Original Article
Activating Mutations in the Gene Encoding the ATP-Sensitive Potassium-Channel Subunit Kir6.2 and Permanent Neonatal Diabetes
N Engl J Med 2004; 350:1838-1849April 29, 2004
- Abstract
Background
Patients with permanent neonatal diabetes usually present within the first three months of life and require insulin treatment. In most, the cause is unknown. Because ATP-sensitive potassium (KATP) channels mediate glucose-stimulated insulin secretion from the pancreatic beta cells, we hypothesized that activating mutations in the gene encoding the Kir6.2 subunit of this channel (KCNJ11) cause neonatal diabetes.
Methods
We sequenced the KCNJ11 gene in 29 patients with permanent neonatal diabetes. The insulin secretory response to intravenous glucagon, glucose, and the sulfonylurea tolbutamide was assessed in patients who had mutations in the gene.
Results
Six novel, heterozygous missense mutations were identified in 10 of the 29 patients. In two patients the diabetes was familial, and in eight it arose from a spontaneous mutation. Their neonatal diabetes was characterized by ketoacidosis or marked hyperglycemia and was treated with insulin. Patients did not secrete insulin in response to glucose or glucagon but did secrete insulin in response to tolbutamide. Four of the patients also had severe developmental delay and muscle weakness; three of them also had epilepsy and mild dysmorphic features. When the most common mutation in Kir6.2 was coexpressed with sulfonylurea receptor 1 in Xenopus laevis oocytes, the ability of ATP to block mutant KATP channels was greatly reduced.
Conclusions
Heterozygous activating mutations in the gene encoding Kir6.2 cause permanent neonatal diabetes and may also be associated with developmental delay, muscle weakness, and epilepsy. Identification of the genetic cause of permanent neonatal diabetes may facilitate the treatment of this disease with sulfonylureas.
Media in This Article
Figure 1
Schematic Representation of the Pancreatic Beta Cell, Illustrating the Role of the ATP-Sensitive Potassium (KATP) Channel in Insulin Secretion.Figure 2
Diabetes Status and Mutations in the Gene Encoding Kir6.2 in 10 Families.Article Activity
- Article
Neonatal diabetes may be defined as insulin-requiring hyperglycemia that is diagnosed within the first three months of life. It may be either transient, resolving within a median of three months, or permanent, in which case insulin treatment is required for life.1 Substantial progress has been made in our understanding of transient neonatal diabetes, with the majority of cases being attributable to an abnormality in an imprinted region of chromosome 6.2 In most patients, the cause of permanent neonatal diabetes is unknown; homozygous and compound heterozygous mutations in the gene encoding glucokinase account for a minority of cases,3-6 and the genes for some very rare, multisystem conditions that include neonatal diabetes have been identified.7-9
ATP-sensitive potassium (KATP) channels play a central role in glucose-stimulated insulin secretion from pancreatic beta cells: insulin secretion is initiated by closure of the channels and inhibited by their opening (Figure 1Figure 1
Schematic Representation of the Pancreatic Beta Cell, Illustrating the Role of the ATP-Sensitive Potassium (KATP) Channel in Insulin Secretion.).10 The beta-cell KATP channel is an octameric complex of four pore-forming, inwardly rectifying potassium-channel subunits (Kir6.2) and four regulatory sulfonylurea-receptor subunits (SUR1).11 Both Kir6.2 and SUR1 are required for correct metabolic regulation of the channel: ATP closes the channel by binding to Kir6.2, and magnesium nucleotides (Mg-ADP and Mg-ATP) stimulate channel activity by interacting with SUR1. Sulfonylureas stimulate insulin secretion in type 2 diabetes by binding to SUR1 and closing KATP channels by an ATP-independent mechanism.10 We hypothesized that activating mutations in the gene encoding the Kir6.2 subunit of the beta-cell KATP channel (KCNJ11) cause monogenic diabetes, because inactivating mutations in this gene lead to uncontrolled insulin secretion and congenital hyperinsulinism.12 The contrasting phenotypes of permanent neonatal diabetes and hyperinsulinism are seen with inactivating and activating mutations, respectively, of the gene encoding glucokinase.3,13,14 Strong support for our hypothesis comes from the observation that transgenic mice with overactive beta-cell KATP channels have profound neonatal diabetes.15 We therefore sequenced the gene encoding Kir6.2 in patients who had permanent neonatal diabetes or dominantly inherited maturity-onset diabetes of the young (MODY).
Methods
Patients
We sequenced the DNA of 29 probands with permanent neonatal diabetes, mainly from the International Society for Pediatric and Adolescent Diabetes (ISPAD) Rare Diabetes Collection. Patients were registered in the collection or were recruited for the study between September 2001 and October 2003. Patients with abnormalities in chromosome 6q24, mutations in the gene encoding glucokinase, exocrine pancreatic insufficiency, and pancreatic agenesis were excluded. We also sequenced the DNA of 15 probands with MODY from families in the United Kingdom in whom mutations in the six known MODY-associated genes had been ruled out.16 Written informed consent was obtained from all the patients or their parents.
Mutational Analyses
The coding region and the intron–exon boundaries of KCNJ11 were amplified from genomic DNA by the polymerase chain reaction with the use of previously described primers17 in addition to fragment 5R 5'CTGTGGTCCTCATCAAGCTG3', fragment 6F 5'GCTGAGGAGGACGGACGTTAC3', and fragment 6R 5'CCACATGGTCCGTGTGTACACACG3'. The products were sequenced by standard methods. Family relationships were confirmed with the use of a panel of 10 microsatellite markers.
Clinical Studies
All patients with mutations in the gene encoding Kir6.2 underwent clinical examinations, including detailed developmental and neurologic assessments by a consultant pediatrician or physician, and their medical records were reviewed. Electrocardiograms were examined for evidence of arrhythmias and for measurement of the QT interval. All physiological tests were performed after the patients had fasted overnight. A glucagon stimulation test was performed as follows: 15 μg of glucagon per kilogram of body weight (maximal dose, 1 mg) was given intravenously at time 0, and blood samples for measurement of C-peptide were obtained at –10, –5, 0, 2, 4, 6, 8, 10, 15, and 20 minutes. The highest C-peptide value was then recorded. A tolbutamide-modified, frequently sampled intravenous glucose-tolerance test was performed as previously described.18 After base-line sampling, a bolus of 0.3 g of glucose per kilogram was given intravenously, followed by a bolus of 3 mg of tolbutamide per kilogram 20 minutes later. We calculated the peak incremental insulin response after the glucose bolus and after the tolbutamide bolus.
Functional Studies
Wild-type mouse Kir6.2 or Kir6.2 in which histidine replaced arginine at position 201 (R201H) was coexpressed with rat SUR1 (containing exon 17) in Xenopus laevis oocytes, and KATP currents were recorded as previously described.19,20 To simulate the effect of heterozygosity, we injected oocytes with SUR1 and a 1:1 mixture of Kir6.2 and Kir6.2-R201H messenger RNA (mRNA). ATP concentration–response curves were fitted according to the Hill equation: I ÷ IC = 1 ÷ [1 + ([ATP] ÷ IC50)h], where I is the KATP current, IC is the current in the absence of nucleotide, [ATP] is the ATP concentration, IC50 is the ATP concentration at which inhibition is half maximal, and h is the Hill coefficient. Data are given as means ±SE.
Results
Mutational Analyses
We identified six novel, heterozygous mutations in the gene encoding Kir6.2 in 10 of the 29 probands who had permanent neonatal diabetes. The mutations were a glutamine-to-arginine substitution at position 52 (Q52R), a valine-to-glycine substitution at position 59 (V59G), a valine-to-methionine substitution at position 59 (V59M), an arginine-to-histidine substitution at position 201 (R201H), an arginine-to-cysteine substitution at position 201 (R201C), and an isoleucine-to-leucine substitution at position 296 (I296L). No mutations were found in any of the probands who had MODY. The R201H missense mutation was identified in 4 of these 10 probands, and the V59M missense mutation was detected in 2. In all the families, neonatal diabetes was seen only in persons who had Kir6.2 mutations, and all family members who did not have these mutations were not diabetic (Figure 2Figure 2
Diabetes Status and Mutations in the Gene Encoding Kir6.2 in 10 Families.).In two families (ISPAD 19 and BR 1), neonatal diabetes had been transmitted from an affected parent to his or her offspring. Because both maternal and paternal transmission can occur, imprinting of this locus is unlikely. In nine cases, DNA was available from both unaffected parents, and paternity was established; the mutations were shown to have arisen spontaneously. None of the mutations were present in 100 nondiabetic subjects from the United Kingdom.
Figure 3Figure 3
Illustration of Two Kir6.2 Subunits, Showing the Mutations Identified in Patients with Permanent Neonatal Diabetes. shows the location of mutated residues in Kir6.2. All the mutated residues are conserved among humans, rats, mice, and bullfrogs. The arginine residue at position 201 is conserved among 10 members of the family of Kir channels, a finding that supports the possibility that this residue has a critical role in channel function. In addition, we identified several previously recognized polymorphisms (a glutamic acid–to–lysine substitution at position 23 [E23K], a silent alanine-to-alanine substitution at position 190 [A190A], a silent leucine-to-leucine substitution at position 267 [L267L], a leucine-to-valine substitution at position 270 [L270V], an isoleucine-to-valine substitution at position 337 (I337V], a silent lysine-to-lysine substitution at position 381 [K381K], and a serine-to-cysteine substitution at position 385 [S385C]).Clinical Characteristics
The clinical characteristics of patients with mutations are shown in Table 1Table 1
Clinical Characteristics of Patients with Mutant Kir6.2.. There were two subgroups of patients: those who had only diabetes and those who had diabetes and shared neurologic abnormalities. Diabetes and low birth weight reflect impaired intrauterine and postnatal insulin secretion and were similar in the two subgroups of patients.Diabetes
Diabetes was diagnosed at a mean age of 7 weeks (range, birth to 26 weeks). At diagnosis, all the patients had marked hyperglycemia (glucose concentration, 270 to 972 mg per deciliter [15 to 54 mmol per liter]), and three had ketoacidosis. None of the patients had elevated concentrations of autoantibodies associated with type 1 diabetes, and the C-peptide concentration was usually less than 200 pmol per liter. The median dose of insulin was 0.8 U per kilogram (range, 0.3 to 1.3). Only one patient (the proband's father in family BR 1) was not treated with insulin. He had received tolbutamide since childhood, and at 46 years of age, he had good control of the disease with this medication (fasting glucose concentration, 110 mg per deciliter [6.1 mmol per liter]; C-peptide concentration, 400 pmol per liter).
Low Birth Weight
Low birth weight was a feature of all the patients; in 7 of 12 (58 percent) the birth weight was at or below the 3rd percentile. Patients who did not have neurologic symptoms (Table 1) showed marked catch-up growth after birth, and their weights and heights were normally distributed on follow-up after a mean of 9.3 years.
Neurologic Features
Three of the patients (the probands in families ISPAD 25, ISPAD 27, and ISPAD 43) had very similar neurologic abnormalities, which suggested extrapancreatic phenotypes associated with their Kir6.2 mutation (Table 1). All three had marked developmental delay, muscle weakness, epilepsy, and dysmorphic features as well as neonatal diabetes. Another patient (the proband in family ISPAD 55) had an intermediate phenotype involving severe developmental delay and muscle weakness in addition to neonatal diabetes, but no other neurologic features. No cause other than their Kir6.2 mutation was found for their neurologic problems. All children had normal karyotypes. The other patients had normal development, indicating that not all mutations in Kir6.2 are associated with neurologic abnormalities.
Developmental Delay
All four patients with common neurologic features had marked developmental delay involving failure to achieve motor, intellectual, and social milestones appropriate for their age. The motor delay was the most marked of these features; the oldest child was unable to walk unaided at the age of 17 years, and all four children showed motor development that was consistent with that of children half their chronologic age or younger. There was muscular weakness on neurologic examination in all four cases. The creatine kinase concentration was normal in all of them. Muscle-biopsy specimens obtained from two of the patients were normal, and electromyography performed in two confirmed that nerve conduction was normal. In one patient action potentials of decreased duration and amplitude suggested a myopathy.
Social and language development was also markedly delayed in these four patients. None of them had microcephaly, and magnetic resonance imaging (MRI) and computed tomographic studies showed no reduction in the size of the cortex or cerebellum. No structural abnormalities were seen, apart from small, nonspecific, generalized patches throughout the white matter in one patient (the proband in family ISPAD 43) on an MRI scan obtained when she was 14 years of age.
Epilepsy
Generalized seizures, either complex or myoclonic, were observed in three patients (the probands in families ISPAD 25, ISPAD 27, and ISPAD 43) beginning in the first year of life. The seizures responded to antiepileptic medication (vigabatrin in two patients and sodium valproate in one). The seizures preceded clinically recognized episodes of hypoglycemia. All electroencephalograms showed generalized abnormal activity with bilateral sharp waves. One patient had marked hypsarrhythmia, which responded to vigabatrin.
