Original Article
Quantification of Plasma Epstein–Barr Virus DNA in Patients with Advanced Nasopharyngeal Carcinoma
N Engl J Med 2004; 350:2461-2470June 10, 2004
- Abstract
Background
We investigated the clinical significance of plasma concentrations of Epstein–Barr virus (EBV) DNA in patients with advanced nasopharyngeal carcinoma.
Methods
Ninety-nine patients with biopsy-proven stage III or IV nasopharyngeal carcinoma and no evidence of metastasis (M0) received 10 weekly chemotherapy treatments followed by radiotherapy. Plasma samples from the patients were subjected to a real-time quantitative polymerase-chain-reaction assay. EBV genotypes of paired samples from plasma and primary tumor were compared.
Results
Plasma EBV DNA was detectable before treatment in 94 of the 99 patients, but not in 40 healthy controls or 20 cured patients. The median concentrations of plasma EBV DNA were 681 copies per milliliter among 25 patients with stage III disease, 1703 copies per milliliter among 74 patients with stage IV disease, and 291,940 copies per milliliter among 19 control patients with distant metastasis (P<0.001). Patients with relapse had a significantly higher plasma EBV DNA concentration before treatment than those who did not have a relapse (median, 3035 vs. 1202 copies per milliliter; P=0.02). The consistent genotyping of EBV DNA between paired samples of plasma and primary tumor suggested that the circulating cell-free EBV DNA may originate from the primary tumor. Unlike the rebound of plasma EBV DNA concentrations in the patients who had a relapse, the plasma EBV DNA concentration was persistently low or undetectable in patients with a complete clinical remission. Overall survival (P<0.001) and relapse-free survival (P=0.02) were significantly lower among patients with pretreatment plasma EBV DNA concentrations of at least 1500 copies per milliliter than among those with concentrations of less than 1500 copies per milliliter. Patients with persistently detectable plasma EBV DNA had significantly worse overall survival (P<0.001) and relapse-free survival (P<0.001) than patients with undetectable EBV DNA one week after the completion of radiotherapy.
Conclusions
Quantification of plasma EBV DNA is useful for monitoring patients with nasopharyngeal carcinoma and predicting the outcome of treatment.
Media in This Article
Figure 1
Real-Time Quantitative PCR Assay Targeting the BamHI-W Region of EBV DNA and Clinical Analyses of Plasma EBV DNA Concentrations in Patients with Nasopharyngeal Carcinoma and Controls.Figure 2
Results of EBV Genotyping.Article Activity
- Article
Nasopharyngeal carcinoma is an endemic carcinoma associated with Epstein–Barr virus (EBV) infection. Radiotherapy is the primary treatment, but studies have supported the use of combined radiotherapy and chemotherapy for advanced cases.1-4 Advances in radiation oncology have improved local control, and treatment failure is now due mainly to distant metastasis.1-4 The outcome of salvage treatment for relapse is poor. The extent of involvement by the tumor at the time of recurrence is an important determinant of survival,5-7 and the efficacy of salvage treatment is closely related to the tumor burden at the time of relapse. For these reasons, the development of reliable methods to detect relapse at an early stage may improve the outcome of treatment. If used at the time of diagnosis, such methods might also identify high-risk patients who could benefit from early, aggressive treatment.
EBV is present in cells from almost every primary and metastatic nasopharyngeal carcinoma, regardless of the degree of tumor differentiation or the geographic origin of the patient.8-15 In this prospective study, we investigated whether the plasma EBV DNA load, measured by real-time quantitative polymerase chain reaction (PCR), correlates with the response to treatment and the likelihood of relapse and survival among patients with nasopharyngeal carcinoma.
Methods
Study Subjects
A total of 101 previously untreated patients with biopsy-proven nasopharyngeal carcinoma and no evidence of distant metastasis (M0) were enrolled between June 1999 and April 2002. The routine staging workup included a detailed clinical examination of the head and neck, fiberoptic nasopharyngoscopy, computed tomography or magnetic resonance imaging of the entire neck from the base of the skull, chest radiography, whole-body bone scanning, abdominal sonography, a complete blood count, and a biochemical profile. Computed tomography of the chest was performed when chest radiography suggested the presence of lung metastasis, and bone marrow biopsy was performed when an abnormal blood count was reported. The cancer stage was defined according to the 1997 American Joint Committee on Cancer tumor–node–metastasis staging system.16
The following persons were recruited to serve as controls: 40 healthy volunteers, 20 patients who had received radiotherapy and had survived more than five years without evidence of recurrent nasopharyngeal carcinoma, and 19 patients who had distant metastasis. Written informed consent was obtained from each study subject.
Treatment
All the patients met at least one of the following criteria: a neck node exceeding 6 cm in diameter; supraclavicular-node metastasis; destruction of the skull base, intracranial invasion, or cranial-nerve palsy; or multiple metastases to the neck, with at least one node exceeding 4 cm in diameter. Treatment consisted of weekly neoadjuvant chemotherapy.2 The chemotherapy consisted of intravenous cisplatin, 60 mg per square meter of body-surface area on days 1, 15, 29, 43, and 57, alternating with 2500 mg of fluorouracil per square meter plus 250 mg of leucovorin per square meter, given by continuous intravenous infusion for 24 hours with the use of an ambulatory pump in an outpatient setting, on days 8, 22, 36, 50, and 64. Radiotherapy was started one week after the completion of 10 weekly doses of chemotherapy and was administered in conventional fractionated doses as described previously.2 The total dose to the primary tumor was 70 Gy for tumor (T) stage T1, T2, or T3 disease and 74 Gy for T4 disease.
Extraction of DNA from Plasma
Peripheral blood (10 ml) was obtained from each patient and control, placed in an EDTA-treated tube, and centrifuged at 1000 ×g for 15 minutes, and the plasma was transferred into 1.5-ml microtubes. The samples were stored at –30°C until further processing. Plasma DNA was extracted with a QIAamp DNA Blood MiniKit (Qiagen). Before DNA extraction, the plasma samples were thawed and centrifuged at 20,000 ×g for five minutes. About 200 to 400 μl of each sample per column (supplied in the QIAamp kit) was used for DNA extraction. The exact amount of extracted plasma was documented for the calculation of the target DNA concentration. Fifty microliters of distilled water was used to elute the DNA from the extraction column.
Blood samples were obtained one day before treatment began, on days 35 and 64 during chemotherapy, and one week after the completion of radiotherapy. During the follow-up period, blood samples were collected every six months or when tumor recurrence was suspected or clinically evident.
Real-Time Quantitative Polymerase Chain Reaction
Concentrations of EBV DNA in plasma were measured with the use of a real-time quantitative PCR assay of the BamHI-W region of the EBV genome. The sequences of the forward and reverse primers were 5'CCCAACACTCCACCACACC3' and 5'TCTTAGGAGCTGTCCGAGGG3', respectively. A dual fluorescence-labeled oligomer, 5'(FAM)CACACACTACACACACCCACCCGTCTC(TAMRA)3', served as a probe. The real-time quantitative PCR assay (40 cycles) and the reaction-setup procedures have been described in detail previously.17 Real-time quantitative PCR was performed with the ABI Prism 7700 Sequence Detection Analyzer (Applied Biosystems). All DNA samples were also subjected to real-time quantitative PCR for the β-globin gene, which served as a control for the extent to which the plasma DNA could be amplified. Multiple water blanks were included in every analysis as a negative control. The EBV and β-globin PCRs were carried out in triplicate. A calibration curve was run in parallel and in duplicate for each analysis with the use of DNA extracted from an EBV-positive cell line, Namalwa (American Type Culture Collection number CRL-1432), as the standard. Concentrations of plasma EBV DNA were expressed as the number of copies of the EBV genome per milliliter of plasma.17 Samples with an undetectable EBV signal after processing under our real-time quantitative PCR conditions (40 cycles) were considered to have zero copies.
