Join the 200th Anniversary Celebration

Original Article

Brief Report

Laboratory-Acquired Severe Acute Respiratory Syndrome

Poh Lian Lim, M.D., M.P.H., Asok Kurup, M.B., B.S., Gowri Gopalakrishna, M.Sc., Kwai Peng Chan, M.B., B.S., Christopher W. Wong, Ph.D., Lee Ching Ng, Ph.D., Su Yun Se-Thoe, Ph.D., Lynette Oon, M.B., B.S., Xinlai Bai, M.Sc., Lawrence W. Stanton, Ph.D., Yijun Ruan, Ph.D., Lance D. Miller, Ph.D., Vinsensius B. Vega, M.Sc., Lyn James, M.B., B.S., M.Med., Peng Lim Ooi, M.B., B.S., M.P.H., Chew Suok Kai, M.B., B.S., Sonja J. Olsen, Ph.D., Brenda Ang, M.B., B.S., and Yee-Sin Leo, M.B., B.S.

N Engl J Med 2004; 350:1740-1745April 22, 2004

Article

The outbreak of severe acute respiratory syndrome (SARS) in Singapore ended in late May 2003.1 The Centers for Disease Control and Prevention (CDC) removed its travel alerts for Toronto, Hong Kong, China, and Taiwan shortly thereafter.2 We report the first case of SARS to occur in Singapore after the initial worldwide outbreak ended. Our report documents the transmission of SARS in a laboratory setting.

Case Report

A 27-year-old graduate student in microbiology at a local university was admitted to Singapore General Hospital on September 3, 2003, with fever. In July and August 2003, he had worked with a nonattenuated strain of West Nile virus in a biosafety level 3 (BSL-3) laboratory at Institute A, where research on SARS-associated coronavirus (SARS-CoV), dengue virus, and Kunjin virus was also conducted. The patient's illness had begun on August 26, 2003, with fever, headache, and polyarthralgia. Three days later, evaluation at the emergency department at Singapore General Hospital revealed apyrexia and a normal complete blood count and chest radiograph, so he was discharged home. He returned with persistent fever on September 3 and was admitted. A review of systems was notable only for a dry cough of two days' duration. He reported no history of exposure to SARS and no clinically significant travel history.

On admission, the patient had a temperature of 37.6°C. Oxygen saturation was 98 percent while he was breathing ambient air. The physical examination was unremarkable. Laboratory evaluation showed mild leukopenia, thrombocytopenia, transaminitis, and an elevated lactate dehydrogenase level of 709 U per liter (normal range, 180 to 380). His chest radiograph was normal. Investigations included routine blood cultures and testing for various pathogens. Sputum, blood, stool, and conjunctival swab specimens obtained on September 3, 4, and 8 were sent for SARS-CoV testing (Table 1Table 1Diagnostic Test Results.).

The patient was initially admitted to a general ward. The following day, he was transferred to an isolation room because of concern regarding the remote possibility of exposure to SARS. On September 8, a polymerase-chain-reaction (PCR) assay of a sputum sample and a serologic test of a blood sample were reported to be positive for SARS-CoV. The Singapore Ministry of Health was notified, and the patient was transferred to the designated isolation facility at Tan Tock Seng Hospital. Chest radiographs on September 11 showed a left midzone pulmonary infiltrate. Computed tomography of the thorax on September 13 (Figure 1Figure 1High-Resolution Computed Tomographic Scan of the Chest Showing Ground-Glass Opacity at the Apical Segment (Panel A) and Superior Aspect of the Posterior Segment (Panel B) of the Left Lower Lobe.) confirmed the presence of the pulmonary infiltrate in the apical segment of the left lower lobe. The patient's respiratory status remained stable, requiring no supplemental oxygen. His fever resolved 12 days after onset, and his dry cough persisted for another week. He was discharged on September 16 and spent 14 days in home quarantine.

Methods

Epidemiologic Investigations

We reviewed medical records and interviewed the patient, his family, and work contacts. We conducted a thorough review of laboratory biosafety procedures, including written procedures, inspected the facility, and interviewed personnel about training and practice procedures.