Dysmorphic Features
All three patients with epilepsy had mild dysmorphic features (see Supplementary Appendix 1, available with the full text of this article at www.nejm.org). Their appearance was characterized by a prominent metopic suture, a downturned mouth, and bilateral ptosis. All three patients had limb contractures, which were diagnosed at birth in two and at four years of age in one.
Physiological Studies
Both during fasting and after glucagon stimulation, the serum C-peptide concentration was generally less than 200 pmol per liter, despite marked hyperglycemia — a finding consistent with profound beta-cell dysfunction (Table 1). Serum C-peptide exceeded the lower limit of the normal range in only three patients (two insulin-treated children and the adult whose diabetes was well controlled with tolbutamide) (Table 1). Three patients, who had mutations affecting residue 201, had only minimal insulin secretion in response to intravenous glucose but did secrete insulin in response to tolbutamide (Figure 4Figure 4
Insulin Secretory Responses to Intravenous Glucose and to Tolbutamide.).Functional Analysis of the R201H Mutation
When wild-type Kir6.2 was coexpressed with SUR1 in X. laevis oocytes, KATP currents were almost undetectable because of inhibition by high intracellular ATP concentrations, but they could be activated by azide, which lowers cytosolic ATP concentrations (Figure 5AFigure 5
The Effects of Metabolic Inhibition, a Sulfonylurea, and Intracellular ATP on Currents in Wild-Type and Mutant ATP-Sensitive Potassium (KATP) Channels.). In contrast, significant resting currents were recorded from oocytes expressing Kir6.2-R201H–SUR1 (P<0.01 for the comparison with wild-type Kir6.2). These currents were further activated by azide (P<0.05 for the comparison with wild-type Kir6.2) and were blocked by tolbutamide, indicating that they flow through KATP channels (Figure 5B and Figure 5C). These data suggest that metabolism causes less blockade of Kir6.2-R201H–SUR1 channels than it does of wild-type KATP channels.To explore the mechanisms underlying these findings, we examined the nucleotide sensitivity of wild-type and mutant channels in inside-out patches (Figure 5D). Kir6.2-R201H–SUR1 channels were considerably less sensitive than wild-type channels to intracellular ATP; mutant channels were half maximally blocked at an ATP concentration of 262±33 μM, as compared with an ATP concentration of 7±1 μM for Kir6.2–SUR1 channels (P<0.001) (Figure 5E). However, mutant channels were activated by Mg-ADP to a similar extent. The single-channel conductance and the fraction of time the channel spends in the open state (the “open probability”) were normal.
To simulate the effect of heterozygosity, we injected oocytes with SUR1 and a 1:1 mixture of Kir6.2 and Kir6.2-R201H mRNA. The resting current of oocytes injected with the 1:1 mixture was slightly, but not significantly, greater (0.27±0.07 nA) than that of oocytes with the wild-type channel (0.13±0.05 nA) (P=0.12) (Figure 5C). The KATP currents of mutant channels were further activated by azide and blocked by tolbutamide, to an extent similar to that in the wild-type channel. The ATP sensitivity was also close to that of the wild-type channel, with an IC50 value of 7.6±0.4 μM (Figure 5E). However, the KATP currents of mutant channels were significantly larger than those of wild-type channels at ATP concentrations of 1 μM (P=0.002) and 3 μM (P=0.008), due to the difference in the Hill coefficient.
Discussion
Our findings show that heterozygous activating mutations in the gene encoding the Kir6.2 subunit of the KATP channel can cause both familial and sporadic neonatal diabetes. This genetic subtype may be a relatively common cause of permanent neonatal diabetes, since we found it in 34 percent of probands. Some patients with mutations in the gene encoding Kir6.2 have marked developmental delay, muscle weakness, and epilepsy, in addition to neonatal diabetes. These observations point to the critical role of KATP channels in pancreatic beta cells and suggest a role in human muscle and brain.
The evidence that these mutations are causal is very strong. They cosegregated with diabetes in the two families with vertical transmission, and the nonfamilial cases of diabetes were associated with spontaneous mutations (since the mutation was not present in the normoglycemic parents). Approximately 1 in 106 people is likely to have a spontaneous mutation in a gene of this size, so nine such mutations is highly unlikely to be a chance observation. The most common mutation (resulting in the R201H substitution) occurs within a CpG dinucleotide, a “hot spot” for mutations in mammalian genes. This probably explains the recurrent finding of the R201H mutation in unrelated families from different countries. Since the majority of the mutations are spontaneous, a family history of diabetes is frequently not present.
Diabetes was diagnosed at a mean age of seven weeks and within the first three months of life in 10 of the 13 patients. Although three patients presented with ketoacidosis, it is likely that at least some patients had minimal secretion of endogenous insulin, since in most patients the disease was not diagnosed immediately after birth, and some had detectable C-peptide concentrations. Patients with Kir6.2 mutations may show some overlap with type 1 diabetes in terms of clinical features, but none of our patients had beta-cell autoantibodies. The extent to which mutations in the gene encoding Kir6.2 account for antibody-negative type 1 diabetes requires investigation.
The severe intrauterine growth retardation found in the patients with Kir6.2 mutations is consistent with greatly reduced or absent insulin secretion in utero and is also seen in patients with glucokinase deficiency, loss of an imprinted region of chromosome 6q24 (which results in transient neonatal diabetes), and pancreatic agenesis.2,3,7,23 Marked postnatal catch-up growth is a feature of these conditions and was also observed in the patients with Kir6.2 mutations who did not have neurologic abnormalities.
Mutations in the gene encoding Kir6.2 probably cause decreased secretion of insulin from beta cells by conferring reduced sensitivity to ATP, which is predicted to result in gain of channel function. Functional analysis of the most common mutation, R201H, showed that the homozygous mutation led to markedly reduced sensitivity to ATP. When wild-type and mutant subunits were coexpressed to simulate the heterozygous state, the ATP sensitivity of the resulting mixed population of heteromeric channels was similar to that of the wild type, except at low ATP concentrations. However, we expect that there will be a small population of homomeric R210H channels with lower ATP sensitivity (about 6 percent of the channels if the number of mutant subunits in the tetrameric channel is binomially distributed). Indeed, such ATP-insensitive channels were observed at the single-channel level (data not shown). Although this current is difficult to measure at high ATP concentrations, it may be sufficient to keep the beta cell hyperpolarized even in the presence of glucose, thereby reducing electrical activity and insulin release. Our results indicate that very small changes in the resting KATP current, due to small changes in ATP sensitivity, can impair insulin secretion sufficiently to cause diabetes in humans. This finding is consistent with some24 but not all25 in vitro studies that suggest that a Kir6.2 polymorphism in which lysine replaces glutamic acid at position 23 (E23K) shows small changes in ATP sensitivity.
A molecular model of the C terminal of Kir6.226 predicts that R201 lies close to the phosphate tail of ATP and that it interacts with the alpha phosphate of ATP. The concept of a critical role for residue 201 in ATP binding is supported by the finding that the ATP sensitivity of KATP channels is reduced when the arginine at position 201 is mutated to histidine and other residues.27,28 Three mutations (Q52R, V59M, and V59G) are found in the slide helix; residue 52 lies at one end of the helix, and residue 59 lies midway along its length (Figure 3). The position of the slide helix implies a role in the regulation of channel gating,21 but it lies distant from the predicted ATP-binding site. Additional work is required to elucidate the mechanism by which the mutations that lie in the slide-helix domain effect disease.
Identification of mutations in the gene encoding the KATP-channel subunit Kir6.2 may have important implications for the treatment of affected patients. Our functional studies in vitro suggest that if the KATP channel could be closed by an ATP-independent mechanism (e.g., by sulfonylureas), insulin secretion might be restored. Patients with mutations affecting position 201 did have clear, but subnormal, insulin responses to intravenous tolbutamide. This observation suggests that the pathophysiological condition in humans mirrors the findings in vitro, raising the possibility of novel treatment strategies based on sulfonylureas (or other specific KATP-channel inhibitors) in these apparently insulin-dependent patients. Of note, one patient with an R201H mutation (the proband's father in family BR 1), who had always been treated with tolbutamide, had C-peptide levels in the normal range and good glycemic control. Further investigation is needed to determine whether the identification of a mutation in the gene encoding Kir6.2 will permit treatment to be given in the form of oral agents rather than subcutaneously injected insulin.
It is unlikely that the severe developmental delay, muscle weakness, and epilepsy seen in a subgroup of the patients with Kir6.2 mutations result from diabetes or its treatment. Severe developmental delay and persistent epilepsy are rare in children with neonatal diabetes2,3,6,7; moreover, in our study, neurologic diagnosis preceded clinically recognized episodes of hypoglycemia, and the contractures seen at birth in two of the patients suggest that neurologic dysfunction was present in utero. Kir6.2 is the pore-forming subunit of KATP channels in skeletal muscle and neurons throughout the brain29,30; hence, altered activity of these channels could cause developmental delay, muscle weakness, and epilepsy. Studies in animal models to assess skeletal muscle and the neurologic effects of gain-of-function mutations have not been performed; however, loss of function of the KATP channel can result in hypoxia-induced seizures,31 and overexpression of SUR1 in forebrain reduces the susceptibility to seizures.32 Analysis of additional patients will be necessary to determine whether Kir6.2 mutations give rise to a discrete syndrome characterized by developmental delay, epilepsy, and neonatal diabetes.
The position and type of the mutation may influence the phenotype. All eight patients with mutations at residue 201 had diabetes but no neurologic abnormalities. The V59M variant is associated both with isolated diabetes and with marked developmental delay in addition to diabetes. This kind of genetic behavior — one in which the same mutation is associated with different phenotypes in different families — has been observed with other genes, such as LMNA.33
That heterozygous mutations of Kir6.2 cause diabetes confirms that the KATP-channel–dependent pathway is critical for insulin secretion and that other, KATP-channel–independent pathways are unable to compensate for its loss. Mutations with a less severe functional effect or modification by the genetic background might lead to transient neonatal diabetes or to diabetes that becomes manifest after the neonatal period. Indeed, we and others have shown that the common Kir6.2 polymorphism E23K is associated with a slightly increased susceptibility to type 2 diabetes.24,34,35
In conclusion, activating mutations in the gene encoding the ATP-sensitive potassium-channel subunit Kir6.2 cause neonatal diabetes, and in some patients, neurologic abnormalities. The preliminary finding that tolbutamide partly compensates for the effect of the most common mutation on insulin secretion offers hope that in at least some cases the diabetes may be effectively treated with sulfonylurea tablets.
Supported in part by funds from the Wellcome Trust and Diabetes UK (to the Institute of Biomedical and Clinical Science, Peninsula Medical School, Exeter); by grants from the Royal Society, the Wellcome Trust, and the Medical Research Council (to the Laboratory of Physiology, Oxford University, Oxford); by a grant from the Dutch Growth Foundation (to Dr. Slingerland); and by grants from the University of Bergen and Haukeland University Hospital (to the Institute for Clinical Medicine and Molecular Medicine, University of Bergen, Bergen). Dr. Hattersley is a Wellcome Trust Clinical Research Leave Fellow, Dr. Pearson is a Wellcome Trust Clinical Research Fellow, and Dr. Ashcroft is the Royal Society GlaxoSmithKline Research Professor.
Dr. Pearson, Ms. Antcliff, and Dr. Proks contributed equally to the article.
We are indebted to the International Society for Pediatric and Adolescent Diabetes, which set up the ISPAD Rare Diabetes registry; to the Child Health and Well-Being Fund, Rotterdam, the Netherlands, which funded its establishment; to Peter Turnpenny and Julia Rankin for their advice; and to the Royal Devon and Exeter National Health Service Health Care Trust for their continued support.
Source Information
From the Institute of Biomedical and Clinical Science, Peninsula Medical School, Exeter, United Kingdom (A.L.G., E.R.P., E.L.E., T.M.F., S.E., A.T.H.); the University Laboratory of Physiology, Oxford University, Oxford, United Kingdom (J.F.A., P.P., F.M.A.); Sophia Children's Hospital, Rotterdam, the Netherlands, (G.J.B., A.S.S.); the Institute of Endocrinology and Diabetes, Children's Hospital at Westmead, Westmead, Australia (N.H., S.S.); Piaui State University Medical School, Teresina, Piaui, Brazil (J.M.C.L.S.); the Institute for Clinical Medicine and Molecular Medicine, University of Bergen, Bergen, Norway (J.M., P.R.N.); Wessex Clinical Genetics Service and the Division of Human Genetics, Southampton University and Hospitals, National Health Service Trust, Southampton, United Kingdom (I.K.T.); Wessex Regional Genetics Laboratories, Salisbury District Hospital, Salisbury, United Kingdom (D.M.); Royal Hospital for Children, Bristol, United Kingdom (J.P.H.S.); Second Department of Pediatrics and Second Faculty of Medicine, Charles University, Prague, Czech Republic (Z.S.); Meander Medical Center, Amersfoort, the Netherlands (A.R.); Academic Unit of Child Health, Sheffield Children's Hospital, Sheffield, United Kingdom (J.K.H.W.); Regional Endocrine Laboratory, Birmingham, United Kingdom (P.C.); St. Luke's Hospital, Bradford, United Kingdom (S.G.); and the Division of Pediatric Endocrinology and Diabetes, Hackensack University Medical Center, Hackensack, N.J. (J.A.).