Typing of EBV DNA in Paired Plasma and Tumor Samples
In some cases, paired samples of DNA from the primary tumor and plasma from the same patient were randomly selected and subjected to qualitative PCR with the use of primers specific to latent membrane protein 1 (LMP-1) and EBV nuclear antigen 3C (EBNA-3C). Direct sequencing of the PCR products from the primary tumor and plasma was performed for verification.
Statistical Analysis
Relapse-free survival was calculated from the first day of chemotherapy until the date of relapse or the last follow-up visit. Overall survival was calculated from the first day of chemotherapy until death or the last follow-up visit. Life-table estimation was performed according to the method of Kaplan and Meier. Univariate comparison of survival curves was performed with the use of the log-rank test. The multivariate Cox proportional-hazards model was used to estimate the hazard ratios and 95 percent confidence intervals. Variables in the model included age, sex, Karnofsky performance status, pathological type according to the World Health Organization, response to chemotherapy, T stage, nodal (N) stage, overall stage, pretreatment plasma EBV DNA concentration, and plasma EBV DNA status one week after the completion of treatment. The relation between the plasma EBV DNA concentration and the relapse rate was evaluated with the use of a chi-square test. The concentrations of plasma EBV DNA were compared with the Mann–Whitney rank-sum test for binary categories or the Kruskal–Wallis test for more than two categories. All statistical tests were two-sided, and a P value of less than 0.05 was considered to indicate statistical significance. Analyses were performed with the use of SAS software (version 8.0, SAS Institute).
Results
Pretreatment Characteristics and Clinical Outcome
Of the 101 patients, 2 patients who interrupted radiotherapy prematurely after receiving 24 and 34 Gy were excluded from subsequent analyses. Table 1Table 1
Characteristics of the 99 Patients. lists the pretreatment characteristics of the remaining 99 patients and their tumors.On completion of chemotherapy, 59 patients (60 percent) had a complete clinical response and 40 (40 percent) had a partial response. A second biopsy of the primary site of the tumor was performed before radiotherapy in 97 patients, 65 of whom were found to have had a pathologically complete response. After a median follow-up of 30 months (range, 14 to 48), 18 patients had had a relapse: 3 relapses were at the site of the primary tumor, 1 was regional, 1 was in the neck and a distant site, and 13 were at distant sites only. The two-year overall survival rate was 92.6 percent. Detailed clinical results for some patients have been reported elsewhere.2
Plasma EBV DNA in Patients and Controls
Using real-time quantitative PCR (Figure 1AFigure 1
Real-Time Quantitative PCR Assay Targeting the BamHI-W Region of EBV DNA and Clinical Analyses of Plasma EBV DNA Concentrations in Patients with Nasopharyngeal Carcinoma and Controls.), we detected EBV DNA in plasma samples from 94 of 99 patients, but in none of the plasma samples from 40 healthy volunteers (Figure 1B) or 20 patients with cured nasopharyngeal carcinoma. The median concentration of EBV DNA in plasma from the patients with nasopharyngeal carcinoma was 1461 copies per milliliter (interquartile range, 302 to 4390). One of five patients with no copies of EBV DNA in plasma had a tumor consisting of keratinizing squamous-cell carcinoma.Relation of Plasma EBV DNA Concentrations to Clinical Stage
Of the 99 patients, 25 had stage III and 74 had stage IV disease. For comparison, blood samples were collected from another 19 patients who had distant metastasis (M1) before treatment. The median concentrations of plasma EBV DNA in patients with stage III, stage IV, and stage M1 disease were 681 copies per milliliter (interquartile range, 134 to 1555), 1703 copies per milliliter (interquartile range, 345 to 4454), and 291,940 copies per milliliter (interquartile range, 27,190 to 4,105,000), respectively (P<0.001) (Figure 1C).
Plasma EBV DNA Concentrations and Relapse
The median plasma EBV DNA concentrations at the time of the initial presentation were 3035 copies per milliliter (interquartile range, 806 to 16,130) among the 18 patients who had a relapse and 1202 copies per milliliter (interquartile range, 271 to 3280) among the 81 patients who did not have a relapse (P=0.02) (Figure 1D). These results were confirmed by univariate binary logistic-regression analysis (P=0.01). The relative risk of relapse for each increase by a factor of 10 in the plasma EBV DNA concentration was 2.3 (95 percent confidence interval, 1.9 to 10.4).
The pretreatment plasma EBV DNA concentrations were higher in patients with distant relapse (median, 4253 copies per milliliter; range, 226 to 249,900) than in those with local or regional relapse (median, 1311 copies per milliliter; range, 353 to 21,920), but the difference was not significant (P=0.37). Of the 18 patients with recurrent disease, blood samples obtained at the time of recurrence were available in 16. These 16 patients had elevations of plasma EBV DNA up to a median of 10,020 copies per milliliter (interquartile range, 2686 to 1,052,000) at the time of recurrence (Figure 1E). The elevation of plasma EBV DNA in 8 of the 16 patients with relapse occurred six months before the recurrence was detected clinically (Figure 1F). No association was observed between the site of relapse and the concentration of EBV DNA during treatment, at the end of chemotherapy, or one week after radiotherapy, and a shorter time to relapse was not associated with higher EBV DNA concentrations (data not shown).
Follow-up Study
The median EBV DNA concentration decreased to 0 copies per milliliter (interquartile range, 0 to 0) one week after the completion of radiotherapy. Only 10 of 99 patients had a detectable concentration of EBV DNA in their plasma at that time (median, 121 copies per milliliter; range, 8 to 5066 ). Seven of these 10 patients subsequently had a relapse: 6 had distant metastases alone, and 1 had a distant metastasis plus a recurrence in the neck. There was no relation between the EBV DNA concentration one week after the completion of radiotherapy and the risk of relapse in these 10 patients.
A total of 130 blood samples were obtained from 68 patients who were in continuous remission during the follow-up period (Figure 1G). The highest plasma EBV DNA value was selected in the case of patients who had more than one measurement during the follow-up period. The median plasma EBV DNA concentration in these 130 samples was 0 copies per milliliter (interquartile range, 0 to 0). The difference in EBV DNA concentrations during the follow-up period between patients who had a relapse and those who did not was significant (P<0.001) (Figure 1E). When we evaluated the timing of blood sampling (Figure 1H), we found that the EBV DNA concentrations in samples obtained one week after the completion of radiotherapy were the best predictors of the likelihood of relapse (P<0.001).