Laboratory Investigations

Sputum, blood, stool, and conjunctival swab specimens from the patient were sent for SARS-CoV testing. Testing for additional pathogens included blood cultures for bacteria, blood smears for malaria, serologic tests for dengue, cytomegalovirus, Epstein–Barr virus, parvovirus B19, and toxoplasma, as well as reverse-transcriptase PCR (RT-PCR) for dengue, West Nile virus, and OC43 and 229E coronaviruses. The sample of West Nile virus that had been handled by the patient was sent to two different laboratories for RT-PCR for West Nile virus and SARS-CoV.

Nucleic Acid Extraction

The QIAamp DNA Stool Mini Kit (Qiagen) was used on the stool samples. RNA from the other clinical samples and the sample of West Nile virus was extracted with the use of the QIAamp Viral RNA Mini Kit.

RT-PCR

Clinical samples were tested for SARS-CoV by means of three PCR assays: RealArt HPA-Coronavirus LC RT PCR (Artus), LightCycler SARS-CoV Quantification Kit (Roche), and an in-house one-step RT-PCR that used primers targeted at the nucleocapsid gene,4 SANS1 5'TGGACCCACAGATTCAACTGA3' and SANPAs2 5'GCTGTGAACCAAGACGCAGTAT3', and the probe 5'FAM-TAACCAGAATGGAGGACGCAATGG-TAMRA3'. The sample of West Nile virus was tested for SARS-CoV by means of the same assays, as well as conventional nested PCR.3 RT-PCR for West Nile virus was performed according to the methods of Shi et al.5 and Scaramozzino et al.6

Serologic Analysis

Enzyme immunoassay was performed according to the CDC protocol; the lysate of SARS-CoV–infected Vero E6 cells and lysate of uninfected Vero E6 cells were supplied by the CDC. Immunofluorescence assays for the detection of IgM and IgG were carried out on SARS-CoV–infected Vero E6 cells that had been placed onto the top row of 12-well Teflon-coated slides and uninfected Vero E6 cells that had been placed on the bottom row. Rabbit antihuman IgM and IgG conjugated to fluorescein isothiocyanate was used (Dako). Serum samples from the patient's work contacts were also tested for the presence of SARS-CoV antibodies by enzyme immunoassay.

Viral Culture

A sputum sample collected on September 4, 2003, was inoculated onto Vero E6 cells.

Sequence Analysis of the SARS-CoV Viral Genome

RNA was extracted from the patient's sputum and the sample of West Nile virus and then converted to complementary DNA by reverse transcription with the use of a set of primers across the SARS-CoV genome. Two rounds of PCR with nested primers were used to amplify the viral genome. Sufficient amplified DNA was obtained to perform DNA sequencing for 15 of the 16 regions of the viral genome. The sequence of the genome for strain Sin0409, which was the patient's isolate, and SinWNV, which was the isolate from the sample of West Nile virus, was derived by two independent methods: sequencing by hybridization with the use of DNA resequencing arrays,7 and conventional sequencing with the use of automated capillary-based instrumentation.8

Results

Epidemiologic Investigations

The university and the laboratory where the patient worked do not maintain stocks of live SARS-CoV. The patient reported no prior BSL-3 laboratory training; his previous experience was with the attenuated Sarafend strain of West Nile virus, a biosafety level 2 agent. An interest in comparing this strain with the more pathogenic New York strain of West Nile virus necessitated his working in a BSL-3 laboratory. An agreement was made for him to do this work at the BSL-3 facility at Institute A. Institute A had been heavily involved in SARS-CoV work during the outbreak and continued this work through August 2003.

The patient visited Institute A three times in late July. He entered the BSL-3 laboratory on only one of these visits, during which he was trained for 20 minutes in BSL-3 procedures. He then proceeded to inoculate cells with West Nile virus. The flasks subsequently showed evidence of bacterial contamination and were destroyed. A laboratory technician at Institute A performed the second inoculation without the patient present. During the next few weeks, the technician maintained the cells while simultaneously continuing routine work on SARS-CoV.

