Original Article
Brief Report
Fatal Myositis Due to the Microsporidian Brachiola algerae, a Mosquito Pathogen
N Engl J Med 2004; 351:42-47July 1, 2004
- Article
Microsporidia are obligate intracellular eukaryotes that have emerged as a cause of chronic diarrheal syndromes in patients with human immunodeficiency virus (HIV) infection.1 Most cases have been caused by Enterocytozoon bieneusi. In addition, there have been clinical reports of skeletal-muscle infection with pleistophora species, Trachipleistophora hominis, and Brachiola vesicularum.1 We identified the mosquito pathogen B. algerae (formerly Nosema algerae) as the cause of fatal myositis in a patient who was receiving infliximab for rheumatoid arthritis.2 To our knowledge, B. algerae has not previously been isolated from deep tissue in a person.
Case Report
In November 2002, a 57-year-old woman with rheumatoid arthritis and diabetes presented with a six-week history of increasing fatigue, generalized muscle and joint pain, profound weakness, and fever. Her symptoms initially limited her daily activities and finally confined her to bed. In the preceding year, she had been taking 15 mg of methotrexate per week and 20 mg of leflunomide per day. She had also been receiving 3 to 10 mg of prednisone daily for several decades. In the six months before admission, she began taking infliximab (a total of four doses of 3 mg per kilogram of body weight at intervals of three to four weeks and one dose of 5 mg per kilogram within the month before admission). The patient resided in a small town in northeastern Pennsylvania and had no recent travel history. She had had no contact with animals. A muscle-biopsy specimen from the left anterior thigh contained microorganisms that were consistent with microsporidia (Figure 1Figure 1
Photomicrographs of Brachiola algerae in Muscle-Biopsy Specimens and Tissue Culture.).The patient was admitted to a tertiary care facility, corticosteroids and infliximab were discontinued, and treatment was begun with 400 mg of albendazole in 40 ml of canola oil twice daily through a nasogastric tube, along with clindamycin, metronidazole, and atovaquone. Magnetic resonance imaging of the brain with the use of gadolinium demonstrated chronic ischemia of the small vessels with no leptomeningeal enhancement. The creatine kinase level was 4103 U per liter on admission and continued to rise, peaking at 6337 U per liter. A test for HIV was negative. A biopsy specimen of the right quadriceps muscle obtained four days after admission also revealed organisms consistent with microsporidia. The morphologic appearance suggested brachiola species, and the identity was confirmed by the polymerase chain reaction (PCR) with the use of primers specific for B. algerae (Nalg6F and Nalg178R).4 No amplification was seen with the use of primers specific for T. hominis — TRACH1R (5'CACCAGGTTGATTCTGCCTG3') and TRACH1F (5'TTATGATCCTGCTGCTCC3'). At this point, treatment with itraconazole (400 mg twice daily) was begun and clindamycin and atovaquone were discontinued.
Narcotic analgesics were necessary to control the patient's worsening muscle pain. During the next two weeks, the patient became increasingly debilitated, and she required mechanical ventilation after respiratory insufficiency developed. A chest film revealed bilateral pulmonary infiltrates; Pneumocystis jiroveci was detected on direct fluorescence antibody testing of a smear from the tracheal aspirate; an examination for microsporidia was negative. Trimethoprim–sulfamethoxazole was added to the regimen, and the chest film cleared over the next week. After 16 days of therapy, microsporidia were seen in a third biopsy specimen, from the right quadriceps muscle. The frequency of albendazole was increased to three times a day but was curtailed because of increasing liver-enzyme levels. Four weeks after admission, the patient died from a massive cerebrovascular infarction, evident on computed tomography of the brain. A postmortem muscle biopsy revealed necrosis and persistent organisms.