Typing of EBV DNA from Plasma and Primary Tumor
On gel electrophoresis, qualitative PCR showed that the sizes of the PCR products for LMP-1 (Figure 2AFigure 2
Results of EBV Genotyping.) and EBNA-3C were identical in paired samples of the primary tumor and plasma. Direct sequencing of the PCR products demonstrated complete homology of EBNA-3C in all 11 patients for whom samples were available and of LMP-1 for 7 of the 11 patients (Figure 2B). The remaining four patients had a difference of only one base between samples.Survival
Kaplan–Meier estimates showed that pretreatment EBV DNA concentrations and the presence or absence of EBV DNA in plasma after radiotherapy correlated significantly with overall and relapse-free survival (Figure 3Figure 3
Kaplan–Meier Estimates of Overall and Relapse-free Survival, According to the Plasma EBV DNA Concentration or the Clinical Stage.). In addition, the response to chemotherapy had a significant influence on overall survival (P=0.04 for the comparison between patients with a complete response and those with a partial response) but not on relapse-free survival (P=0.12). Age, sex, pathological type, Karnofsky performance status, plasma EBV DNA status during and at the end of chemotherapy, T stage, N stage, and overall stage had no significant effect on overall or relapse-free survival. Overall survival at two years was 100 percent among patients with pretreatment plasma EBV DNA concentrations of less than 1500 copies per milliliter, and 83.4 percent among those with pretreatment plasma EBV DNA concentrations of at least 1500 copies per milliliter (P<0.001) (Figure 3A). The two-year relapse-free survival rates were 88.8 percent among patients with pretreatment plasma EBV DNA concentrations of less than 1500 copies per milliliter and 66.4 percent among patients with concentrations of at least 1500 copies per milliliter (P=0.02) (Figure 3B). The two-year overall survival rates were 56.3 percent among patients with persistently detectable plasma EBV DNA after radiotherapy and 96.7 percent among those with undetectable EBV DNA after radiotherapy (P<0.001) (Figure 3C). The relapse-free survival rates at two years were 28.6 percent among patients with persistently detectable plasma EBV DNA after radiotherapy and 84.2 percent among those with undetectable EBV DNA after radiotherapy (P<0.001) (Figure 3D). The overall survival rates at two years were 100 percent among patients with stage III disease and 92.3 percent among patients with stage IV disease (P=0.10), and the rates of relapse-free survival were 90.3 percent and 75.1 percent, respectively (P=0.05) (Figure 3E and Figure 3F).Multivariate Cox Analysis
When the pretreatment plasma EBV DNA concentration and clinical features (age, sex, Karnofsky performance status, pathological type, response to chemotherapy, T stage, N stage, and overall stage) were entered into a multivariate analysis, only the pretreatment plasma EBV DNA concentration was significantly related to relapse-free survival (P=0.03; hazard ratio for relapse with a pretreatment EBV DNA concentration of at least 1500 copies per milliliter as compared with less than 1500 copies per milliliter, 3.2; 95 percent confidence interval, 1.1 to 9.0). The hazard ratio for death could not be calculated because no patients with EBV DNA concentrations of less than 1500 copies per milliliter died. If both pretreatment and post-treatment EBV DNA concentrations were included with clinical features in a Cox analysis (Table 2Table 2
Results of Multivariate Cox Proportional-Hazards Analysis.), a persistently detectable concentration of EBV DNA in plasma after radiotherapy was the most important prognostic factor in terms of both overall survival (P=0.002; hazard ratio for death, 22.9; 95 percent confidence interval, 3.0 to 173.5) and relapse-free survival (P<0.001; hazard ratio for relapse, 34.5; 95 percent confidence interval, 7.4 to 162.1) after adjustment for other variables. Tumor stage and pretreatment plasma EBV DNA concentration showed borderline effects on relapse-free survival (P=0.05 and P=0.07, respectively).Discussion
A close association between EBV and nasopharyngeal carcinoma has been established on the basis of the presence of DNA, RNA, and proteins of EBV in almost all cancer cells of primary sites and various metastatic sites8-15; the origin of the tumor in a single EBV-infected cell18; and the presence of high concentrations of antibodies against EBV proteins in healthy people in whom nasopharyngeal carcinoma later developed.19 Furthermore, EBV has been detected in premalignant nasopharyngeal lesions, including carcinoma in situ and dysplasia.20 Latent EBV infection does not occur in normal nasopharyngeal epithelial cells, however.21
In a previous study of EBV in patients with nasopharyngeal carcinoma, we demonstrated that the presence of EBNA-1 DNA in cells in the peripheral blood predicted a high risk of distant metastases and a low risk of survival.22 The evidence we obtained indicates that the source of EBNA-1 DNA in these circulating cells is disseminated nasopharyngeal-carcinoma cells.23
EBV DNA has been detected by qualitative PCR in plasma or serum samples from patients with nasopharyngeal carcinoma.24-26 But the low sensitivity and substantial false positive rate limited the value of this approach. Lo et al. detected cell-free EBV DNA in the plasma of 55 of 57 patients with nasopharyngeal carcinoma (96 percent) and 3 of 43 control subjects (7 percent).17 They demonstrated that circulating EBV DNA concentrations correlated with the tumor stage,27 the likelihood of recurrence,28 the likelihood of survival,29 and the presence of residual disease30 in patients with nasopharyngeal carcinoma who received radiotherapy. They found that circulating EBV DNA molecules are naked DNA fragments, most of which are shorter than 181 bp.31 Although the sensitivity of the PCR assay may vary with different segments of viral DNA, similar results were obtained with the use of the BamHI-W region or the EBNA-1 gene.17 In a small group of patients, Ngan et al. showed that serum EBV DNA could be detected a mean of 17.4 weeks before recurrence was clinically apparent.32 After the completion of salvage chemotherapy, serum EBV DNA profiles concordant with the clinical outcomes were observed in most patients.
Chan et al.30 reported results similar to ours, but they used a pretreatment cutoff value of 4000 copies per milliliter and a post-treatment cutoff value of 500 copies per milliliter, whereas we used values of 1500 and 0 copies per milliliter, respectively. Taken together, the data show that plasma EBV DNA concentrations can be a useful molecular marker for screening, monitoring, and prediction of relapse in patients with nasopharyngeal carcinoma. Our results and those of previous studies17,30 cannot yet be considered definitive, however, because relapse can occur 3 to 10 years after the completion of initial therapy.
Supported by grants from the National Science Council (NSC89-2314-B-075A-021-M08, NSC90-2314-B-075A-007, and NSC91-2314-B-075A-004-M08) and Taichung Veterans General Hospital (TCVGH-917006D and TCVGH-927005D) — both in Taiwan.
We are indebted to Dr. Shi-Chuan Chang for his critical review of the manuscript.
Source Information
From the Department of Radiation Oncology (J.-C.L., J.-S.J.) and the Department of Otorhinolaryngology (R.-S.J.), Taichung Veterans General Hospital, Taichung; the Department of Medicine, School of Medicine (J.-C.L.), and the Department of Biochemistry and Center for Cellular and Molecular Biology, School of Life Science (Y.-H.W.), National Yang-Ming University, Taipei; the Department of Radiation Oncology, National Cheng Kung University Hospital, Tainan (J.-C.L.); the Department of Medicine, School of Medicine (J.-C.L.), and the Department of Public Health (W.-M.L.), China Medical University, Taichung; the Department of Basic Medicine, Hung Kuang University, Taichung (W.-Y.W.); and the Cancer Center, Taipei Veterans General Hospital, Taipei (K.Y.C.) — all in Taiwan.
Address reprint requests to Dr. Lin at the Department of Radiation Oncology, Taichung Veterans General Hospital, Taiwan No. 160, Sec. 3, Taichung-Kang Rd., Taichung 407, Taiwan, or at jclin@vghtc.gov.tw.
