Original Article
Somatic and Germ-Line Mutations of the HRPT2 Gene in Sporadic Parathyroid Carcinoma
N Engl J Med 2003; 349:1722-1729October 30, 2003
- Abstract
Background
We looked for mutations of the HRPT2 gene, which encodes the parafibromin protein, in sporadic parathyroid carcinoma because germ-line inactivating HRPT2 mutations have been found in a type of familial hyperparathyroidism — hyperparathyroidism–jaw tumor (HPT-JT) syndrome — that carries an increased risk of parathyroid cancer.
Methods
We directly sequenced the full coding and flanking splice-junctional regions of the HRPT2 gene in 21 parathyroid carcinomas from 15 patients who had no known family history of primary hyperparathyroidism or the HPT-JT syndrome at presentation. We also sought to confirm the somatic nature of the identified mutations and tested the carcinomas for tumor-specific loss of heterozygosity at HRPT2.
Results
Parathyroid carcinomas from 10 of the 15 patients had HRPT2 mutations, all of which were predicted to inactivate the encoded parafibromin protein. Two distinct HRPT2 mutations were found in tumors from five patients, and biallelic inactivation as a result of a mutation and loss of heterozygosity was found in one tumor. At least one HRPT2 mutation was demonstrably somatic in carcinomas from six patients. Unexpectedly, HRPT2 mutations in the parathyroid carcinomas of three patients were identified as germ-line mutations.
Conclusions
Sporadic parathyroid carcinomas frequently have HRPT2 mutations that are likely to be of pathogenetic importance. Certain patients with apparently sporadic parathyroid carcinoma carry germ-line mutations in HRPT2 and may have the HPT-JT syndrome or a phenotypic variant.
Media in This Article
Figure 1
Examples of Somatic and Germ-Line Mutations of the HRPT2 Gene in Sporadic Parathyroid Carcinoma.Table 1
HRPT2 Gene Mutation and Loss-of-Heterozygosity Analyses in Parathyroid Carcinomas from 15 Patients.Article Activity
- Article
Parathyroid carcinomas are an uncommon and often devastating cause of primary hyperparathyroidism.1,2 These cancers characteristically result in more profound clinical manifestations of hyperparathyroidism than do parathyroid adenomas, the most frequent cause of primary hyperparathyroidism. If a parathyroid carcinoma spreads to distant sites, it can cause relentless hypercalcemia and severe metabolic complications that are notoriously difficult to control and often result in death. Affected patients may require repeated palliative surgical extirpation of metastatic nodules.1-3 Early en bloc resection of the primary tumor is the only curative treatment. Because the histopathological features of parathyroid carcinoma and adenoma may overlap, a definitive diagnosis of parathyroid carcinoma requires the presence of invasion of surrounding structures by the tumor, local recurrence, or metastasis,3-9 yet these features signify a stage at which cure is usually impossible. An understanding of the molecular pathogenesis of parathyroid carcinoma could have considerable value with respect to early diagnosis, prognosis, and new approaches to treatment.
No specific gene has been established as a direct contributor to the pathogenesis of sporadic parathyroid carcinoma, although several important molecular clues have been uncovered.10-15 For example, a region on chromosome 13 is frequently lost in parathyroid carcinomas.10-14 However, molecular analysis16 has not yet established the identity of the relevant gene or genes in this region of the chromosome.17,18
We investigated the HRPT2 gene, which encodes the parafibromin protein, in sporadic parathyroid carcinoma because inactivating germ-line mutations in this gene were recently identified in the majority of kindreds with the hereditary hyperparathyroidism–jaw tumor (HPT-JT) syndrome, or hyperparathyroidism 2 (Online Mendelian Inheritance in Man number #145001), a rare autosomal dominant cause of parathyroid tumors, ossifying fibromas of the mandible and maxilla, and various cystic and neoplastic renal abnormalities.19-26 Also, somatic inactivating mutations of the gene were reported in 4 percent of cystic parathyroid adenomas (2 of 47), none of which had germ-line mutations.19 Parathyroid tumors often occur asynchronously in patients with the HPT-JT syndrome, and although most of the tumors are benign, the incidence of malignant parathyroid carcinomas is markedly increased in these patients. For these reasons, it seemed plausible that inactivating somatic mutations of HRPT2 might occur in sporadic parathyroid carcinomas.