The patient's fourth and final visit to Institute A was on August 23, 2003, three days before the onset of illness. That morning, before the patient's arrival, the technician combined two T75 flasks containing the previously inoculated West Nile virus into one 50-ml tube and centrifuged it. The patient entered the BSL-3 laboratory three times that day. The first time, he went in with the technician, wearing only street clothes, and did not engage in any work. The technician removed the centrifuge tube from the protective container in the open laboratory, placed it under a biosafety hood, and provided the patient with further instructions. Both then exited the laboratory. The patient reported putting on a gown and two sets of gloves before reentering the laboratory alone, where he spent 20 minutes unsupervised, transferring the cell supernatant into prelabeled cryovials using plastic, disposable Pasteur pipettes. He added bleach to the used tube before discarding it. All tasks were completed under the biosafety hood. After completion, he exited the laboratory to meet the technician. Together, both reentered the laboratory and transferred the cryovials to a –70°C freezer located in the biosafety level 2 facility. The cryovials remained in the freezer; no further work on them was reported.

Interviews with the patient's family and work contacts did not identify any other possible source of infection with SARS-CoV. One work contact had had a gastrointestinal illness a week before the patient became ill; however, his clinical symptoms differed from those characteristic of SARS, and he had no antibodies against SARS-CoV 27 days after the onset of illness. None of the contacts reported a clinically significant history of travel or contact with a patient with SARS during the Singapore outbreak between March and May 2003.

A total of 8 household contacts, 2 community contacts, 32 hospital contacts, and 42 work contacts were identified, of whom 25 were placed under home quarantine. Both laboratories where the patient had worked were closed as a precautionary measure. Environmental samples were not obtained because the laboratory had been extensively disinfected.

PCR, Serologic Analyses, and Viral Culture

The patient's sputum and stool samples collected on September 4 were positive for SARS-CoV on all three PCR assays. Conjunctival and blood samples were negative for SARS-CoV on PCR. These clinical samples were reextracted; repeated PCR with the use of the Artus kit yielded the same results. However, no SARS-CoV was cultured from sputum after 15 days of incubation.

PCR testing for West Nile virus was positive on the sample of West Nile virus from the cryovial handled by the patient. In addition, however, high levels of SARS-CoV RNA (4.625×106 copies per milliliter) were detected in the same cryovial.

The patient's serum sample collected on September 3 was negative for SARS-CoV antibody on enzyme immunoassay and immunofluorescence assays, whereas that collected on September 8 had a titer of at least 6400 on enzyme immunoassay and was positive for IgM and IgG (titer, 160) on immunofluorescence assays. The patient's samples were negative for all other pathogens except cytomegalovirus, for which he had a positive IgG titer (Table 1).

Serologic tests of samples obtained from 24 quarantined contacts four weeks after their last exposure to the patient were negative for SARS-CoV.9 Work contacts were tested a median of 20 days (range, 16 to 24) after their last contact with the patient. None of them had been exposed to the patient after he became ill. Serologic analyses of blood samples obtained from the technician on September 10 and September 16, 18 and 24 days, respectively, after her last possible exposure to the patient, were negative for SARS-CoV. She was not tested for West Nile virus infection.

Genome Sequence Analysis of SARS-CoV from the Patient

A partial sequence (87 percent complete) was determined for the SARS viral genome isolated from the patient. The sequence of this strain, Sin0409, was compared with 44 SARS-CoV genomes determined for strains collected from patients around the world. The Sin0409 sequence was inspected at 13 key positions that varied among previously sequenced SARS-CoV genomes. The presence or absence of these variant nucleotides represents signatures within the viral genome and has proved useful to establish links in SARS-transmission histories.10 These signature sequences were used to determine the most likely origin of the patient's illness. The sequence of the 13 signature positions within Sin0409 showed that it was most similar to Sin2774 (Figure 2Figure 2Molecular Relationships among 47 SARS-CoV Genomes.). Sin2774 was isolated early in the epidemic from a primary contact of the first index patient (Sin2500) in Singapore. This strain has become the predominant laboratory strain used in SARS research in Singapore. The close sequence similarity of the patient's SARS virus with the laboratory strain provides additional evidence of laboratory transmission.

