Original Article
Immunoproliferative Small Intestinal Disease Associated with Campylobacter jejuni
N Engl J Med 2004; 350:239-248January 15, 2004
- Abstract
Background
Immunoproliferative small intestinal disease (also known as alpha chain disease) is a form of lymphoma that arises in small intestinal mucosa-associated lymphoid tissue (MALT) and is associated with the expression of a monotypic truncated immunoglobulin α heavy chain without an associated light chain. Early-stage disease responds to antibiotics, suggesting a bacterial origin. We attempted to identify a causative agent.
Methods
We performed polymerase chain reaction (PCR), DNA sequencing, fluorescence in situ hybridization, and immunohistochemical studies on intestinal-biopsy specimens from a series of patients with immunoproliferative small intestinal disease.
Results
Analysis of frozen intestinal tissue obtained from an index patient with immunoproliferative small intestinal disease who had a dramatic response to antibiotics revealed the presence of Campylobacter jejuni. A follow-up retrospective analysis of archival intestinal-biopsy specimens disclosed campylobacter species in four of six additional patients with immunoproliferative small intestinal disease.
Conclusions
These results indicate that campylobacter and immunoproliferative small intestinal disease are associated and that C. jejuni should be added to the growing list of human pathogens responsible for immunoproliferative states.
Media in This Article
Figure 1
Histologic and Immunohistologic Studies of Endoscopic-Biopsy Specimens from the Index Patient.Figure 2
Resolution of Immunoproliferative Small Intestinal Disease in the Index Patient after Antimicrobial Therapy.Article Activity
- Article
Immunoproliferative small intestinal disease, also known as alpha chain disease, is a mucosa-associated lymphoid-tissue (MALT) lymphoma characterized by infiltration of the bowel wall with a plasma-cell population that secretes a monotypic, truncated immunoglobulin α heavy chain lacking an associated light chain.1-3 Lymphoid infiltration leads to malabsorption and protein-losing enteropathy. The disease can cause a spectrum of histopathological changes, ranging from seemingly benign lymphoid infiltration to malignant diffuse large-B-cell lymphoma.
Since its initial description,1 immunoproliferative small intestinal disease has largely been reported in the Mediterranean basin, the Middle East, the Far East, and Africa. In the Middle East, the most common site of extranodal lymphoma is the gastrointestinal tract: immunoproliferative small intestinal disease accounts for approximately one third of gastrointestinal lymphomas.4 The restricted geographic distribution of the disease has led to the hypothesis that environmental factors may have a pathogenic role.
Remarkably, early-stage immunoproliferative small intestinal disease typically responds to antibiotics, suggesting that it may be triggered by bacterial infection.5,6 However, previous attempts to identify a causative agent with the use of standard culture methods have failed.5-7 Immunoproliferative small intestinal disease shares histopathological features with gastric MALT lymphoma associated with Helicobacter pylori infection,2,3 and a case report suggested that H. pylori may be a potential causative agent.8 However, this proposal was not supported by the results of a subsequent retrospective study of 21 patients with immunoproliferative small intestinal disease.9 We used a molecular strategy similar to that used to identify the causative agents of bacillary angiomatosis (Bartonella henselae)10 and Whipple's disease (Tropheryma whipplei),11 in order to determine whether immunoproliferative small intestinal disease could be linked to specific bacterial species.
Case Reports
Index Patient
A 45-year-old woman from Cameroon was hospitalized for a 12-month-long illness characterized by chronic diarrhea and wasting. Histologic examination of endoscopic biopsy specimens from her duodenum and proximal jejunum revealed massive infiltration of the lamina propria, with a dimorphic population of plasma cells located in the superficial mucosa and centrocyte-like lymphocytes proliferating deeper in the mucosa, mostly around crypts (Figure 1AFigure 1
Histologic and Immunohistologic Studies of Endoscopic-Biopsy Specimens from the Index Patient., Figure 1B, Figure 1C, and Figure 1D). Infiltration of the lamina propria was less pronounced in antral-biopsy specimens.Immunohistochemical studies of these biopsy specimens showed that the plasma cells were negative for CD20, whereas the centrocyte-like lymphocytes were positive for CD20 (Figure 1E and Figure 1F). The cytoplasm of both plasma cells and centrocyte-like lymphocytes showed intense staining for immunoglobulin α heavy chain, with no detectable expression of light chains or surface immunoglobulin in these cells (Figure 1G, Figure 1H, Figure 1I, and Figure 1J). Centrocyte-like lymphocytes were responsible for the lymphoepithelial lesions that are typical of MALT lymphomas (Figure 1D, Figure 1E, and Figure 1F).
Staining of gastric- and intestinal-biopsy specimens with Giemsa and silver stains and serologic assays were all negative for H. pylori. Tissue and stool cultures were negative for salmonella, yersinia, shigella, and campylobacter. An enzyme-linked immunosorbent assay and Western blot assays of serum were positive for Campylobacter jejuni (data not shown).
Analysis of blood samples disclosed 7560 lymphocytes per cubic millimeter, with the vast majority having morphologic features of lymphoplasmacytes. Analysis with the use of a fluorescence-activated cell sorter established that 82 percent of peripheral-blood lymphocytes were CD19+, CD20–, CD38+, CD138– B cells. Immunocytochemical studies of the sorted cells revealed high levels of cytoplasmic α heavy chains without detectable light chains or surface immunoglobulin. Bone marrow biopsy disclosed extensive infiltration with lymphoplasmacytes. Evidence of the clonality of this population was provided by Southern blot analysis of peripheral-blood lymphocyte DNA, which showed discrete rearrangements of the genes for the immunoglobulin heavy-chain and κ light-chain loci (data not shown). The serum IgA level was increased to 10.9 g per liter (normal range, 0.76 to 3.90), whereas IgG and IgM levels were decreased (to 5.81 and 0.22 g per liter, respectively). Immunoelectrophoresis of serum, aspirated jejunal luminal contents, and urine from the patient showed a prominent arc of α heavy chain precipitin (Figure 2AFigure 2
Resolution of Immunoproliferative Small Intestinal Disease in the Index Patient after Antimicrobial Therapy.). Western blot analysis of serum revealed the presence of a truncated monotypic α1 heavy chain.On the basis of these clinical, histopathological, and immunologic findings, a diagnosis of immunoproliferative small intestinal disease was made. Given the gastric extension of the disease, the phenotypic similarities between the disease and H. pylori–associated gastric MALT lymphoma,2,3 and a previous case report of regression of immunoproliferative small intestinal disease in a patient after the eradication of H. pylori infection,8 triple antimicrobial therapy was initiated (1 g of amoxicillin twice daily, 500 mg of metronidazole twice daily, and 500 mg of clarithromycin twice daily) in combination with a proton-pump inhibitor (20 mg of omeprazole twice daily). The diarrhea subsided within a week, the leukemic component disappeared within 10 weeks (Figure 2B), and there was progressive resolution of the paraproteinemia (Figure 2A and Figure 2C) and intestinal lymphoplasmacytic infiltrate (data not shown). Treatment was stopped after five months because the patient was asymptomatic, the leukemic and serum paraprotein abnormalities had disappeared, and lymphoplasmacytic infiltration of the intestine was barely detectable in follow-up endoscopic biopsy specimens from the jejunum. One year after the diagnosis had been established, the results of clinical examination and laboratory studies were normal.