Methods
Muscle tissue was fixed in 10 percent neutral buffered formalin, embedded in paraffin, sectioned, and stained with hematoxylin and eosin, periodic acid–Schiff, and Wright–Giemsa according to standard techniques.5 Slides were also incubated with a 1:400 dilution of rabbit antiserum against B. algerae (human corneal isolate3), rabbit antiserum against B. algerae (Undeen mosquito isolate 6), rabbit antiserum against Vittaforma corneae, or rabbit antiserum against Encephalitozoon cuniculi at 37°C for 30 minutes; washed three times with phosphate-buffered saline; and incubated at 37°C for 30 minutes in a 1:100 dilution of fluorescein-labeled goat antirabbit IgG. The specimens were then washed three times with phosphate-buffered saline, mounted with glycerol, and examined and photographed with an Olympus BX60 microscope equipped with epifluorescence optics.
For transmission electron microscopy, muscle-biopsy specimens and cultures were fixed in 0.1 M cacodylate-buffered 2.5 percent glutaraldehyde and then processed according to standard methods.7 Thin sections were stained with uranyl acetate and lead citrate. The samples were examined with the use of a Tecnai 12 transmission electron microscope at the Rutgers University electron-microscopy facility.
A piece of fresh muscle-biopsy tissue measuring 8 by 8 mm was mechanically triturated and inoculated onto RK13 (rabbit kidney) and L6E9 (rat myoblast) cells. RK13 cells were maintained in minimal essential medium (GIBCO-BRL) containing 7 percent fetal-calf serum and a 1 percent solution of penicillin, streptomycin, and amphotericin B.5,8 L6E9 cells were maintained in Dulbecco's minimal essential medium (GIBCO-BRL) containing 10 percent fetal-calf serum and a 1 percent solution of penicillin and streptomycin.8 Cells were incubated at 37°C and 30°C.
Conserved primer pairs (ss18f and ss1492r and ss530f and ls530r) for the large and the small subunit of the ribosomal RNA (rRNA) gene were used to amplify the microsporidian rRNA gene from muscle-biopsy material according to previously described methods.4 The PCR products were cloned into a TA cloning vector (PCR 2.1, Invitrogen) and sequenced on an ABI Prism DNA Sequencer (model 377, PerkinElmer), and data sets were assembled with the use of SeqMan sequence-analysis software (DNAStar). The resulting rRNA sequence was deposited in GenBank (accession number AY230191).
Results
Light Microscopy
Sections of skeletal muscle from the first biopsy, of the left quadriceps muscle, demonstrated distended myofibers filled with basophilic microorganisms on staining with hematoxylin and eosin (Figure 1A). The small spores measured 4 by 2 μm. Polar granules were apparent on staining with periodic acid–Schiff. Several areas of the biopsy specimen contained ruptured myofibers with extracellular organisms but no associated inflammatory-cell response. A second biopsy specimen obtained eight days later, after the dose of immunosuppressive agents had been tapered and antimicrobial therapy had been initiated (Figure 1B), had a similar microbial load; however, necrotic myofibers and a neutrophilic inflammatory-cell response were now apparent. A third biopsy specimen obtained 19 days after the first specimen demonstrated a necrotizing myopathy with regeneration of myofibers; however, the inflammatory response was no longer evident. Tissue sections reacted strongly with antiserum against B. algerae (Figure 1D) but not antiserum against either V. corneae or E. cuniculi.
Electron Microscopy
Within infected muscle cells, both developmental and spore stages of microsporidium were present (Figure 2AFigure 2
Findings on Transmission Electron Microscopy of the Initial Muscle-Biopsy Specimen. and Figure 2B). The spores contained a polar filament with approximately nine coils (seen in cross section in Figure 2B) surrounding the paired, abutting nuclei (diplokaryon) and cytoplasmic organelles. These structures were encased within the thick-walled spore coat. The plasmalemma of the developing parasite was coated with electron-dense secretions and had vesiculotubular appendages. All stages were diplokaryotic and were in direct contact with the host-cell cytoplasm. These features are characteristic of the genus brachiola of the phylum Microsporidia.1 PCR and rRNA-Sequence Data
On PCR, the sequence of rRNA obtained from muscle-biopsy specimens was identical to the sequence of rRNA from spores obtained from this organism in tissue culture. BLAST analysis demonstrated that this sequence had 99.7 percent identity with the GenBank rRNA sequence of B. algerae (accession number AF069063) obtained from Anopheles stephensi.