The SARS-CoV strain (SinWNV) isolated from the sample of West Nile virus was partially (91 percent) sequenced and compared with the sequence of the patient's sample and of all other SARS genome sequences (Figure 2). The SinWNV sequence was identical to Sin2774 at the 13 key positions and thus confirmed that this sample of West Nile virus was contaminated with the laboratory strain of SARS. The sequence of Sin0409 had a deletion of 47 bases that had not been seen in any other SARS strain, including previously sequenced isolates of the laboratory strain Sin2774. The identical deletion was found in the SinWNV isolate, which strongly implicates this laboratory stock as the source of the SARS-CoV that infected the patient.

Discussion

This case report is clinically significant because it documents the occurrence of SARS since the worldwide epidemic ended in July 2003. The clinical features and incubation period are consistent with those of previously described cases of SARS,11,12 the positive results for SARS-CoV on PCR of clinical specimens were borne out by different assays, and the patient had seroconversion to SARS-CoV.

This case is scientifically important in that it documents laboratory-acquired SARS-CoV infection. Other, nonlaboratory sources of infection were investigated and ruled out. The patient could have been infected earlier and had a latent SARS-CoV infection. However, the presence of SARS-CoV nucleic acid in sputum and stool samples and the documented seroconversion, which coincided with a clinical illness compatible with SARS, indicate that he had an acute infection. Alternatively, the patient could have been exposed to another person with unrecognized SARS infection. However, the findings of the epidemiologic investigation do not provide support for this theory.

The most likely explanation is that the patient acquired his infection in the laboratory. The strongest evidence supporting this assertion was the presence of SARS-CoV in the sample of West Nile virus with which he had been working three days before his illness began. Furthermore, the strain isolated from the patient had the same signature sequences as the SARS-CoV found to be contaminating the sample of West Nile virus, and these sequences, in turn, were highly similar to those of the predominant research strain in Institute A and Singapore.

Both West Nile virus and SARS-CoV are grown in Vero E6 cells.13,14 Although the precise mechanism of contamination remains unknown in this case, the high level of SARS-CoV in the sample of West Nile virus suggests that the two viruses were growing simultaneously in the cells and indicates that contamination occurred before August 23. Titers of SARS-CoV range from 0 to 6 log copies per milliliter, depending on the sample; respiratory specimens typically yield higher titers than stool specimens (0 to 1 log copy per milliliter). The moderately high SARS-CoV titer in the contaminated cryovial of West Nile virus relative to that in respiratory and stool samples may well account for the occurrence of this case of laboratory-acquired SARS, despite the fact that large numbers of clinical specimens were processed during the previous epidemic.

Until now, human-to-human spread has been the predominant mode of transmission of SARS.11,15 Laboratory-acquired infections have been documented with other pathogens, including West Nile virus.16 We postulate that transmission occurred as the result of an error made by the technician, the patient, or both. However, interviews with both persons identified no previous, recognized laboratory accidents. We speculate that the patient was not coinfected with West Nile virus because this virus is transmitted by parenteral exposure.16 This case of laboratory-acquired SARS indicates that concern regarding the potential risk to laboratory personnel is justified, and the epidemiologic criteria in the current case definitions of the World Health Organization (WHO)17 and CDC9 may need to be amended to include laboratory exposure to SARS-CoV as a risk factor for infection. Furthermore, because laboratories handling live SARS-CoV are potential sources of infection, this case highlights the importance of strict adherence to effective biosafety practices.18

This case underscores the need for unceasing vigilance and for the ability to respond swiftly and comprehensively in order to prevent another outbreak of SARS. The patient's illness was mild and his radiologic findings developed late, making the diagnosis dependent on a high index of suspicion and the availability of reliable laboratory tests. A delay in diagnosis in hospital settings increases the risk that the outbreak will spread and ultimately reach the community. This is the challenge we now face in preparing for the next reemergence of SARS.

