretches of conserved sequences were found toward the 5' end of the gene, whereas the sequences in the 3' region were more variable.BMPR2 Mutations
DNA from Patient 8 had an R899X mutation in BMPR2. DNA from Patients 7, 10, and 16 had a previously unreported restriction-fragment–length polymorphism (RFLP) pattern. Thus, 4 of the 16 patients with primary pulmonary hypertension who were screened (25 percent) had mutations. Two of these patients were positive for HHV-8 on immunohistochemical and PCR analysis (Patients 8 and 16), and two were negative (Patients 7 and 10) (Table 1).
Discussion
Our studies provide evidence of HHV-8 infection in the vascular lesions and lung parenchymal cells of patients with nonfamilial primary pulmonary hypertension. HHV-8 infection of lung tissue was demonstrated with the use of two methods, immunohistochemical analysis for the expression of LANA-1 encoded by ORF73 and PCR for the detection of viral cyclin DNA encoded by ORF72. There was a high rate of concordance between staining for LANA-1 and the detection of viral cyclin DNA.
LANA-1 is constitutively expressed in lytic and latent HHV-8 infection29,30 and is a reliable indicator of HHV-8 infection.31 The pulmonary vascular lesions and parenchymal cells from 10 of 16 patients with nonfamilial primary pulmonary hypertension expressed LANA-1, whereas tissue samples from only 1 of 3 patients with HIV-1–associated severe pulmonary hypertension were positive. Kaposi's sarcoma was not present in this patient. These data suggest that HIV-1–associated pulmonary hypertension can occur independently of HHV-8 infection. In contrast to specimens from patients with primary pulmonary hypertension, the lung tissue from all patients with secondary pulmonary hypertension due to known causes, such as congenital cardiac abnormalities, collagen vascular disorders, anorexigen use,32 and sarcoidosis, had no evidence of HHV-8 infection.
LANA-1, viral cyclin, and viral FLICE inhibitory protein (FLIP) are cotranscribed on two polycistronic messenger RNAs and are constitutively expressed in cells latently infected with HHV-8.31 Consequently, the presence of LANA-1 in plexiform lesions from patients with primary pulmonary hypertension reliably predicts the coexpression of viral cyclin and viral FLIP gene products. Viral cyclin has both functional and sequence homology with D-type cyclins, which direct cyclin-dependent kinase 4 and 6 to phosphorylate the retinoblastoma protein.33,34 Underphosphorylated retinoblastoma protein is sequestered by the E2F family of transcription factors, which regulates the expression of cell-cycle–entry genes. Therefore, viral cyclin induces cell-cycle progression by inhibiting the function of the retinoblastoma protein. The generation of free E2F also leads to the expression of p14ARF, ultimately increasing the expression of the p53 tumor-suppressor protein and inducing p53-dependent apoptosis.35 LANA-1 inhibits the function of p53, thereby preventing apoptosis of latently infected cells.36 The capacity of gene products expressed during latent infection (e.g., viral cyclin and LANA-1) to trigger unregulated cell-cycle progression while simultaneously blocking p53-dependent apoptosis is probably a major molecular mechanism contributing to the oncogenicity of HHV-8.30 The pattern of inducing E2F-dependent transcription while inhibiting p53-dependent apoptosis is a common feature of several different DNA tumor viruses, such as human papillomaviruses, adenoviruses, and simian virus 40.37,38
The types of cells that HHV-8 may infect have not all been identified. We detected the expression of LANA-1 in a variety of cells in the lungs of patients with primary pulmonary hypertension, including bronchoepithelial cells, inflammatory cells (primarily lymphocytes and macrophages), and endothelial cells. Our data suggest that HHV-8 has the capacity to infect a wide variety of cells in lung tissue, and we hypothesize that HHV-8 infection may be responsible for a broader spectrum of diseases in humans than is currently known.