Methods
Patients and Tumor Specimens
A total of 21 parathyroid-carcinoma samples were obtained from 15 patients who had been treated surgically for primary hyperparathyroidism in the United States and Japan. The 21 specimens included 5 primary carcinomas, 6 locally recurrent tumors, and 10 distant metastases (Table 1Table 1
HRPT2 Gene Mutation and Loss-of-Heterozygosity Analyses in Parathyroid Carcinomas from 15 Patients.). For inclusion in this study, we required an unequivocal diagnosis of parathyroid carcinoma, as demonstrated by the presence of either distant metastasis or widespread invasion of contiguous structures and local recurrence.3-9 Histopathological features often associated with parathyroid carcinoma (but not stringently diagnostic), such as fibrous bands, numerous cells in mitosis, trabecular cellular architecture, nuclear atypia, and microvascular or microscopic capsular invasion, were commonly present. For 10 of the 15 patients, peripheral-blood leukocytes served as a source of germ-line DNA; for Patient 6, normal muscle was the source. Germ-line DNA was not available from four patients.At initial parathyroidectomy, the 15 patients ranged in age from 20 to 62 years (mean, 43); 5 were women and 10 were men. None of the 15 patients had a personal or family history of the HPT-JT syndrome, multiple endocrine neoplasia type 1, or another familial form of hyperparathyroidism at presentation. After the diagnosis of parathyroid carcinoma in Patient 5, a parathyroid adenoma was diagnosed in an uncle. No patient had a history of irradiation to the head and neck or of uremic secondary or tertiary hyperparathyroidism, and no patient had been treated with radiation therapy or chemotherapy.
Immediately after surgical resection, tumor samples were frozen in liquid nitrogen for storage at –80°C until use. Genomic DNA was extracted from tumor and nontumor tissues by proteinase K digestion followed by phenol–chloroform extraction and ethanol precipitation. Tumor and blood samples were obtained in accordance with protocols approved by institutional review boards for human studies; patients provided informed consent as dictated by these protocols.
Detection of HRPT2 Mutations
The 21 samples of parathyroid-carcinoma DNA were analyzed for mutations in the HRPT2 gene by direct sequencing of both strands. The 17 exons of the gene, which encode a protein of 531 amino acids, were amplified as 15 different fragments with the use of primers derived from flanking intronic or 3'- or 5'-untranslated-region sequences (listed in Supplementary Appendix 1, available with the full text of this article at http://www.nejm.org). After amplification, primers were removed by digestion with 10 U of exonuclease I (Amersham Pharmacia Biotech) and 1 U of shrimp alkaline phosphatase (Amersham).
Sequencing reactions were performed with the use of the BigDye Terminator cycle sequencing kit (Applied Biosystems) as described previously.27 Data were analyzed with the use of Sequencing Analysis and AutoAssembler software (Applied Biosystems), and all mutations were confirmed by repeated forward and reverse sequencing of the involved exon or intron from an independent polymerase chain reaction (PCR). When mutations were detected in tumor DNA, the same exons or introns in corresponding germ-line DNA samples, when available, were sequenced in a similar manner. Amplified exons for which sequencing in both directions showed a clear chromatogram and an apparently normal sequence on one side of a specific nucleotide position abruptly followed by an unclear sequence on the other were interpreted as suggesting a frame-shift mutation. To determine definitively whether an insertion or a deletion was present in these cases, or to confirm the loss of a specific allele in one instance, amplified exons were resequenced after cloning to separate the alleles. PCR products were cloned into the PCR4-TOPO vector with use of the TOPO TA Cloning Kit (Invitrogen), transformed into Escherichia coli, and plated onto LB agar to which 50 μg of ampicillin per milliliter had been added. Then, 8 to 10 distinct colonies were picked and resuspended in PCR mix for amplification and sequencing.