We are indebted to Dr. T.G. Ksiazek and the CDC in Atlanta for generously providing the SARS-CoV reagents and protocol for the enzyme immunoassay; to Dr. Raymond Lin from the Department of Laboratory Medicine at KK Women's and Children's Hospital for performing the PCR for OC43 and 229E; to Dr. Timothy Barkham from the Department of Microbiology at Tan Tock Seng Hospital for microbiologic support; to Dr. Gregory Kaw from the Department of Radiology at Tan Tock Seng Hospital for providing the computed tomographic images; and to the members of the international biosafety-review panel, including Dr. Antony James Della-Porta (chair) and Dr. Kazuyoshi Sugiyama from the WHO and Dr. Pierre E. Rollin from the CDC, for their contributions.

Source Information

From the Department of Infectious Diseases, Tan Tock Seng Hospital (P.L.L., B.A., Y.-S.L.); the Departments of Medicine (A.K.) and Pathology (K.P.C., S.Y.S-T., L.O., X.B.), Singapore General Hospital; the Ministry of Health (G.G., L.J., P.L.O., C.S.K.); the Genome Institute of Singapore (C.W.W., L.W.S., Y.R., L.D.M., V.B.V.); and DSO National Laboratories (L.C.N.) — all in Singapore; and the International Emerging Infections Program, Centers for Disease Control and Prevention, Nonthaburi, Thailand (S.J.O.).

Address reprint requests to Dr. Lim at the Department of Infectious Diseases, Tan Tock Seng Hospital, 11 Jalan Tan Tock Seng, Singapore 308433, or at .

References

References

  1. 1

    Centers for Disease Control and Prevention. Travel alert removed: Singapore. (Accessed March 26, 2004, at http://www.cdc.gov/travel/other/sarssingapore.htm.)

  2. 2

    SARS information for travelers: February 11, 2004. (Accessed March 26, 2004, at http://www.cdc.gov/ncidod/sars/travel.htm.)

  3. 3

    Ng LFP, Wong M, Koh S, et al. Detection of severe acute respiratory syndrome coronavirus in blood of infected patients. J Clin Microbiol 2004;42:347-350
    CrossRef | Web of Science | Medline

  4. 4

    Research, therapy and training in tropical medicine: centenary of the tropical institute. Hamburg, Germany: Bernhard-Nocht-Institute of Tropical Medicine, 2000. (Accessed March 26, 2004 at http://www.bni-hamburg.de.)

  5. 5

    Shi PY, Kauffman EB, Ren P, et al. High-throughput detection of West Nile virus RNA. J Clin Microbiol 2001;39:1264-1271
    CrossRef | Web of Science | Medline

  6. 6

    Scaramozzino N, Crance JM, Jouan A, DeBriel DA, Stoll F, Garin D. Comparison of flavivirus universal primer pairs and development of a rapid, highly sensitive heminested reverse transcription-PCR assay for detection of flaviviruses targeted to a conserved region of the NS5 gene sequences. J Clin Microbiol 2001;39:1922-1927
    CrossRef | Web of Science | Medline

  7. 7

    Wong CW, Albert TJ, Vega VB, et al. Tracking the evolution of the SARS coronavirus using rapid, high-throughput, high-density resequencing arrays. Genome Res 2004;14:398-405
    CrossRef | Web of Science | Medline

  8. 8

    Ruan YJ, Wei CL, Fe AL, et al. Comparative full-length genome sequence analysis of 14 SARS coronavirus isolates and common mutations associated with putative origins of infection. Lancet 2003;361:1779-1785[Erratum, Lancet 2003;361:1832.]
    CrossRef | Web of Science | Medline

  9. 9

    Centers for Disease Control and Prevention. Updated interim U.S. case definition for severe acute respiratory syndrome (SARS). (Accessed March 26, 2004, at http://www.cdc.gov/ncidod/sars/casedefinition.htm.)