Although we demonstrated HHV-8 infection of the lungs in patients with primary pulmonary hypertension, we cannot conclude that infection alone causes this condition. It is possible that some unique aspect of primary pulmonary hypertension increases the risk of HHV-8 infection. Factors unique to the plexiform lesions (e.g., local production of inflammatory cytokines) may enhance the replication of HHV-8 in affected tissues. However, that HHV-8 infection has some role in the process is suggested by the number of features that are shared by Kaposi's sarcoma and the plexiform lesions of primary pulmonary hypertension (Table 2Table 2
Features Shared by Kaposi's Sarcoma Lesions and Plexiform Lesions from Patients with Primary Pulmonary Hypertension.). In primary but not secondary pulmonary hypertension, many, but not all, of the endothelial-cell clusters, which make up a large portion of the plexiform lesions, are due to the monoclonal growth of endothelial cells.4 In this context, it is of interest that early Kaposi's sarcoma lesions are characterized by polyclonal-cell hyperplasia, but they can develop into a true clonal cancer as the disease progresses to its nodular state.39 Our findings show that Kaposi's sarcoma skin lesions and plexiform lesions in patients with primary pulmonary hypertension have histologic similarities: slit-like vascular spaces and sheets of spindle cells that express factor VIII–related antigen (an endothelial-cell marker) and VEGF. HHV-8 may thus have a particular affinity for tissues and cells that have a high level of expression of VEGF, such as lung microvascular endothelial cells or Kaposi's sarcoma cells. The increased expression of VEGF may in turn increase the growth of endothelial cells.40-42 The resemblance between Kaposi's sarcoma lesions and the plexiform lesions of primary pulmonary hypertension suggests that the spectrum of molecular mechanisms leading to the development of severe pulmonary hypertension includes genetic and epigenetic mechanisms. Clearly, one or several genetic susceptibility factors are required to allow the proliferation of endothelial cells to occur in pulmonary precapillary arterioles. High shear stress (as occurs in tissues from patients with Eisenmenger's syndrome), anorexigen use, and perhaps HHV-8 infection may help trigger or amplify a process in which “the law of the endothelial cell monolayer has been broken”43 and there is endothelial-cell dysfunction44 and irreversible obliteration of the lumen by a disordered process of angiogenesis.42,43
We propose that HHV-8 infection and the expression of viral cyclin and LANA-1 in the lungs contribute to the growth of monoclonal endothelial cells and mutations in somatic endothelial cells in plexiform lesions from patients with primary pulmonary hypertension. Our findings indicate that vasculotropic viruses such as HHV-8 can encourage the growth of endothelial cells by dysregulating cell growth or growth-factor signaling.
Supported by a program project grant from the National Institutes of Health (PO1 HL66524, to Dr. Voelkel) and by a grant from the National Heart, Lung, and Blood Institute (K08 HL03911, to Dr. Cool).
Drs. Rai and Yeager contributed equally to the article.
We are indebted to Drs. David Badesch, Karen Fagan, and Bertron Groves (Pulmonary Hypertension Center, University of Colorado Health Sciences Center, Denver) for their support; to Drs. Thomas Campbell and James Neid for their critical review of the manuscript; to Dr. Joanne Yi (University of California, San Diego) for providing tissue from patients with Eisenmenger's syndrome; and to Lisa Litzenberger for photographic support.
Source Information
From the Pulmonary Hypertension Center (C.D.C., P.R.R., M.E.Y., A.E.S., T.M.B., M.W.G., N.F.V.), the Department of Pathology (C.D.C.), and the Webb-Waring Institute (D.H.-S.), University of Colorado Health Sciences Center; and the National Jewish Medical and Research Center (C.D.C., K.K.B., J.M.R.) — all in Denver; and the Cardiopulmonary Division, Department of Pathology, Johns Hopkins University, Baltimore (R.M.T.).
Address reprint requests to Dr. Voelkel at the Pulmonary and Critical Care Division, University of Colorado Health Sciences Center, Box C272, 4200 E. 9th Ave., Denver, CO 80262, or at norbert.voelkel@uchsc.edu.
- References
References
1
Deng Z ,Morse JH ,Slager SL , et al. Familial primary pulmonary hypertension (gene PPH1) is caused by mutations in the bone morphogenetic protein receptor-II gene. Am J Hum Genet 2000;67:737-744
CrossRef | Web of Science | Medline2
Tuder RM ,Cool CD ,Yeager M ,Taraseviciene-Stewart L ,Bull TM ,Voelkel NF . The pathobiology of pulmonary hypertension: endothelium. Clin Chest Med 2001;22:405-418
CrossRef | Web of Science | Medline3
Voelkel NF ,Tuder RM . Cellular and molecular mechanisms in the pathogenesis of severe pulmonary hypertension. Eur Respir J 1995;8:2129-2138
CrossRef | Web of Science | Medline4
Lee SD ,Shroyer KR ,Markham NE ,Cool CD ,Voelkel NF ,Tuder RM . Monoclonal endothelial cell proliferation is present in primary but not secondary pulmonary hypertension. J Clin Invest 1998;101:927-934
CrossRef | Web of Science | Medline5
Yeager ME ,Voelkel NF ,Tuder RM . Mutational analysis of endothelial cell TGF-β receptor type II in plexiform lesions of patients with primary pulmonary hypertension. Circulation 1999;100:Suppl:I-587 abstract.6
Geraci MW ,Moore M ,Gesell T , et al. Gene expression patterns in the lungs of patients with primary pulmonary hypertension: a gene microarray analysis. Circ Res 2001;88:555-562
Web of Science | Medline7
Boshoff C ,Weiss RA . Kaposi's sarcoma-associated herpesvirus. Adv Cancer Res 1998;75:57-86
CrossRef | Web of Science | Medline8
Weiss RA ,Whitby D ,Talbot S ,Kellam P ,Boshoff C . Human herpesvirus type 8 and Kaposi's sarcoma. J Natl Cancer Inst Monogr 1998;23:51-54
Medline9
Soulier J ,Grollet L ,Oksenhendler E , et al. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease. Blood 1995;86:1276-1280
Web of Science | Medline10
Schuylz TF, Chang Y, Moore PS. Kaposi's sarcoma-associated herpesvirus (human herpes virus 8) in human tumor viruses. In: McCance D, ed. Human tumor viruses. Washington, D.C.: American Society for Microbiology, 1998:87-134.