Sequencing of all HRPT2 exons (1, 2, 3, 4, 5, 7, and 14) for which germ-line mutations were identified in this study (or in kindreds with the HPT-JT syndrome19) was performed as described previously19 in 150 unrelated healthy control subjects.
Loss-of-Heterozygosity Analysis
We analyzed 17 matched pairs of germ-line and tumor DNA samples from 11 patients for loss of heterozygosity at the HRPT2 locus by genotyping four microsatellite markers. D1S542 and D1S413 flank HRPT2 on its centromeric and telomeric sides, respectively (University of California Santa Cruz Human Genome Project Working Draft, available at http://genome.ucsc.edu). We also searched the human-genome–sequence data base for previously unreported dinucleotide repeat sequences within HRPT2 that might serve as the basis for new intragenic HRPT2 polymorphisms, identified two such regions within intron 10 and intron 14, and designed primers from unique flanking sequences for PCR amplification: 5'TGATTTCTCATGCATTTCCTG3' (intron 10 forward primer), 5'TAACTACCTGAAACCCATCAC3' (intron 10 reverse primer), 5'AATTAGTGTCACAGTATCTTA3' (intron 14 forward primer), and 5'CTCAAAGTATCTATTAGGTA3' (intron 14 reverse primer). These new intragenic markers were highly polymorphic, showing substantial frequencies of heterozygosity in our patients: 60 percent for intron 10 and 50 percent for intron 14. Electrophoresis of fluorescently labeled products in an ABI Prism 377 Sequencer was followed by pattern analysis with the use of Genescan and Genotyper software (Applied Biosystems).27 An allelic imbalance was identified by an analysis of the heights of allele peaks in tumor and control samples27 and was considered to indicate a loss of heterozygosity when the contribution of the minority allele was repeatedly negligible.
Results
We identified HRPT2 mutations in parathyroid carcinomas from 10 of 15 patients with apparently sporadic disease. All mutations were predicted to inactivate the encoded protein, parafibromin, which is also affected in the HPT-JT syndrome.19 A total of 15 different HRPT2 mutations, spanning six exons, were identified in 12 tumors from 10 of the 15 patients (Table 1). Five mutations resulted directly in a premature stop codon, and 10 gave rise to an altered reading frame, typically with an early stop codon also following shortly in the altered frame (Table 1). Testing of germ-line DNA showed that eight HRPT2 mutations (from six patients) were somatic, and two distinct somatic mutations were found in tumors from two of these patients. Two mutations were also found in each tumor from two additional patients, but it was not possible to determine the somatic or germ-line status of these mutations.
Unexpectedly, HRPT2 mutations found in the parathyroid carcinomas of three patients were identified as germ-line mutations (Table 1 and Figure 1Figure 1
Examples of Somatic and Germ-Line Mutations of the HRPT2 Gene in Sporadic Parathyroid Carcinoma.), even though none of these patients had a known family history of the HPT-JT syndrome or presented with clinical evidence thereof. None of these germ-line mutations were present in 150 control subjects, nor were other mutations found in the sequenced exons. Two of these germ-line mutations (664C>T and 373insA) were not reported in a previous study of kindreds with the HPT-JT syndrome,19 whereas one (679insAG) was.19 Patient 8 had a germ-line mutation in one allele of HRPT2 and a tumor-specific somatic HRPT2 mutation in the other allele (Table 1).The availability of germ-line DNA from 11 of the 15 patients allowed examination of their tumors for loss of heterozygosity within or near HRPT2. Loss of heterozygosity was identified in one carcinoma, from Patient 4 (Table 1 and Figure 1B). Parathyroid carcinomas from 6 of the 10 patients whose tumors revealed mutations had two HRPT2 lesions (Table 1). In tumor tissue from Patient 4, one allele contained a somatic frame-shift mutation and the other was deleted (Table 1 and Figure 1B); each of the other five tumors had two distinct intragenic HRPT2 mutations (Table 1 and Figure 1).