Culture
Cells were incubated at 37°C and 30°C. No growth occurred at 37°C, but growth was seen at 30°C. Over a period of 21 days, the infection increased until about 30 percent of the cells were infected (Figure 1C). Transfer of infection with the use of cultured spores was possible at 30°C but not at 37°C. PCR of the cultivated organism demonstrated that the rRNA sequence was the same as that obtained from muscle tissue. A culture of this organism was deposited in the American Type Culture Collection (ATCC-PRA109).
Discussion
We document a deep-tissue infection with B. algerae, a mosquito pathogen, in a patient with diabetes and rheumatoid arthritis. The infection was fatal despite treatment with albendazole and itraconazole. Large numbers of mature spores were present in all muscle-biopsy specimens; after treatment, however, almost no proliferative forms were present, suggesting that treatment may have prevented replication. The diagnosis of a microsporidian infection was established by the demonstration of characteristic spores and proliferative stages consistent with B. algerae.5,7 Both B. algerae and B. vesicularum produce extensive vesicular appendages that extend into the host-cell cytoplasm, but only B. vesicularum produces branching protoplasmic extensions.5,7 The diagnosis was confirmed by molecular phylogeny with the use of the small-subunit rRNA gene.
Microsporidia are obligate intracellular parasites that are ubiquitous in the environment and infect almost all animal phyla (invertebrate and vertebrate). They are eukaryotes containing a nucleus with a nuclear envelope, an intracytoplasmic-membrane system, vesicular Golgi,1 and “remnant” mitochondria.9 Microsporidia possess prokaryotic-sized ribosomes lacking a 5.8S subunit.4 They were once considered to be primitive protozoa; however, molecular phylogenetic analysis has led to the recognition that these organisms are more closely related to the fungi than to other protozoa. The phylum Microsporidia (Microspora) includes more than 144 genera1 of which the following contain species that are known to infect humans: nosema (N. corneum, renamed V. corneae, and N. algerae, renamed B. algerae 5), pleistophora,10-12 enterocytozoon, encephalitozoon, septata (reclassified as encephalitozoon), trachipleistophora,13 brachiola,7 and microsporidium. Infection has been described in persons who are immunocompromised as a result of HIV infection14 or organ transplantation15-19 as well as in immunocompetent persons.1
Three microsporidian genera have been implicated in myositis. Cali et al. described a B. vesicularum infection in a patient with the acquired immunodeficiency syndrome (AIDS) and a CD4 cell count of 35 per cubic millimeter who presented with a five-month history of fever, progressive muscular weakness, and leg pain.7 Treatment with albendazole and itraconazole resulted in clinical improvement. Myositis associated with T. hominis was described in a patient with AIDS and a three-month history of worsening muscle pain, fevers, and a creatine kinase level of 1410 U per liter.13 The patient's condition improved after treatment with albendazole, sulfadiazine, and pyrimethamine. Pleistophora have been described as the cause of myositis in a patient with AIDS (P. ronneafiei 12) and in an HIV- negative patient with a low CD4 cell count.10-12 The patient with AIDS died, whereas the HIV-negative patient was free of symptoms four years after the initial presentation.10-12
Our patient was taking immunosuppressive agents for rheumatoid arthritis, had no evidence of HIV infection, and presented with muscle pain and progressive weakness associated with elevated creatine kinase levels. The causative organism was identified as B. algerae. This organism has been reported to cause a superficial corneal lesion, but no systemic infections have been described.3 Other nosema species have also been reported in corneal infections in HIV-negative patients.20 The finding that B. algerae can grow at temperatures of 26 to 37°C in several kinds of tissue-culture cells, including those of insects, amphibians, and mammals,8 suggests that the pathogen could infect mammals. However, this broad temperature range could also be an important limiting factor restricting the site of infection.5,21
Because of its ability to infect many mosquito genera that are found worldwide, including culex, anopheles, and aedes, B. algerae has been investigated for use as a pesticide.22 The infection is transmitted horizontally but not transovarially. Infected mosquitoes have reduced reproductive capacity, longevity, and susceptibility to malarial parasites. B. algerae has been used experimentally to infect many other genera of insects, including those feeding on infected mosquitoes.22
Intravenous, peroral, or intranasal inoculations of B. algerae into immunologically competent mice failed to produce persistent infections.21,23 However, subcutaneous inoculations into the ears, tail, or footpads of such mice — sites in which temperatures are lower than 37°C — produced localized infections.21,23 Similarly, in athymic mice, superficial inoculation caused disseminated disease,23 whereas intravenous, peroral, or intranasal inoculation failed to establish infection. These studies suggest that an immunodeficient host could become susceptible to B. algerae if the site of infection, before dissemination, was in a superficial location with a temperature that was lower than core body temperature.