- References
References
1
Al-Sarraf M ,LeBlanc M ,Giri PGS , et al. Chemoradiotherapy versus radiotherapy in patients with advanced nasopharyngeal cancer: phase III randomized Intergroup study 0099. J Clin Oncol 1998;16:1310-1317
Web of Science | Medline2
Lin JC ,Jan JS ,Hsu CY ,Jiang RS ,Wang WY . Outpatient weekly neoadjuvant chemotherapy followed by radiotherapy for advanced nasopharyngeal carcinoma: high complete response and low toxicity rates. Br J Cancer 2003;88:187-194
CrossRef | Web of Science | Medline3
Lin JC ,Jan JS ,Hsu CY ,Liang WM ,Jiang RS ,Wang WY . Phase III study of concurrent chemoradiotherapy versus radiotherapy alone for advanced nasopharyngeal carcinoma: positive effect on overall and progression-free survival. J Clin Oncol 2003;21:631-637
CrossRef | Web of Science | Medline4
Lin JC ,Jan JS ,Chen KY ,Hsu CY ,Liang WM ,Wang WY . Outpatient weekly 24-hour infusional adjuvant chemotherapy of cisplatin, 5-fluorouracil, and leucovorin for high-risk nasopharyngeal carcinoma. Head Neck 2003;25:438-450
CrossRef | Web of Science | Medline5
Teo PML ,Kwan WH ,Chan ATC ,Lee WY ,King WWK ,Mok CO . How successful is high-dose (≥60 Gy) reirradiation using mainly external beams in salvaging local failures of nasopharyngeal carcinoma? Int J Radiat Oncol Biol Phys 1998;40:897-913
CrossRef | Web of Science | Medline6
Chang JTC ,See LC ,Liao CT , et al. Locally recurrent nasopharyngeal carcinoma. Radiother Oncol 2000;54:135-142
CrossRef | Web of Science | Medline7
Leung TW ,Tung SY ,Sze WK , et al. Salvage radiation therapy for locally recurrent nasopharyngeal carcinoma. Int J Radiat Oncol Biol Phys 2000;48:1331-1338
CrossRef | Web of Science | Medline8
Chang YS ,Tyan YS ,Liu ST ,Tsai MS ,Pao CC . Detection of Epstein-Barr virus DNA sequences in nasopharyngeal carcinoma cells by enzymatic DNA amplification. J Clin Microbiol 1990;28:2398-2402
Web of Science | Medline9
Wu TC ,Mann RB ,Epstein JI , et al. Abundant expression of EBER1 small nuclear RNA in nasopharyngeal carcinoma: a morphologically distinctive target for detection of Epstein-Barr virus in formalin-fixed paraffin-embedded carcinoma specimens. Am J Pathol 1991;138:1461-1469
Web of Science | Medline10
Chen CL ,Wen WN ,Chen JY ,Hsu MM ,Hsu HC . Detection of Epstein-Barr virus genome in nasopharyngeal carcinoma by in situ DNA hybridization. Intervirology 1993;36:91-98
Web of Science | Medline11
Pathmanathan R ,Prasad U ,Chandrika G ,Sadler R ,Flynn K ,Raab-Traub N . Undifferentiated, nonkeratinizing, and squamous cell carcinoma of the nasopharynx: variants of Epstein-Barr virus-infected neoplasia. Am J Pathol 1995;146:1355-1367
Web of Science | Medline12
Lee WY ,Hsiao JR ,Jin YT ,Tsai ST . Epstein-Barr virus detection in neck metastases by in-situ hybridization in fine-needle aspiration cytologic studies: an aid for differentiating the primary site. Head Neck 2000;22:336-340
CrossRef | Web of Science | Medline13
Tsai ST ,Jin YT ,Su IJ . Expression of EBER1 in primary and metastatic nasopharyngeal carcinoma tissues using in situ hybridization: a correlation with WHO histologic subtypes. Cancer 1996;77:231-236
CrossRef | Web of Science | Medline14
Macdonald MR ,Freeman JL ,Hui MF , et al. Role of Epstein-Barr virus in fine-needle aspirates of metastatic neck nodes in the diagnosis of nasopharyngeal carcinoma. Head Neck 1995;17:487-493
CrossRef | Web of Science | Medline15
Chao TY ,Chow KC ,Chang JY , et al. Expression of Epstein-Barr virus-encoded RNAs as a marker for metastatic undifferentiated nasopharyngeal carcinoma. Cancer 1996;78:24-29
CrossRef | Web of Science | Medline16
Fleming ID, Cooper JS, Henson DE, et al., eds. AJCC cancer staging manual. 5th ed. Philadelphia: Lippincott–Raven, 1997:31-9.
17
Lo YMD ,Chan LYS ,Lo K-W , et al. Quantitative analysis of cell-free Epstein-Barr virus DNA in plasma of patients with nasopharyngeal carcinoma. Cancer Res 1999;59:1188-1191
Web of Science | Medline18
Raab-Traub N ,Flynn K . The structure of the termini of the Epstein-Barr virus as a marker of clonal cellular proliferation. Cell 1986;47:883-889
CrossRef | Web of Science | Medline19
Chien Y-C ,Chen J-Y ,Liu M-Y , et al. Serologic markers of Epstein-Barr virus infection and nasopharyngeal carcinoma in Taiwanese men. N Engl J Med 2001;345:1877-1882
Full Text | Web of Science | Medline20
Pathmanathan R ,Prasad U ,Sadler R ,Flynn K ,Raab-Traub N . Clonal proliferations of cells infected with Epstein-Barr virus in preinvasive lesions related to nasopharyngeal carcinoma. N Engl J Med 1995;333:693-698
Full Text | Web of Science | Medline21
Yeung WM ,Zong YS ,Chiu CT , et al. Epstein-Barr virus carriage by nasopharyngeal carcinoma in situ. Int J Cancer 1993;53:746-750
CrossRef | Web of Science | Medline22
Lin JC ,Chen KY ,Wang WY , et al. Detection of Epstein-Barr virus DNA in the peripheral-blood cells of patients with nasopharyngeal carcinoma: relationship to distant metastasis and survival. J Clin Oncol 2001;19:2607-2615
Web of Science | Medline23
Wang WY ,Chien YC ,Jan JS ,Chueh CM ,Lin JC . Consistent sequence variation of Epstein-Barr virus nuclear antigen 1 in primary tumor and peripheral blood cells of patients with nasopharyngeal carcinoma. Clin Cancer Res 2002;8:2586-2590
Web of Science | Medline24
Mutirangura A ,Pornthanakasem W ,Theamboonlers A , et al. Epstein-Barr viral DNA in serum of patients with nasopharyngeal carcinoma. Clin Cancer Res 1998;4:665-669
Web of Science | Medline25
Shotelersuk K ,Khorprasert C ,Sakdikul S ,Pornthanakasem W ,Voravud N ,Mutirangura A . Epstein-Barr virus DNA in serum/plasma as a tumor marker for nasopharyngeal cancer. Clin Cancer Res 2000;6:1046-1051
Web of Science | Medline26
Hsiao JR ,Jin YT ,Tsai ST . Detection of cell free Epstein-Barr virus DNA in sera from patients with nasopharyngeal carcinoma. Cancer 2002;94:723-729
CrossRef | Web of Science | Medline27
Lo YMD ,Leung SF ,Chan LYS , et al. Plasma cell-free Epstein-Barr virus DNA quantitation in patients with nasopharyngeal carcinoma: correlation with clinical staging. Ann N Y Acad Sci 2000;906:99-101
CrossRef | Web of Science | Medline28
Lo YMD ,Chan LYS ,Chan ATC , et al. Quantitative and temporal correlation between circulating cell-free Epstein-Barr virus DNA and tumor recurrence in nasopharyngeal carcinoma. Cancer Res 1999;59:5452-5455
Web of Science | Medline29