Six Additional Patients
Immunoproliferative small intestinal disease is rare. Frozen intestinal samples from other patients with untreated immunoproliferative small intestinal disease were not available to us. Therefore, we retrieved archival paraffin-embedded excisional jejunal-biopsy specimens obtained at the time of laparoscopy 8 to 27 years earlier from six additional patients in whom immunoproliferative small intestinal disease had been diagnosed at a single hospital according to established histopathological and immunologic criteria.1,5,6,12
Methods
Tissue Samples
We analyzed tissue specimens from six sources. Frozen and formalin-fixed, paraffin-embedded specimens were obtained from gastric, duodenal, and jejunal biopsies performed endoscopically in the index patient one day before and eight days after the initiation of antimicrobial therapy. Archival jejunal-biopsy specimens, which had been fixed in Bouin's fluid and embedded in paraffin, were obtained from six additional patients who had received a diagnosis of immunoproliferative small intestinal disease. Formalin-fixed, paraffin-embedded jejunal-biopsy specimens were obtained endoscopically from a patient infected with human immunodeficiency virus (HIV) who had acute C. jejuni enteritis. Formalin-fixed, paraffin-embedded stomach samples were obtained from a patient with H. pylori gastritis. Frozen duodenal-biopsy specimens were obtained from 10 patients with chronic diarrhea of unknown origin (as defined by negative cultures for known enteropathogens). Formalin-fixed, paraffin-embedded duodenal-biopsy specimens were obtained from 10 patients who were being evaluated for anemia.
Bacterial Strains and Antibodies
We obtained C. jejuni reference strain CIP 70.2, H. pylori reference strain CIP 103995, and Escherichia coli reference strain CIP 7624 from the Institut Pasteur collection. Two mouse monoclonal antibodies were used for immunohistochemical studies: IgG2b NCL-C-JEJUNI (Novocastra), which recognizes a flagellar immunologic determinant common to C. jejuni and H. pylori, 13 and IgM CP1/IIG10 (Biotrend), which is directed against a 43-kD, non–surface-associated H. pylori antigen that is not detectable in other helicobacter species or unrelated bacteria.
Polymerase Chain Reaction
Universal primers PB (5'TAACACATGCAAGTCGAACG3') and DG74 (5'AGGAGGTGATCCAACCGCA3') were used to amplify bacterial 16S ribosomal DNA (rDNA).14 Established primers directed at C. jejuni (CCCJ609F 5'AATCTAATGGCTTAACCATTA3' and CCJ1442R 5'GTAACTAGTTTAGTATTCCGG3')15 were used to generate an 852-bp 16S rDNA amplicon. Primers specific for H. pylori (5'fla 5'CCACGGTTAAAGCGTCTATTGG3' and 3'fla 5'GATCGCATTAGTCAACCTCCCG3')16 were used to amplify a 401-bp fragment from the flaB gene. Two pairs of primers — 72/96F (5'ACAGGAAGAAGCTTGCTTCTTTGC3') and 455/477R (5'GAGCAAAGGTATTAACTTTACTCCC3') and 455/477F (5'GGGAGTAAAGTTAATACCTTTGCTC3') and 1000/1025R (5'ACATTCTCATCTCTGAAAACTTCCG3') — were designed to amplify 16S rDNA from Enterobacteriaceae. Cycling conditions for all polymerase chain reactions (PCRs) were as follows: 7 minutes at 95°C, 35 cycles of denaturation for 30 seconds at 95°C, annealing for 20 seconds at 55°C, and 2 minutes of extension at 72°C and then 10 minutes at 72°C.
The specificity of the PCR assays was initially established with the use of DNA extracted from the three reference strains listed above (Table 1Table 1
Results of Polymerase-Chain-Reaction (PCR) Assays of Biopsy Specimens from the Index Patient with Immunoproliferative Small Intestinal Disease and Control Samples.). For the index patient, amplicons from 16S ribosomal genes were subcloned, and the nucleotide sequences of 12 randomly chosen clones were determined on both strands. All 16S rDNA sequences that were at least 99 percent homologous were considered to belong to the same species.17,18 Fluorescence in Situ Hybridization
Cy3-tagged 5'ATTACTGAGATGACTAGCACCCC3' (Cj-490) was used to probe for the presence of C. jejuni, 19 whereas Cy3-tagged 5'CACACCTGACTGACTATCCCG3' (Hpy-1) was used to detect H. pylori.20 Deparaffinized, formalin-fixed sections that were 5 μm thick were incubated for 10 minutes in lysozyme buffer (10 mg of lysozyme per milliliter [Sigma], 100 mM TRIS–hydrochloric acid [pH 8], and 50 mM EDTA) at room temperature and then for 2 hours at 35°C in hybridization chambers with the oligonucleotide probe (diluted to a final concentration of 4.5 ng per microliter in a solution of 30 percent formamide, 0.9 M sodium chloride, 20 mM TRIS–hydrochloric acid [pH 8], and 0.01 percent sodium dodecyl sulfate). Tissue sections were washed twice (for 15 minutes at 37°C per cycle) in wash buffer (0.9 M sodium chloride, 20 mM TRIS–hydrochloric acid [pH 8], 5 mM EDTA, and 0.01 percent sodium dodecyl sulfate) and once in distilled water, dried at room temperature, mounted, and observed by means of epifluorescence microscopy.
All tissue samples studied were collected as part of routine care. The National Ethics Committee of France requires neither approval by institutional review boards nor informed consent for this type of research to be conducted.
Results
Identification of C. jejuni DNA
DNA was extracted from frozen jejunal- and gastric-biopsy specimens from the index patient. Initial PCR assays of these DNAs were performed with the use of well-established universal primers known to generate amplicons from the 16S rDNA genes from most phyla in the bacteria superkingdom.14 Amplicons were produced in assays in which the DNA template was extracted from frozen jejunal samples harvested one day before treatment was initiated. In contrast, no amplicons were produced with the use of DNA prepared from material harvested eight days after therapy was started.
The nucleotide sequences of 8 of 12 cloned amplicons generated from the pretreatment preparation of jejunal DNA were 99.6 percent identical to 16S rDNA amplified from DNA of the C. jejuni reference strain. Computer searches of GenBank with the use of the BLAST program (http://www.ncbi.nlm.nih.gov/blast/) and the 16S rDNA data base (http://greengenes.llnl.gov/16S/) showed that the four remaining sequences were from abiotrophia, neisseria, lactococcus, and haemophilus. Members of these four genera are part of the normal oropharyngeal microbiota in humans.
Follow-up PCR studies with the use of primers directed at C. jejuni 16S rDNA yielded amplicons of the expected size from antral, jejunal, and fecal DNAs prepared from material obtained before the initiation of antimicrobial therapy (Table 1). Assays of the same DNAs with the use of primers directed at H. pylori 16S rDNA or primers that recognize 16S rDNA from members of the Enterobacteriaceae family were all negative (Table 1). In addition, the PCR assay was negative with the use of primers directed at C. jejuni and DNA prepared from jejunal- and gastric-biopsy specimens obtained from the index patient eight days after the initiation of antibiotic treatment and from DNA extracted from frozen proximal intestinal-biopsy specimens from 10 control patients with diarrhea of unknown origin (i.e., not associated with cultivatable enteropathogens) (Table 1).
The results of sequencing 16S rDNA amplicons obtained with universal bacterial 16S rDNA primers and the C. jejuni–directed PCR assays of endoscopic biopsy specimens from the index patient and controls provided initial evidence of an association between this campylobacter species and immunoproliferative small intestinal disease.