  10. 10

    Swofford DL. PAUP: phylogenetic analysis using parsimony (and other methods), version 4.0. Sunderland, Mass.: Sinauer, 2002.

  11. 11

    Booth CM, Matukas LM, Tomlinson GA, et al. Clinical features and short-term outcomes of 144 patients with SARS in the greater Toronto area. JAMA 2003;289:2801-2809[Erratum, JAMA 2003;290:334.]
    CrossRef | Web of Science | Medline

  12. 12

    Hsu L-Y, Lee C-C, Green JA, et al. Severe acute respiratory syndrome (SARS) in Singapore: clinical features of index patient and initial contacts. Emerg Infect Dis 2003;9:713-717
    Web of Science | Medline

  13. 13

    Ksiazek TG, Erdman D, Goldsmith CS, et al. A novel coronavirus associated with severe acute respiratory syndrome. N Engl J Med 2003;348:1953-1966
    Full Text | Web of Science | Medline

  14. 14

    Lanciotti RS, Kerst AJ, Nasci RS, et al. Rapid detection of West Nile virus from human clinical specimens, field-collected mosquitoes, and avian samples by a TaqMan reverse transcriptase-PCR assay. J Clin Microbiol 2000;38:4066-4071
    Web of Science | Medline

  15. 15

    Seto WH, Tsang D, Yung RW, et al. Effectiveness of precautions against droplets and contact in prevention of nosocomial transmission of severe acute respiratory syndrome (SARS). Lancet 2003;361:1519-1520
    CrossRef | Web of Science | Medline

  16. 16

    Laboratory-acquired West Nile virus infections -- United States, 2002. MMWR Morb Mortal Wkly Rep 2002;51:1133-1135
    Medline

  17. 17

    World Health Organization. Case definitions for surveillance of severe acute respiratory syndrome (SARS). (Accessed March 26, 2004, at http://www.who.int/csr/sars/casedefinition/en.)

  18. 18

    Biosafety and SARS incident in Singapore September 2003: report of the Review Panel on New SARS Case and Biosafety. Singapore: Ministry of Health, 2003. (Accessed March 26, 2004, at http://www.moh.gov.sg/sars/advisories/default.html.)

Citing Articles (30)

Citing Articles

  1. 1

    Pedro B.S. Pedrosa, Telma A.O. Cardoso. (2011) Viral infections in workers in hospital and research laboratory settings: a comparative review of infection modes and respective biosafety aspects. International Journal of Infectious Diseases 15:6, e366-e376
    CrossRef

  2. 2

    Tara N. Palmore, Kent A. Sepkowitz. 2011. Airborne Infectious Diseases. .
    CrossRef

  3. 3

    Tara N. Palmore, Kent A. Sepkowitz. 2010. Airborne Infectious Diseases. .
    CrossRef

  4. 4

    Larry J. Anderson, Suxiang Tong. (2010) Update on SARS research and other possibly zoonotic coronaviruses. International Journal of Antimicrobial Agents 36, S21-S25
    CrossRef

  5. 5

    P. Brouqui. (2009) Facing highly infectious diseases: new trends and current concepts. Clinical Microbiology and Infection 15:8, 700-705
    CrossRef

  6. 6

    Philippe Brouqui, Vincenzo Puro, Francesco M Fusco, Barbara Bannister, Stephan Schilling, Per Follin, René Gottschalk, Robert Hemmer, Helena C Maltezou, Kristi Ott, Renaat Peleman, Christian Perronne, Gerard Sheehan, Heli Siikamäki, Peter Skinhoj, Giuseppe Ippolito. (2009) Infection control in the management of highly pathogenic infectious diseases: consensus of the European Network of Infectious Disease. The Lancet Infectious Diseases 9:5, 301-311
    CrossRef