Lo YMD ,Chan ATC ,Chan LYS , et al. Molecular prognostication of nasopharyngeal carcinoma by quantitative analysis of circulating Epstein-Barr virus DNA. Cancer Res 2000;60:6878-6881
Web of Science | Medline30
Chan ATC ,Lo YMD ,Zee B , et al. Plasma Epstein-Barr virus DNA and residual disease after radiotherapy for undifferentiated nasopharyngeal carcinoma. J Natl Cancer Inst 2002;94:1614-1619
CrossRef | Web of Science | Medline31
Chan KCA ,Zhang J ,Chan ATC , et al. Molecular characterization of circulating EBV DNA in the plasma of nasopharyngeal carcinoma and lymphoma patients. Cancer Res 2003;63:2028-2032
Web of Science | Medline32
Ngan RKC ,Lau WH ,Yip TTC , et al. Remarkable application of serum EBV EBER-1 in monitoring response of nasopharyngeal cancer patients to salvage chemotherapy. Ann N Y Acad Sci 2001;945:73-79
CrossRef | Web of Science | Medline
- Citing Articles (95)
Citing Articles
1
Ming-Liang He, Millore X-M Luo, Marie C. Lin, Hsiang-fu Kung. (2012) MicroRNAs: Potential diagnostic markers and therapeutic targets for EBV-associated nasopharyngeal carcinoma. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1825:1, 1-10
CrossRef2
Claire Gourzones, Clément Barjon, Pierre Busson. (2012) Host-tumor interactions in nasopharyngeal carcinomas. Seminars in Cancer Biology
CrossRef3
Jian-Rong He, Guo-Ping Shen, Ze-Fang Ren, Han Qin, Cui Cui, Ying Zhang, Yi-Xin Zeng, Wei-Hua Jia. (2012) Pretreatment levels of peripheral neutrophils and lymphocytes as independent prognostic factors in patients with nasopharyngeal carcinoma. Head & Neckn/a-n/a
CrossRef4
D. Zheng, J. Wan, Y. G. Cho, L. Wang, C.-J. Chiou, S. Pai, C. Woodard, J. Zhu, G. Liao, O. Martinez-Maza, J. Qian, H. Zhu, G. S. Hayward, R. F. Ambinder, S. D. Hayward. (2011) Comparison of Humoral Immune Responses to Epstein-Barr Virus and Kaposi's Sarcoma-Associated Herpesvirus Using a Viral Proteome Microarray. Journal of Infectious Diseases 204:11, 1683-1691
CrossRef5
Francesca Gatto, Giulia Cassina, Francesco Broccolo, Giuseppe Morreale, Edoardo Lanino, Eddi Di Marco, Efthiya Vardas, Daniela Bernasconi, Stefano Buttò, Nicola Principi, Susanna Esposito, Gabriella Scarlatti, Paolo Lusso, Mauro S. Malnati. (2011) A multiplex calibrated real-time PCR assay for quantitation of DNA of EBV-1 and 2. Journal of Virological Methods 178:1-2, 98-105
CrossRef6
Lei Chen, Chao-Su Hu, Xiao-Zhong Chen, Guo-Qing Hu, Zhi-Bin Cheng, Yan Sun, Wei-Xiong Li, Yuan-Yuan Chen, Fang-Yun Xie, Shao-Bo Liang, Yong Chen, Ting-Ting Xu, Bin Li, Guo-Xian Long, Si-Yang Wang, Bao-Min Zheng, Ying Guo, Ying Sun, Yan-Ping Mao, Ling-Long Tang, Yu-Ming Chen, Meng-Zhong Liu, Jun Ma. (2011) Concurrent chemoradiotherapy plus adjuvant chemotherapy versus concurrent chemoradiotherapy alone in patients with locoregionally advanced nasopharyngeal carcinoma: a phase 3 multicentre randomised controlled trial. The Lancet Oncology
CrossRef7
Nancy Y Lee, Qiang Zhang, David G Pfister, John Kim, Adam S Garden, James Mechalakos, Kenneth Hu, Quynh T Le, A Dimitrios Colevas, Bonnie S Glisson, Anthony TC Chan, K Kian Ang. (2011) Addition of bevacizumab to standard chemoradiation for locoregionally advanced nasopharyngeal carcinoma (RTOG 0615): a phase 2 multi-institutional trial. The Lancet Oncology
CrossRef8
Chanida Vinayanuwattikun, Virote Sriuranpong, Suebpong Tanasanvimon, Poonchavist Chantranuwat, Apiwat Mutirangura. (2011) Epithelial-Specific Methylation Marker. Journal of Thoracic Oncology 6:11, 1818-1825
CrossRef9
P. Bossi, E. Orlandi, C. Bergamini, L. D. Locati, R. Granata, A. Mirabile, D. Parolini, M. Franceschini, C. Fallai, P. Olmi, P. Quattrone, P. Potepan, A. Gloghini, R. Miceli, F. Mattana, G. Scaramellini, L. Licitra. (2011) Docetaxel, cisplatin and 5-fluorouracil-based induction chemotherapy followed by intensity-modulated radiotherapy concurrent with cisplatin in locally advanced EBV-related nasopharyngeal cancer. Annals of Oncology 22:11, 2495-2500
CrossRef10
C.-F. Kuo, L.-C. See, K.-H. Yu, I.-J. Chou, H.-C. Chang, M.-J. Chiou, S.-F. Luo. (2011) Incidence, cancer risk and mortality of dermatomyositis and polymyositis in Taiwan: a nationwide population study. British Journal of Dermatologyno-no
CrossRef11
Wen-Yi Wang, Chih-Wen Twu, Wan-Yu Lin, Rong-San Jiang, Kai-Li Liang, Kuan-Wen Chen, Ching-Te Wu, Yi-Ting Shih, Jin-Ching Lin. (2011) Plasma Epstein-Barr virus DNA screening followed by 18F-fluoro-2-deoxy-D-glucose positron emission tomography in detecting posttreatment failures of nasopharyngeal carcinoma. Cancer 117:19, 4452-4459
CrossRef12
ZhaoYang Zeng, HongBin Huang, WenLing Zhang, Bo Xiang, Ming Zhou, YanHong Zhou, Jian Ma, Mei Yi, XiaYu Li, XiaoLing Li, Wei Xiong, GuiYuan Li. (2011) Nasopharyngeal carcinoma: Advances in genomics and molecular genetics. Science China Life Sciences 54:10, 966-975
CrossRef13
Hongbin Cao, Alice Banh, Shirley Kwok, Xiaoli Shi, Simon Wu, Trevor Krakow, Brian Khong, Brindha Bavan, Rajeev Bala, Benjamin A. Pinsky, Dimitrios Colevas, Nader Pourmand, Albert C. Koong, Christina S. Kong, Quynh-Thu Le. (2011) Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients. International Journal of Radiation Oncology*Biology*Physics
CrossRef14
Anthony T.C. Chan. (2011) Current treatment of nasopharyngeal carcinoma. European Journal of Cancer 47, S302-S303
CrossRef15
Xin An, Feng-Hua Wang, Pei-Rong Ding, Ling Deng, Wen-Qi Jiang, Li Zhang, Jian-Yong Shao, Yu-Hong Li. (2011) Plasma Epstein-Barr virus DNA level strongly predicts survival in metastatic/recurrent nasopharyngeal carcinoma treated with palliative chemotherapy. Cancer 117:16, 3750-3757
CrossRef16
Nehla Mokni Baizig, Patrice Morand, Jean Marie Seigneurin, Hamouda Boussen, Asma Fourati, Said Gritli, Zeineb Oueslati, Slim Touati, Amor Gamoudi, Mansour Ben Abdallah, Michèle El May, Ahmed El May. (2011) Complementary determination of Epstein-Barr virus DNA load and serum markers for nasopharyngeal carcinoma screening and early detection in individuals at risk in Tunisia. European Archives of Oto-Rhino-Laryngology
CrossRef17
Jong-Mu Sun, Myung-Ju Ahn, Min Jae Park, Hui-Young Lee, Jin Seok Ahn, Seungkoo Lee, Gu Kang, Joungho Han, Young-Ik Son, Chung-Hwan Baek, Yong Chan Ahn, Keunchil Park. (2011) Expression of Excision Repair Cross-Complementation Group 1 as Predictive Marker for Nasopharyngeal Cancer Treated With Concurrent Chemoradiotherapy. International Journal of Radiation Oncology*Biology*Physics 80:3, 655-660