Detection of Campylobacter jejuni in Small Intestinal Tissue
To provide further evidence of the presence of C. jejuni in the index patient, we developed a fluorescence in situ hybridization (FISH) assay using an oligonucleotide probe directed at C. jejuni 16S rRNA. The sensitivity and specificity of the FISH assay were established as follows: staining with the Cy3-labeled oligonucleotide was readily detectable in a smear of cultured C. jejuni (Figure 3AFigure 3
Fluorescence in Situ Hybridization (FISH) and Immunohistochemical Analysis of Tissue Specimens.), intraluminal C. jejuni were detected in a jejunal-biopsy specimen from an HIV-infected patient with culture-documented C. jejuni enteritis (Table 2Table 2
Results of Fluorescence in Situ Hybridization and Immunohistochemical Assays of Biopsy Specimens from the Index Patient, Six Other Patients with Immunoproliferative Small Intestinal Disease, and Controls.), and no signal was noted in gastric-biopsy specimens from a patient with H. pylori gastritis (Table 2 and Figure 3B).Subsequent FISH analysis with the C. jejuni probe revealed the organism in sections of jejunal- and stomach-biopsy specimens obtained from the index patient before the initiation of antimicrobial therapy. The organism was most prominent in the lamina propria, often in the vicinity of capillaries (Figure 3D, Figure 3E, Figure 3F, and Figure 3G), a finding consistent with the observed tropism of this organism in an animal model of infection.21 A control H. pylori–specific FISH probe (Figure 3C) did not produce a signal (Table 2), a finding that is consistent with the negative Giemsa and silver staining and the PCR results (Table 1).
Finally, immunohistochemical methods were used to confirm the presence of C. jejuni in the index patient. Two well-characterized, commercially available preparations of monoclonal antibody were used: one recognizes a flagellar immunologic determinant shared by C. jejuni and H. pylori (NCL-C-JEJUNI), and another is specific for an H. pylori epitope (CP1/IIG10). Control experiments that used sections of jejunum from an HIV-infected patient with culture-positive acute C. jejuni enteritis disclosed a prominent signal with NCL-C-JEJUNI and no signal with the H. pylori–specific monoclonal antibody (Figure 3H and Table 2). Assays of sections prepared from jejunal- and gastric-biopsy specimens obtained before the index patient started antimicrobial therapy disclosed readily detectable signals in the lamina propria with NCL-C-JEJUNI but not with the H. pylori–specific antibody (Figure 3I and Table 2). Together, these results support the conclusion that C. jejuni was present at the sites of gut abnormalities in the index patient and rule out the possibility of concomitant H. pylori infection.
Analysis of Archival Tissues
We were unable to recover amplifiable DNA from any of the archival samples from six patients with immunoproliferative small intestinal disease — that is, the PCRs for the human β-actin gene as well as for C. jejuni 16S rDNA were all negative. This failure most likely reflects the method of fixation together with the age of the samples. However, because material fixed with Bouin's fluid is known to be suitable for FISH,22,23 these biopsy specimens were analyzed with the use of three probes: a universal bacterial 16S rDNA oligonucleotide (positive control for the presence of bacteria), the probe directed at C. jejuni, and the specific probe for H. pylori. The bacterial FISH probe was positive in samples from five of the six patients (Patients 1 through 5 in Table 2). The C. jejuni–directed probe produced a positive signal in three of the six biopsy specimens from these patients (Patients 1, 2, and 3 in Table 2).
In addition, the two monoclonal antibodies were used to confirm that C. jejuni immunologic determinants were present in all three FISH-positive samples (Figure 3J, Figure 3K, and Figure 3L), as well as in one FISH-negative sample (Figure 3M and Table 2). No signal was detected with these monoclonal antibodies in the 10 control duodenal samples. Moreover, the H. pylori–specific FISH probe and monoclonal antibody did not detect this species in any of the archival jejunal-biopsy specimens from the six patients with immunoproliferative small intestinal disease (Table 2).
Discussion
Previous attempts to link a bacterial species to immunoproliferative small intestinal disease with the use of culture-based approaches have failed.5-7 We used a molecular approach to establish a link between immunoproliferative small intestinal disease and C. jejuni infection in an index patient. This association is based on three observations. First, a PCR assay with the use of universal bacterial 16S rDNA primers and DNA templates prepared from biopsy specimens of the proximal small intestine obtained before the initiation of antimicrobial treatment in the index patient yielded amplicons encompassing the entire 16S rDNA gene that were identified as C. jejuni by sequencing. No other enteropathogen was detected by PCR. Second, FISH and immunohistochemical analyses showed C. jejuni in diseased biopsy specimens of the small intestine. Third, the eradication of C. jejuni with antimicrobial therapy was associated with rapid remission of the immunoproliferative small intestinal disease (i.e., resolution of both diarrhea and lymphoplasmacytic infiltration of the intestine and the disappearance of the leukemic component and the monotypic truncated immunoglobulin α heavy chain in serum).
Further support for an association between C. jejuni and immunoproliferative small intestinal disease is provided by four additional observations. Our retrospective study of a monocentric series of archival biopsy specimens yielded four additional cases of campylobacter-associated disease among six patients with immunoproliferative small intestinal disease. Puri et al. described a patient in whom culture-positive C. jejuni diarrhea developed two to three days after the initiation of antineoplastic chemotherapy for immunoproliferative small intestinal disease24 — a sequence of events that suggests that chemotherapy exacerbated a preexisting C. jejuni infection. Immunoproliferative small intestinal disease occurs almost exclusively in developing countries where C. jejuni infection is hyperendemic, often chronic, and asymptomatic.5,25-27 Finally, antimicrobial regimens reported to be effective in treating the disease are also active against C. jejuni infection.5-7
Our FISH and immunohistochemical studies detected C. jejuni in biopsy specimens of the small intestine and stomach from the index patient but not in biopsy specimens of the intestinal lumen. This result is in agreement with the negative stool cultures and may account for the failure of previous studies to link immunoproliferative small intestinal disease with this organism with the use of standard culture-based studies.5-7 Moreover, C. jejuni is microaerophilic and may exist in a viable but noncultivatable state.28
Our results do not allow us to conclude that C. jejuni is the only bacterial species associated with immunoproliferative small intestinal disease. Nonetheless, C. jejuni should be added to the growing list of human pathogens responsible for chronic infection that are also implicated in antigen-driven immunoproliferative states.29-31 The association of C. jejuni with immunoproliferative small intestinal disease is reminiscent of the link between H. pylori infection and gastric MALT lymphoma.29,30 However, in contrast to a previous case report8 and in agreement with a more recent study based on a series of 21 cases,9 we found no evidence that H. pylori is involved in the development of immunoproliferative small intestinal disease.
C. jejuni has been shown to persist in Peyer's patches and mesenteric lymph nodes in a gnotobiotic mouse model32 and to secrete a toxin, CdtB, that mediates DNA damage.33 These properties could be critical in the pathogenesis of immunoproliferative small intestinal disease. C. jejuni can elicit a strong IgA mucosal response, and chronic infection with C. jejuni leads to sustained stimulation of the mucosal immune system.26 This persistent stimulation could eventually lead to the expansion of IgA-secreting clones and to the selection of a clone that secretes α heavy chains that has eluded antibody-antigen Fc-dependent down-regulation.34,35 Eradication of the antigenic source with antimicrobial treatment may stop the proliferation of this lymphoplasmacytic population.
As is true for H. pylori–associated gastric MALT lymphomas, a better understanding of the role of C. jejuni in the pathogenesis of immunoproliferative small intestinal disease will require further analysis of mechanisms and the development of suitable animal models. The identification of an association between C. jejuni and immunoproliferative small intestinal disease may lead to improvements in the diagnosis, management, and prevention of this disease, at least in a subgroup of patients.