Our patient had begun treatment with infliximab, a monoclonal antibody with high binding affinity and specificity for tumor necrosis factor α (TNF-α), six months before myositis developed. Infliximab therapy is associated with an increased risk of infection or reactivation of infection with pathogens such as Mycobacterium tuberculosis, Histoplasma capsulatum, Listeria monocytogenes, and pneumocystis.24-27 The ability to mount an effective host response to many intracellular pathogens depends partly on the production of type 1 helper T-cell cytokines, including TNF-α.28 Protective immunity against E. cuniculi, a microsporidian, depends on the induction of type 1 helper T-cell cytokines such as interleukin-12 and interferon-γ.29,30 The role of TNF-α has not been studied in animal models of microsporidiosis; however, elevated fecal levels of TNF-α have been detected in patients with AIDS and intestinal microsporidiosis.31 Treatment of murine peritoneal macrophages in vitro with TNF-α inhibited the replication of E. cuniculi.32 Therefore, anti–TNF-α therapy may have an adverse effect on microsporidiosis.
The present case report illustrates that insect pathogens such as B. algerae are capable of causing disseminated disease in humans. Studies in animals suggest that local replication in body parts with lower temperatures (e.g., ears, nose, and skin) may be necessary for the microorganism to adapt to mammalian body temperature before it begins disseminating throughout the body.21,23 B. algerae infects many mosquito species. Small numbers of spores have been found in the feeding tubes of mosquitoes infected with T. hominis, but there are no published reports of B. algerae in the salivary glands of mosquitoes.33 The most heavily infected organ is the gut and malpighian tubules, but infection is found throughout the insect, including muscle and fat cells.6 Although the inoculation of spores during feeding cannot be excluded, we believe it is more likely that infection with B. algerae in this patient was a consequence of crushing an infected mosquito while it was feeding, thereby mechanically inoculating the spores into the skin-bite wound.
Supported by a grant (AI31788) from the National Institutes of Health.
Dr. Gareca reports having received consulting fees from Merck and grant support from Pharmacia/Upjohn.
Source Information
From the Department of Medicine, Jacobi Medical Center, Bronx, N.Y. (C.M.C.); the Departments of Medicine (C.M.C., L.M.W.) and Pathology (L.M.W., P.M.T., M.W.), Albert Einstein College of Medicine, Bronx, N.Y.; the Departments of Infectious Disease (L.V.R., J.N., E.Y., M.G.) and Pathology (D.F.B., G.C.), Lehigh Valley Hospital, Allentown, Pa.; the Department of Biological Sciences, Rutgers University, Newark, N.J. (A.C., P.M.T.); and the Division of Parasitic Diseases, Centers for Disease Control and Prevention, Atlanta (G.S.V., L.X.).
Address reprint requests to Dr. Coyle at Pelham Pkwy. and Eastchester Rd. S., Rm. 3N7, Department of Medicine, Jacobi Medical Center, Bronx, NY 10461, or at coyle@aecom.yu.edu.
- References
References
1
Wittner M, Weiss LM, eds. The microsporidia and microsporidiosis. Washington, D.C.: ASM Press, 1999.