11
Antman K ,Chang Y . Kaposi's sarcoma. N Engl J Med 2000;342:1027-1038
Full Text | Web of Science | Medline12
Mette SA ,Palevsky HI ,Pietra GG , et al. Primary pulmonary hypertension in association with human immunodeficiency virus infection: a possible viral etiology for some forms of hypertensive pulmonary arteriopathy. Am Rev Respir Dis 1992;145:1196-1200
CrossRef | Web of Science | Medline13
Speich R ,Jenni R ,Opravil M ,Pfab M ,Russi EW . Primary pulmonary hypertension in HIV infection. Chest 1991;100:1268-1271
CrossRef | Web of Science | Medline14
Mehta NJ ,Khan IA ,Mehta RN ,Sepkowitz DA . HIV-related pulmonary hypertension: analytic review of 131 cases. Chest 2000;118:1133-1141
CrossRef | Web of Science | Medline15
Lennette E ,Blackbourn DJ ,Levy JA . Antibodies to human herpesvirus type 8 in the general population and in Kaposi's sarcoma patients. Lancet 1996;348:858-861
CrossRef | Web of Science | Medline16
Bull TM, Cool CD, Serls AE, et al. Primary pulmonary hypertension, Castleman's disease and HHV-8. Eur Respir J (in press).
17
Humbert M ,Monti G ,Brenot F , et al. Increased interleukin-1 and interleukin-6 serum concentrations in severe primary pulmonary hypertension. Am J Respir Crit Care Med 1995;151:1628-1631
Web of Science | Medline18
Eddahibi S ,Humbert M ,Sediame S , et al. Imbalance between platelet vascular endothelial growth factor and platelet-derived growth factor in pulmonary hypertension: effect of prostacyclin therapy. Am J Respir Crit Care Med 2000;162:1493-1499
Web of Science | Medline19
Tuder RM ,Groves B ,Badesch DB ,Voelkel NF . Exuberant endothelial cell growth and elements of inflammation are present in plexiform lesions of pulmonary hypertension. Am J Pathol 1994;144:275-285
Web of Science | Medline20
Tuder RM ,Voelkel NF . Pulmonary hypertension and inflammation. J Lab Clin Med 1998;132:16-24
CrossRef | Medline21
Chang Y ,Cesarman E ,Pessin MS , et al. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 1994;266:1865-1869
CrossRef | Web of Science | Medline22
Moore PS ,Chang Y . Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and without HIV infection. N Engl J Med 1995;332:1181-1185
Full Text | Web of Science | Medline23
Dupin N ,Fisher C ,Kellam P , et al. Distribution of human herpesvirus-8 latently infected cells in Kaposi's sarcoma, multicentric Castleman's disease, and primary effusion lymphoma. Proc Natl Acad Sci U S A 1999;96:4546-4551
CrossRef | Web of Science | Medline24
Pan L ,Milligan L ,Michaeli J ,Cesarman E ,Knowles DM . Polymerase chain reaction detection of Kaposi's sarcoma-associated herpesvirus-optimized protocols and their application to myeloma. J Mol Diagn 2001;3:32-38
CrossRef | Web of Science | Medline25
BLAST 2 sequences. (Accessed August 22, 2003, at http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html.)