In the four instances in which more than one tumor sample was available from a single patient, representing primary tumor plus a local recurrence or a metastasis or multiple metastases, all samples had the same HRPT2 gene status (Table 1). These patients included two (Patients 5 and 7) for whom the identical somatic mutation was present in both primary tumor and a metastasis or a local recurrence (Table 1).
Discussion
There has been considerable progress in elucidating the pathogenesis of sporadic parathyroid adenomas,19,28,29 but the molecular roots of parathyroid carcinoma are obscure. The identification of mutations in HRPT2 in patients with the HPT-JT syndrome, in which parathyroid carcinoma is overrepresented despite the more common presence of benign parathyroid tumors, led us to evaluate whether HRPT2 is involved in sporadic parathyroid carcinoma. We found mutations of the HRPT2 gene in sporadic parathyroid carcinomas from 10 of 15 patients. The demonstration of tumor-specific, acquired HRPT2 mutations in multiple parathyroid carcinomas marks these tumors as clonal expansions, each derived from an original cell that had undergone HRPT2 mutation and had gained a selective advantage. Therefore, HRPT2 mutation is very likely an important contributor to the pathogenesis of parathyroid carcinoma. Consistent with this conclusion are the findings of unexpected germ-line mutations in HRPT2 in certain patients with apparently sporadic parathyroid carcinoma. The concordant HRPT2 status among tumors in patients who had more than one sample available for analysis is consistent with the concept that HRPT2 mutation may influence the phenotype of parathyroid carcinoma, including its metastatic potential, at an early stage of tumorigenesis. The likelihood that the observed mutations inactivated the HRPT2 gene product and the finding that multiple parathyroid carcinomas each contained such distinct inactivating HRPT2 lesions indicate that a tumor-suppressor gene mechanism16 is involved in HRPT2's contribution to tumorigenesis.
Atypical parathyroid adenomas and parathyromatosis30 are lesions that share some phenotypic features with parathyroid carcinoma but fail to fulfill rigorous criteria for cancer; study of their HRPT2 status should help clarify the extent to which they resemble parathyroid carcinoma on a molecular level. The mechanisms of action of parafibromin — the protein encoded by HRPT2 — in cell physiology and tumor suppression are unknown. Nonetheless, our findings indicate that parafibromin is a potential target for new therapeutic agents that could benefit patients with parathyroid carcinoma.
Patients with apparently sporadic parathyroid carcinoma who carry germ-line mutations in HRPT2 may, on further investigation of their clinical features and relatives, turn out to have the HPT-JT syndrome31,32 or phenotypic variants of the syndrome, perhaps with altered penetrance of the mutation. Two of the germ-line mutations we identified (664C>T and 373insA) were not reported in a previous study of kindreds with the HPT-JT syndrome,19 whereas one (679insAG) was,19 raising the possibility of a mutational “hot spot” or a familial relationship unknown to the patient.
The identification of a germ-line HRPT2 mutation in a patient with apparently sporadic parathyroid carcinoma requires clinicians to reconsider the approach to this patient and raises new management issues with respect to his or her relatives. When hyperparathyroidism recurs or worsens in such a patient, a new and distinct primary parathyroid tumor, benign or malignant, should be carefully sought in addition to a recurrence or progression of the original carcinoma, because asynchronous primary parathyroid neoplasms can develop in patients with the HPT-JT syndrome. Surveillance for renal and jaw neoplasia may also be indicated.