  7. 7

    Barbara Bannister, Vincenzo Puro, Francesco Maria Fusco, Julia Heptonstall, Giuseppe Ippolito. (2009) Framework for the design and operation of high-level isolation units: consensus of the European Network of Infectious Diseases. The Lancet Infectious Diseases 9:1, 45-56
    CrossRef

  8. 8

    Sriram Kammila, Dipankar Das, Pravin K. Bhatnagar, Hoon H. Sunwoo, Gustavo Zayas-Zamora, Malcolm King, Mavanur R. Suresh. (2008) A rapid point of care immunoswab assay for SARS-CoV detection. Journal of Virological Methods 152:1-2, 77-84
    CrossRef

  9. 9

    Philip Keith Pattemore, Lance C. Jennings. 2008. Epidemiology of Respiratory Infections. , 435-452.
    CrossRef

  10. 10

    Jane D. Siegel, Emily Rhinehart, Marguerite Jackson, Linda Chiarello. (2007) 2007 Guideline for Isolation Precautions: Preventing Transmission of Infectious Agents in Health Care Settings. American Journal of Infection Control 35:10, S65-S164
    CrossRef

  11. 11

    Mohammad Madjid, Russell V. Luepker, Kurt J. Greenlund, Kathryn A. Taubert, Michael J. Roy, Rose Marie Robertson. (2007) Task Force IV: Cardiovascular Effects of Emerging Infectious Diseases and Biological Terrorism Threats. Journal of the American College of Cardiology 49:12, 1407-1412
    CrossRef

  12. 12

    Julian W. Tang, Jo L.K. Cheung, Ida M.T. Chu, Margaret Ip, Mamie Hui, Malik Peiris, Paul K.S. Chan. (2007) Characterizing 56 complete SARS-CoV S-gene sequences from Hong Kong. Journal of Clinical Virology 38:1, 19-26
    CrossRef

  13. 13

    Lauren J. Stockman, Mehran S. Massoudi, Rita Helfand, Dean Erdman, Alison M. Siwek, Larry J. Anderson, Umesh D. Parashar. (2007) Severe Acute Respiratory Syndrome in Children. The Pediatric Infectious Disease Journal 26:1, 68-74
    CrossRef

  14. 14

    Philip W. Smith, Arthur O. Anderson, George W. Christopher, Theodore J. Cieslak, G. J. Devreede, Glen A. Fosdick, Carl B. Greiner, John M. Hauser, Steven H. Hinrichs, Kermit D. Huebner, Peter C. Iwen, Dawn R. Jourdan, Mark G. Kortepeter, V. Paul Landon, Patricia A. Lenaghan, Robert E. Leopold, Leroy A. Marklund, James W. Martin, Sharon J. Medcalf, Robert J. Mussack, Randall H. Neal, Bruce S. Ribner, Jonathan Y. Richmond, Chuck Rogge, Leo A. Daly, Gary A. Roselle, Mark E. Rupp, Anthony R. Sambol, Joann E. Schaefer, John Sibley, Andrew J. Streifel, Susanna G. Von Essen, Kelly L. Warfield. (2006) Designing a Biocontainment Unit to Care for Patients with Serious Communicable Diseases: A Consensus Statement. Biosecurity and Bioterrorism: Biodefense Strategy, Practice, and Science 4:4, 351-365
    CrossRef

  15. 15

    J.W. Tang, Y. Li, I. Eames, P.K.S. Chan, G.L. Ridgway. (2006) Factors involved in the aerosol transmission of infection and control of ventilation in healthcare premises. Journal of Hospital Infection 64:2, 100-114
    CrossRef

  16. 16

    E. S. McBryde, G. Gibson, A. N. Pettitt, Y. Zhang, B. Zhao, D. L. S. McElwain. (2006) Bayesian modelling of an epidemic of severe acute respiratory syndrome. Bulletin of Mathematical Biology 68:4, 889-917
    CrossRef

  17. 17

    M. P. Muller, S. E. Richardson, A. McGeer, L. Dresser, J. Raboud, T. Mazzulli, M. Loeb, M. Louie, . (2006) Early diagnosis of SARS: lessons from the Toronto SARS outbreak. European Journal of Clinical Microbiology & Infectious Diseases 25:4, 230-237
    CrossRef