26
Thomson JR ,Machado RD ,Pauciulo MW , et al. Sporadic primary pulmonary hypertension is associated with germline mutations of the gene encoding BMPR-II, a receptor member of the TGF-beta family. J Med Genet 2000;37:741-745
CrossRef | Web of Science | Medline27
Lane KB ,Machado RD ,Pauciulo MW , et al. Heterozygous germline mutations in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat Genet 2000;26:81-84
CrossRef | Web of Science | Medline28
Machado RD ,Pauciulo MW ,Thomson JR , et al. BMPR2 haploinsufficiency as the inherited molecular mechanism for primary pulmonary hypertension. Am J Hum Genet 2001;68:92-102
CrossRef | Web of Science | Medline29
Sarid R ,Flore O ,Bohenzky RA ,Chang Y ,Moore PS . Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1). J Virol 1998;72:1005-1012
Web of Science | Medline30
Fakhari FD ,Dittmer DP . Charting latency transcripts in Kaposi's sarcoma-associated herpesvirus by whole-genome real-time quantitative PCR. J Virol 2002;76:6213-6223
CrossRef | Web of Science | Medline31
Dittmer D ,Lagunoff M ,Renne R ,Staskus K ,Haase A ,Ganem D . A cluster of latently expressed genes in Kaposi's sarcoma-associated herpesvirus. J Virol 1998;72:8309-8315
Web of Science | Medline32
Abenhaim L ,Moride Y ,Brenot F , et al. Appetite-suppressant drugs and the risk of primary pulmonary hypertension: International Primary Pulmonary Hypertension Study Group. N Engl J Med 1996;335:609-616
Full Text | Web of Science | Medline33
Cesarman E ,Nador RG ,Bai F , et al. Kaposi's sarcoma-associated herpesvirus contains G protein-coupled receptor and cyclin D homologs which are expressed in Kaposi's sarcoma and malignant lymphoma. J Virol 1996;70:8218-8223
Web of Science | Medline34
Chang Y ,Moore PS ,Talbot SJ , et al. Cyclin encoded by KS herpesvirus. Nature 1996;382:410-410
CrossRef | Web of Science | Medline35
Bates S ,Phillips AC ,Clark PA , et al. p14ARF links the tumour suppressors RB and p53. Nature 1998;395:124-125
CrossRef | Web of Science | Medline36
Friborg J Jr ,Kong W ,Hottiger MO ,Nabel GJ . p53 Inhibition of the LANA protein of KSHV protects against cell death. Nature 1999;402:889-894
Web of Science | Medline37
Munger K ,Howley PM . Human papillomavirus immortalization and transformation functions. Virus Res 2002;89:213-228
CrossRef | Web of Science | Medline38
zur Hausen H . Oncogenic DNA viruses. Oncogene 2001;20:7820-7823
CrossRef | Web of Science | Medline39
Judde JG ,Lacoste V ,Briere J , et al. Monoclonality or oligoclonality of human herpesvirus 8 terminal repeat sequences in Kaposi's sarcoma and other diseases. J Natl Cancer Inst 2000;92:729-736
CrossRef | Web of Science | Medline40
Masood R ,Cai J ,Zheng T ,Smith DL ,Naidu Y ,Gill PS . Vascular endothelial growth factor/vascular permeability factor is an autocrine growth factor for AIDS-Kaposi sarcoma. Proc Natl Acad Sci U S A 1997;94:979-984
CrossRef | Web of Science | Medline41
Masood R ,Cesarman E ,Smith DL ,Gill PS ,Flore O . Human herpesvirus-8-transformed endothelial cells have functionally activated vascular endothelial growth factor/vascular endothelial growth factor receptor. Am J Pathol 2002;160:23-29
CrossRef | Web of Science | Medline42
Tuder RM ,Chacon M ,Alger L , et al. Expression of angiogenesis-related molecules in plexiform lesions in severe pulmonary hypertension: evidence for a process of disordered angiogenesis. J Pathol 2001;195:367-374
CrossRef | Web of Science | Medline43
Voelkel NF ,Cool C ,Taraceviene-Stewart L , et al. Janus face of vascular endothelial growth factor: the obligatory survival factor for lung vascular endothelium controls precapillary artery remodeling in severe pulmonary hypertension. Crit Care Med 2002;30:Suppl 5:S251-S256