2
Lipsky PE ,van der Heijde DMFM ,St Clair EW , et al. Infliximab and methotrexate in the treatment of rheumatoid arthritis. N Engl J Med 2000;343:1594-1602
Full Text | Web of Science | Medline3
Visvesvara GS ,Belloso M ,Moura H , et al. Isolation of Nosema algerae from the cornea of an immunocompetent patient. J Eukaryot Microbiol 1999;46:10S-10S
CrossRef | Web of Science | Medline4
Weiss LM . Molecular phylogeny and diagnostic approaches to microsporidia. Contrib Microbiol 2000;6:209-235
CrossRef | Medline5
Lowman PM ,Takvorian PM ,Cali A . The effects of elevated temperatures and various time-temperature combinations on the development of Brachiola (Nosema) algerae N. Comb. in mammalian cell culture. J Eukaryot Microbiol 2000;47:221-234
CrossRef | Web of Science | Medline6
Vavra J ,Undeen AH . Nosema algerae n. sp. (Cnidospora, Microsporidia) a pathogen in a laboratory colony of Anopheles stephensi Liston (Diptera, Culicidae). J Protozool 1970;17:240-249
Medline7
Cali A ,Takvorian PM ,Lewin S , et al. Brachiola vesicularum, n. g., n. sp., a new microsporidium associated with AIDS and myositis. J Eukaryot Microbiol 1998;45:240-251
CrossRef | Web of Science | Medline8
Visvesvara GS . In vitro cultivation of microsporidia of clinical importance. Clin Microbiol Rev 2002;15:401-413
CrossRef | Web of Science | Medline9
Williams BA ,Hirt RP ,Lucocq JM ,Embley TM . A mitochondrial remnant in the microsporidian Trachipleistophora hominis. Nature 2002;418:865-869
CrossRef | Web of Science | Medline10
Chupp GL ,Alroy J ,Adelman LS ,Breen JC ,Skolnik PR . Myositis due to Pleistophora (Microsporidia) in a patient with AIDS. Clin Infect Dis 1993;16:15-21
CrossRef | Web of Science | Medline11
Ledford DK ,Overman MD ,Gonzalvo A ,Cali A ,Mester SW ,Lockey RF . Microsporidiosis myositis in a patient with the acquired immunodeficiency syndrome. Ann Intern Med 1985;102:628-630
Web of Science | Medline12
Cali A ,Takvorian PM . Ultrastructure and development of Pleistophora ronneafiei n. sp., a microsporidium (Protista) in the skeletal muscle of an immune-compromised individual. J Eukaryot Microbiol 2003;50:77-85
CrossRef | Web of Science | Medline13
Field AS ,Marriott DJ ,Milliken ST , et al. Myositis associated with a newly described microsporidian, Trachipleistophora hominis, in a patient with AIDS. J Clin Microbiol 1996;34:2803-2811
Web of Science | Medline14
Weber R ,Bryan RT ,Schwartz DA ,Owen RL . Human microsporidial infections. Clin Microbiol Rev 1994;7:426-461
Web of Science | Medline15
Gumbo T ,Hobbs RE ,Carlyn C ,Hall G ,Isada CM . Microsporidia infection in transplant patients. Transplantation 1999;67:482-484
CrossRef | Web of Science | Medline16
Latib MA ,Pascoe MD ,Duffield MS ,Kahn D . Microsporidiosis in the graft of a renal transplant recipient. Transpl Int 2001;14:274-277
CrossRef | Web of Science | Medline17
Mohindra AR ,Lee MW ,Visvesvara G , et al. Disseminated microsporidiosis in a renal transplant recipient. Transpl Infect Dis 2002;4:102-107
CrossRef | Medline18
Rabodonirina M ,Bertocchi M ,Desportes-Livage I , et al. Enterocytozoon bieneusi as a cause of chronic diarrhea in a heart-lung transplant recipient who was seronegative for human immunodeficiency virus. Clin Infect Dis 1996;23:114-117
CrossRef | Web of Science | Medline19
Sax PE ,Rich JD ,Pieciak WS ,Trnka YM . Intestinal microsporidiosis occurring in a liver transplant recipient. Transplantation 1995;60:617-618
CrossRef | Web of Science | Medline20
Cali A ,Meisler DM ,Lowder CY , et al. Corneal microsporidioses: characterization and identification. J Protozool 1991;38:215S-217S
Medline21
Trammer T ,Chioralia G ,Maier WA ,Seitz HM . In vitro replication of Nosema algerae (Microsporidia), a parasite of anopheline mosquitoes, in human cells above 36 degrees C. J Eukaryot Microbiol 1999;46:464-468
CrossRef | Web of Science | Medline22
Brooks WM. Entomogenous protozoa. In: Ignoffo CM, ed. CRC handbook of natural pesticides. Vol. 5. Microbial insecticides. Part A. Entomogenous protozoa and fungi. Boca Raton, Fla.: CRC Press, 1988:1-149.