Susceptibility to the development of parathyroid carcinoma or other manifestations of the HPT-JT syndrome may exist in the relatives of a patient with apparently sporadic parathyroid carcinoma who has an HRPT2 germ-line mutation if they also carry the mutation. Monitoring of serum calcium levels is warranted in such family members, with the goal of early diagnosis and treatment of an incipient or premetastatic parathyroid cancer. If primary hyperparathyroidism develops in a relative who is at risk, surgery aimed at identifying and examining all parathyroid glands could be advocated, even if a more limited approach might otherwise have been chosen.
We suggest that HRPT2 germ-line DNA testing should be seriously considered for patients presenting with apparently sporadic parathyroid carcinoma. The identification of a coding mutation would be definitive, although a negative result would not rule out the existence of an undetected, noncoding mutation, and indeed, the latter are expected, since germ-line HRPT2 coding mutations were not found in affected members of almost half of families with classic HPT-JT syndrome.19 A separate question is whether and when genetic testing should be offered to at-risk relatives of a patient who has parathyroid carcinoma with an HRPT2 germ-line mutation. Genotyping of such family members for this recognized mutation would enable the focused implementation of clinical and biochemical monitoring of carriers of the mutation and offer reassurance to family members who do not have the mutation. Monitoring serum calcium levels in all persons at risk provides an alternative to definitive DNA diagnosis.
Supported by the Murray-Heilig Fund in Molecular Medicine, the Swedish Cancer Foundation, the Nilsson-Ehle Foundation, the Robert Lundberg Foundation, the Torsten and Ragnar Söderberg Foundations, the Gustav V Jubilee Foundation, and the Emil and Vera Cornell Foundation.
Ms. Shattuck and Dr. Välimäki contributed equally to this article.
We are indebted to Dr. Anders Höög for expert histopathological evaluations and to Ms. Pamela Vachon for expert administrative assistance.
Source Information
From the Center for Molecular Medicine (T.M.S., A.A.) and the Division of Endocrinology and Metabolism (A.A.), University of Connecticut School of Medicine, Farmington; the Departments of Molecular Medicine (S.V., C.L.) and Surgical Sciences (S.V., L.-O.F.), Karolinska Hospital, Stockholm, Sweden; the Department of Endocrine Surgery, Tokyo Women's Medical University, Sinjuku-ku, Tokyo, Japan (T.O.); the Department of Surgery, Massachusetts General Hospital, Boston (R.D.G.); the Department of Surgery, University of California, San Francisco, Mt. Zion Medical Center, San Francisco (O.H.C.); the Endocrine Research Unit, Veterans Affairs Medical Center, University of California, San Francisco, San Francisco (D.S.); the Division of Endocrinology, University of Colorado, Veterans Affairs Medical Center, Denver (M.E.W.); the Division of Diabetes and Endocrinology, Department of Internal Medicine, Jikei University School of Medicine, Tokyo, Japan (K.T.); and the Cancer Genetics Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Md. (C.M.R., J.D.C.).
Address reprint requests to Dr. Arnold at the Center for Molecular Medicine, University of Connecticut School of Medicine, 263 Farmington Ave., Farmington, CT 06030-3101, or at molecularmedicine@uchc.edu, or to Dr. Larsson at catharina.larsson@cmm.ki.se.