CrossRef | Web of Science | Medline44
Loscalzo J . Endothelial dysfunction in pulmonary hypertension. N Engl J Med 1992;327:117-119
Full Text | Web of Science | Medline
- Citing Articles (68)
Citing Articles
1
Yu-Mee Kim, Leila Haghighat, Edda Spiekerkoetter, Hirofumi Sawada, Cristina M. Alvira, Lingli Wang, Swati Acharya, Gabriela Rodriguez-Colon, Andrew Orton, Mingming Zhao, Marlene Rabinovitch. (2011) Neutrophil Elastase Is Produced by Pulmonary Artery Smooth Muscle Cells and Is Linked to Neointimal Lesions. The American Journal of Pathology 179:3, 1560-1572
CrossRef2
Gopinath Sutendra, Peter Dromparis, Sébastien Bonnet, Alois Haromy, Michael S. McMurtry, R. Chris Bleackley, Evangelos D. Michelakis. (2011) Pyruvate dehydrogenase inhibition by the inflammatory cytokine TNFα contributes to the pathogenesis of pulmonary arterial hypertension. Journal of Molecular Medicine 89:8, 771-783
CrossRef3
Johann Strumpher, Eric Jacobsohn. (2011) Pulmonary Hypertension and Right Ventricular Dysfunction: Physiology and Perioperative Management. Journal of Cardiothoracic and Vascular Anesthesia 25:4, 687-704
CrossRef4
Masaru Nagayoshi, Yuji Tada, James West, Eri Ochiai, Akira Watanabe, Takahito Toyotome, Nobuhiro Tanabe, Yuichi Takiguchi, Ayako Shigeta, Tadashi Yasuda, Kazutoshi Shibuya, Katsuhiko Kamei, Koichiro Tatsumi. (2011) Inhalation of Stachybotrys chartarum Evokes Pulmonary Arterial Remodeling in Mice, Attenuated by Rho-Kinase Inhibitor. Mycopathologia 172:1, 5-15
CrossRef5
Ralph T. Schermuly, Hossein A. Ghofrani, Martin R. Wilkins, Friedrich Grimminger. (2011) Mechanisms of disease: pulmonary arterial hypertension. Nature Reviews Cardiology 8:8, 443-455
CrossRef6
Carlyne D Cool, Norbert F Voelkel, Todd Bull. (2011) Viral infection and pulmonary hypertension: is there an association?. Expert Review of Respiratory Medicine 5:2, 207-216
CrossRef7
Stefania Cicalini, Pierangelo Chinello, Nicola Petrosillo. (2011) HIV infection and pulmonary arterial hypertension. Expert Review of Respiratory Medicine 5:2, 257-266
CrossRef8
Nada Kherbeck, Mathieu C. Tamby, Guillaume Bussone, Hanadi Dib, Frederic Perros, Marc Humbert, Luc Mouthon. (2011) The Role of Inflammation and Autoimmunity in the Pathophysiology of Pulmonary Arterial Hypertension. Clinical Reviews in Allergy & Immunology
CrossRef9
S. S. Pullamsetti, R. Savai, W. Janssen, B. K. Dahal, W. Seeger, F. Grimminger, H. A. Ghofrani, N. Weissmann, R. T. Schermuly. (2011) Inflammation, immunological reaction and role of infection in pulmonary hypertension. Clinical Microbiology and Infection 17:1, 7-14
CrossRef10
Mark Geraci, Barbara Meyrick. 2011. Genomics and Proteomics of Pulmonary Vascular Disease. .
CrossRef11
Brian B. Graham, Margaret M. Mentink-Kane, Hazim El-Haddad, Shawn Purnell, Li Zhang, Ari Zaiman, Elizabeth F. Redente, David W.H. Riches, Paul M. Hassoun, Angela Bandeira, Hunter C. Champion, Ghazwan Butrous, Thomas A. Wynn, Rubin M. Tuder. (2010) Schistosomiasis-Induced Experimental Pulmonary Hypertension. The American Journal of Pathology 177:3, 1549-1561
CrossRef12
G. Sutendra, S. Bonnet, G. Rochefort, A. Haromy, K. D. Folmes, G. D. Lopaschuk, J. R. B. Dyck, E. D. Michelakis. (2010) Fatty Acid Oxidation and Malonyl-CoA Decarboxylase in the Vascular Remodeling of Pulmonary Hypertension. Science Translational Medicine 2:44, 44ra58-44ra58
CrossRef13
Sonu Dhillon, Anshul Kaker, Aneil Dosanjh, Deepa Japra, David H. VanThiel. (2010) Irreversible Pulmonary Hypertension Associated with the use of Interferon Alpha for Chronic Hepatitis C. Digestive Diseases and Sciences 55:6, 1785-1790
CrossRef14
Jørgen Slots. (2010) Human viruses in periodontitis. Periodontology 2000 53:1, 89-110
CrossRef15