23
Koudela B ,Visvesvara GS ,Moura H ,Vavra J . The human isolate of Brachiola algerae (Phylum Microspora): development in SCID mice and description of its fine structure features. Parasitology 2001;123:153-162
CrossRef | Web of Science | Medline24
Myers A ,Clark J ,Foster H . Tuberculosis and treatment with infliximab. N Engl J Med 2002;346:625-625
Full Text | Web of Science25
Keane J ,Gershon S ,Wise RP , et al. Tuberculosis associated with infliximab, a tumor necrosis factor α-neutralizing agent. N Engl J Med 2001;345:1098-1104
Full Text | Web of Science | Medline26
Lee JH ,Slifman NR ,Gershon SK , et al. Life-threatening histoplasmosis complicating immunotherapy with tumor necrosis factor alpha antagonists infliximab and etanercept. Arthritis Rheum 2002;46:2565-2570
CrossRef | Web of Science | Medline27
Tai TL ,O'Rourke KP ,McWeeney M ,Burke CM ,Sheehan K ,Barry M . Pneumocystis carinii pneumonia following a second infusion of infliximab. Rheumatology (Oxford) 2002;41:951-952
CrossRef | Web of Science | Medline28
Senaldi G ,Yin S ,Shaklee CL ,Piguet PF ,Mak TW ,Ulich TR . Corynebacterium parvum- and Mycobacterium bovis bacillus Calmette-Guerin-induced granuloma formation is inhibited in TNF receptor I (TNF-RI) knockout mice and by treatment with soluble TNF-RI. J Immunol 1996;157:5022-5026
Web of Science | Medline29
Khan IA ,Moretto M . Role of gamma interferon in cellular immune response against murine Encephalitozoon cuniculi infection. Infect Immun 1999;67:1887-1893
Web of Science | Medline30
Khan IA ,Moretto M ,Weiss LM . Immune response to Encephalitozoon cuniculi infection. Microbes Infect 2001;3:401-405
CrossRef | Web of Science | Medline31
Sharpstone D ,Rowbottom A ,Francis N , et al. Thalidomide: a novel therapy for microsporidiosis. Gastroenterology 1997;112:1823-1829[Erratum, Gastroenterology 1997;113:1054.]