CrossRef18
Heidi Schwarzenbach, Dave S. B. Hoon, Klaus Pantel. (2011) Cell-free nucleic acids as biomarkers in cancer patients. Nature Reviews Cancer 11:6, 426-437
CrossRef19
Kai-Ping Chang, Ya-Ting Chang, Chih-Ching Wu, Yu-Ling Liu, Min-Chi Chen, Ngan-Ming Tsang, Cheng-Lung Hsu, Yu-Sun Chang, Jau-Song Yu. (2011) Multiplexed immunobead-based profiling of cytokine markers for detection of nasopharyngeal carcinoma and prognosis of patient survival. Head & Neck 33:6, 886-897
CrossRef20
S. Secondino, M. Zecca, L. Licitra, A. Gurrado, I. Schiavetto, P. Bossi, L. Locati, R. Schiavo, S. Basso, F. Baldanti, R. Maccario, F. Locatelli, S. Siena, P. Pedrazzoli, P. Comoli. (2011) T-cell therapy for EBV-associated nasopharyngeal carcinoma: preparative lymphodepleting chemotherapy does not improve clinical results. Annals of Oncology
CrossRef21
Elham Hassen, Karim Farhat, Sallouha Gabbouj, Noureddine Bouaouina, Hamdi Abdelaziz, Lotfi Chouchane. (2011) Epstein–Barr virus DNA quantification and follow-up in Tunisian nasopharyngeal carcinoma patients. Biomarkers 16:3, 274-280
CrossRef22
Myriam Loyo, Mariana Brait, Myoung S. Kim, Kimberly L. Ostrow, Chunfa C. Jie, Alice Y. Chuang, Joseph A. Califano, Nanette J. Liégeois, Shahnaz Begum, William H. Westra, Mohammad O. Hoque, Qian Tao, David Sidransky. (2011) A survey of methylated candidate tumor suppressor genes in nasopharyngeal carcinoma. International Journal of Cancer 128:6, 1393-1403
CrossRef23
Anna Merlo, Riccardo Turrini, Riccardo Dolcetti, Paola Zanovello, Antonio Rosato. (2011) Immunotherapy for EBV-associated malignancies. International Journal of Hematology 93:3, 281-293
CrossRef24
Xue Hou, Chong Zhao, Ying Guo, Fei Han, Li-Xia Lu, Shao-Xiong Wu, Su Li, Pei-Yu Huang, He Huang, Li Zhang. (2011) Different Clinical Significance of Pre- and Post-treatment Plasma Epstein–Barr Virus DNA Load in Nasopharyngeal Carcinoma Treated with Radiotherapy. Clinical Oncology 23:2, 128-133
CrossRef25
Michela Casanova, Gianni Bisogno, Lorenza Gandola, Giovanni Cecchetto, Andrea Di Cataldo, Eleonora Basso, Paolo Indolfi, Paolo D'Angelo, Francesca Favini, Paola Collini, Paolo Potepan, Andrea Ferrari, . (2011) A prospective protocol for nasopharyngeal carcinoma in children and adolescents. Cancern/a-n/a
CrossRef26
Kun-Lung Chuang, See-Tong Pang, Shuen-Kuei Liao, Chun Te Wu, Ying Hsu Chang, Heng-Chang Chuang, Cheng-Keng Chuang. (2011) Epstein-Barr virus DNA load in tumour tissues correlates with poor differentiation status in non-muscle invasive urothelial carcinomas. BJU International 107:1, 150-154
CrossRef27
Min-Chi Chen, Ping-Tsung Chen, Chunghuang Hubert Chan, Cheng-Ta Yang, Chih-Cheng Chen, Cih-En Huang, Chang-Hsien Lu, Kuan-Der Lee. (2011) Second primary esophageal or lung cancer in patients with head and neck carcinoma in Taiwan: incidence and risk in relation to primary index tumor site. Journal of Cancer Research and Clinical Oncology 137:1, 115-123
CrossRef28
Primož Strojan, Alfio Ferlito, Jesus E. Medina, Julia A. Woolgar, Alessandra Rinaldo, K. Thomas Robbins, Johannes J. Fagan, William M. Mendenhall, Vinidh Paleri, Carl E. Silver, Kerry D. Olsen, June Corry, Carlos Suárez, Juan P. Rodrigo, Johannes A. Langendijk, Kenneth O. Devaney, Luiz P. Kowalski, Dana M. Hartl, Missak Haigentz, Jochen A. Werner, Phillip K. Pellitteri, Remco de Bree, Gregory T. Wolf, Robert P. Takes, Eric M. Genden, Michael L. Hinni, Vanni Mondin, Ashok R. Shaha, Leon Barnes. (2011) Contemporary management of lymph node metastases from an unknown primary to the neck: I. A review of diagnostic approaches. Head & Neckn/a-n/a
CrossRef29
Cheng-Lung Hsu, Kai-Ping Chang, Chien-Yu Lin, Hsien-Kun Chang, Cheng-Hsu Wang, Tung-Liang Lin, Chun-Ta Liao, Ngan-Ming Tsang, Li-Yu Lee, Sheng-Chieh Chan, Shu-Hang Ng, Hsin-Pai Li, Yu-Sun Chang, Hung-Ming Wang. (2011) Plasma epstein-barr virus DNA concentration and clearance rate as novel prognostic factors for metastatic nasopharyngeal carcinoma. Head & Neckn/a-n/a
CrossRef30
Kimberley Jones, Jamie P. Nourse, Colm Keane, Pauline Crooks, David Gottlieb, David S. Ritchie, Devinder Gill, Maher K. Gandhi. (2011) Tumor-specific but not non-specific cell-free circulating DNA can be used to monitor disease response in lymphoma. American Journal of Hematologyn/a-n/a
CrossRef31
Hong-Lian Ruan, Feng-Hua Xu, Wen-Sheng Liu, Qi-Sheng Feng, Li-Zhen Chen, Yi-Xin Zeng, Wei-Hua Jia. (2010) Alcohol and tea consumption in relation to the risk of nasopharyngeal carcinoma in Guangdong, China. Frontiers of Medicine in China 4:4, 448-456
CrossRef32
A. T. C. Chan. (2010) Nasopharyngeal carcinoma. Annals of Oncology 21:Supplement 7, vii308-vii312
CrossRef33
Bernadette Brennan, Charles Stiller. 2010. Rare Tumors. , 319-332.
CrossRef34
José-Tomás Navarro, Águeda Hernández, Jesús Rodríguez-Manzano, José-Luis Mate, Javier Grau, Mireia Morgades, Elisa Martró, Cristina Tural, Josep-Maria Ribera, Lurdes Matas. (2010) Plasma Epstein-Barr viral load measurement as a diagnostic marker of lymphoma in HIV-infected patients. Medicina Clínica 135:11, 485-490
CrossRef35
Ivan Weng-Keong Tham, Jiade Jay Lu. (2010) Controversies and challenges in the current management of nasopharyngeal cancer. Expert Review of Anticancer Therapy 10:9, 1439-1450
CrossRef36
Ze-Fang Ren, Wen-Sheng Liu, Hai-De Qin, Ya-Fei Xu, Dan-Dan Yu, Qi-Sheng Feng, Li-Zhen Chen, Xiao-Ou Shu, Yi-Xin Zeng, Wei-Hua Jia. (2010) Effect of family history of cancers and environmental factors on risk of nasopharyngeal carcinoma in Guangdong, China. Cancer Epidemiology 34:4, 419-424
CrossRef37
Jung-Shun Lee, Chih-Ming Huang, I-Chun Yeh, Helen Hai-Wen Chen, Jin-Ching Lin, Hsing-Hong Chen. (2010) Isolated osteoradionecrosis of the dens mimicking metastasis of nasopharyngeal carcinoma after radiotherapy. Journal of Clinical Neuroscience 17:8, 1064-1066
CrossRef38
Albiruni R.A. Razak, Lillian L. Siu, Fei-Fei Liu, Emma Ito, Brian O’Sullivan, Kelvin Chan. (2010) Nasopharyngeal carcinoma: The next challenges. European Journal of Cancer 46:11, 1967-1978
CrossRef39
Kimberley Jones, Maher K. Gandhi. (2010) Can a blood test monitor lymphoma?. Leukemia & Lymphoma 51:6, 957-959
CrossRef40
Francesco Caponigro, Francesco Longo, Franco Ionna, Francesco Perri. (2010) Treatment approaches to nasopharyngeal carcinoma: a review. Anti-Cancer Drugs 21:5, 471-477
CrossRef41