Supported by grants from the Programme de Recherche Fondamentale en Microbiologie, Maladies Infectieuses et Parasitaires, Ministère de l'Education Nationale de la Recherche et de la Technologie.
We are indebted to Hélène Poirel for Southern blot analysis, to Pierre Aucouturier for Western blot studies, to Jean-Louis Fauchère for C. jejuni and H. pylori serologic analyses, and to Jean-Claude Rambaud for assistance in retrieving archival biopsy materials and for helpful discussions.
Source Information
From Hôpital Avicenne (M.L., A.M., F.S., J.F., L.G., O.L.), Institut Pasteur (M.L., O.L.), Hôpital Necker (E.A., C.P., P.B.), Conservatoire National des Arts et Métiers (P.P.), Hôpital Saint-Louis (D.B.), and Hôpital Lariboisière (A.L.) — all in Paris; and Washington University School of Medicine, St. Louis (J.I.G.).
Address reprint requests to Dr. Lecuit at the Service des Maladies Infectieuses et Tropicales, Hôpital Necker–Enfants Malades, Université Paris V, 149 rue de Sèvres, 75743 Paris CEDEX 15, France, or at mlecuit@pasteur.fr.
- References
References
1
Seligmann M ,Danon F ,Hurez D ,Mihaesco E ,Preud'homme JL . Alpha-chain disease: a new immunoglobulin abnormality. Science 1968;162:1396-1397
CrossRef | Web of Science | Medline2
Isaacson P ,Wright DH . Malignant lymphoma of mucosa-associated lymphoid tissue: a distinctive type of B-cell lymphoma. Cancer 1983;52:1410-1416
CrossRef | Web of Science | Medline3
Isaacson PG ,Dogan A ,Price SK ,Spencer J . Immunoproliferative small-intestinal disease: an immunohistochemical study. Am J Surg Pathol 1989;13:1023-1033
CrossRef | Web of Science | Medline4
Salem P ,Anaissie E ,Allam C , et al. Non-Hodgkin's lymphomas in the Middle East: a study of 417 patients with emphasis on special features. Cancer 1986;58:1162-1166
CrossRef | Web of Science | Medline5
Rambaud J-C, Brouet J-C, Seligmann M. Alpha chain disease and related lymphoproliferative disorders. In: Ogra PL, Mestecky J, Lamm ME, Strober W, McGhee JR, Bienenstock J, eds. Handbook of mucosal immunology. San Diego, Calif.: Academic Press, 1994:425-33.
6
Isaacson PG, Norton AJ, eds. Extranodal lymphomas. London: Churchill Livingstone, 1994:340.
7
Harzic M ,Girard-Pipau F ,Halphen M ,Ferchal F ,Perol Y ,Rambaud J-C . Étude bactériologique, parasitologique et virologique de la flore digestive dans la maladie des chaînes alpha. Gastroenterol Clin Biol 1985;9:472-479
Web of Science | Medline8
Fischbach W ,Tacke W ,Greiner A ,Konrad H , Muller-Hermelink. Regression of immunoproliferative small intestinal disease after eradication of Helicobacter pylori. Lancet 1997;349:31-32
CrossRef | Web of Science | Medline9
Malekzadeh R ,Kaviani MJ ,Tabei SZ ,Abdolhadi B ,Haghshenas M ,Navab F . Lack of association between Helicobacter pylori infection and immunoproliferative small intestinal disease. Arch Iran Med 1999;2:1-410
Relman DA ,Loutit JS ,Schmidt TM ,Falkow S ,Tompkins LS . The agent of bacillary angiomatosis: an approach to the identification of uncultured pathogens. N Engl J Med 1990;323:1573-1580
Full Text | Web of Science | Medline11
Relman DA ,Schmidt TM ,MacDermott RP ,Falkow S . Identification of the uncultured bacillus of Whipple's disease. N Engl J Med 1992;327:293-301
Full Text | Web of Science | Medline12
Galian A ,Lecestre MJ ,Scotto J ,Bognel C ,Matuchansky C ,Rambaud JC . Pathological study of alpha-chain disease, with special emphasis on evolution. Cancer 1977;39:2081-2101
CrossRef | Web of Science | Medline13
Newell DG . Monoclonal antibodies directed against the flagella of Campylobacter jejuni: production, characterization and lack of effect on the colonization of infant mice. J Hyg (Lond) 1986;96:131-141
CrossRef | Web of Science | Medline14
Greisen K ,Loeffelholz M ,Purohit A ,Leong D . PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol 1994;32:335-351
Web of Science | Medline15
Linton D ,Lawson AJ ,Owen RJ ,Stanley J . PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. J Clin Microbiol 1997;35:2568-2572
Web of Science | Medline16
Suerbaum S ,Josenhans C ,Labigne A . Cloning and genetic characterization of the Helicobacter pylori and Helicobacter mustelae flaB flagellin genes and construction of H. pylori flaA- and flaB-negative mutants by electroporation-mediated allelic exchange. J Bacteriol 1993;175:3278-3288
Web of Science | Medline17
Kwok AY ,Su SC ,Reynolds RP , et al. Species identification and phylogenetic relationships based on partial HSP60 gene sequences within the genus Staphylococcus. Int J Syst Bacteriol 1999;49:1181-1192
CrossRef | Medline18
Rossello-Mora R ,Amann R . The species concept for prokaryotes. FEMS Microbiol Rev 2001;25:39-67
CrossRef | Web of Science | Medline19
Waller DF ,Ogata SA . Quantitative immunocapture PCR assay for detection of Campylobacter jejuni in foods. Appl Environ Microbiol 2000;66:4115-4118
CrossRef | Web of Science | Medline20
Trebesius K ,Panthel K ,Strobel S , et al. Rapid and specific detection of Helicobacter pylori macrolide resistance in gastric tissue by fluorescent in situ hybridisation. Gut 2000;46:608-614
CrossRef | Web of Science | Medline21
Boosinger TR ,Powe TA . Campylobacter jejuni infections in gnotobiotic pigs. Am J Vet Res 1988;49:456-458
Web of Science | Medline22
Weiss LM ,Chen YY . Effects of different fixatives on detection of nucleic acids from paraffin-embedded tissues by in situ hybridization using oligonucleotide probes. J Histochem Cytochem 1991;39:1237-1242
CrossRef | Web of Science | Medline23
Montone KT ,Litzky LA . Rapid method for detection of Aspergillus 5S ribosomal RNA using a genus-specific oligonucleotide probe. Am J Clin Pathol 1995;103:48-51
Web of Science | Medline24
Puri AS ,Aggarwal R ,Khan EM , et al. Explosive Campylobacter jejuni diarrhea in immunoproliferative small intestinal disease. Indian J Gastroenterol 1992;11:141-143
Medline25
Ponka A ,Pitkanen T ,Sarna S ,Kosunen TU . Infection due to Campylobacter jejuni: a report of 524 outpatients. Infection 1984;12:175-178
CrossRef | Web of Science | Medline26
Skirrow MB, Blaser MJ. Campylobacter jejuni. In: Blaser MJ, Smith PD, Ravdin JI, Greenberg HB, Guerrant RL, eds. Infections of the gastrointestinal tract. New York: Raven Press, 1995:825-48.