CrossRef | Web of Science | Medline32
Didier ES ,Shadduck JA . IFN-gamma and LPS induce murine macrophages to kill Encephalitozoon cuniculi in vitro. J Eukaryot Microbiol 1994;41:34S-34S
Web of Science | Medline33
Weidner E ,Canning EU ,Rutledge CR ,Meek CL . Mosquito (Diptera: Culicidae) host compatibility and vector competency for the human myositic parasite Trachipleistophora hominis (phylum microspora). J Med Entomol 1999;36:522-525
Web of Science | Medline
- Citing Articles (33)
Citing Articles
1
Chusana Suankratay, Ekkachai Thiansukhon, Voraphoj Nilaratanakul, Chaturong Putaporntip, Somchai Jongwutiwes. (2012) Disseminated Infection Caused by Novel Species of Microsporidium , Thailand. Emerging Infectious Diseases 18:2, 302-304
CrossRef2
Samar N. El-Beshbishi, Nairmen N. Ahmed, Samar H. Mostafa, Goman A. El-Ganainy. (2011) Parasitic infections and myositis. Parasitology Research
CrossRef3
Mohammed Selman, Jean-François Pombert, Leellen Solter, Laurent Farinelli, Louis M. Weiss, Patrick Keeling, Nicolas Corradi. (2011) Acquisition of an animal gene by microsporidian intracellular parasites. Current Biology 21:15, R576-R577
CrossRef4
A. K. Reddy, P. K. Balne, P. Garg, S. Krishnaiah. (2011) Is microsporidial keratitis a seasonal infection in India?. Clinical Microbiology and Infection 17:7, 1114-1116
CrossRef5
Jiří Vávra, Martin Kamler, David Modrý, Břetislav Koudela. (2011) Opportunistic nature of the mammalian microsporidia: experimental transmission of Trachipleistophora extenrec (Fungi: Microsporidia) between mammalian and insect hosts. Parasitology Research 108:6, 1565-1573
CrossRef6
Stefanie Steinert, Elena A. Levashina. (2011) Intracellular immune responses of dipteran insects. Immunological Reviews 240:1, 129-140
CrossRef7
Sophia Koo, Francisco M. Marty, Lindsey R. Baden. (2011) Infectious Complications Associated with Immunomodulating Biologic Agents. Hematology/Oncology Clinics of North America 25:1, 117-138
CrossRef8
S. Richelle Monaghan, Rebecca L. Rumney, Nguyen T. K. Vo, Niels C. Bols, Lucy E. J. Lee. (2011) In vitro growth of microsporidia Anncaliia algerae in cell lines from warm water fish. In Vitro Cellular & Developmental Biology - Animal 47:2, 104-113
CrossRef9
ANN CALI, RONALD NEAFIE, LOUIS M. WEISS, KAYA GHOSH, REBECCA B. VERGARA, RACHNA GUPTA, PETER M. TAKVORIAN. (2010) Human Vocal Cord Infection with the Microsporidium Anncaliia algerae. Journal of Eukaryotic Microbiology 57:6, 562-567
CrossRef10
Nancy F. Crum-Cianflone. (2010) Nonbacterial Myositis. Current Infectious Disease Reports 12:5, 374-382
CrossRef11
Sophia Koo, Francisco M. Marty, Lindsey R. Baden. (2010) Infectious Complications Associated with Immunomodulating Biologic Agents. Infectious Disease Clinics of North America 24:2, 285-306
CrossRef12
John Jeff Alvarado, Anjana Nemkal, J. Michael Sauder, Marijane Russell, Donna E. Akiyoshi, Wuxian Shi, Steven C. Almo, Louis M. Weiss. (2009) Structure of a microsporidian methionine aminopeptidase type 2 complexed with fumagillin and TNP-470. Molecular and Biochemical Parasitology 168:2, 158-167
CrossRef13
S. Richelle Monaghan, Michael L. Kent, Virginia G. Watral, R. John Kaufman, Lucy E. J. Lee, Niels C. Bols. (2009) Animal cell cultures in microsporidial research: their general roles and their specific use for fish microsporidia. In Vitro Cellular & Developmental Biology - Animal 45:3-4, 135-147
CrossRef14
Shajahan Johny, Troy M. Larson, Leellen F. Solter, Kevin A. Edwards, Douglas W. Whitman. (2009) Phylogenetic characterization of Encephalitozoon romaleae (Microsporidia) from a grasshopper host: Relationship to Encephalitozoon spp. infecting humans. Infection, Genetics and Evolution 9:2, 189-195
CrossRef15
G. J. LEITCH, C. CEBALLOS. (2009) A role for antimicrobial peptides in intestinal microsporidiosis. Parasitology 136:02, 175
CrossRef16
Gordon J. Leitch, Carolina Ceballos. (2008) Effects of host temperature and gastric and duodenal environments on microsporidia spore germination and infectivity of intestinal epithelial cells. Parasitology Research 104:1, 35-42
CrossRef17
Shajahan Johny, Douglas W. Whitman. (2008) Effect of four antimicrobials against an Encephalitozoon sp. (Microsporidia) in a grasshopper host. Parasitology International 57:3, 362-367
CrossRef18
Abdel Belkorchia, Corinne Biderre, Cécile Militon, Valérie Polonais, Patrick Wincker, Claire Jubin, Frédéric Delbac, Eric Peyretaillade, Pierre Peyret. (2008) In vitro propagation of the microsporidian pathogen Brachiola algerae and studies of its chromosome and ribosomal DNA organization in the context of the complete genome sequencing project. Parasitology International 57:1, 62-71
CrossRef19
Robert Orenstein, Eric L Matteson. (2007) Opportunistic infections associated with TNF-α treatment. Future Rheumatology 2:6, 567-576
CrossRef20
Hollie Hale-Donze, Elizabeth S Didier. 2007. Microsporidioses. .