- References
References
1
Wang CA ,Gaz RD . Natural history of parathyroid carcinoma: diagnosis, treatment, and results. Am J Surg 1985;149:522-527
CrossRef | Web of Science | Medline2
Shane E . Clinical review 122: parathyroid carcinoma. J Clin Endocrinol Metab 2001;86:485-493
CrossRef | Web of Science | Medline3
Bondeson L ,Sandelin K ,Grimelius L . Histopathological variables and DNA cytometry in parathyroid carcinoma. Am J Surg Pathol 1993;17:820-829
CrossRef | Web of Science | Medline4
Roth SI . Pathology of the parathyroids in hyperparathyroidism. Arch Pathol 1962;73:495-510
Web of Science | Medline5
Schantz A ,Castleman B . Parathyroid carcinoma: a study of 70 cases. Cancer 1973;31:600-605
CrossRef | Web of Science | Medline6
Vetto JT ,Brennan MF ,Woodruf J ,Burt M . Parathyroid carcinoma: diagnosis and clinical history. Surgery 1993;114:882-892
Web of Science | Medline7
Sandelin K ,Thompson NW ,Bondeson L . Metastatic parathyroid carcinoma: dilemmas in management. Surgery 1991;110:978-986
Web of Science | Medline8
Sandelin K ,Auer G ,Bondeson L ,Grimelius L ,Farnebo LO . Prognostic factors in parathyroid cancer: a review of 95 cases. World J Surg 1992;16:724-731
CrossRef | Web of Science | Medline9
Anderson BJ ,Samaan NA ,Vassilopoulou-Sellin R ,Ordonez NG ,Hickey RC . Parathyroid carcinoma: features and difficulties in diagnosis and management. Surgery 1983;94:906-915
Web of Science | Medline10
Cryns VL ,Thor A ,Xu HJ , et al. Loss of the retinoblastoma tumor-suppressor gene in parathyroid carcinoma. N Engl J Med 1994;330:757-761
Full Text | Web of Science | Medline11
Pearce SH ,Trump D ,Wooding C ,Sheppard MN ,Clayton RN ,Thakker RV . Loss of heterozygosity studies at the retinoblastoma and breast cancer susceptibility (BRCA2) loci in pituitary, parathyroid, pancreatic and carcinoid tumors. Clin Endocrinol (Oxf) 1996;45:195-200
CrossRef | Web of Science | Medline12
Dotzenrath C ,Teh BT ,Farnebo F , et al. Allelic loss of the retinoblastoma tumor suppressor gene: a marker for aggressive parathyroid tumors? J Clin Endocrinol Metab 1996;81:3194-3196
CrossRef | Web of Science | Medline13
Kytola S ,Farnebo F ,Obara T , et al. Patterns of chromosomal imbalances in parathyroid carcinomas. Am J Pathol 2000;157:579-586
CrossRef | Web of Science | Medline14
Imanishi Y ,Palanisamy N ,Tahara H , et al. Molecular pathogenetic analysis of parathyroid carcinoma. J Bone Miner Res 1999;14:Suppl 1:S421-S421
Web of Science15
Agarwal SK ,Schrock E ,Kester MB , et al. Comparative genomic hybridization analysis of human parathyroid tumors. Cancer Genet Cytogenet 1998;106:30-36
CrossRef | Web of Science | Medline16
Haber D ,Harlow E . Tumour-suppressor genes: evolving definitions in the genomic age. Nat Genet 1997;16:320-322
CrossRef | Web of Science | Medline17
Shattuck TM ,Kim TS ,Costa J , et al. Mutational analyses of RB and BRCA2 as candidate tumour suppressor genes in parathyroid carcinoma. Clin Endocrinol (Oxf) 2003;59:180-189
CrossRef | Web of Science | Medline18
Costa J ,Shattuck TM ,Imanishi Y , et al. Mutational analyses of connexin 26, connexin 30 and connexin 46 as candidate tumor suppressor genes in parathyroid carcinoma. J Endocr Genet 2003;3:57-6219
Carpten JD ,Robbins CM ,Villablanca A , et al. HRPT2, encoding parafibromin, is mutated in hyperparathyroidism-jaw tumor syndrome. Nat Genet 2002;32:676-680