27
Coker AO ,Isokpehi RD ,Thomas BN ,Amisu KO ,Obi CL . Human campylobacteriosis in developing countries. Emerg Infect Dis 2002;8:237-244
CrossRef | Web of Science | Medline28
Rollins DM ,Colwell RR . Viable but nonculturable stage of Campylobacter jejuni and its role in survival in the natural aquatic environment. Appl Environ Microbiol 1986;52:531-538
Web of Science | Medline29
Wotherspoon AC ,Doglioni C ,Diss TC , et al. Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet 1993;342:575-577
CrossRef | Web of Science | Medline30
Hussell T ,Isaacson PG ,Crabtree JE ,Spencer J . The response of cells from low-grade B-cell gastric lymphomas of mucosa-associated lymphoid tissue to Helicobacter pylori. Lancet 1993;342:571-574
CrossRef | Web of Science | Medline31
Pagano JS . Viruses and lymphomas. N Engl J Med 2002;347:78-79
Full Text | Web of Science | Medline32
Fauchere JL ,Veron M ,Lellouch-Tubiana A ,Pfister A . Experimental infection of gnotobiotic mice with Campylobacter jejuni: colonisation of intestine and spread to lymphoid and reticulo-endothelial organs. J Med Microbiol 1985;20:215-224
CrossRef | Web of Science | Medline33
Lara-Tejero M ,Galan JE . A bacterial toxin that controls cell cycle progression as a deoxyribonuclease I-like protein. Science 2000;290:354-357
CrossRef | Web of Science | Medline34
Yodoi J ,Adachi M ,Noro N . IgA binding factors and Fc receptors for IgA: comparative studies between IgA and IgE Fc receptor systems. Int Rev Immunol 1987;2:117-141
CrossRef | Medline35
Ogra PL, Lamm ME, Mestecky J, Strober W, Bienenstock J. Mucosal immunology. 2nd ed. Vol. 1. San Diego, Calif.: Academic Press, 1999.
- Citing Articles (98)
Citing Articles
1
Marion J. J. Kuper-Hommel, J. Han J. M. van Krieken. (2012) Molecular pathogenesis and histologic and clinical features of extranodal marginal zone lymphomas of mucosa-associated lymphoid tissue type. Leukemia & Lymphoma1-14
CrossRef2
Silvia Stockinger, Mathias W. Hornef, Cécilia Chassin. (2011) Establishment of intestinal homeostasis during the neonatal period. Cellular and Molecular Life Sciences 68:22, 3699-3712
CrossRef3
Hind Mrabti, Ghizlane Raiss, Soundouss Raissouni, El Mehdi Tazi, Hanane Inghaouen, Ibrahim El Ghissassi, Hassan Errihani. (2011) Lymphomes malins non hodgkiniens de l’intestin grêle de type « immunoproliferative small intestinal disease ». La Presse Médicale 40:11, 995-1000
CrossRef4
Rute Marques, Ivo G. Boneca. (2011) Expression and functional importance of innate immune receptors by intestinal epithelial cells. Cellular and Molecular Life Sciences 68:22, 3661-3673
CrossRef5
Matthew McCallum, Gary S. Shaw, Carole Creuzenet. (2011) Characterization of the dehydratase WcbK and the reductase WcaG involved in GDP-6-deoxy- manno -heptose biosynthesis in Campylobacter jejuni. Biochemical Journal 439:2, 235-248
CrossRef6
Joanna Grabska, Constantin A Dasanu. (2011) Autoimmune phenomena in untreated and treated marginal zone lymphoma. Expert Opinion on Pharmacotherapy 12:15, 2369-2379
CrossRef7
Jerome S. Burke. (2011) Lymphoproliferative Disorders of the Gastrointestinal Tract: A Review and Pragmatic Guide to Diagnosis. Archives of Pathology & Laboratory Medicine 135:10, 1283-1297
CrossRef8
A. A. Warsame, H.-C. Aasheim, K. Nustad, G. Troen, A. Tierens, V. Wang, U. Randen, H. P. Dong, S. Heim, A. Brech, J. Delabie. (2011) Splenic marginal zone lymphoma with VH1-02 gene rearrangement expresses poly- and self-reactive antibodies with similar reactivity. Blood 118:12, 3331-3339
CrossRef9
A Carvalho, C Cunha, A J Almeida, N S Osório, M Saraiva, M Teixeira-Coelho, S Pedreiro, E Torrado, N Domingues, A G Gomes-Alves, A Marques, J F Lacerda, M G da Silva, M Gomes, A C Pinto, F Torres, P Rendeiro, P Tavares, M Di Ianni, R Medeiros, P Heutink, P M Bracci, L Conde, P Ludovico, J Pedrosa, P Maciel, L Pitzurra, F Aversa, H Marques, A Paiva, C F Skibola, L Romani, A G Castro, F Rodrigues. (2011) The rs5743836 polymorphism in TLR9 confers a population-based increased risk of non-Hodgkin lymphoma. Genes and Immunity
CrossRef10
D. Corcos, M. J. Osborn, L. S. Matheson. (2011) B-cell receptors and heavy chain diseases: guilty by association?. Blood 117:26, 6991-6998
CrossRef11
Lina Guerra, Riccardo Guidi, Teresa Frisan. (2011) Do bacterial genotoxins contribute to chronic inflammation, genomic instability and tumor progression?. FEBS Journalno-no
CrossRef12
Graham A. W. Rook, Angus Dalgleish. (2011) Infection, immunoregulation, and cancer. Immunological Reviews 240:1, 141-159
CrossRef13
Judith A. Ferry. 2011. Lymphomas of the Esophagus, Gastrointestinal Tract, Hepatobiliary Tract, and Pancreas. , 133-196.
CrossRef14
Philippe Marteau, Ulriikka Chaput. (2011) Bacteria as Trigger for Chronic Gastrointestinal Disorders. Digestive Diseases 29:2, 166-171
CrossRef15
Sandrine Roulland, Mustapha Faroudi, Emilie Mamessier, Stéphanie Sungalee, Gilles Salles, Bertrand Nadel. 2011. Early Steps of Follicular Lymphoma Pathogenesis. , 1-46.
CrossRef16
Beth D Kirkpatrick, David R Tribble. (2011) Update on human Campylobacter jejuni infections. Current Opinion in Gastroenterology 27:1, 1-7
CrossRef17
S. S. Dave. (2010) Host Factors for Risk and Survival in Lymphoma. Hematology 2010:1, 255-258
CrossRef18
Dandan Zhang, Lina Dong, Haiyan Li, Hasi Jin, Hongtao Ye, Xiaoge Zhou, Zifen Gao, Gehong Dong, Jianbo Zhu, Honggang Liu, Liping Gong. (2010) Ocular adnexal mucosa-associated lymphoid tissue lymphoma in Northern China: high frequency of numerical chromosomal changes and no evidence of an association with Chlamydia psittaci. Leukemia & Lymphoma 51:11, 2031-2038
CrossRef19
Stella Koutros, Michael C.R. Alavanja, Jay H. Lubin, Dale P. Sandler, Jane A. Hoppin, Charles F. Lynch, Charles Knott, Aaron Blair, Laura E. Beane Freeman. (2010) An Update of Cancer Incidence in the Agricultural Health Study. Journal of Occupational and Environmental Medicine 52:11, 1098-1105
CrossRef20
Nadir Arber, Menachem Moshkowitz. 2010. Small Bowel Tumors. , 236-243.