Kazufumi Nakamura, Juichiro Shimizu, Noriyuki Kataoka, Katsushi Hashimoto, Tetsuya Ikeda, Hideki Fujio, Keiko Ohta-Ogo, Aiko Ogawa, Aya Miura, Satoshi Mohri, Satoshi Nagase, Hiroshi Morita, Kengo Fukushima Kusano, Hiroshi Date, Hiromi Matsubara, Seiichi Mochizuki, Ken Hashimoto, Fumihiko Kajiya, Tohru Ohe. (2010) Altered nano/micro-order elasticity of pulmonary artery smooth muscle cells of patients with idiopathic pulmonary arterial hypertension. International Journal of Cardiology 140:1, 102-107
CrossRef16
Iwona Fijalkowska, Weiling Xu, Suzy A.A. Comhair, Allison J. Janocha, Lori A. Mavrakis, Balaji Krishnamachary, Lijie Zhen, Thianzi Mao, Amy Richter, Serpil C. Erzurum, Rubin M. Tuder. (2010) Hypoxia Inducible-Factor1α Regulates the Metabolic Shift of Pulmonary Hypertensive Endothelial Cells. The American Journal of Pathology 176:3, 1130-1138
CrossRef17
Joon H. Park, Arnold I. Levinson. (2010) Granulomatous-lymphocytic interstitial lung disease (GLILD) in common variable immunodeficiency (CVID). Clinical Immunology 134:2, 97-103
CrossRef18
Yoshiaki Furuya, Toru Satoh, Masataka Kuwana. (2010) Interleukin-6 as a Potential Therapeutic Target for Pulmonary Arterial Hypertension. International Journal of Rheumatology 2010, 1-8
CrossRef19
Paul M. Hassoun, Luc Mouthon, Joan A. Barberà, Saadia Eddahibi, Sonia C. Flores, Friedrich Grimminger, Peter Lloyd Jones, Michael L. Maitland, Evangelos D. Michelakis, Nicholas W. Morrell, John H. Newman, Marlene Rabinovitch, Ralph Schermuly, Kurt R. Stenmark, Norbert F. Voelkel, Jason X.-J. Yuan, Marc Humbert. (2009) Inflammation, Growth Factors, and Pulmonary Vascular Remodeling. Journal of the American College of Cardiology 54:1, S10-S19
CrossRef20
D. Murphy, R. E. Girgis. (2009) HIV-associated pulmonary arterial hypertension: a clinical problem that is here to stay?. International Journal of Clinical Practice 63, 19-21
CrossRef21
Norbert F Voelkel, Carlyne D Cool, Sonia Flores. (2008) From viral infection to pulmonary arterial hypertension: a role for viral proteins?. AIDS 22:Suppl 3, S49-S53
CrossRef22
Marc Humbert. (2008) Mediators involved in HIV-related pulmonary arterial hypertension. AIDS 22:Suppl 3, S41-S47
CrossRef23
Marlene Rabinovitch. (2008) Molecular pathogenesis of pulmonary arterial hypertension. Journal of Clinical Investigation 118:7, 2372-2379
CrossRef24
Carlyne D. Cool, Gail Deutsch. (2008) Pulmonary Arterial Hypertension from a Pediatric Perspective. Pediatric and Developmental Pathology 11:3, 169-177
CrossRef25
Priscilla Y Hsue, Steven G Deeks, Husam H Farah, Swapna Palav, Samira Y Ahmed, Amanda Schnell, Allison B Ellman, Laurence Huang, Sheila C Dollard, Jeffrey N Martin. (2008) Role of HIV and human herpesvirus-8 infection in pulmonary arterial hypertension. AIDS 22:7, 825-833
CrossRef26
Vladimir LJ Lazarevic, Maria Liljeholm, Karin Forsberg, Stefan Söderberg, Anders Wahlin. (2008) Fludarabine, Cyclophosphamide and Rituximab (FCR) induced pulmonary hypertension in Waldenström macroglobulinemia. Leukemia & Lymphoma 49:6, 1209-1211
CrossRef27
Eli Gabbay, Robert G. Weintraub, Lewis J. Rubin. 2008. Pulmonary Arterial Hypertension. , 759-771.
CrossRef28
M Southwood, TK Jeffery, X Yang, PD Upton, SM Hall, C Atkinson, SG Haworth, S Stewart, PN Reynolds, L Long, RC Trembath, NW Morrell. (2008) Regulation of bone morphogenetic protein signalling in human pulmonary vascular development. The Journal of Pathology 214:1, 85-95
CrossRef29
D. Bendayan, R. Sarid, A. Cohen, D. Shitrit, I. Shechtman, M.R. Kramer. (2008) Absence of Human Herpesvirus 8 DNA Sequences in Lung Biopsies from Israeli Patients with Pulmonary Arterial Hypertension. Respiration 75:2, 155-157
CrossRef30