Address reprint requests to Dr. Hattersley at Diabetes and Vascular Medicine, Institute of Biomedical and Clinical Science, Peninsula Medical School, Barrack Rd., Exeter EX2 5AX, United Kingdom, or at a.t.hattersley@ex.ac.uk.
- References
References
1
Shield JP . Neonatal diabetes: new insights into aetiology and implications. Horm Res 2000;53:Suppl 1:7-11
CrossRef | Web of Science | Medline2
Temple IK ,Gardner RJ ,Mackay DJ ,Barber JC ,Robinson DO ,Shield JP . Transient neonatal diabetes: widening the understanding of the etiopathogenesis of diabetes. Diabetes 2000;49:1359-1366
CrossRef | Web of Science | Medline3
Njolstad PR ,Sovik O ,Cuesta-Munoz A , et al. Neonatal diabetes mellitus due to complete glucokinase deficiency. N Engl J Med 2001;344:1588-1592
Full Text | Web of Science | Medline4
Gloyn AL ,Ellard S ,Shield JP , et al. Complete glucokinase deficiency is not a common cause of permanent neonatal diabetes. Diabetologia 2002;45:290-290
CrossRef | Web of Science | Medline5
Vaxillaire M ,Samson C ,Cave H ,Metz C ,Froguel P ,Polak M . Glucokinase gene mutations are not a common cause of permanent neonatal diabetes in France. Diabetologia 2002;45:454-455
CrossRef | Web of Science | Medline6
Njolstad PR ,Sagen JV ,Bjorkhaug L , et al. Permanent neonatal diabetes caused by glucokinase deficiency: inborn error of glucose-insulin signaling pathway. Diabetes 2003;52:2854-2860
CrossRef | Web of Science | Medline7
Stoffers DA ,Zinkin NT ,Stanojevic V ,Clarke WL ,Habener JF . Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nat Genet 1997;15:106-110
CrossRef | Web of Science | Medline8
Delepine M ,Nicolino M ,Barrett T ,Golamaully M ,Lathrop GM ,Julier C . EIF2AK3, encoding translation initiation factor 2-alpha kinase 3, is mutated in patients with Wolcott-Rallison syndrome. Nat Genet 2000;25:406-409
CrossRef | Web of Science | Medline9
Wildin RS ,Ramsdell F ,Peake J , et al. X-linked neonatal diabetes mellitus, enteropathy and endocrinopathy syndrome is the human equivalent of mouse scurfy. Nat Genet 2001;27:18-20
CrossRef | Web of Science | Medline10
Gribble FM ,Reimann F . Sulphonylurea action revisited: the post-cloning era. Diabetologia 2003;46:875-891
CrossRef | Web of Science | Medline11
Clement JP IV ,Kunjilwar K ,Gonzalez G , et al. Association and stoichiometry of K(ATP) channel subunits. Neuron 1997;18:827-838
CrossRef | Web of Science | Medline12
Thomas PM ,Ye Y ,Lightner E . Mutation of the pancreatic islet inward rectifier, Kir6.2 also leads to familial persistent hyperinsulinemic hypoglycemia of infancy. Hum Mol Genet 1996;5:1809-1812
CrossRef | Web of Science | Medline13
Glaser B ,Kesavan P ,Heyman M , et al. Familial hyperinsulinism caused by an activating glucokinase mutation. N Engl J Med 1998;338:226-230
Full Text | Web of Science | Medline14
Nichols CG ,Koster JC . Diabetes and insulin secretion: whither KATP? Am J Physiol Endocrinol Metab 2002;283:E403-E412
Web of Science | Medline15
Koster JC ,Marshall BA ,Ensor N ,Corbett JA ,Nichols CG . Targeted overactivity of beta cell K(ATP) channels induces profound neonatal diabetes. Cell 2000;100:645-654
CrossRef | Web of Science | Medline16
Frayling TM ,Lindgren CM ,Chevre JC , et al. A genome-wide scan in families with maturity-onset diabetes of the young: evidence for further genetic heterogeneity. Diabetes 2003;52:872-881
CrossRef | Web of Science | Medline17
Inoue H ,Ferrer J ,Warren-Perry M , et al. Sequence variants in the pancreatic islet beta-cell inwardly rectifying K+ channel Kir6.2 (Bir) gene: identification and lack of role in Caucasian patients with NIDDM. Diabetes 1997;46:502-507
CrossRef | Web of Science | Medline18
Pearson ER ,Starkey BJ ,Powell RJ ,Gribble FM ,Clark PM ,Hattersley AT . Genetic cause of hyperglycaemia determines response to treatment in diabetes. Lancet 2003;362:1275-1281
CrossRef | Web of Science | Medline19
Gribble FM ,Ashfield R ,Ammala C ,Ashcroft FM . Properties of cloned ATP-sensitive K+ currents expressed in Xenopus oocytes. J Physiol 1997;498:87-98
Web of Science | Medline20
Trapp S ,Proks P ,Tucker SJ ,Ashcroft FM . Molecular analysis of ATP-sensitive K channel gating and implications for channel inhibition by ATP. J Gen Physiol 1998;112:333-349
CrossRef | Web of Science | Medline21
Kuo A ,Gulbis JM ,Antcliff JF , et al. Crystal structure of the potassium channel KirBac1.1 in the closed state. Science 2003;300:1922-1926
CrossRef | Web of Science | Medline22
Freeman JV ,Cole TJ ,Chinn S ,Jones PR ,White EM ,Preece MA . Cross sectional stature and weight reference curves for the UK, 1990. Arch Dis Child 1995;73:17-24
CrossRef | Web of Science | Medline23
Hattersley AT ,Beards F ,Ballantyne E ,Appleton M ,Harvey R ,Ellard S . Mutations in the glucokinase gene of the fetus result in reduced birth weight. Nat Genet 1998;19:268-270
CrossRef | Web of Science | Medline24
Schwanstecher C ,Meyer U ,Schwanstecher M . K(IR)6.2 polymorphism predisposes to type 2 diabetes by inducing overactivity of pancreatic beta-cell ATP-sensitive K(+) channels. Diabetes 2002;51:875-879
CrossRef | Web of Science | Medline25
Riedel MJ ,Boora P ,Steckley D ,de Vries G ,Light PE . Kir6.2 polymorphisms sensitize beta-cell ATP-sensitive potassium channels to activation by acyl CoAs: a possible cellular mechanism for increased susceptibility to type 2 diabetes? Diabetes 2003;52:2630-2635
CrossRef | Web of Science | Medline26
Trapp S ,Haider S ,Jones P ,Sansom MS ,Ashcroft FM . Identification of residues contributing to the ATP binding site of Kir6.2. EMBO J 2003;22:2903-2912
CrossRef | Web of Science | Medline27
Ribalet B ,John SA ,Weiss JN . Molecular basis for Kir6.2 channel inhibition by adenine nucleotides. Biophys J 2003;84:266-276
CrossRef | Web of Science | Medline28
Shyng SL ,Cukras CA ,Harwood J ,Nichols CG . Structural determinants of PIP(2) regulation of inward rectifier K(ATP) channels. J Gen Physiol 2000;116:599-608
CrossRef | Web of Science | Medline29
Karschin C ,Ecke C ,Ashcroft FM ,Karschin A . Overlapping distribution of K(ATP) channel-forming Kir6.2 subunit and the sulfonylurea receptor SUR1 in rodent brain. FEBS Lett 1997;401:59-64
CrossRef | Web of Science | Medline30
Inagaki N ,Gonoi T ,Clement JP IV , et al. Reconstitution of IKATP: an inward rectifier subunit plus the sulfonylurea receptor. Science 1995;270:1166-1170
CrossRef | Web of Science | Medline31
Yamada K ,Ji JJ ,Yuan H , et al. Protective role of ATP-sensitive potassium channels in hypoxia-induced generalized seizure. Science 2001;292:1543-1546
CrossRef | Web of Science | Medline32
Hernandez-Sanchez C ,Basile AS ,Fedorova I , et al. Mice transgenically overexpressing sulfonylurea receptor 1 in forebrain resist seizure induction and excitotoxic neuron death. Proc Natl Acad Sci U S A 2001;98:3549-3554
CrossRef | Web of Science | Medline33
Novelli G ,D'Apice MR . The strange case of the “lumper“ lamin A/C gene and human premature ageing. Trends Mol Med 2003;9:370-375
CrossRef | Web of Science | Medline34
Gloyn AL ,Weedon MN ,Owen KR , et al. Large-scale association studies of variants in genes encoding the pancreatic beta-cell KATP channel subunits Kir6.2 (KCNJ11) and SUR1 (ABCC8) confirm that the KCNJ11 E23K variant is associated with type 2 diabetes. Diabetes 2003;52:568-572
CrossRef | Web of Science | Medline35
Nielsen EM ,Hansen L ,Carstensen B , et al. The E23K variant of Kir6.2 associates with impaired post-OGTT serum insulin response and increased risk of type 2 diabetes. Diabetes 2003;52:573-577
CrossRef | Web of Science | Medline
- Citing Articles (229)
Citing Articles
1
J. Lau, J. Svensson, L. Grapensparr, Å. Johansson, P.-O. Carlsson. (2012) Superior beta cell proliferation, function and gene expression in a subpopulation of rat islets identified by high blood perfusion. Diabetologia
CrossRef2
R. Clark, R. Männikkö, D. J. Stuckey, M. Iberl, K. Clarke, F. M. Ashcroft. (2012) Mice expressing a human KATP channel mutation have altered channel ATP sensitivity but no cardiac abnormalities. Diabetologia
CrossRef3
Siri Atma W. Greeley, Rochelle N. Naylor, Louis H. Philipson, Graeme I. Bell. (2011) Neonatal Diabetes: An Expanding List of Genes Allows for Improved Diagnosis and Treatment. Current Diabetes Reports 11:6, 519-532
CrossRef4
Veronica Lang, Nermeen Youssef, Peter E. Light. (2011) The Molecular Genetics of Sulfonylurea Receptors in the Pathogenesis and Treatment of Insulin Secretory Disorders and Type 2 Diabetes. Current Diabetes Reports 11:6, 543-551
CrossRef5
Ingfrid S. Haldorsen, Helge Ræder, Mette Vesterhus, Anders Molven, Pål R. Njølstad. (2011) The role of pancreatic imaging in monogenic diabetes mellitus. Nature Reviews Endocrinology
CrossRef6
Beate Karges, Thomas Meissner, Andrea Icks, Thomas Kapellen, Reinhard W. Holl. (2011) Management of diabetes mellitus in infants. Nature Reviews Endocrinology
CrossRef7
Abdelhadi M Habeb, Mohamed SF Al-Magamsi, Ihsan M Eid, Mohamed I Ali, Andrew T Hattersley, Khalid Hussain, Sian Ellard. (2011) Incidence, genetics, and clinical phenotype of permanent neonatal diabetes mellitus in northwest Saudi Arabia. Pediatric Diabetesno-no
CrossRef8
Rajesh Joshi, Ankur Phatarpekar. (2011) Neonatal diabetes mellitus due to L233F mutation in the KCNJ11 gene. World Journal of Pediatrics 7:4, 371-372
CrossRef9
Andrey P. Babenko, Martine Vaxillaire. (2011) Mechanism of KATP hyperactivity and sulfonylurea tolerance due to a diabetogenic mutation in L0 helix of sulfonylurea receptor 1 (ABCC8). FEBS Letters 585:22, 3555-3559
CrossRef10
Jerod Scott Denton, David Aaron Jacobson. (2011) Channeling dysglycemia: ion-channel variations perturbing glucose homeostasis. Trends in Endocrinology & Metabolism
CrossRef11
P. Bowman, S. E. Flanagan, E. L. Edghill, A. Damhuis, M. H. Shepherd, R. Paisey, A. T. Hattersley, S. Ellard. (2011) Heterozygous ABCC8 mutations are a cause of MODY. Diabetologia
CrossRef12
Oscar Rubio-Cabezas, Sarah E Flanagan, Annet Damhuis, Andrew T Hattersley, Sian Ellard. (2011) KATP channel mutations in infants with permanent diabetes diagnosed after 6 months of life. Pediatric Diabetesno-no