CrossRef21
Didier Decaudin, Agnès Ferroni, Anne Vincent-Salomon, Kheira Beldjord, Pierre Validire, Patricia de Cremoux, Patricia Validire, Corine Plancher, Claire Mathiot, Elizabeth Macintyre, Bernard Asselain, Jacques Girodet, Frédéric Mal, Nicole Brousse, Jean-Luc Beretti, Rémi Dendale, Livia Lumbroso-Le Rouic, Olivier Hermine, Marc Lecuit. (2010) Ocular adnexal lymphoma and Helicobacter pylori gastric infection. American Journal of Hematology 85:9, 645-649
CrossRef22
Gloria J. Morris, Efrat Dotan, Mitchell R. Smith, Frederick B. Hagemeister, Harmar D. Brereton. (2010) Gastric Mucosa-Associated Lymphoid Tissue Lymphoma. Seminars in Oncology 37:3, 183-187
CrossRef23
Xavier Sagaert, Eric Van Cutsem, Gert De Hertogh, Karel Geboes, Thomas Tousseyn. (2010) Gastric MALT lymphoma: a model of chronic inflammation-induced tumor development. Nature Reviews Gastroenterology & Hepatology
CrossRef24
Fatma Elif Yıldırım, Ayşen Karaduman, Pervin Hürmüz, Enis Özyar, İbrahim Barışta, Arzu Sağlam. (2010) Symmetrical primary cutaneous marginal zone lymphoma associated with rheumatoid arthritis. Journal of Cutaneous Pathology 37:5, 600-604
CrossRef25
Shuji Yamamoto, Hiroshi Nakase, Kouhei Yamashita, Minoru Matsuura, Mariko Takada, Chiharu Kawanami, Tsutomu Chiba. (2010) Gastrointestinal follicular lymphoma: review of the literature. Journal of Gastroenterology 45:4, 370-388
CrossRef26
Katsuya Ikuta, Mikihiro Fujiya, Nobuhiro Ueno, Takaaki Hosoki, Kentaro Moriichi, Mitsunori Honda, Yoshihiro Torimoto, Toshiko Yamochi, Hidekazu Ota, Yutaka Kohgo. (2010) Atypical Mucosa-Associated Lymphoid Tissue Lymphoma in the Transverse Colon Associated with Macroglobulinemia. Internal Medicine 49:7, 677-682
CrossRef27
Nichollas E. Scott, N. Bishara Marzook, Ania Deutscher, Linda Falconer, Ben Crossett, Steven P. Djordjevic, Stuart J. Cordwell. (2010) Mass spectrometric characterization of the Campylobacter jejuni adherence factor CadF reveals post-translational processing that removes immunogenicity while retaining fibronectin binding. PROTEOMICS 10:2, 277-288
CrossRef28
Sung Yong Oh, Cheolwon Suh. (2010) Non-gastric Marginal Zone B-cell Lymphoma in Korea: Clinical Features, Treatment, and Prognostic Factors. The Korean Journal of Internal Medicine 25:3, 227
CrossRef29
Takayuki Matsumoto, Shotaro Nakamura, Motohiro Esaki, Shinichiro Yada, Tomohiko Moriyama, Shunichi Yanai, Minako Hirahashi, Takashi Yao, Mitsuo Iida. (2010) Double-Balloon Endoscopy Depicts Diminutive Small Bowel Lesions in Gastrointestinal Lymphoma. Digestive Diseases and Sciences 55:1, 158-165
CrossRef30
Kent C. Holtzmuller. 2010. Evaluation of Acute Diarrhea. , 378-385.
CrossRef31
Francis Amoo, Di Zhao, Ingram M. Roberts. 2010. Celiac Disease, Tropical Sprue, Whipple Disease, Lymphangiectasia, Immunoproliferative Small Intestinal Disease, and Nonsteroidal Anti-Inflammatory Drugs. , 291-296.
CrossRef32
Kim O. Gradel, Mette Nørgaard, Claus Dethlefsen, Henrik C. Schønheyder, Brian Kristensen, Tove Ejlertsen, Henrik Nielsen. (2009) Increased risk of zoonotic Salmonella and Campylobacter gastroenteritis in patients with haematological malignancies: a population-based study. Annals of Hematology 88:8, 761-767
CrossRef33
Shirley C. Paski, Carol E. Semrad. (2009) Small Bowel Tumors. Gastrointestinal Endoscopy Clinics of North America 19:3, 461-479
CrossRef34
Catherine de Martel, Silvia Franceschi. (2009) Infections and cancer: Established associations and new hypotheses. Critical Reviews in Oncology/Hematology 70:3, 183-194
CrossRef35
Mirjana Sretenovic, Milica Colovic, Gradimir Jankovic, Nada Suvajdzic, Biljana Mihaljevic, Natasa Colovic, Milena Todorovic, Henry Dushan E. Atkinson. (2009) More than a third of non-gastric malt lymphomas are disseminated at diagnosis: a single center survey. European Journal of Haematology 82:5, 373-380
CrossRef36
A. Illes, L. Varoczy, G. Papp, P. C. Wilson, P. Alex, R. Jonsson, T. Kovacs, Y. T. Konttinen, M. Zeher, B. Nakken, P. Szodoray. (2009) Aspects of B-Cell Non-Hodgkin’s Lymphoma Development: A Transition from Immune-Reactivity to Malignancy. Scandinavian Journal of Immunology 69:5, 387-400
CrossRef37
A. J. M. Ferreri, I. Ernberg, C. Copie-Bergman. (2009) Infectious agents and lymphoma development: molecular and clinical aspects. Journal of Internal Medicine 265:4, 421-438
CrossRef38
Nichollas E Scott, Stuart J Cordwell. (2009) Campylobacter proteomics: guidelines, challenges and future perspectives. Expert Review of Proteomics 6:1, 61-74
CrossRef39
Susan M. Logan, Joseph P. M. Hui, Evgeny Vinogradov, Annie J. Aubry, Jeremy E. Melanson, John F. Kelly, Harald Nothaft, Evelyn C. Soo. (2009) Identification of novel carbohydrate modifications on Campylobacter jejuni 11168 flagellin using metabolomics-based approaches. FEBS Journal 276:4, 1014-1023
CrossRef40
DAVID LEWIN, KLAUS J. LEWIN. 2009. Small Intestine. , 719-754.
CrossRef41
JUDITH A. FERRY. 2009. Lymphoid Tumors of the GI Tract, Hepatobiliary Tract, and Pancreas. , 701-732.