Barbara Gärtner, Jutta K. Preiksaitis. (2010) EBV viral load detection in clinical virology. Journal of Clinical Virology 48:2, 82-90
CrossRef42
Alex S. C. Machado, Marcela C. Da Silva Robaina, Lidia M. Magalhães De Rezende, Alexandre G. Apa, Nívea D. Amoêdo, Carlos E. Bacchi, Claudete E. Klumb. (2010) Circulating cell-free and Epstein–Barr virus DNA in pediatric B-non-Hodgkin lymphomas. Leukemia & Lymphoma 51:6, 1020-1027
CrossRef43
T. Martelius, M. Lappalainen, S. M. Aalto, A. Nihtinen, K. Hedman, V.-J. Anttila. (2010) Clinical characteristics, outcome and the role of viral load in nontransplant patients with Epstein-Barr viraemia. Clinical Microbiology and Infection 16:6, 657-662
CrossRef44
K. JONES, J. NOURSE, G. CORBETT, M. K. GANDHI. (2010) Sodium valproate in combination with ganciclovir induces lysis of EBV-infected lymphoma cells without impairing EBV-specific T-cell immunity. International Journal of Laboratory Hematology 32:1p1, e169-e174
CrossRef45
William I. Wei, Dora L. W. Kwong. (2010) Current Management Strategy of Nasopharyngeal Carcinoma. Clinical and Experimental Otorhinolaryngology 3:1, 1
CrossRef46
Hendrik Andreas Wolff, Ralph M. W. Rödel, Bastian Gunawan, Tobias Overbeck, Markus K. A. Herrmann, Steffen Hennies, Andrea Hille, Hilke Vorwerk, Christoph Matthias, Clemens F. Hess, Hans Christiansen. (2010) Nasopharyngeal carcinoma in adults: treatment results after long-term follow-up with special reference to adjuvant interferon-beta in undifferentiated carcinomas. Journal of Cancer Research and Clinical Oncology 136:1, 89-97
CrossRef47
S.-C. Tsai, S.-J. Lin, P.-W. Chen, W.-Y. Luo, T.-H. Yeh, H.-W. Wang, C.-J. Chen, C.-H. Tsai. (2009) EBV Zta protein induces the expression of interleukin-13, promoting the proliferation of EBV-infected B cells and lymphoblastoid cell lines. Blood 114:1, 109-118
CrossRef48
Da-Jiang Li, Jin-Xin Bei, Shi-Juan Mai, Jin-Fen Xu, Li-Zhen Chen, Ru-Hua Zhang, Xing-Juan Yu, Ming-Huang Hong, Yi-Xin Zeng, Tiebang Kang. (2009) The dominance of China 1 in the spectrum of Epstein-Barr virus strains from Cantonese patients with nasopharyngeal carcinoma. Journal of Medical Virology 81:7, 1253-1260
CrossRef49
Heming Lu, Luxing Peng, Xianbin Yuan, Yanrong Hao, Zhiping Lu, Jiaxin Chen, Jinjian Cheng, Shan Deng, Junzhao Gu, Qiang Pang, Jian Qin. (2009) Concurrent chemoradiotherapy in locally advanced nasopharyngeal carcinoma: A treatment paradigm also applicable to patients in Southeast Asia. Cancer Treatment Reviews 35:4, 345-353
CrossRef50
Angel Chao, Chi-Neu Tsai, Swei Hsueh, Li-Yu Lee, Tse-Ching Chen, Shang-Lang Huang, Fang-Yu Chao, Chyong-Huey Lai. (2009) Does Epstein-Barr Virus Play a Role in Lymphoepithelioma-like Carcinoma of the Uterine Cervix?. International Journal of Gynecological Pathology 28:3, 279-285
CrossRef51
Tony C. Y. Chuang, Alice Y. C. Chuang, Luana Poeta, Wayne M. Koch, Joseph A. Califano, Ralph P. Tufano. (2009) Detectable BRAF mutation in serum DNA samples from patients with papillary thyroid carcinomas. Head & NeckNA-NA
CrossRef52
Hyo Song Kim, Kyung Hee Kim, Kyoung Ha Kim, Myung Hee Chang, Sang Hoon Ji, Do Hyoung Lim, Kihyun Kim, Seok Jin Kim, Younghyeh Ko, Chang-Seok Ki, Sook Jung Jo, Jae Won Lee, Won Seog Kim. (2009) Whole blood Epstein-Barr virus DNA load as a diagnostic and prognostic surrogate: extranodal natural killer/T-cell lymphoma. Leukemia & Lymphoma 50:5, 757-763
CrossRef53
Herbert H. Loong, Brigette B. Ma, Anthony T. Chan. (2008) Update on the Management and Therapeutic Monitoring of Advanced Nasopharyngeal Cancer. Hematology/Oncology Clinics of North America 22:6, 1267-1278
CrossRef54
Anna Merlo, Riccardo Turrini, Riccardo Dolcetti, Paola Zanovello, Alberto Amadori, Antonio Rosato. (2008) Adoptive cell therapy against EBV-related malignancies: a survey of clinical results. Expert Opinion on Biological Therapy 8:9, 1265-1294
CrossRef55
Hiroshi Kimura, Yoshinori Ito, Ritsuro Suzuki, Yukihiro Nishiyama. (2008) Measuring Epstein-Barr virus (EBV) load: the significance and application for each EBV-associated disease. Reviews in Medical Virology 18:5, 305-319
CrossRef56
Kai-Ping Chang, Cheng-Lung Hsu, Yu-Liang Chang, Ngan-Ming Tsang, Chin-Kuo Chen, Ta-Jen Lee, Kuo-Chien Tsao, Chung-Guei Huang, Yu-Sun Chang, Jau-Song Yu, Sheng-Po Hao. (2008) Complementary serum test of antibodies to Epstein-Barr virus nuclear antigen-1 and early antigen: A possible alternative for primary screening of nasopharyngeal carcinoma. Oral Oncology 44:8, 784-792
CrossRef57
Brigette B. Y. Ma, Edwin P. Hui, Anthony T. C. Chan. (2008) Systemic approach to improving treatment outcome in nasopharyngeal carcinoma: Current and future directions. Cancer Science 99:7, 1311-1318
CrossRef58
Cheng-Yu Lin, Sen-Tien Tsai, Ying-Tai Jin, Ming-Wei Yang, I-Chun Yeh, Jenn-Ren Hsiao. (2008) Outcome of surgical management of persistent or recurrent neck mass in patients with nasopharyngeal carcinoma after radiotherapy. European Archives of Oto-Rhino-Laryngology 265:S1, 69-74
CrossRef59
Margaret L. Gulley, Weihua Tang. (2008) Laboratory Assays for Epstein-Barr Virus-Related Disease. The Journal of Molecular Diagnostics 10:4, 279-292
CrossRef60
Mark Agulnik, Joel B. Epstein. (2008) Nasopharyngeal carcinoma: Current management, future directions and dental implications. Oral Oncology 44:7, 617-627
CrossRef61
Ana M. Neves, Gertrude Thompson, Júlio Carvalheira, José Costa Trindade, José Rueff, Joaquim Machado Caetano, James W. Casey, Sylvie Hermouet. (2008) Detection and quantitative analysis of human herpesvirus in pilocytic astrocytoma. Brain Research 1221, 108-114
CrossRef62
Brigette Ma, Edwin P. Hui, Ann King, K. F. To, Frankie Mo, Sing F. Leung, Michael Kam, Y. M. Dennis Lo, Benny Zee, Tony Mok, Anil Ahuja, Anthony T. C. Chan. (2008) A phase II study of patients with metastatic or locoregionally recurrent nasopharyngeal carcinoma and evaluation of plasma Epstein–Barr virus DNA as a biomarker of efficacy. Cancer Chemotherapy and Pharmacology 62:1, 59-64
CrossRef63
Joël Guigay. (2008) Advances in nasopharyngeal carcinoma. Current Opinion in Oncology 20:3, 264-269
CrossRef64
P.-W. Yang, S.-S. Chang, C.-H. Tsai, Y.-H. Chao, M.-R. Chen. (2008) Effect of phosphorylation on the transactivation activity of Epstein-Barr virus BMRF1, a major target of the viral BGLF4 kinase. Journal of General Virology 89:4, 884-895
CrossRef65
Matthew G. Fury, David G. Pfister. 2008. Head and Neck Squamous Cell Carcinoma. , 479-485.