Silvia Ulrich, Mark R. Nicolls, Laima Taraseviciene, Rudolf Speich, Norbert Voelkel. (2008) Increased Regulatory and Decreased CD8+ Cytotoxic T Cells in the Blood of Patients with Idiopathic Pulmonary Arterial Hypertension. Respiration 75:3, 272-280
CrossRef31
Stephen Y. Chan, Joseph Loscalzo. (2008) Pathogenic mechanisms of pulmonary arterial hypertension. Journal of Molecular and Cellular Cardiology 44:1, 14-30
CrossRef32
Jian-Chao Zong, Ravit Arav-Boger, Donald J. Alcendor, Gary S. Hayward. (2007) Reflections on the interpretation of heterogeneity and strain differences based on very limited PCR sequence data from Kaposi's sarcoma-associated herpesvirus genomes. Journal of Clinical Virology 40:1, 1-8
CrossRef33
Eugènia Negredo, Màrius Pagés, José Ramírez. (2007) Varón de 50 años afectado de sida y con una masa retroperitoneal. Medicina Clínica 129:2, 70-76
CrossRef34
Naushad Hirani, Alessandra Manes, Carlo Parravicini, Chiara Scalamogna, Massimiliano Palazzini, Luca Negro, Serena Romanazzi, Erika Longhi, Giovanna Bestetti, Roberta Piolin, Giovanna Lunghi, Anna Orlandi, Angelo Branzi, Mario Corbellino, Nazzareno Galiè. (2007) Evidence for Kaposi's sarcoma-associated herpes virus infection in patients with idiopathic pulmonary arterial hypertension: a case series and review of the literature. Current Medical Research and Opinion 23:s2, S83-S87
CrossRef35
Paul Bresser, Marion I. Cornelissen, Wim van der Bij, Carel J.M. van Noesel, Wim Timens. (2007) Idiopathic pulmonary arterial hypertension in Dutch Caucasian patients is not associated with human herpes virus-8 infection. Respiratory Medicine 101:4, 854-856
CrossRef36
Rubin M. Tuder, John C. Marecki, Amy Richter, Iwona Fijalkowska, Sonia Flores. (2007) Pathology of Pulmonary Hypertension. Clinics in Chest Medicine 28:1, 23-42
CrossRef37
Marlene Rabinovitch. (2007) Pathobiology of Pulmonary Hypertension. Annual Review of Pathology: Mechanisms of Disease 2:1, 369-399
CrossRef38
Judith Therrien, Sherryn Rambihar, Bill Newman, Kathy Siminovitch, David Langleben, Gary Webb, John Granton. (2006) Eisenmenger syndrome and atrial septal defect: Nature or nurture?. Canadian Journal of Cardiology 22:13, 1133-1136
CrossRef39
Nicola Petrosillo, Pierangelo Chinello, Stefania Cicalini. (2006) Pulmonary hypertension in individuals with HIV infection. AIDS 20:16, 2128-2129
CrossRef40
Félix Gutiérrez, Mar Masiá, Sergio Padilla, José M. Ramos, Enrique Bernal, Pilar Morales, Francisco Pozo, Encarnación Andrada, Alberto Martin-Hidalgo. (2006) Occult lymphadenopathic Kaposi's sarcoma associated with severe pulmonary hypertension: A clinical hint about the potential role of HHV-8 in HIV-related pulmonary hypertension?. Journal of Clinical Virology 37:2, 79-82
CrossRef41
Michael H. Ieong, Harrison W. Farber. (2006) Noninfectious Pulmonary Complications of HIV. Clinical Pulmonary Medicine 13:3, 194-202
CrossRef42
Jessica R Grubb, Anne C Moorman, Rose K Baker, Henry Masur. (2006) The changing spectrum of pulmonary disease in patients with HIV infection on antiretroviral therapy. AIDS 20:8, 1095-1107
CrossRef43
Abdul Rahim Wong, Aida Hanum G. Rasool, Nik Zainal Abidin, Abdul Rahmand Noor, Ban Seng Quah. (2006) Sildenafil as treatment for Human Immunodeficiency Virus-related pulmonary hypertension in a child. Journal of Paediatrics and Child Health 42:3, 147-148
CrossRef44
Csaba Galambos, Jill Montgomery, Frank J. Jenkins. (2006) No Role for Kaposi Sarcoma-Associated Herpesvirus in Pediatric Idiopathic Pulmonary Hypertension. Pediatric Pulmonology 41:2, 122-125
CrossRef45
Thomas F Schulz. (2006) The pleiotropic effects of Kaposi's sarcoma herpesvirus. The Journal of Pathology 208:2, 187-198
CrossRef46
Azad Raiesdana, Joseph Loscalzo. (2006) Pulmonary arterial hypertension. Annals of Medicine 38:2, 95-110