CrossRef13
Yanmei Sang, Guichen Ni, Yi Gu, Min Liu. (2011) A V59M KCNJ11 gene mutation leading to intermediate DEND syndrome in a Chinese child. Journal of Pediatric Endocrinology and Metabolism 24:9-10, 763-766
CrossRef14
Gábor Winkler, László Gerő. (2011) Az inzulinszekretagóg antidiabetikumok farmakogenetikai vonatkozásai. Orvosi Hetilap 152:41, 1651-1660
CrossRef15
Angela W.S. Lee, Roger D. Cox. (2011) Use of mouse models in studying type 2 diabetes mellitus. Expert Reviews in Molecular Medicine 13,
CrossRef16
, D. Iafusco, O. Massa, B. Pasquino, C. Colombo, L. Iughetti, C. Bizzarri, C. Mammì, D. Lo Presti, T. Suprani, R. Schiaffini, Colin G. Nichols, L. Russo, V. Grasso, F. Meschi, R. Bonfanti, S. Brescianini, F. Barbetti. (2011) Minimal incidence of neonatal/infancy onset diabetes in Italy is 1:90,000 live births. Acta Diabetologica
CrossRef17
L. W. Harries. (2011) Messenger RNA processing and its role in diabetes. Diabetic Medicine 28:9, 1010-1017
CrossRef18
Marianna Rachmiel, Oscar Rubio-Cabezas, Sian Ellard, Andrew T Hattersley, Kusiel Perlman. (2011) Early-onset, severe lipoatrophy in a patient with permanent neonatal diabetes mellitus secondary to a recessive mutation in the INS gene. Pediatric Diabetesno-no
CrossRef19
S. Suzuki, M. Koga, S. Amamiya, A. Nakao, K. Wada, K. Okuhara, S. Hayano, A. R. Sarhat, H. Takahashi, K. Matsuo, Y. Tanahashi, K. Fujieda. (2011) Glycated albumin but not HbA1c reflects glycaemic control in patients with neonatal diabetes mellitus. Diabetologia 54:9, 2247-2253
CrossRef20
Andrea K. Steck, Wiliam E. Winter. (2011) Review on monogenic diabetes. Current Opinion in Endocrinology, Diabetes and Obesity 18:4, 252-258
CrossRef21
Thomas Hansen, Andrés Ingason, Srdjan Djurovic, Ingrid Melle, Mogens Fenger, Omar Gustafsson, Klaus D. Jakobsen, Henrik B. Rasmussen, Sarah Tosato, Marcella Rietschel, Josef Frank, Mike Owen, Chiara Bonetto, Jaana Suvisaari, Johan Hilge Thygesen, Hannes Pétursson, Jouko Lönnqvist, Engilbert Sigurdsson, Ina Giegling, Nick Craddock, Michael C. O'Donovan, Mirella Ruggeri, Sven Cichon, Roel A. Ophoff, Olli Pietiläinen, Leena Peltonen, Markus M. Nöthen, Dan Rujescu, David St. Clair, David A. Collier, Ole A. Andreassen, Thomas Werge. (2011) At-Risk Variant in TCF7L2 for Type II Diabetes Increases Risk of Schizophrenia. Biological Psychiatry 70:1, 59-63
CrossRef22
, L. Russo, D. Iafusco, S. Brescianini, V. Nocerino, C. Bizzarri, S. Toni, F. Cerutti, C. Monciotti, R. Pesavento, L. Iughetti, L. Bernardini, R. Bonfanti, L. Gargantini, M. Vanelli, L. Aguilar-Bryan, M. A. Stazi, V. Grasso, C. Colombo, F. Barbetti. (2011) Permanent diabetes during the first year of life: multiple gene screening in 54 patients. Diabetologia 54:7, 1693-1701
CrossRef23
Mary E. Travers, Mark I. McCarthy. (2011) Type 2 diabetes and obesity: genomics and the clinic. Human Genetics 130:1, 41-58
CrossRef24
Yi Quan, Andrew Barszczyk, Zhong-ping Feng, Hong-shuo Sun. (2011) Current understanding of KATP channels in neonatal diseases: focus on insulin secretion disorders. Acta Pharmacologica Sinica 32:6, 765-780
CrossRef25
Rochelle N Naylor, Siri Atma W Greeley, Graeme I Bell, Louis H Philipson. (2011) Genetics and pathophysiology of neonatal diabetes mellitus. Journal of Diabetes Investigation 2:3, 158-169
CrossRef26
Lijuan Yang, Xianghai Zhou, Yingying Luo, Xiuqin Sun, Yong Tang, Wulan Guo, Xueyao Han, Linong Ji. (2011) Association between KCNJ11 gene polymorphisms and risk of type 2 diabetes mellitus in East Asian populations: a meta-analysis in 42,573 individuals. Molecular Biology Reports
CrossRef27
R. K. P. Benninger, M. S. Remedi, W. S. Head, A. Ustione, D. W. Piston, C. G. Nichols. (2011) Defects in beta cell Ca2+ signalling, glucose metabolism and insulin secretion in a murine model of KATP channel-induced neonatal diabetes mellitus. Diabetologia 54:5, 1087-1097
CrossRef28
Kate Bennett, Chela James, Angham Mutair, Hala Al-Shaikh, Aisha Sinani, Khalid Hussain. (2011) Four novel cases of permanent neonatal diabetes mellitus caused by homozygous mutations in the glucokinase gene. Pediatric Diabetes 12:3pt1, 192-196
CrossRef29
Oddmund Søvik, Øystein Aagenaes, Stig Å Eide, Deborah Mackay, Isabel K Temple, Anders Molven, Pål R Njølstad. (2011) Familial occurrence of neonatal diabetes with duplications in chromosome 6q24: treatment with sulfonylurea and 40-yr follow-up. Pediatric Diabetesno-no
CrossRef30
Oscar Rubio-Cabezas, Tomasz Klupa, Maciej T. Malecki, . (2011) Permanent neonatal diabetes mellitus - the importance of diabetes differential diagnosis in neonates and infants. European Journal of Clinical Investigation 41:3, 323-333
CrossRef31
Yiannis S. Ioannou, Sian Ellard, Andrew Hattersley, Nicos Skordis. (2011) KCNJ11 activating mutations cause both transient and permanent neonatal diabetes mellitus in Cypriot patients. Pediatric Diabetes 12:2, 133-137
CrossRef32
Esther J. Pearl, Zeina Jarikji, Marko E. Horb. (2011) Functional analysis of Rfx6 and mutant variants associated with neonatal diabetes. Developmental Biology 351:1, 135-145
CrossRef33
M Borowiec, K Antosik, W Fendler, G Deja, P Jarosz-Chobot, M Mysliwiec, A Zmyslowska, M Malecki, A Szadkowska, W Mlynarski. (2011) Novel glucokinase mutations in patients with monogenic diabetes - clinical outline of GCK-MD and potential for founder effect in Slavic population. Clinical Geneticsno-no
CrossRef34
N. Zwaveling-Soonawala, E. E. Hagebeuk, A. S. Slingerland, C. Ris-Stalpers, T. Vulsma, A. S. Trotsenburg. (2011) Successful transfer to sulfonylurea therapy in an infant with developmental delay, epilepsy and neonatal diabetes (DEND) syndrome and a novel ABCC8 gene mutation. Diabetologia 54:2, 469-471
CrossRef35
M. I. McCarthy. (2011) Dorothy Hodgkin Lecture 2010^. From hype to hope? A journey through the genetics of Type 2 diabetes. Diabetic Medicine 28:2, 132-140
CrossRef36
Wafa Qubbaj, Abdulrahman Al-Swaid, Saad Al-Hassan, Khalid Awartani, Hesham Deek, Serdar Coskun. (2011) First successful application of preimplantation genetic diagnosis and haplotyping for congenital hyperinsulinism. Reproductive BioMedicine Online 22:1, 72-79
CrossRef37
Jung Hyun Kong, June Bum Kim. (2011) Transient neonatal diabetes mellitus caused by a de novo ABCC8 gene mutation. Korean Journal of Pediatrics 54:4, 179
CrossRef38
Richard M Watanabe. (2011) Inherited destiny? Genetics and gestational diabetes mellitus. Genome Medicine 3:3, 18
CrossRef39
Kyong Soo Park. (2011) Sulwon Lecture 2009: The Search for Genetic Risk Factors of Type 2 Diabetes Mellitus. Diabetes & Metabolism Journal 35:1, 12
CrossRef40
Miloš M. Ješić, Maja D. Ješić, Svjetlana Maglajlić, Silvija Sajić, Svetislav Necić. (2011) Successful sulfonylurea treatment of a neonate with neonatal diabetes mellitus due to a new KCNJ11 mutation. Diabetes Research and Clinical Practice 91:1, e1-e3
CrossRef41
Y. Wang, X.O. Zhou, Y. Zhang, P.J. Gao, D.L. Zhu. (2011) Association of KCNJ11 with impaired glucose regulation in essential hypertension. Genetics and Molecular Research 10:2, 1111-1119
CrossRef42
N. Bouhours-Nouet, R. Coutant. (2011) Aspectos clínicos y diagnósticos de la diabetes infantil. EMC - Pediatría 46:4, 1-20
CrossRef43
Ryosuke Sato, Hiroshi Watanabe, Rieko Genma, Masahiro Takeuchi, Masato Maekawa, Hirotoshi Nakamura. (2010) ABCC8 polymorphism (Ser1369Ala): influence on severe hypoglycemia due to sulfonylureas. Pharmacogenomics 11:12, 1743-1750
CrossRef44
S. Bens, R. Siebert, A. Caliebe. (2010) Transienter neonataler Diabetes und Hypomethylierungssyndrome. medizinische genetik 22:4, 411-418
CrossRef45
Geoffrey A. Walford, Jose C. Florez. (2010) Type 2 Diabetes and Genetics, 2010: Translating Knowledge into Understanding. Current Cardiovascular Risk Reports 4:6, 437-445
CrossRef46
Yutaka Seino, Kishio Nanjo, Naoko Tajima, Takashi Kadowaki, Atsunori Kashiwagi, Eiichi Araki, Chikako Ito, Nobuya Inagaki, Yasuhiko Iwamoto, Masato Kasuga, Toshiaki Hanafusa, Masakazu Haneda, Kohjiro Ueki. (2010) Report of the Committee on the classification and diagnostic criteria of diabetes mellitus. Diabetology International 1:1, 2-20
CrossRef47
, Yutaka Seino, Kishio Nanjo, Naoko Tajima, Takashi Kadowaki, Atsunori Kashiwagi, Eiichi Araki, Chikako Ito, Nobuya Inagaki, Yasuhiko Iwamoto, Masato Kasuga, Toshiaki Hanafusa, Masakazu Haneda, Kohjiro Ueki. (2010) Report of the Committee on the Classification and Diagnostic Criteria of Diabetes Mellitus. Journal of Diabetes Investigation 1:5, 212-228
CrossRef48
Amélie Bonnefond, Philippe Froguel, Martine Vaxillaire. (2010) The emerging genetics of type 2 diabetes. Trends in Molecular Medicine 16:9, 407-416
CrossRef49
Kate Bennett, Chela James, Khalid Hussain. (2010) Pancreatic β-cell KATP channels: Hypoglycaemia and hyperglycaemia. Reviews in Endocrine and Metabolic Disorders 11:3, 157-163
CrossRef50
Emma L. Edghill, Sarah E. Flanagan, Sian Ellard. (2010) Permanent neonatal diabetes due to activating mutations in ABCC8 and KCNJ11. Reviews in Endocrine and Metabolic Disorders 11:3, 193-198
CrossRef51
Julie Støy, Donald F. Steiner, Soo-Young Park, Honggang Ye, Louis H. Philipson, Graeme I. Bell. (2010) Clinical and molecular genetics of neonatal diabetes due to mutations in the insulin gene. Reviews in Endocrine and Metabolic Disorders 11:3, 205-215
CrossRef52
Siri Atma W. Greeley, Susan E. Tucker, Rochelle N. Naylor, Graeme I. Bell, Louis H. Philipson. (2010) Neonatal diabetes mellitus: A model for personalized medicine. Trends in Endocrinology & Metabolism 21:8, 464-472
CrossRef53
Sarah E. Flanagan, Ann-Marie Patch, Sian Ellard. (2010) Using SIFT and PolyPhen to Predict Loss-of-Function and Gain-of-Function Mutations. Genetic Testing and Molecular Biomarkers 14:4, 533-537
CrossRef54
Zofia K.Z. Gajdos, Katherine D. Henderson, Joel N. Hirschhorn, Mark R. Palmert. (2010) Genetic determinants of pubertal timing in the general population. Molecular and Cellular Endocrinology 324:1-2, 21-29
CrossRef55
Angus Jones, Andrew T. Hattersley. 2010. Monogenic Causes of Diabetes. , 243-264.