CrossRef66
Steven FT Thijsen, Marjolein PD Deege. (2008) Molecular diagnosis of Epstein–Barr virus infections. Expert Opinion on Medical Diagnostics 2:1, 21-31
CrossRef67
Supaporn Suwiwat, Jintana Pradutkanchana, Takafumi Ishida, Winyou Mitarnun. (2007) Quantitative analysis of cell-free Epstein-Barr virus DNA in the plasma of patients with peripheral T-cell and NK-cell lymphomas and peripheral T-cell proliferative diseases. Journal of Clinical Virology 40:4, 277-283
CrossRef68
Bayardo Perez-Ordoñez. (2007) An Update on Epstein-Barr Virus and Nasopharyngeal Carcinogenesis. Head and Neck Pathology 1:2, 141-145
CrossRef69
Christine H. Chung, Stuart Wong, K. Kian Ang, Elizabeth H. Hammond, Adam P. Dicker, Paul M. Harari, Quynh-Thu Le. (2007) Strategic Plans to Promote Head and Neck Cancer Translational Research Within the Radiation Therapy Oncology Group: A Report From the Translational Research Program. International Journal of Radiation Oncology*Biology*Physics 69:2, S67-S78
CrossRef70
Paolo Paoli, Chiara Pratesi, Maria Teresa Bortolin. (2007) The Epstein Barr virus DNA levels as a tumor marker in EBV-associated cancers. Journal of Cancer Research and Clinical Oncology 133:11, 809-815
CrossRef71
Jin-Ching Lin, Wen-Yi Wang, Wen-Miin Liang, Hsin-Yi Chou, Jian-Sheng Jan, Rong-San Jiang, Ju-Yu Wang, Chih-Wen Twu, Kai-Li Liang, Jeffrey Chao, Wu-Chung Shen. (2007) Long-Term Prognostic Effects of Plasma Epstein-Barr Virus DNA by Minor Groove Binder-Probe Real-Time Quantitative PCR on Nasopharyngeal Carcinoma Patients Receiving Concurrent Chemoradiotherapy. International Journal of Radiation Oncology*Biology*Physics 68:5, 1342-1348
CrossRef72
Fei-Fei Liu, Lori Frappier, John Kim, Brian O’Sullivan, Angela Hui, Carlo Bastianutto. (2007) East-West Symposium on nasopharyngeal cancer. International Journal of Radiation Oncology*Biology*Physics 67:3, 703-708
CrossRef73
M. Fleischhacker, B. Schmidt. (2007) Circulating nucleic acids (CNAs) and cancer—A survey. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1775:1, 181-232
CrossRef74
Frank Diehl, Luis A Diaz. (2007) Digital quantification of mutant DNA in cancer patients. Current Opinion in Oncology 19:1, 36-42
CrossRef75
C Cameron Yin, Dan Jones. (2006) Molecular approaches towards characterization, monitoring and targeting of viral-associated hematological malignancies. Expert Review of Molecular Diagnostics 6:6, 831-841
CrossRef76
Samuel B Pattle, Paul J Farrell. (2006) The role of Epstein–Barr virus in cancer. Expert Opinion on Biological Therapy 6:11, 1193-1205
CrossRef77
Jill Lacy, Regina Loomis, Susan Grill, Pavani Srimatkandada, Rocco Carbone, Yung-Chi Cheng. (2006) Systemic Bcl-2 antisense oligodeoxynucleotide in combination with cisplatin cures EBV+ nasopharyngeal carcinoma xenografts in SCID mice. International Journal of Cancer 119:2, 309-316
CrossRef78
Fuming Sang, Jicun Ren. (2006) Comparisons between capillary zone electrophoresis and real-time PCR for quantification of circulating DNA levels in human sera. Journal of Chromatography B 838:2, 122-128
CrossRef79
Jose M. Garcia, Vanesa Garcia, Javier Silva, Cristina Peña, Gemma Dominguez, Antonio Sanchez, Luis Sanfrutos, Mariano Provencio, Isabel Millan, Dolores Chaparro, Pilar España, Felix Bonilla. (2006) Extracellular tumor DNA in plasma and overall survival in breast cancer patients. Genes, Chromosomes and Cancer 45:7, 692-701
CrossRef80
Chih-Chung Lu, Mei-Ru Chen. (2006) Lytic replication of Epstein–Barr virus. Future Virology 1:4, 435-446
CrossRef81
Ning Ren, Lun-Xiu Qin, Hong Tu, Yin-Kun Liu, Bo-Heng Zhang, Zhao-You Tang. (2006) The prognostic value of circulating plasma DNA level and its allelic imbalance on chromosome 8p in patients with hepatocellular carcinoma. Journal of Cancer Research and Clinical Oncology 132:6, 399-407
CrossRef82
Lisa Licitra, Chiara Rossini, Paolo Bossi, Laura D. Locati. (2006) Advances in the changing patterns of aetiology of head and neck cancers. Current Opinion in Otolaryngology & Head and Neck Surgery 14:2, 95-99
CrossRef83
Guojun Li, Erich M. Sturgis. (2006) The role of human papillomavirus in squamous carcinoma of the head and neck. Current Oncology Reports 8:2, 130-139
CrossRef84
Maria Teresa Bortolin, Chiara Pratesi, Riccardo Dolcetti, Ettore Bidoli, Emanuela Vaccher, Stefania Zanussi, Rosamaria Tedeschi, Paolo De Paoli. (2006) Clinical value of Epstein–Barr virus DNA levels in peripheral blood samples of Italian patients with Undifferentiated Carcinoma of Nasopharyngeal Type. Cancer Letters 233:2, 247-254
CrossRef85
Xiaohong Rose Yang, Alisa M. Goldstein, Chien-Jen Chen, Charles S. Rabkin, Jen-Yang Chen, Yu-Juen Cheng, Wan-Lun Hsu, Brenda Sun, Scott R. Diehl, Mei-Ying Liu, Michael Walters, Wen Shao, Betty A. Ortiz-Conde, Denise Whitby, Sandra H. Elmore, Margaret L. Gulley, Allan Hildesheim. (2006) Distribution of Epstein-Barr viral load in serum of individuals from nasopharyngeal carcinoma high-risk families in Taiwan. International Journal of Cancer 118:3, 780-784
CrossRef86
William I Wei, Jonathan ST Sham. (2005) Nasopharyngeal carcinoma. The Lancet 365:9476, 2041-2054
CrossRef87
C. Suankratay, S. Shuangshoti, A. Mutirangura, V. Prasanthai, S. Lerdlum, S. Shuangshoti, J. Pintong, H. Wilde. (2005) Epstein-Barr Virus Infection-Associated Smooth-Muscle Tumors in Patients with AIDS. Clinical Infectious Diseases 40:10, 1521-1528
CrossRef88
Mei-Yin Chang, Inn-Wen Chong, Fang-Ming Chen, Jaw-Yuan Wang, Tian-Lu Cheng, Yu-Jen Cheng, Chau Chyun Sheu, Sung-Yu Hung, Ming-Chen Yang, Shiu-Ru Lin. (2005) High frequency of frameshift mutation on p53 gene in Taiwanese with non small cell lung cancer. Cancer Letters 222:2, 195-204
CrossRef89
William P O??Meara, Nancy Lee. (2005) Advances in nasopharyngeal carcinoma. Current Opinion in Oncology 17:3, 225-230
CrossRef90
Lirong Qu, Shushen Xu, David Rowe, Darrell Triulzi. (2005) Efficacy of Epstein-Barr virus removal by leukoreduction of red blood cells. Transfusion 45:4, 591-595
CrossRef91
M Agulnik, L L Siu. (2005) State-of-the-art management of nasopharyngeal carcinoma: current and future directions. British Journal of Cancer 92:5, 799-806
CrossRef92
Manit Arya, Iqbal S Shergill, Magali Williamson, Lyndon Gommersall, Neehar Arya, Hitendra RH Patel. (2005) Basic principles of real-time quantitative PCR. Expert Review of Molecular Diagnostics 5:2, 209-219
CrossRef93
Carlos Rodriguez-Galindo, Marcia Wofford, Robert P. Castleberry, Gregory P. Swanson, Wendy B. London, James Fontanesi, Alberto S. Pappo, Edwin C. Douglass. (2005) Preradiation chemotherapy with methotrexate, cisplatin, 5-fluorouracil, and leucovorin for pediatric nasopharyngeal carcinoma. Cancer 103:4, 850-857
CrossRef94
Paul J Farrell. (2005) Can plasma Epstein?Barr virus DNA levels be used to monitor nasopharyngeal carcinoma progression?. Nature Clinical Practice Oncology 2:1, 14-15
CrossRef95
J.S.H. Low, D.M.K. Heng, J.T.S. Wee. (2004) The question of T2a and N3a in the UICC/AJCC (1997) staging system for nasopharyngeal carcinoma. Clinical Oncology 16:8, 581-583
CrossRef