CrossRef42
David Schottenfeld, Jennifer L. Beebe-Dimmer, Fawn D. Vigneau. (2009) The Epidemiology and Pathogenesis of Neoplasia in the Small Intestine. Annals of Epidemiology 19:1, 58-69
CrossRef43
E. S. Jaffe, N. L. Harris, H. Stein, P. G. Isaacson. (2008) Classification of lymphoid neoplasms: the microscope as a tool for disease discovery. Blood 112:12, 4384-4399
CrossRef44
H. Hjalgrim, E. A. Engels. (2008) Infectious aetiology of Hodgkin and non-Hodgkin lymphomas: a review of the epidemiological evidence. Journal of Internal Medicine 264:6, 537-548
CrossRef45
D. de Jong, G. Enblad. (2008) Inflammatory cells and immune microenvironment in malignant lymphoma. Journal of Internal Medicine 264:6, 528-536
CrossRef46
M. P. Purdue, Q. Lan, S. S. Wang, A. Kricker, I. Menashe, T.-Z. Zheng, P. Hartge, A. E. Grulich, Y. Zhang, L. M. Morton, C. M. Vajdic, T. R. Holford, R. K. Severson, B. P. Leaderer, J. R. Cerhan, M. Yeager, W. Cozen, K. Jacobs, S. Davis, N. Rothman, S. J. Chanock, N. Chatterjee, B. K. Armstrong. (2008) A pooled investigation of Toll-like receptor gene variants and risk of non-Hodgkin lymphoma. Carcinogenesis 30:2, 275-281
CrossRef47
Emanuele Zucca, Francesco Bertoni, Anastasios Stathis, Franco Cavalli. (2008) Marginal Zone Lymphomas. Hematology/Oncology Clinics of North America 22:5, 883-901
CrossRef48
L.S. Mansfield, J.S. Patterson, B.R. Fierro, A.J. Murphy, V.A. Rathinam, J.J. Kopper, N.I. Barbu, T.J. Onifade, J.A. Bell. (2008) Genetic background of IL-10−/− mice alters host–pathogen interactions with Campylobacter jejuni and influences disease phenotype. Microbial Pathogenesis 45:4, 241-257
CrossRef49
Julie M. Matthews, Lilliana I. Moreno, Jeremy Dennis, Gerald E. Byrne, Phillip Ruiz, Sander R. Dubovy, Izidore S. Lossos. (2008) Ocular adnexal lymphoma: no evidence for bacterial DNA associated with lymphoma pathogenesis. British Journal of Haematology 142:2, 246-249
CrossRef50
Q. V. Tu, M. A. McGuckin, G. L. Mendz. (2008) Campylobacter jejuni response to human mucin MUC2: modulation of colonization and pathogenicity determinants. Journal of Medical Microbiology 57:7, 795-802
CrossRef51
Ignatius Chua, Isabella Quinti, Bodo Grimbacher. (2008) Lymphoma in common variable immunodeficiency: interplay between immune dysregulation, infection and genetics. Current Opinion in Hematology 15:4, 368-374
CrossRef52
C. Schollkopf, M. Melbye, L. Munksgaard, K. E. Smedby, K. Rostgaard, B. Glimelius, E. T. Chang, G. Roos, M. Hansen, H.-O. Adami, H. Hjalgrim. (2008) Borrelia infection and risk of non-Hodgkin lymphoma. Blood 111:12, 5524-5529
CrossRef53
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Rosenberg, Eric S., Cort, Alice M., Ebeling, Sally H.Peters, Christine C., Munshi, Nikhil C., Digumarthy, Subba, Rahemtullah, Aliyah, . (2008) Case 13-2008. New England Journal of Medicine 358:17, 1838-1848
Full Text54
Marc J. Gollub. (2008) Imaging of Gastrointestinal Lymphoma. Radiologic Clinics of North America 46:2, 287-312
CrossRef55
K. Ekstrom Smedby, C. M. Vajdic, M. Falster, E. A. Engels, O. Martinez-Maza, J. Turner, H. Hjalgrim, P. Vineis, A. Seniori Costantini, P. M. Bracci, E. A. Holly, E. Willett, J. J. Spinelli, C. La Vecchia, T. Zheng, N. Becker, S. De Sanjose, B. C.-H. Chiu, L. Dal Maso, P. Cocco, M. Maynadie, L. Foretova, A. Staines, P. Brennan, S. Davis, R. Severson, J. R. Cerhan, E. C. Breen, B. Birmann, A. E. Grulich, W. Cozen. (2008) Autoimmune disorders and risk of non-Hodgkin lymphoma subtypes: a pooled analysis within the InterLymph Consortium. Blood 111:8, 4029-4038
CrossRef56
B Herreros, A Sanchez-Aguilera, M A Piris. (2008) Lymphoma microenvironment: culprit or innocent?. Leukemia 22:1, 49-58
CrossRef57
Sandrine Roulland, Felipe Suarez, Olivier Hermine, Bertrand Nadel. (2008) Pathophysiological aspects of memory B-cell development. Trends in Immunology 29:1, 25-33
CrossRef58
Christina Kalpadakis, Gerassimos A. Pangalis, Theodoros P. Vassilakopoulos, Maria-Christina Kyrtsonis, Marina P. Siakantaris, Flora N. Kontopidou, Penelope Korkolopoulou, Panagia Bobotsis, Sotirios Sahanas, Tatiana Tzenou, Dimitra Anagnostou, Evangelia Dimitriadou, Xanthi Yiakoumis, Evangelos Patsouris, Panagiota Roussou, Panayiotis Panayiotidis, Eleni Papadaki, Maria K. Angelopoulou. (2008) Non-gastric extra-nodal marginal zone lymphomas–a single centre experience on 76 patients. Leukemia & Lymphoma 49:12, 2308-2315
CrossRef59
Takeshi Hara, Hisashi Tsurumi, Tomohiro Kato, Yasuyuki Imao, Yasushi Kojima, Keishi Kojima, Jun-ichi Kitagawa, Naoki Katsumura, Hiroshi Araki, Tsuyoshi Takami, Hisataka Moriwaki. (2008) Immunoproliferative Small Intestinal Disease with Protein Loss Complicated with Duodenal T Cell Lymphoma during Progression. Internal Medicine 47:4, 299-303
CrossRef60
E Chanudet, P Adam, A G Nicholson, A C Wotherspoon, R Ranaldi, G Goteri, S A Pileri, H Ye, H K Müller-Hermelink, M-Q Du. (2007) Chlamydiae and Mycoplasma infections in pulmonary MALT lymphoma. British Journal of Cancer
CrossRef61
Changhoon Yoo, Min-Hee Ryu, Jooryung Huh, Ji Hyun Park, Hye Jin Kang, Hyo Sook Ahn, Yongjae Lee, Myoung Joon Kim, Hyoungnam Lee, Tae Won Kim, Heung Moon Chang, Jae-Lyun Lee, Yoon-Koo Kang. (2007) Chlamydia psittaci infection and clinicopathologic analysis of ocular adnexal lymphomas in Korea. American Journal of Hematology 82:9, 821-823
CrossRef62
Andrés J.M. Ferreri, Emanuele Zucca. (2007) Marginal-zone lymphoma. Critical Reviews in Oncology/Hematology 63:3, 245-256
CrossRef63
S Wöhrer, M Troch, B Streubel, J Zwerina, C Skrabs, M Formanek, W Hauff, M Hoffmann, L Müllauer, A Chott, M Raderer. (2007) MALT lymphoma in patients with autoimmune diseases: a comparative analysis of characteristics and clinical course. Leukemia 21:8, 1812-1818
CrossRef64
Judith A. Ferry, Claire Y. Fung, Lawrence Zukerberg, Mark J. Lucarelli, Robert P. Hasserjian, Frederic I. Preffer, Nancy L. Harris. (2007) Lymphoma of the Ocular Adnexa: A Study of 353 Cases. The American Journal of Surgical Pathology 31:2, 170-184
CrossRef65
Grace S. Zhang, Jane N. Winter, Daina Variakojis, Steven Reich, Gary S. Lissner, Paul Bryar, Maryann Regner, Kathy Mangold, Karen Kaul. (2007) Lack of an association between Chlamydia psittaci and ocular adnexal lymphoma. Leukemia & Lymphoma 48:3, 577-583
CrossRef66
P M Banks. (2007) Gastrointestinal lymphoproliferative disorders. Histopathology 50:1, 42-54