CrossRef56
Timothy M. Olson, Andre Terzic. (2010) Human KATP channelopathies: diseases of metabolic homeostasis. Pflügers Archiv - European Journal of Physiology 460:2, 295-306
CrossRef57
Maria S. Remedi, Joseph C. Koster. (2010) KATP channelopathies in the pancreas. Pflügers Archiv - European Journal of Physiology 460:2, 307-320
CrossRef58
M. Shepherd. (2010) Stopping insulin injections following genetic testing in diabetes: impact on identity. Diabetic Medicine 27:7, 838-843
CrossRef59
Jennifer A Wambach, Bess A Marshall, Joseph C Koster, Neil H White, Colin G Nichols. (2010) Successful sulfonylurea treatment of an insulin-naïve neonate with diabetes mellitus due to a KCNJ11 mutation. Pediatric Diabetes 11:4, 286-288
CrossRef60
P. Pun, R. Clark, K.-W. Wan, R. Peverini, T. A. Merritt. (2010) Neonatal Diabetes Mellitus: The Impact of Molecular Diagnosis. NeoReviews 11:6, e306-e310
CrossRef61
Dimitri M. Kullmann. (2010) Neurological Channelopathies. Annual Review of Neuroscience 33:1, 151-172
CrossRef62
Angus G. Jones, Andrew T. Hattersley. (2010) Reevaluation of a case of type 1 diabetes mellitus diagnosed before 6 months of age. Nature Reviews Endocrinology 6:6, 347-351
CrossRef63
Tomasz Klupa, Jan Skupien, Barbara Mirkiewicz-Sieradzka, Agnieszka Gach, Anna Noczynska, Agnieszka Zubkiewicz-Kucharska, Mieczyslaw Szalecki, Elzbieta Kozek, Joanna Nazim, Wojciech Mlynarski, Maciej T. Malecki. (2010) Efficacy and Safety of Sulfonylurea Use in Permanent Neonatal Diabetes Due to KCNJ11 Gene Mutations: 34-Month Median Follow-Up. Diabetes Technology & Therapeutics 12:5, 387-391
CrossRef64
Ali Mohamadi, Loretta M Clark, Paul H Lipkin, E Mark Mahone, Ericka L Wodka, Leslie P Plotnick. (2010) Medical and developmental impact of transition from subcutaneous insulin to oral glyburide in a 15-yr-old boy with neonatal diabetes mellitus and intermediate DEND syndrome: extending the age of KCNJ11 mutation testing in neonatal DM. Pediatric Diabetes 11:3, 203-207
CrossRef65
V. V. Khadilkar, A. V. Khadilkar, R. R. Kapoor, K. Hussain, A. T. Hattersley, S. Ellard. (2010) KCNJ11 activating mutation in an Indian family with remitting and relapsing diabetes. The Indian Journal of Pediatrics 77:5, 551-554
CrossRef66
Kai Wang, Samuel P. Dickson, Catherine A. Stolle, Ian D. Krantz, David B. Goldstein, Hakon Hakonarson. (2010) Interpretation of Association Signals and Identification of Causal Variants from Genome-wide Association Studies. The American Journal of Human Genetics 86:5, 730-742
CrossRef67
Kristen D. McKnight, Pei Wang, Seung K. Kim. (2010) Deconstructing Pancreas Development to Reconstruct Human Islets from Pluripotent Stem Cells. Cell Stem Cell 6:4, 300-308
CrossRef68
B. M. Shields, R. M. Freathy, A. T. Hattersley. (2010) Genetic influences on the association between fetal growth and susceptibility to type 2 diabetes. Journal of Developmental Origins of Health and Disease 1:02, 96
CrossRef69
R. Mannikko, C. Jefferies, S. E. Flanagan, A. Hattersley, S. Ellard, F. M. Ashcroft. (2010) Interaction between mutations in the slide helix of Kir6.2 associated with neonatal diabetes and neurological symptoms. Human Molecular Genetics 19:6, 963-972
CrossRef70
Kathryn Beardsall, Carlo Acerini, David B Dunger. (2010) Physiological and clinical role of insulin in the neonate. Expert Review of Endocrinology & Metabolism 5:2, 197-207
CrossRef71
Richard W Grant, Deborah J Wexler. (2010) Loss-of-function CYP2C9 variants: finding the correct clinical role for Type 2 diabetes pharmacogenetic testing. Expert Review of Cardiovascular Therapy 8:3, 339-343
CrossRef72
I. Garin, E. L. Edghill, I. Akerman, O. Rubio-Cabezas, I. Rica, J. M. Locke, M. A. Maestro, A. Alshaikh, R. Bundak, G. del Castillo, A. Deeb, D. Deiss, J. M. Fernandez, K. Godbole, K. Hussain, M. O'Connell, T. Klupa, S. Kolouskova, F. Mohsin, K. Perlman, Z. Sumnik, J. M. Rial, E. Ugarte, T. Vasanthi, , K. Johnstone, S. E. Flanagan, R. Martinez, C. Castano, A.-M. Patch, E. Fernandez-Rebollo, K. Raile, N. Morgan, L. W. Harries, L. Castano, S. Ellard, J. Ferrer, G. P. de Nanclares, A. T. Hattersley. (2010) Recessive mutations in the INS gene result in neonatal diabetes through reduced insulin biosynthesis. Proceedings of the National Academy of Sciences 107:7, 3105-3110
CrossRef73
M. Balasubramanian, J.P.H. Shield, C.L. Acerini, J. Walker, S. Ellard, M. Marchand, M. Polak, M. Vaxillaire, J.A. Crolla, D.J. Bunyan, D.J.G. Mackay, I.K. Temple. (2010) Pancreatic hypoplasia presenting with neonatal diabetes mellitus in association with congenital heart defect and developmental delay. American Journal of Medical Genetics Part A 152A:2, 340-346
CrossRef74
Barbara Wiedemann, Edith Schober, Thomas Waldhoer, Julia Koehle, Sarah E Flanagan, Deborah JG Mackay, Elisabeth Steichen, Dagmar Meraner, Lothar-Bernd Zimmerhackl, Andrew T Hattersley, Sian Ellard, Sabine Hofer. (2010) Incidence of neonatal diabetes in Austria-calculation based on the Austrian Diabetes Register. Pediatric Diabetes 11:1, 18-23
CrossRef75
Lene Bjerke Laborie, Deborah J. G. Mackay, I. Karen Temple, Anders Molven, Oddmund Søvik, Pål Rasmus Njølstad. (2010) DNA hypomethylation, transient neonatal diabetes, and prune belly sequence in one of two identical twins. European Journal of Pediatrics 169:2, 207-213
CrossRef76
K. Shimomura, G. P. de Nanclares, C. Foutinou, M. Caimari, L. Castaño, F. M. Ashcroft. (2010) The first clinical case of a mutation at residue K185 of Kir6.2 (KCNJ11): a major ATP-binding residue. Diabetic Medicine 27:2, 225-229
CrossRef77
N Maneka G De Silva, Timothy M Frayling. (2010) Novel biological insights emerging from genetic studies of type 2 diabetes and related metabolic traits. Current Opinion in Lipidology 21:1, 44-50
CrossRef78
Koji Okamoto, Naoko Iwasaki, Chisa Nishimura, Kent Doi, Eisei Noiri, Shinko Nakamura, Miho Takizawa, Makiko Ogata, Risa Fujimaki, Niels Grarup, Charlotta Pisinger, Knut Borch-Johnsen, Torsten Lauritzen, Annelli Sandbaek, Torben Hansen, Kazuki Yasuda, Haruhiko Osawa, Kishio Nanjo, Takashi Kadowaki, Masato Kasuga, Oluf Pedersen, Toshiro Fujita, Naoyuki Kamatani, Yasuhiko Iwamoto, Katsushi Tokunaga. (2010) Identification of KCNJ15 as a Susceptibility Gene in Asian Patients with Type 2 Diabetes Mellitus. The American Journal of Human Genetics 86:1, 54-64
CrossRef79
Louis H. Philipson, Rinki Murphy, Sian Ellard, Andrew T. Hattersley, Julie Støy, Siri A. Greeley, Graeme I. Bell, Kenneth S. Polonsky. 2010. Genetic Testing in Diabetes MellitusA Clinical Guide to Monogenic Diabetes. , 17-25.
CrossRef80
Maria Sara Remedi, Colin G. Nichols. (2009) Hyperinsulinism and Diabetes: Genetic Dissection of β Cell Metabolism-Excitation Coupling in Mice. Cell Metabolism 10:6, 442-453
CrossRef81
Mustafa Abdo Saif Dehwah, Zhang Shuang, Wang Zhen Hua, Wang Min, Qing-Yang Huang. (2009) Type 2 Diabetes: Genetic Advance and Aetiology. Journal of Applied Sciences 9:19, 3407-3423
CrossRef82
Stephen O’Rahilly. (2009) Human genetics illuminates the paths to metabolic disease. Nature 462:7271, 307-314
CrossRef83
L. Groop, V. Lyssenko. (2009) Genetic basis of β-cell dysfunction in man. Diabetes, Obesity and Metabolism 11, 149-158
CrossRef84
Inas H Thomas, Natinder K Saini, Amita Adhikari, Joyce M Lee, Josephine Z Kasa-vubu, Delia M Vazquez, Ram K Menon, Ming Chen, Stefan S Fajans. (2009) Neonatal diabetes mellitus with pancreatic agenesis in an infant with homozygous IPF-1 Pro63fsX60 mutation. Pediatric Diabetes 10:7, 492-496
CrossRef85
A. L. Gloyn. (2009) RD Lawrence Lecture 2009 Old genes, new tricks: learning about blood glucose regulation from naturally occurring genetic variation in humans. Diabetic Medicine 26:11, 1083-1089
CrossRef86
Daniela Seick Barbarini, Vera Haslinger, Katerina Schmidt, Ann-Marie Patch, Guido Müller, Burkhard Simma. (2009) Neonatal diabetes mellitus due to pancreas agenesis: a new case report and review of the literature. Pediatric Diabetes 10:7, 487-491
CrossRef87
Kara K. Osbak, Kevin Colclough, Cecile Saint-Martin, Nicola L. Beer, Christine Bellanné-Chantelot, Sian Ellard, Anna L. Gloyn. (2009) Update on mutations in glucokinase ( GCK ), which cause maturity-onset diabetes of the young, permanent neonatal diabetes, and hyperinsulinemic hypoglycemia. Human Mutation 30:11, 1512-1526
CrossRef88
Agnieszka Gach, Krystyna Wyka, Iwona Pietrzak, Olga Wegner, Maciej T. Malecki, Wojciech Mlynarski. (2009) Neonatal diabetes in a child positive for islet cell antibodies at onset and Kir6.2 activating mutation. Diabetes Research and Clinical Practice 86:2, e25-e27
CrossRef89
Akrouh Alejandro, Halcomb S. Eliza, Nichols Colin G., Sala-Rabanal Monica. (2009) Molecular biology of K ATP channels and implications for health and disease. IUBMB Life 61:10, 971-978
CrossRef90
C. F. Kline, H. T. Kurata, T. J. Hund, S. R. Cunha, O. M. Koval, P. J. Wright, M. Christensen, M. E. Anderson, C. G. Nichols, P. J. Mohler. (2009) Dual role of KATP channel C-terminal motif in membrane targeting and metabolic regulation. Proceedings of the National Academy of Sciences 106:39, 16669-16674
CrossRef91
Andrew Hattersley, Jan Bruining, Julian Shield, Pal Njolstad, Kim C Donaghue. (2009) The diagnosis and management of monogenic diabetes in children and adolescents. Pediatric Diabetes 10, 33-42
CrossRef92
Tomasz Klupa, Irina Kowalska, Krystyna Wyka, Jan Skupien, Ann-Marie Patch, Sarah E. Flanagan, Anna Noczynska, Malgorzata Arciszewska, Sian Ellard, Andrew T. Hattersley, Jacek Sieradzki, Wojciech Mlynarski, Maciej T. Malecki. (2009) Mutations in the ABCC8 (SUR1 subunit of the K ATP channel) gene are associated with a variable clinical phenotype. Clinical Endocrinology 71:3, 358-362
CrossRef93
Maria E. Craig, Andrew Hattersley, Kim C. Donaghue. (2009) Definition, epidemiology and classification of diabetes in children and adolescents. Pediatric Diabetes 10, 3-12
CrossRef94
Elliot S. Stolerman, Jose C. Florez. (2009) Genomics of type 2 diabetes mellitus: implications for the clinician. Nature Reviews Endocrinology 5:8, 429-436
CrossRef95
A. S. Slingerland, B. M. Shields, S. E. Flanagan, G. J. Bruining, K. Noordam, A. Gach, W. Mlynarski, M. T. Malecki, A. T. Hattersley, S. Ellard. (2009) Referral rates for diagnostic testing support an incidence of permanent neonatal diabetes in three European countries of at least 1 in 260,000 live births. Diabetologia 52:8, 1683-1685
CrossRef96