CrossRef47
C. Gregory Elliott. 2006. Genetics of Pulmonary Arterial Hypertension. , 50-65.
CrossRef48
A. R. Barclay, G. Sholler, J. Christodolou, A. Shun, S. Arbuckle, S. Dorney, M. O. Stormon. (2005) Pulmonary hypertension—A new manifestation of mitochondrial disease. Journal of Inherited Metabolic Disease 28:6, 1081-1089
CrossRef49
Carmen Hidalgo-Tenorio, Encarnita Milla-Álvarez, María del Pino Hernández-Molinero, Ignacio Casado. (2005) Hipertensión pulmonar y síndrome de Schönlein-Henoch. Medicina Clínica 125:16, 638-639
CrossRef50
Emily L. Wong, Blossom Damania. (2005) Linking KSHV to human cancer. Current Oncology Reports 7:5, 349-356
CrossRef51
Andrew Grigg, Malcolm Buchanan, Helen Whitford. (2005) Late-onset pulmonary arterial hypertension in association with graft-versus-host disease after allogeneic stem-cell transplantation. American Journal of Hematology 80:1, 38-42
CrossRef52
Todd M. Bull, Karen A. Fagan, David B. Badesch. (2005) Pulmonary Vascular Manifestations of Mixed Connective Tissue Disease. Rheumatic Disease Clinics of North America 31:3, 451-464
CrossRef53
J. M. Cadillac, R. E. Sigler, J. B. Weinberg, M. L. Lutzke, R. Rochford. (2005) Gammaherpesvirus-Induced Lung Pathology Is Altered in the Absence of Macrophages. Lung 183:4, 239-251
CrossRef54
J.C. Caraballo Fonseca, C.D. Martínez Balzano, R. Sánchez de León. (2005) Disfunción endotelial en la hipertensión pulmonar. Archivos de Bronconeumología 41:7, 389-392
CrossRef55
David Montani, Anne-Genevieve Marcelin, Olivier Sitbon, Vincent Calvez, Gérald Simonneau, Marc Humbert. (2005) Human herpes virus 8 in HIV and non-HIV infected patients with pulmonary arterial hypertension in France. AIDS 19:11, 1239-1240
CrossRef56
Masakuni Kido, Lingling Du, Christopher C. Sullivan, Reena Deutsch, Stuart W. Jamieson, Patricia A. Thistlethwaite. (2005) Gene transfer of a TIE2 receptor antagonist prevents pulmonary hypertension in rodents. The Journal of Thoracic and Cardiovascular Surgery 129:2, 268-276
CrossRef57
A. S. Zinkernagel, J. Overbeck, M. Opravil, R. Jenni, R. Speich, N. J. Mueller. (2005) Long-term survival and interruption of HAART in HIV-related pulmonary hypertension. European Journal of Clinical Microbiology & Infectious Diseases 24:2, 153-155
CrossRef58
Masanori Daibata, Isao Miyoshi, Hirokuni Taguchi, Hiromi Matsubara, Hiroshi Date, Nobuyoshi Shimizu, Yuji Ohtsuki. (2004) Absence of human herpesvirus 8 in lung tissues from Japanese patients with primary pulmonary hypertension. Respiratory Medicine 98:12, 1231-1232
CrossRef59
Farber, Harrison W., Loscalzo, Joseph, . (2004) Pulmonary Arterial Hypertension. New England Journal of Medicine 351:16, 1655-1665
Full Text60
Mehran Mandegar, Yuan-Cheng B. Fung, Wei Huang, Carmelle V. Remillard, Lewis J. Rubin, Jason X.-J. Yuan. (2004) Cellular and molecular mechanisms of pulmonary vascular remodeling: role in the development of pulmonary hypertension. Microvascular Research 68:2, 75-103
CrossRef61
Irene M Lang, Diana Bonderman, Meinhard Kneussl, Manfred Marx. (2004) Paediatric pulmonary vascular disease. Paediatric Respiratory Reviews 5:3, 238-248
CrossRef62
Marc Humbert, Nicholas W Morrell, Stephen L Archer, Kurt R Stenmark, Margaret R MacLean, Irene M Lang, Brian W Christman, E.Kenneth Weir, Oliver Eickelberg, Norbert F Voelkel, Marlene Rabinovitch. (2004) Cellular and molecular pathobiology of pulmonary arterial hypertension. Journal of the American College of Cardiology 43:12, S13-S24
CrossRef63
Giuseppe G. Pietra, Frederique Capron, Susan Stewart, Ornella Leone, Marc Humbert, Ivan M. Robbins, Lynne M. Reid, R.M. Tuder. (2004) Pathologic assessment of vasculopathies in pulmonary hypertension. Journal of the American College of Cardiology 43:12, S25-S32
CrossRef64
Jean‐Philippe Zuber, Alexandra Calmy, John M. Evison, Barbara Hasse, Veronique Schiffer, Thomas Wagels, Reto Nuesch, Lorenzo Magenta, Bruno Ledergerber, Rolf Jenni, Rudolf Speich, Milos Opravil, . (2004) Pulmonary Arterial Hypertension Related to HIV Infection: Improved Hemodynamics and Survival Associated with Antiretroviral Therapy. Clinical Infectious Diseases 38:8, 1178-1185
CrossRef65
Paolo De Paoli. (2004) Human herpesvirus 8: an update. Microbes and Infection 6:3, 328-335
CrossRef66
Cornelia Henke-Gendo, Thomas F Schulz. (2004) Transmission and disease association of Kaposi??s sarcoma-associated herpesvirus: recent developments. Current Opinion in Infectious Diseases 17:1, 53-57
CrossRef67
(2004) HHV-8 in Pulmonary Hypertension. New England Journal of Medicine 350:2, 194-195
Full Text68
Cesarman, Ethel, . (2003) Kaposi's Sarcoma–Associated Herpesvirus — The High Cost of Viral Survival. New England Journal of Medicine 349:12, 1107-1109
Full Text
- Letters