CrossRef21
Theodore G. Andreadis. (2007) MICROSPORIDIAN PARASITES OF MOSQUITOES. Journal of the American Mosquito Control Association 23:sp2, 3-29
CrossRef22
Ndongo Dia, Laurence Lavie, Guy Méténier, Bhen S. Toguebaye, Christian P. Vivarès, Emmanuel Cornillot. (2007) InterB multigenic family, a gene repertoire associated with subterminal chromosome regions of Encephalitozoon cuniculi and conserved in several human-infecting microsporidian species. Current Genetics 51:3, 171-186
CrossRef23
Lesley Ann Saketkoo, Luis R. Espinoza. (2006) Impact of Biologic Agents on Infectious Diseases. Infectious Disease Clinics of North America 20:4, 931-961
CrossRef24
Elizabeth S Didier, Louis M Weiss. (2006) Microsporidiosis: current status. Current Opinion in Infectious Diseases 19:5, 485-492
CrossRef25
Robert Orenstein. (2006) Infections related to TNF-α inhibitors. Expert Review of Dermatology 1:5, 737-749
CrossRef26
CASPAR FRANZEN, ELENA S. NASSONOVA, JURGEN SCHOLMERICH, IRMA V. ISSI. (2006) Transfer of the Members of the Genus Brachiola (Microsporidia) to the Genus Anncaliia Based on Ultrastructural and Molecular Data. The Journal of Eukaryotic Microbiology 53:1, 26-35
CrossRef27
Nancy F. Crum, Edith R. Lederman, Mark R. Wallace. (2005) Infections Associated With Tumor Necrosis Factor-?? Antagonists. Medicine 84:5, 291-302
CrossRef28
Caspar Franzen, Melanie Hösl, Bernd Salzberger, Pia Hartmann. (2005) UPTAKE OF ENCEPHALITOZOON SPP. AND VITTAFORMA CORNEAE (MICROSPORIDIA) BY DIFFERENT CELLS. Journal of Parasitology 91:4, 745-749
CrossRef29
Yanji Xu, Louis M. Weiss. (2005) The microsporidian polar tube: A highly specialised invasion organelle. International Journal for Parasitology 35:9, 941-953
CrossRef30
CASPAR FRANZEN, SUSANNE FISCHER, JOSEF SCHROEDER, WILFRID BLEISS, STEPHAN SCHNEUWLY, JURGEN SCHOLMERICH, BERND SALZBERGER. (2005) In Vitro Cultivation of an Insect Microsporidian Tubulinosema ratisbonensis in Mammalian Cells. The Journal of Eukaryotic Microbiology 52:4, 349-355
CrossRef31
Elizabeth S Didier, Joseph A Maddry, Paul J Brindley, Mary E Stovall, Peter J Didier. (2005) Therapeutic strategies for human microsporidia infections. Expert Review of Anti-infective Therapy 3:3, 419-434
CrossRef32
Elizabeth S. Didier. (2005) Microsporidiosis: An emerging and opportunistic infection in humans and animals. Acta Tropica 94:1, 61-76
CrossRef33
ANN CALI, LOUIS M. WEISS, PETER M. TAKVORIAN. (2004) An Analysis of the Microsporidian Genus Brachiola, with Comparisons of Human and Insect Isolates of Brachiola algerae. The Journal of Eukaryotic Microbiology 51:6, 678-685
CrossRef