W.-H. Ting,, C.-Y. Huang,, F.-S. Lo,, H.-C. Lee,, C.-L. Lin,, W.-L. Guo,, Y.-J. Lee,. (2009) Improved Diabetic Control During Oral Sulfonylurea Treatment in Two Children with Permanent Neonatal Diabetes Mellitus. Journal of Pediatric Endocrinology and Metabolism 22:7, 661-668
CrossRef97
T. K. Taneja, J. Mankouri, R. Karnik, S. Kannan, A. J. Smith, T. Munsey, H. B.T. Christesen, D. J. Beech, A. Sivaprasadarao. (2009) Sar1-GTPase-dependent ER exit of KATP channels revealed by a mutation causing congenital hyperinsulinism. Human Molecular Genetics 18:13, 2400-2413
CrossRef98
B Jose, U Griffiths, T Barrett PhD, AT Hattersley, JJ Milles. (2009) Glibenclamide controls ketosis-prone diabetes in a 38-year-old woman with Kir6.2 mutation. Practical Diabetes International 26:6, 244-245i
CrossRef99
A. Hartemann-Heurtier, A. Simon, C. Bellanné-Chantelot, R. Reynaud, H. Cavé, M. Polak, M. Vaxillaire, A. Grimaldi. (2009) Mutations in the ABCC8 gene can cause autoantibody-negative insulin-dependent diabetes. Diabetes & Metabolism 35:3, 233-235
CrossRef100
T Sandal, LB Laborie, K Brusgaard, SÅ Eide, HBT Christesen, O Søvik, PR Njølstad, A Molven. (2009) The spectrum of ABCC8 mutations in Norwegian patients with congenital hyperinsulinism of infancy. Clinical Genetics 75:5, 440-448
CrossRef101
Brian F. Meyer, Osama Alsmadi, Salma Wakil, Khalid Al-Rubeaan. (2009) Genetics of type 2 diabetes in Arabs: What we know to date. International Journal of Diabetes Mellitus 1:1, 32-34
CrossRef102
Ewan R. Pearson. (2009) Pharmacogenetics in diabetes. Current Diabetes Reports 9:2, 172-181
CrossRef103
Mark I. McCarthy, Eleftheria Zeggini. (2009) Genome-wide association studies in type 2 diabetes. Current Diabetes Reports 9:2, 164-171
CrossRef104
Verena M. Wagner, Britta Kremke, Olaf Hiort, Sarah E. Flanagan, Ewan R. Pearson. (2009) Transition from insulin to sulfonylurea in a child with diabetes due to a mutation in KCNJ11 encoding Kir6.2—initial and long-term response to sulfonylurea therapy. European Journal of Pediatrics 168:3, 359-361
CrossRef105
Sarah E. Flanagan, S
verine Clauin, Christine Bellann
CrossRef106
Zofia KZ Gajdos, Joel N Hirschhorn, Mark R Palmert. (2009) What controls the timing of puberty? An update on progress from genetic investigation. Current Opinion in Endocrinology, Diabetes and Obesity 16:1, 16-24
CrossRef107
Maria Sara Remedi, Harley T. Kurata, Alexis Scott, F. Thomas Wunderlich, Eva Rother, Andre Kleinridders, Ailing Tong, Jens C. Brüning, Joseph C. Koster, Colin G. Nichols. (2009) Secondary Consequences of β Cell Inexcitability: Identification and Prevention in a Murine Model of KATP-Induced Neonatal Diabetes Mellitus. Cell Metabolism 9:2, 140-151
CrossRef108
Peter Proks, Frances M. Ashcroft. (2009) Modeling KATP channel gating and its regulation. Progress in Biophysics and Molecular Biology 99:1, 7-19
CrossRef109
M. Rupnik. (2009) The physiology of rodent beta-cells in pancreas slices. Acta Physiologica 195:1, 123-138
CrossRef110
Natalie D. Shaw, Joseph A. Majzoub. (2009) Permanent Neonatal Diabetes in a Patient with a KCNJ11/Q52R Mutation Accompanied by Intermittent Hypoglycemia and Liver Failure. International Journal of Pediatric Endocrinology 2009, 1-4
CrossRef111
NatalieD Shaw, JosephA Majzoub. (2009) Permanent Neonatal Diabetes in a Patient with a KCNJ11/Q52R Mutation Accompanied by Intermittent Hypoglycemia and Liver Failure. International Journal of Pediatric Endocrinology 2009:1, 453240
CrossRef112
Christophe A. Girard, F. Thomas Wunderlich, Kenju Shimomura, Stephan Collins, Stephan Kaizik, Peter Proks, Fernando Abdulkader, Anne Clark, Vicky Ball, Lejla Zubcevic, Liz Bentley, Rebecca Clark, Chris Church, Alison Hugill, Juris Galvanovskis, Roger Cox, Patrik Rorsman, Jens C. Brüning, Frances M. Ashcroft. (2008) Expression of an activating mutation in the gene encoding the KATP channel subunit Kir6.2 in mouse pancreatic β cells recapitulates neonatal diabetes. Journal of Clinical Investigation
CrossRef113
Inga Prokopenko, Mark I. McCarthy, Cecilia M. Lindgren. (2008) Type 2 diabetes: new genes, new understanding. Trends in Genetics 24:12, 613-621
CrossRef114
Lynnette R. Ferguson. (2008) Dissecting the Nutrigenomics, Diabetes, and Gastrointestinal Disease Interface: From Risk Assessment to Health Intervention. OMICS: A Journal of Integrative Biology 12:4, 237-244
CrossRef115
Maciej T. Malecki, Wojciech Mlynarski, Jan Skupien. (2008) Can geneticists help clinicians to understand and treat non-autoimmune diabetes?. Diabetes Research and Clinical Practice 82, S83-S93
CrossRef116
Gary Yellen. (2008) Ketone bodies, glycolysis, and K ATP channels in the mechanism of the ketogenic diet. Epilepsia 49, 80-82
CrossRef117
M. I. McCarthy, J. N. Hirschhorn. (2008) Genome-wide association studies: potential next steps on a genetic journey. Human Molecular Genetics 17:R2, R156-R165
CrossRef118
Jørn V Sagen, Lise Bjørkhaug, Janne Molnes, Helge Raeder, Louise Grevle, Oddmund Søvik, Anders Molven, Pål R Njølstad. (2008) Diagnostic screening of MODY2/ GCK mutations in the Norwegian MODY Registry. Pediatric Diabetes 9:5, 442-449
CrossRef119
Julie Støy, Siri Atma W Greeley, Veronica P Paz, Honggang Ye, Ashley N Pastore, Kinga B Skowron, Rebecca B Lipton, Fran R Cogen, Graeme I Bell, Louis H Philipson, . (2008) Diagnosis and treatment of neonatal diabetes: an United States experience†. Pediatric Diabetes 9:5, 450-459
CrossRef120
Nadia Bahi-Buisson, Sandra El Sabbagh, Christine Soufflet, Fabienne Escande, Nathalie Boddaert, Vassili Valayannopoulos, Christine Bellané-Chantelot, Karine Lascelles, Olivier Dulac, Perrine Plouin, Pascale de Lonlay. (2008) Myoclonic absence epilepsy with photosensitivity and a gain of function mutation in glutamate dehydrogenase. Seizure 17:7, 658-664
CrossRef121
Johannes Zschocke. (2008) Dominant versus recessive: Molecular mechanisms in metabolic disease. Journal of Inherited Metabolic Disease 31:5, 599-618
CrossRef122
Alessandro Doria, Mary-Elizabeth Patti, C. Ronald Kahn. (2008) The Emerging Genetic Architecture of Type 2 Diabetes. Cell Metabolism 8:3, 186-200
CrossRef123
A. L. Gloyn, M. I. McCarthy. (2008) Genetics: how the UKPDS contributed to determining the genetic landscape of Type 2 diabetes. Diabetic Medicine 25, 35-40
CrossRef124
Maciej T. Malecki, Wojciech Mlynarski. (2008) Monogenic diabetes: implications for therapy of rare types of disease. Diabetes, Obesity and Metabolism 10:8, 607-616
CrossRef125
Thomas Waterfield, Anna L Gloyn. (2008) Monogenic β-cell dysfunction in children: clinical phenotypes, genetic etiology and mutational pathways. Pediatric Health 2:4, 517-532
CrossRef126
Sara E. Pinney, Courtney MacMullen, Susan Becker, Yu-Wen Lin, Cheryl Hanna, Paul Thornton, Arupa Ganguly, Show-Ling Shyng, Charles A. Stanley. (2008) Clinical characteristics and biochemical mechanisms of congenital hyperinsulinism associated with dominant KATP channel mutations. Journal of Clinical Investigation 118:8, 2877-2886
CrossRef127
Doga Turkkahraman, Iffet Bircan, Nicholas D. Tribble, Sema Akçurin, Sian Ellard, Anna L. Gloyn. (2008) Permanent Neonatal Diabetes Mellitus Caused by a Novel Homozygous (T168A) Glucokinase (GCK) Mutation: Initial Response to Oral Sulphonylurea Therapy. The Journal of Pediatrics 153:1, 122-126
CrossRef128
Valeriya Lyssenko. (2008) The transcription factor 7-like 2 gene and increased risk of type 2 diabetes: an update. Current Opinion in Clinical Nutrition and Metabolic Care 11:4, 385-392
CrossRef129
J. C. Florez. (2008) Newly identified loci highlight beta cell dysfunction as a key cause of type 2 diabetes: Where are the insulin resistance genes?. Diabetologia 51:7, 1100-1110
CrossRef130
Louise Chappell, Shaun Gorman, Fiona Campbell, Sian Ellard, Gillian Rice, Angus Dobbie, Yanick Crow. (2008) A further example of a distinctive autosomal recessive syndrome comprising neonatal diabetes mellitus, intestinal atresias and gall bladder agenesis. American Journal of Medical Genetics Part A 146A:13, 1713-1717
CrossRef131
John RB Perry, Timothy M Frayling. (2008) New gene variants alter type 2 diabetes risk predominantly through reduced beta-cell function. Current Opinion in Clinical Nutrition and Metabolic Care 11:4, 371-377
CrossRef132
Ewan R. Pearson. (2008) Recent advances in the genetics of diabetes. Primary Care Diabetes 2:2, 67-72
CrossRef133
Andrew A Bremer, Sayali Ranadive, Robert H Lustig. (2008) Outpatient transition of an infant with permanent neonatal diabetes due to a KCNJ11 activating mutation from subcutaneous insulin to oral glyburide. Pediatric Diabetes 9:3pt1, 236-239
CrossRef134
E. DAmato, P. Tammaro, T. J. Craig, A. Tosi, R. Giorgetti, R. Lorini, F. M. Ashcroft. (2008) Variable phenotypic spectrum of diabetes mellitus in a family carrying a novel KCNJ11 gene mutation. Diabetic Medicine 25:6, 651-656
CrossRef135
Leif Groop, Valeriya Lyssenko. (2008) Genes and type 2 diabetes mellitus. Current Diabetes Reports 8:3, 192-197
CrossRef136
Carlo Colombo, Ottavia Porzio, Ming Liu, Ornella Massa, Mario Vasta, Silvana Salardi, Luciano Beccaria, Carla Monciotti, Sonia Toni, Oluf Pedersen, Torben Hansen, Luca Federici, Roberta Pesavento, Francesco Cadario, Giorgio Federici, Paolo Ghirri, Peter Arvan, Dario Iafusco, Fabrizio Barbetti. (2008) Seven mutations in the human insulin gene linked to permanent neonatal/infancy-onset diabetes mellitus. Journal of Clinical Investigation
CrossRef137
P. Tammaro, S. E. Flanagan, B. Zadek, S. Srinivasan, H. Woodhead, S. Hameed, I. Klimes, A. T. Hattersley, S. Ellard, F. M. Ashcroft. (2008) A Kir6.2 mutation causing severe functional effects in vitro produces neonatal diabetes without the expected neurological complications. Diabetologia 51:5, 802-810
CrossRef138
Rinki Murphy, Sian Ellard, Andrew T Hattersley. (2008) Clinical implications of a molecular genetic classification of monogenic β-cell diabetes. Nature Clinical Practice Endocrinology & Metabolism 4:4, 200-213
CrossRef139
Stéphane Cauchi, Philippe Froguel. (2008) TCF7L2 genetic defect and type 2 diabetes. Current Diabetes Reports 8:2, 149-155
CrossRef140
Cecilia M Lindgren, Mark I McCarthy. (2008) Mechanisms of Disease: genetic insights into the etiology of type 2 diabetes and obesity. Nature Clinical Practice Endocrinology & Metabolism 4:3, 156-163
CrossRef141
Mark Forbes, Andrew T. Hattersley. 2008. The genetics of diabetic pregnancy. , 466-474.