CrossRef | Web of Science | Medline20
Jackson CE ,Norum RA ,Boyd SB , et al. Hereditary hyperparathyroidism and multiple ossifying jaw fibromas: a clinically and genetically distinct syndrome. Surgery 1990;108:1006-1012
Web of Science | Medline21
Wassif WS ,Farnebo F ,Teh BT , et al. Genetic studies of a family with hereditary hyperparathyroidism-jaw tumour syndrome. Clin Endocrinol (Oxf) 1999;50:191-196
CrossRef | Web of Science | Medline22
Kennett S ,Pollick H . Jaw lesions in familial hyperparathyroidism. Oral Surg Oral Med Oral Pathol 1971;31:502-510
CrossRef | Medline23
Eversole LR ,Leider AS ,Nelson K . Ossifying fibroma: a clinicopathologic study of sixty-four cases. Oral Surg Oral Med Oral Pathol 1985;60:505-511
CrossRef | Medline24
Szabo J ,Heath B ,Hill VM , et al. Hereditary hyperparathyroidism-jaw tumor syndrome: the endocrine tumor gene HRPT2 maps to chromosome 1q21-q31. Am J Hum Genet 1995;56:944-950
Web of Science | Medline25
Teh BT ,Farnebo F ,Kristoffersson U , et al. Autosomal dominant primary hyperparathyroidism and jaw tumor syndrome associated with renal hamartomas and cystic kidney disease: linkage to 1q21-q32 and loss of the wild-type allele in renal hamartomas. J Clin Endocrinol Metab 1996;81:4204-4211
CrossRef | Web of Science | Medline26
Haven CJ ,Wong FK ,van Dam EW , et al. A genotypic and histopathological study of a large Dutch kindred with hyperparathyroidism-jaw tumor syndrome. J Clin Endocrinol Metab 2000;85:1449-1454
CrossRef | Web of Science | Medline27
Shattuck TM ,Costa J ,Bernstein M ,Jensen RT ,Chung DC ,Arnold A . Mutational analysis of Smad3, a candidate tumor suppressor implicated in TGF-β and menin pathways, in parathyroid adenomas and enteropancreatic endocrine tumors. J Clin Endocrinol Metab 2002;87:3911-3914
CrossRef | Web of Science | Medline28
Arnold A ,Shattuck TM ,Mallya SM , et al. Molecular pathogenesis of primary hyperparathyroidism. J Bone Miner Res 2002;17:Suppl 2:N30-N36
CrossRef | Web of Science | Medline29
Marx SJ . Hyperparathyroid and hypoparathyroid disorders. N Engl J Med 2000;343:1863-1875[Erratum, N Engl J Med 2001;344:240, 696.]
Full Text | Web of Science | Medline30
Fitko R ,Roth SI ,Hines JR ,Roxe DM ,Cahill E . Parathyromatosis in hyperparathyroidism. Hum Pathol 1990;21:234-237
CrossRef | Web of Science | Medline31
Marx SJ ,Simonds WF ,Agarwal SK , et al. Hyperparathyroidism in hereditary syndromes: special expressions and special managements. J Bone Miner Res 2002;17:Suppl 2:N37-N43
Web of Science | Medline32
Simonds WF ,James-Newton LA ,Agarwal SK , et al. Familial isolated hyperparathyroidism: clinical and genetic characteristics of 36 kindreds. Medicine (Baltimore) 2002;81:1-26
CrossRef | Web of Science | Medline
- Citing Articles (120)
Citing Articles
1
Christina H. Wei, Avital Harari. (2012) Parathyroid Carcinoma: Update and Guidelines for Management. Current Treatment Options in Oncology
CrossRef2
J-H Zhang, E M Seigneur, M Pandey, A Loshakov, P K Dagur, P S Connelly, L Koo, L M Panicker, W F Simonds. (2012) The EIF4EBP3 translational repressor is a marker of CDC73 tumor suppressor haploinsufficiency in a parathyroid cancer syndrome. Cell Death and Disease 3:2, 266
CrossRef3
Murat Bastepe, Harald Jüppner, Rajesh V. Thakker. 2012. Parathyroid Disorders. , 557-588.