CrossRef67
C João, P Farinha, M G da Silva, C Martins, M Crespo, J Cabeçadas. (2007) Cytogenetic abnormalities in MALT lymphomas and their precursor lesions from different organs. A fluorescence in situ hybridization (FISH) study. Histopathology 50:2, 217-224
CrossRef68
Elías Gracia, Patrizia Froesch, Luca Mazzucchelli, Vittoria Martin, Delvys Rodríguez-Abreu, Julio Jiménez, María Melgares, Dania Santos, Virginia Capó, Franco Cavalli, Emanuele Zucca, Francesco Bertoni. (2007) Low prevalence of Chlamydia psittaci in ocular adnexal lymphomas from Cuban patients. Leukemia & Lymphoma 48:1, 104-108
CrossRef69
Ming-Qing Du. (2007) MALT Lymphoma: Recent Advances in Aetiology and Molecular Genetics. Journal of Clinical and Experimental Hematopathology 47:2, 31-42
CrossRef70
Brendan C Dickson, Stefano Serra, Runjan Chetty. (2006) Primary gastrointestinal tract lymphoma: diagnosis and management of common neoplasms. Expert Review of Anticancer Therapy 6:11, 1609-1628
CrossRef71
Fabio M. Iwamoto, Lauren E. Abrey. (2006) Primary dural lymphomas: a review. Neurosurgical FOCUS 21:5, 1-5
CrossRef72
E. Zucca, F. Bertoni. (2006) Chlamydia or Not Chlamydia, That Is the Question: Which Is the Microorganism Associated With MALT Lymphomas of the Ocular Adnexa?. JNCI Journal of the National Cancer Institute 98:19, 1348-1349
CrossRef73
Ioanna Economidou, Orestis N. Manousos, John K. Triantafillidis, Michalis M. Vaslamatzis, Rodessa Zafiropoulou, Theodora Papadakis. (2006) Immunoproliferative small intestinal disease in Greece: presentation of 13 cases including two from Albania. European Journal of Gastroenterology & Hepatology 18:9, 1029-1038
CrossRef74
Susan G Fisher, Richard I Fisher. (2006) The emerging concept of antigen-driven lymphomas: epidemiology and treatment implications. Current Opinion in Oncology 18:5, 417-424
CrossRef75
E Chanudet, Y Zhou, CM Bacon, AC Wotherspoon, H-K Müller-Hermelink, P Adam, HY Dong, D de Jong, Y Li, R Wei, X Gong, Q Wu, R Ranaldi, G Goteri, SA Pileri, H Ye, RA Hamoudi, H Liu, J Radford, M-Q Du. (2006) Chlamydia psittaci is variably associated with ocular adnexal MALT lymphoma in different geographical regions. The Journal of Pathology 209:3, 344-351
CrossRef76
Richard Goodgame. (2006) A Bayesian Approach to Acute Infectious Diarrhea in Adults. Gastroenterology Clinics of North America 35:2, 249-273
CrossRef77
Catherine Thieblemont, Bertrand Coiffier. (2006) Management of marginal zone lymphomas. Current Treatment Options in Oncology 7:3, 213-222
CrossRef78
Roberto L. Vargas, Enzo Fallone, Raymond E. Felgar, Jonathan W. Friedberg, Arnaldo A. Arbini, Arthur A. Andersen, Paul G. Rothberg. (2006) Is there an association between ocular adnexal lymphoma and infection with Chlamydia psittaci?. Leukemia Research 30:5, 547-551
CrossRef79
E Campo, A Chott, M C Kinney, L Leoncini, C J L M Meijer, C S Papadimitriou, M A Piris, H Stein, S H Swerdlow. (2006) Update on extranodal lymphomas. Conclusions of the Workshop held by the EAHP and the SH in Thessaloniki, Greece. Histopathology 48:5, 481-504
CrossRef80
Michael D. Willard, Stanley L. Marks. 2006. Bacterial Causes of Enteritis and Colitis. , 39-44.
CrossRef81
Dietlind L. Wahner-Roedler, Robert A. Kyle. (2005) Heavy chain diseases. Best Practice & Research Clinical Haematology 18:4, 729-746
CrossRef82
Andrew E. Grulich, Claire M. Vajdic. (2005) The epidemiology of non-Hodgkin lymphoma. Pathology 37:6, 409-419
CrossRef83
Philip A. Salem, Fadi F. Estephan. (2005) Immunoproliferative Small Intestinal Disease. The Cancer Journal 11:5, 374-382
CrossRef84
Helena Guardiola, Noelia Pérez Muñoz. (2005) Dolor abdominal y rectorragia en una mujer de 68 años. Medicina Clínica 124:15, 588-594
CrossRef85
Alistair J. Lax. (2005) Opinion: Bacterial toxins and cancer — a case to answer?. Nature Reviews Microbiology 3:4, 343-349
CrossRef86
B Streubel, U Vinatzer, A Lamprecht, M Raderer, A Chott. (2005) T(3;14)(p14.1;q32) involving IGH and FOXP1 is a novel recurrent chromosomal aberration in MALT lymphoma. Leukemia
CrossRef87
Steven F Moss, Martin J Blaser. (2005) Mechanisms of Disease: inflammation and the origins of cancer. Nature Clinical Practice Oncology 2:2, 90-97
CrossRef88
Antonia M. S. M
ller, Gabriele Ihorst, Roland Mertelsmann, Monika Engelhardt. (2005) Epidemiology of non-Hodgkin?s lymphoma (NHL): trends, geographic distribution, and etiology. Annals of Hematology 84:1, 1-12
CrossRef89
R. H. Davies. 2005. Pathogen population on poultry farms. , 101-152.
CrossRef90
Thomas Girard, Isabelle Luquet-Besson, Fanny Baran-Marszak, Martine Raphael, Francois Boue. (2005) HIV+ MALT lymphoma remission induced by highly active antiretroviral therapy alone. European Journal of Haematology 74:1, 70-72
CrossRef91
BIRGITTA SCHWEICKERT, ANNETTE MOTER, MICHAEL LEFMANN, ULF B. GOBEL. (2004) Let them fly or light them up: matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry and fluorescence in situ hybridization (FISH). APMIS 112:11-12, 856-885
CrossRef92
Peggy C.R. Godschalk, Astrid P. Heikema, Michel Gilbert, Tomoko Komagamine, C. Wim Ang, Jobine Glerum, Denis Brochu, Jianjun Li, Nobuhiro Yuki, Bart C. Jacobs, Alex van Belkum, Hubert P. Endtz. (2004) The crucial role of Campylobacter jejuni genes in anti-ganglioside antibody induction in Guillain-Barré syndrome. Journal of Clinical Investigation 114:11, 1659-1665
CrossRef93
J.-P. Butzler. (2004) Campylobacter, from obscurity to celebrity. Clinical Microbiology and Infection 10:10, 868-876
CrossRef94
Luca Albarello, Claudio Doglioni. (2004) A Specific Bug for Each MALT Lymphoma Site. Advances in Anatomic Pathology 11:5, 276-277
CrossRef95
Peter G. Isaacson, Ming-Qing Du. (2004) Timeline: MALT lymphoma: from morphology to molecules. Nature Reviews Cancer 4:8, 644-653
CrossRef96
E. S. Jaffe. (2004) Common Threads of Mucosa-Associated Lymphoid Tissue Lymphoma Pathogenesis: From Infection to Translocation. JNCI Journal of the National Cancer Institute 96:8, 571-573
CrossRef97
(2004) Immunoproliferative Small Intestinal Disease Associated with Campylobacter jejuni. New England Journal of Medicine 350:16, 1685-1686
Full Text98
Parsonnet, Julie, Isaacson, Peter G., . (2004) Bacterial Infection and MALT Lymphoma. New England Journal of Medicine 350:3, 213-215
Full Text
- Letters