CrossRef142
A. S. Slingerland, W. Hurkx, K. Noordam, S. E. Flanagan, J. W. Jukema, L. C. Meiners, G. J. Bruining, A. T. Hattersley, M. Hadders-Algra. (2008) Sulphonylurea therapy improves cognition in a patient with the V59M KCNJ11 mutation. Diabetic Medicine 25:3, 277-281
CrossRef143
Lu Qi. (2008) Genetic effects, gene-lifestyle interactions, and type 2 diabetes. Central European Journal of Medicine 3:1, 1-7
CrossRef144
Isabelle Flechtner, Martine Vaxillaire, Hélène Cavé, Raphael Scharfmann, Philippe Froguel, Michel Polak. (2008) Neonatal hyperglycaemia and abnormal development of the pancreas. Best Practice & Research Clinical Endocrinology & Metabolism 22:1, 17-40
CrossRef145
Allan F. Moore, Jose C. Florez. (2008) Genetic Susceptibility to Type 2 Diabetes and Implications for Antidiabetic Therapy. Annual Review of Medicine 59:1, 95-111
CrossRef146
Osama Alsmadi, Khalid Al-Rubeaan, Salma M. Wakil, Faiqa Imtiaz, Gamal Mohamed, Haya Al-Saud, Nouran Abu Al-Saud, Nasser Aldaghri, Shahinaz Mohammad, Brian F Meyer. (2008) Genetic Study of Saudi Diabetes (GSSD): significant association of theKCNJ11 E23K polymorphism with type 2 diabetes. Diabetes/Metabolism Research and Reviews 24:2, 137-140
CrossRef147
S Sattiraju, S Reyes, GC Kane, A Terzic. (2008) KATP Channel Pharmacogenomics: From Bench to Bedside. Clinical Pharmacology & Therapeutics 83:2, 354-357
CrossRef148
MARK A. SPERLING, STUART A. WEINZIMER, WILLIAM V. TAMBORLANE. 2008. Diabetes Mellitus. , 374-421.
CrossRef149
M Shepherd. (2007) Transforming lives: transferring patients with neonatal diabetes from insulin to sulphonylureas. European Diabetes Nursing 3:3, 137-142
CrossRef150
Mangala M. Soundarapandian, Xiaofen Zhong, Lisheng Peng, Di Wu, Youming Lu. (2007) Role of K ATP channels in protection against neuronal excitatory insults. Journal of Neurochemistry 103:5, 1721-1729
CrossRef151
H. de Wet, M. G. Rees, K. Shimomura, J. Aittoniemi, A.-M. Patch, S. E. Flanagan, S. Ellard, A. T. Hattersley, M. S. P. Sansom, F. M. Ashcroft. (2007) Increased ATPase activity produced by mutations at arginine-1380 in nucleotide-binding domain 2 of ABCC8 causes neonatal diabetes. Proceedings of the National Academy of Sciences 104:48, 18988-18992
CrossRef152
A. I. Tarasov, C. A. Girard, B. Larkin, P. Tammaro, S. E. Flanagan, S. Ellard, F. M. Ashcroft. (2007) Functional analysis of two Kir6.2 (KCNJ11) mutations, K170T and E322K, causing neonatal diabetes. Diabetes, Obesity and Metabolism 9:s2, 46-55
CrossRef153
Wojciech Mlynarski, Andrei I Tarasov, Agnieszka Gach, Christophe A Girard, Iwona Pietrzak, Lejla Zubcevic, Jacek Kusmierek, Tomasz Klupa, Maciej T Malecki, Frances M Ashcroft. (2007) Sulfonylurea improves CNS function in a case of intermediate DEND syndrome caused by a mutation in KCNJ11. Nature Clinical Practice Neurology 3:11, 640-645
CrossRef154
A. M. Patch, S. E. Flanagan, C. Boustred, A. T. Hattersley, S. Ellard. (2007) Mutations in the ABCC8 gene encoding the SUR1 subunit of the K ATP channel cause transient neonatal diabetes, permanent neonatal diabetes or permanent diabetes diagnosed outside the neonatal period. Diabetes, Obesity and Metabolism 9:s2, 28-39
CrossRef155
C. G. Nichols, J. C. Koster, M. S. Remedi. (2007) ?-cell hyperexcitability: from hyperinsulinism to diabetes. Diabetes, Obesity and Metabolism 9:s2, 81-88
CrossRef156
Z. Sumnik, S. Kolouskova, J. K. H. Wales, V. Komarek, O. Cinek. (2007) Sulphonylurea treatment does not improve psychomotor development in children with KCNJ11 mutations causing permanent neonatal diabetes mellitus accompanied by developmental delay and epilepsy (DEND syndrome). Diabetic Medicine 24:10, 1176-1178
CrossRef157
Timothy Geoffrey Barrett. (2007) Differential diagnosis of type 1 diabetes: which genetic syndromes need to be considered?. Pediatric Diabetes 8:s6, 15-23
CrossRef158
Timothy M. Frayling. (2007) Genome–wide association studies provide new insights into type 2 diabetes aetiology. Nature Reviews Genetics 8:9, 657-662
CrossRef159
Sian Ellard, Sarah E. Flanagan, Christophe A. Girard, Ann-Marie Patch, Lorna W. Harries, Andrew Parrish, Emma L. Edghill, Deborah J.G. Mackay, Peter Proks, Kenju Shimomura, Holger Haberland, Dennis J. Carson, Julian P.H. Shield, Andrew T. Hattersley, Frances M. Ashcroft. (2007) Permanent Neonatal Diabetes Caused by Dominant, Recessive, or Compound Heterozygous SUR1 Mutations with Opposite Functional Effects. The American Journal of Human Genetics 81:2, 375-382
CrossRef160
Yee-Ming Chan, Lori MB Laffel. (2007) Transition from insulin to glyburide in a 4-month-old girl with neonatal diabetes mellitus caused by a mutation in KCNJ11. Pediatric Diabetes 8:4, 235-238
CrossRef161
Martijn van de Bunt, Anna L Gloyn. (2007) Monogenic disorders of the pancreatic β-cell: personalizing treatment for rare forms of diabetes and hypoglycemia. Personalized Medicine 4:3, 247-259
CrossRef162
M. Mazzuca, F. Lesage. (2007) Canaux potassiques, maladies héréditaires et acquises. La Revue de Médecine Interne 28:8, 576-579
CrossRef163
Andrew T. Hattersley. (2007) Prime suspect: the TCF7L2 gene and type 2 diabetes risk. Journal of Clinical Investigation 117:8, 2077-2079
CrossRef164
Struan FA Grant, Hakon Hakonarson. (2007) Recent development in pharmacogenomics: from candidate genes to genome-wide association studies. Expert Review of Molecular Diagnostics 7:4, 371-393
CrossRef165
I. Rica, C. Luzuriaga, G. Pérez de Nanclares, I. Estalella, A. Aragonés, R. Barrio, J. R. Bilbao, C. Carlés, C. Fernández, J. M. Fernández, E. Fernández-Rebollo, E. Gastaldo, P Giralt, J. M. Gomez Vida, A. Gutiérrez, J. P. López Siguero, M. J. Martínez-Aedo, M. Muñoz, J. Prieto, J. Rodrigo, F. Vargas, L. Castano. (2007) The majority of cases of neonatal diabetes in Spain can be explained by known genetic abnormalities. Diabetic Medicine 24:7, 707-713
CrossRef166
Rachel M. Freathy, Michael N. Weedon, Amanda Bennett, Elina Hyppönen, Caroline L. Relton, Beatrice Knight, Beverley Shields, Kirstie S. Parnell, Christopher J. Groves, Susan M. Ring, Marcus E. Pembrey, Yoav Ben-Shlomo, David P. Strachan, Chris Power, Marjo-Riitta Jarvelin, Mark I. McCarthy, George Davey Smith, Andrew T. Hattersley, Timothy M. Frayling. (2007) Type 2 Diabetes TCF7L2 Risk Genotypes Alter Birth Weight: A Study of 24,053 Individuals. The American Journal of Human Genetics 80:6, 1150-1161
CrossRef167
Katharine R Owen, Mark I McCarthy. (2007) Genetics of type 2 diabetes. Current Opinion in Genetics & Development 17:3, 239-244
CrossRef168
Thomas M Barber, Amanda J Bennett, Anna L Gloyn, Christopher J Groves, Ulla Sovio, Aimo Ruokonen, Hannu Martikainen, Anneli Pouta, Saara Taponen, Michael N Weedon, Anna-Liisa Hartikainen, John A H Wass, Marjo-Riitta Järvelin, Eleftheria Zeggini, Stephen Franks, Mark I McCarthy. (2007) Relationship between E23K (an established type II diabetes-susceptibility variant within KCNJ11), polycystic ovary syndrome and androgen levels. European Journal of Human Genetics 15:6, 679-684
CrossRef169
Michael N. Weedon, Timothy M. Frayling. (2007) Insights on pathogenesis of type 2 diabetes from MODY genetics. Current Diabetes Reports 7:2, 131-138
CrossRef170
Zohar Landau, Julio Wainstein, Aaron Hanukoglu, Myriam Tuval, Judith Lavie, Benjamin Glaser. (2007) Sulfonylurea-Responsive Diabetes in Childhood. The Journal of Pediatrics 150:5, 553-555
CrossRef171
Óscar Rubio Cabezas, Jesús Argente Oliver. (2007) Diabetes mellitus en la infancia: una enfermedad heterogénea. Medicina Clínica 128:16, 627-633
CrossRef172
David A. Cano, Matthias Hebrok, Martin Zenker. (2007) Pancreatic Development and Disease. Gastroenterology 132:2, 745-762
CrossRef173
Martin A Kennedy. (2007) Pharmacogenomics: single genes, whole genomes and global networks. Personalized Medicine 4:1, 87-94
CrossRef174
Joseph Bryan, Alvaro Muñoz, Xinna Zhang, Martina Düfer, Gisela Drews, Peter Krippeit-Drews, Lydia Aguilar-Bryan. (2007) ABCC8 and ABCC9: ABC transporters that regulate K+ channels. Pflügers Archiv - European Journal of Physiology 453:5, 703-718
CrossRef175
Annabelle S. Slingerland. (2007) Monogenic diabetes in children and young adults: Challenges for researcher, clinician and patient. Reviews in Endocrine and Metabolic Disorders 7:3, 171-185
CrossRef176
Diva D De León, Charles A Stanley. (2007) Mechanisms of Disease: advances in diagnosis and treatment of hyperinsulinism in neonates. Nature Clinical Practice Endocrinology & Metabolism 3:1, 57-68
CrossRef177
Min Sun Kim, Sun-Young Kim, Gu-Hwan Kim, Han Wook Yoo, Dong Whan Lee, Dae-Yeol Lee. (2007) Sulfonylurea Therapy in Two Korean Patients with Insulin-treated Neonatal Diabetes due to Heterozygous Mutations of the KCNJ11 Gene Encoding Kir6.2. Journal of Korean Medical Science 22:4, 616
CrossRef178
S. Cauchi, M. Vaxillaire, H. Choquet, E. Durand, A. Duval, M. Polak, P. Froguel. (2006) No major contribution of TCF7L2 sequence variants to maturity onset of diabetes of the young (MODY) or neonatal diabetes mellitus in French white subjects. Diabetologia 50:1, 214-216
CrossRef179
Andrew Hattersley, Jan Bruining, Julian Shield, Pal Njolstad, Kim Donaghue. (2006) ISPAD Clinical Practice Consensus Guidelines 2006?2007 The diagnosis and management of monogenic diabetes in children. Pediatric Diabetes 7:6, 352-360
CrossRef180
E. L. Edghill, C. Bingham, A. S. Slingerland, J. A. L. Minton, C. Noordam, S. Ellard, A. T. Hattersley. (2006) Hepatocyte nuclear factor-1 beta mutations cause neonatal diabetes and intrauterine growth retardation: support for a critical role of HNF-1? in human pancreatic development. Diabetic Medicine 23:12, 1301-1306
CrossRef181
I Flechtner, P De Lonlay, M Polak. (2006) Diabetes and hypoglycaemia in young children and mutations in the Kir6.2 subunit of the potassium channel. Diabetes & Metabolism 32:6, 569-580
CrossRef182
Wei Zhang, Daorong Feng, Yulin Li, Kaori Iida, Barbara McGrath, Douglas R. Cavener. (2006) PERK EIF2AK3 control of pancreatic β cell differentiation and proliferation is required for postnatal glucose homeostasis. Cell Metabolism 4:6, 491-497
CrossRef183
Maria E Craig, Andrew Hattersley, Kim Donaghue. (2006) ISPAD Clinical Practice Consensus Guidelines 2006?2007 Definition, epidemiology and classification. Pediatric Diabetes 7:6, 343-351
CrossRef184
Christophe A. J. Girard, Kenju Shimomura, Peter Proks, Nathan Absalom, Luis Castano, Guiomar de Nanclares, Frances M. Ashcroft. (2006) Functional analysis of six Kir6.2 (KCNJ11) mutations causing neonatal diabetes. Pflügers Archiv - European Journal of Physiology 453:3, 323-332
CrossRef185
A. S. Slingerland, R. Nuboer, M. Hadders-Algra, A. T. Hattersley, G. J. Bruining. (2006) Improved motor development and good long-term glycaemic control with sulfonylurea treatment in a patient with the syndrome of intermediate developmental delay, early-onset generalised epilepsy and neonatal diabetes associated with the V59M mutation in the KCNJ11 gene. Diabetologia 49:11, 2559-2563
CrossRef186
Damla Goksen, Sukran Darcan, Mahmut Coker, Güzide Aksu, Basak Yıldız, Sinan Kara, Nilgün Kültürsay. (2006) Permanent neonatal diabetes with arthrogryposis multiplex congenita and neurogenic bladder ? a new syndrome?. Pediatric Diabetes 7:5, 279-283