  18. 18

    Alexander GERBER, Axel FISCHER, Karl-Heinz WILLIG, DavidA. GRONEBERG. (2006) Air Conditioning Systems as Non-Infectious Health Hazards Inducing Acute Respiratory Symptoms. Industrial Health 44:2, 302-303
    CrossRef

  19. 19

    Jai-hai LU, Zhong-min GUO, Wen-yu HAN, Guo-ling WANG, Ding-mei ZHANG, Yi-fei WANG, Sheng-yun SUN, Qin-he YANG, Huan-ying ZHENG, Bing L WONG, Nan-shan ZHONG. (2005) Preparation and development of equine hyperimmune globulin F(ab')2 against severe acute respiratory syndrome coronavirus1. Acta Pharmacologica Sinica 26:12, 1479-1484
    CrossRef

  20. 20

    James B. Mahony, Susan Richardson. (2005) Molecular Diagnosis of Severe Acute Respiratory Syndrome. The Journal of Molecular Diagnostics 7:5, 551-559
    CrossRef

  21. 21

    L. Li, J. Gu, X. Shi, E. Gong, X. Li, H. Shao, X. Shi, H. Jiang, X. Gao, D. Cheng, L. Guo, H. Wang, X. Shi, P. Wang, Q. Zhang, B. Shen. (2005) Biosafety Level 3 Laboratory for Autopsies of Patients with Severe Acute Respiratory Syndrome: Principles, Practices, and Prospects. Clinical Infectious Diseases 41:6, 815-821
    CrossRef

  22. 22

    Kwai Pen Chan. (2005) Control of Severe Acute Respiratory Syndrome in Singapore. Environmental Health and Preventive Medicine 10:5, 255-259
    CrossRef

  23. 23

    Shuo Shen, Pi-Shiu Lin, Yu-Chan Chao, Aihua Zhang, Xiaoming Yang, Seng Gee Lim, Wanjin Hong, Yee-Joo Tan. (2005) The severe acute respiratory syndrome coronavirus 3a is a novel structural protein. Biochemical and Biophysical Research Communications 330:1, 286-292
    CrossRef

  24. 24

    Danuta M. Skowronski, Caroline Astell, Robert C. Brunham, Donald E. Low, Martin Petric, Rachel L. Roper, Pierre J. Talbot, Theresa Tam, Lorne Babiuk. (2005) Severe Acute Respiratory Syndrome (SARS): A Year in Review. Annual Review of Medicine 56:1, 357-381
    CrossRef

  25. 25

    Samson SY. Wong, KY Yuen. (2005) The severe acute respiratory syndrome (SARS). Journal of Neurovirology 11:5, 455-468
    CrossRef

  26. 26

    , . (2005) Strategies adopted and lessons learnt during the severe acute respiratory syndrome crisis in Singapore. Reviews in Medical Virology 15:1, 57-70
    CrossRef

  27. 27

    Umesh D Parashar, Angela Merianos, Cathy Roth, Larry J Anderson. 2005. Preparing for a Possible Resurgence of SARS. , 231-238.
    CrossRef

  28. 28

    Nan-Shan Zhong, Gary W.K. Wong. (2004) Epidemiology of severe acute respiratory syndrome (SARS): adults and children. Paediatric Respiratory Reviews 5:4, 270-274
    CrossRef

  29. 29

    Christl A Donnelly, Matthew C Fisher, Christophe Fraser, Azra C Ghani, Steven Riley, Neil M Ferguson, Roy M Anderson. (2004) Epidemiological and genetic analysis of severe acute respiratory syndrome. The Lancet Infectious Diseases 4:11, 672-683
    CrossRef

  30. 30

    Paul A Tambyah. (2004) Severe acute respiratory syndrome from the trenches, at a Singapore university hospital. The Lancet Infectious Diseases 4:11, 690-696
    CrossRef