CrossRef187
J. Jay Gargus. 2006. Receptor, Transporter and Ion Channel Diseases. .
CrossRef188
Jamel Mankouri, Tarvinder K Taneja, Andrew J Smith, Sreenivasan Ponnambalam, Asipu Sivaprasadarao. (2006) Kir6.2 mutations causing neonatal diabetes prevent endocytosis of ATP-sensitive potassium channels. The EMBO Journal 25:17, 4142-4151
CrossRef189
M. S. Remedi, J. V. Rocheleau, A. Tong, B. L. Patton, M. L. McDaniel, D. W. Piston, J. C. Koster, C. G. Nichols. (2006) Hyperinsulinism in mice with heterozygous loss of KATP channels. Diabetologia 49:10, 2368-2378
CrossRef190
Anna L Gloyn, Sian Ellard. (2006) Defining the genetic aetiology of monogenic diabetes can improve treatment. Expert Opinion on Pharmacotherapy 7:13, 1759-1767
CrossRef191
G. Tonini, C. Bizzarri, R. Bonfanti, M. Vanelli, F. Cerutti, E. Faleschini, F. Meschi, F. Prisco, E. Ciacco, M. Cappa, C. Torelli, V. Cauvin, S. Tumini, D. Iafusco, F. Barbetti, . (2006) Sulfonylurea treatment outweighs insulin therapy in short-term metabolic control of patients with permanent neonatal diabetes mellitus due to activating mutations of the KCNJ11 (KIR6.2) gene. Diabetologia 49:9, 2210-2213
CrossRef192
Babenko, Andrey P., Polak, Michel, Cavé, Hélène, Busiah, Kanetee, Czernichow, Paul, Scharfmann, Raphael, Bryan, Joseph, Aguilar-Bryan, Lydia, Vaxillaire, Martine, Froguel, Philippe, . (2006) Activating Mutations in the ABCC8 Gene in Neonatal Diabetes Mellitus. New England Journal of Medicine 355:5, 456-466
Full Text193
Pearson, Ewan R., Flechtner, Isabelle, Njølstad, Pål R., Malecki, Maciej T., Flanagan, Sarah E., Larkin, Brian, Ashcroft, Frances M., Klimes, Iwar, Codner, Ethel, Iotova, Violeta, Slingerland, Annabelle S., Shield, Julian, Robert, Jean-Jacques, Holst, Jens J., Clark, Penny M., Ellard, Sian, Søvik, Oddmund, Polak, Michel, Hattersley, Andrew T., . (2006) Switching from Insulin to Oral Sulfonylureas in Patients with Diabetes Due to Kir6.2 Mutations. New England Journal of Medicine 355:5, 467-477
Full Text194
Sperling, Mark A., . (2006) ATP-Sensitive Potassium Channels — Neonatal Diabetes Mellitus and Beyond. New England Journal of Medicine 355:5, 507-510
Full Text195
A. Varadi, A. Grant, M. McCormack, T. Nicolson, M. Magistri, K. J. Mitchell, A. P. Halestrap, H. Yuan, B. Schwappach, G. A. Rutter. (2006) Intracellular ATP-sensitive K+ channels in mouse pancreatic beta cells: against a role in organelle cation homeostasis. Diabetologia 49:7, 1567-1577
CrossRef196
E. Feigerlová, Š. Pruhová, L. Dittertová, J. Lebl, D. Pinterová, K. Kološtová, M. Černá, O. Pedersen, T. Hansen. (2006) Aetiological heterogeneity of asymptomatic hyperglycaemia in children and adolescents. European Journal of Pediatrics 165:7, 446-452
CrossRef197
Anna L Gloyn, Catherine Diatloff-Zito, Emma L Edghill, Christine Bellanné-Chantelot, Sylvie Nivot, Régis Coutant, Sian Ellard, Andrew T Hattersley, Jean Jacques Robert. (2006) KCNJ11 activating mutations are associated with developmental delay, epilepsy and neonatal diabetes syndrome and other neurological features. European Journal of Human Genetics 14:7, 824-830
CrossRef198
S. E. Flanagan, E. L. Edghill, A. L. Gloyn, S. Ellard, A. T. Hattersley. (2006) Mutations in KCNJ11, which encodes Kir6.2, are a common cause of diabetes diagnosed in the first 6 months of life, with the phenotype determined by genotype. Diabetologia 49:6, 1190-1197
CrossRef199
Colin G. Nichols. (2006) KATP channels as molecular sensors of cellular metabolism. Nature 440:7083, 470-476
CrossRef200
Mark I. McCarthy, Eleftheria Zeggini. (2006) Genetics of type 2 diabetes. Current Diabetes Reports 6:2, 147-154
CrossRef201
Catherine Pihoker. (2006) What type of diabetes do young people have?. Current Diabetes Reports 6:2, 108-112
CrossRef202
Anna L. Gloyn, Juveria Siddiqui, Sian Ellard. (2006) Mutations in the genes encoding the pancreatic beta-cell K ATP channel subunits Kir6.2 ( KCNJ11 ) and SUR1 ( ABCC8 ) in diabetes mellitus and hyperinsulinism. Human Mutation 27:3, 220-231
CrossRef203
MIE KAWAJIRI, YOSHIYUKI OKANO, MIYUKI KUNO, DAISUKE TOKUHARA, YUTAKA HASE, HIROSHI INADA, FUMI TASHIRO, JUN-ICHI MIYAZAKI, TSUNEKAZU YAMANO. (2006) Unregulated Insulin Secretion by Pancreatic Beta Cells in Hyperinsulinism/Hyperammonemia Syndrome: Role of Glutamate Dehydrogenase, ATP-Sensitive Potassium Channel, and Nonselective Cation Channel. Pediatric Research 59:3, 359-364
CrossRef204
Helen Freeman, Kenju Shimomura, Emma Horner, Roger D. Cox, Frances M. Ashcroft. (2006) Nicotinamide nucleotide transhydrogenase: A key role in insulin secretion. Cell Metabolism 3:1, 35-45
CrossRef205
Andrew T Hattersley. (2006) Beyond the beta cell in diabetes. Nature Genetics 38:1, 12-13
CrossRef206
Jonathan V. Rocheleau, Maria S. Remedi, Butch Granada, W. Steven Head, Joseph C. Koster, Colin G. Nichols, David W. Piston. (2006) Critical Role of Gap Junction Coupled KATP Channel Activity for Regulated Insulin Secretion. PLoS Biology 4:2, e26
CrossRef207
Yumiko Kotani, Ichiro Yokota, Shoji Kagami, Shin Amemiya, Nobuo Matsuura, Nozomu Sasaki, The Japanese Study Group of Insulin. (2006) Relatively Small Birth Size and Accelerated Early Growth of Japanese Type 1 Diabetic Children with Younger Onset. Clinical Pediatric Endocrinology 15:2, 73-78
CrossRef208
C. Colombo, M. Delvecchio, C. Zecchino, M. F. Faienza, L. Cavallo, F. Barbetti, . (2005) Transient neonatal diabetes mellitus is associated with a recurrent (R201H) KCNJ11 (KIR6.2) mutation. Diabetologia 48:11, 2439-2441
CrossRef209
H John, SE Flanagan, R Corrall, AT Hattersley, S Ellard, M Shepherd. (2005) Neonatal diabetes is more than just a paediatric problem: 57 years of diabetes from a Kir6.2 mutation. Practical Diabetes International 22:9, 342-344
CrossRef210
Tara Bharucha, Justin Brown, Ciara McDonnell, Robecca Gebert, Peter McDougall, Fergus Cameron, George Werther, Margaret Zacharin. (2005) Neonatal diabetes mellitus: Insulin pump as an alternative management strategy. Journal of Paediatrics and Child Health 41:9-10, 522-526
CrossRef211
Mark A Sperling. (2005) Neonatal diabetes mellitus: from understudy to center stage. Current Opinion in Pediatrics 17:4, 512-518
CrossRef212
Paolo Tammaro, Christophe Girard, Janne Molnes, Pål R Njølstad, Frances M Ashcroft. (2005) Kir6.2 mutations causing neonatal diabetes provide new insights into Kir6.2–SUR1 interactions. The EMBO Journal 24:13, 2318-2330
CrossRef213
Khalid Hussain, Karen E Cosgrove. (2005) From congenital hyperinsulinism to diabetes mellitus: the role of pancreatic beta-cell KATP channels. Pediatric Diabetes 6:2, 103-113
CrossRef214
Maciej T. Malecki. (2005) Genetics of type 2 diabetes mellitus. Diabetes Research and Clinical Practice 68, S10-S21
CrossRef215
Peter Proks, Christophe Girard, Shozeb Haider, Anna L Gloyn, Andrew T Hattersley, Mark S P Sansom, Frances M Ashcroft. (2005) A gating mutation at the internal mouth of the Kir6.2 pore is associated with DEND syndrome. EMBO reports 6:5, 470-475
CrossRef216
T. Klupa, E. L. Edghill, J. Nazim, J. Sieradzki, S. Ellard, A. T. Hattersley, M. T. Malecki. (2005) The identification of a R201H mutation in KCNJ11, which encodes Kir6.2, and successful transfer to sustained-release sulphonylurea therapy in a subject with neonatal diabetes: evidence for heterogeneity of beta cell function among carriers of the R201H mutation. Diabetologia 48:5, 1029-1031
CrossRef217
I. Barroso. (2005) Genetics of Type 2 diabetes. Diabetic Medicine 22:5, 517-535
CrossRef218
Deborah J. G. Mackay, I Karen Temple, Julian P. H. Shield, David O. Robinson. (2005) Bisulphite sequencing of the transient neonatal diabetes mellitus DMR facilitates a novel diagnostic test but reveals no methylation anomalies in patients of unknown aetiology. Human Genetics 116:4, 255-261
CrossRef219
Michael J. Riedel, Diana C. Steckley, Peter E. Light. (2005) Current status of the E23K Kir6.2 polymorphism: implications for type-2 diabetes. Human Genetics 116:3, 133-145
CrossRef220
Jennifer F Antcliff, Shozeb Haider, Peter Proks, Mark S P Sansom, Frances M Ashcroft. (2005) Functional analysis of a structural model of the ATP-binding site of the KATP channel Kir6.2 subunit. The EMBO Journal 24:2, 229-239
CrossRef221
Ornella Massa, Dario Iafusco, Elena D'Amato, Anna L. Gloyn, Andrew T. Hattersley, Bruno Pasquino, Giorgio Tonini, Francesco Dammacco, Giorgio Zanette, Franco Meschi, Ottavia Porzio, Gianfranco Bottazzo, Antonino Crin
CrossRef222
S. Speier, S.-B. Yang, K. Sroka, T. Rose, M. Rupnik. (2005) KATP-channels in beta-cells in tissue slices are directly modulated by millimolar ATP. Molecular and Cellular Endocrinology 230:1-2, 51-58
CrossRef223
Valeriya Lyssenko, Peter Almgren, Dragi Anevski, Marju Orho-Melander, Marketa Sjögren, Carola Saloranta, Tiinamaija Tuomi, Leif Groop, . (2005) Genetic Prediction of Future Type 2 Diabetes. PLoS Medicine 2:12, e345
CrossRef224
Gabrielle S Sellick, Karen T Barker, Irene Stolte-Dijkstra, Christina Fleischmann, Richard J Coleman, Christine Garrett, Anna L Gloyn, Emma L Edghill, Andrew T Hattersley, Peter K Wellauer, Graham Goodwin, Richard S Houlston. (2004) Mutations in PTF1A cause pancreatic and cerebellar agenesis. Nature Genetics 36:12, 1301-1305
CrossRef225
Kupper A. Wintergerst, Susan Hargadon, Helen Y. Hsiang. (2004) Continuous subcutaneous insulin infusion in neonatal diabetes mellitus. Pediatric Diabetes 5:4, 202-206
CrossRef226
J. Mitchell, Z. Punthakee, B. Lo, C. Bernard, K. Chong, C. Newman, L. Cartier, V. Desilets, E. Cutz, I. L. Hansen, P. Riley, C. Polychronakos. (2004) Neonatal diabetes, with hypoplastic pancreas, intestinal atresia and gall bladder hypoplasia: search for the aetiology of a new autosomal recessive syndrome. Diabetologia 47:12, 2160-2167
CrossRef227
Thomas J. Jentsch, Christian A. Hübner, Jens C. Fuhrmann. (2004) Ion channels: Function unravelled by dysfunction. Nature Cell Biology 6:11, 1039-1047
CrossRef228
Larisa Stankovich, David Wicks, Sasko Despotovski, Dong Liang. (2004) Atomic Absorption Spectroscopy in Ion Channel Screening. ASSAY and Drug Development Technologies 2:5, 569-574
CrossRef229
Gribble, Fiona M., Reimann, Frank, . (2004) Open to Control — New Hope for Patients with Neonatal Diabetes. New England Journal of Medicine 350:18, 1817-1818
Full Text