CrossRef4
Emanuele Ferri, Enrico Armato, Francisco José García Purriños, Riccardo Manconi. (2012) Hyperfunctional Parathyroid Carcinoma With Mediastinal Extension. Acta Otorrinolaringologica (English Edition) 63:1, 68-71
CrossRef5
E. S. Sawyer, N. C. Northrup, C. W. Schmiedt, W. T. N. Culp, K. M. Rassnick, L. D. Garrett, K. A. Selting, C. F. Saba, E. W. Howerth. (2011) Outcome of 19 dogs with parathyroid carcinoma after surgical excision*. Veterinary and Comparative Oncologyno-no
CrossRef6
Alberto Falchetti, Loredana Cavalli, Tiziana Cavalli, Francesca Giusti, Gemma Marcucci, Francesca Marini, Maria Luisa Brandi. (2011) Molecular diagnosis of parathyroid carcinoma: a reality in the near future. Expert Opinion on Medical Diagnostics1-11
CrossRef7
Alberto Cascón, Carlos Vázquez Huarte-Mendicoa, L. Javier Leandro-García, Rocío Letón, Javier Suela, Alfredo Santana, Mauro Boronat Costa, Iñaki Comino-Méndez, Iñigo Landa, Lydia Sánchez, Cristina Rodríguez-Antona, Juan C. Cigudosa, Mercedes Robledo. (2011) Detection of the first gross CDC73 germline deletion in an HPT-JT syndrome family. Genes, Chromosomes and Cancer 50:11, 922-929
CrossRef8
Michael Schaapveld, Francisca H. Jorna, Katja K.H. Aben, Harm R. Haak, John T.M. Plukker, Thera P. Links. (2011) Incidence and prognosis of parathyroid gland carcinoma: A population-based study in The Netherlands estimating the preoperative diagnosis. The American Journal of Surgery 202:5, 590-597
CrossRef9
M. A. Hahn, K.-A. Dickson, S. Jackson, A. Clarkson, A. J. Gill, D. J. Marsh. (2011) The tumor suppressor CDC73 interacts with the ring finger proteins RNF20 and RNF40 and is required for the maintenance of histone 2B monoubiquitination. Human Molecular Genetics
CrossRef10
K. Frank-Raue, C. Haag, E. Schulze, R. Keuser, F. Raue, H. Dralle, K. Lorenz. (2011) CDC73-related hereditary hyperparathyroidism: five new mutations and the clinical spectrum. European Journal of Endocrinology 165:3, 477-483
CrossRef11
S. Lim, M. S. Elston, A. J. Gill, D. J. Marsh, J. V. Conaglen. (2011) Metastatic parathyroid carcinoma initially misdiagnosed as parathyroid adenoma: the role of parafibromin in increasing diagnostic accuracy. Internal Medicine Journal 41:9, 695-699
CrossRef12
Hua-chuan Zheng, Zheng-li Wei, Xiao-yan Xu, Xiao-cui Nie, Xue Yang, Hiroyuki Takahashi, Yasuo Takano. (2011) Parafibromin expression is an independent prognostic factor for colorectal carcinomas. Human Pathology 42:8, 1089-1102
CrossRef13
Wai Kwan Siu, Chun Yiu Law, Ching Wan Lam, Chloe Miu Mak, Gary Wing Kin Wong, Andrew Yiu Yan Ho, Kwok Yip Ho, Ka Tai Loo, Sin Chuen Chiu, Louis Tsun Cheung Chow, Sui Fan Tong, Albert Yan Wo Chan. (2011) Novel nonsense CDC73 mutations in Chinese patients with parathyroid tumors. Familial Cancer
CrossRef14
Sebastian Brown, Christine O'Neill, James Suliburk, Stan Sidhu, Mark Sywak, Anthony Gill, Bruce Robinson, Leigh Delbridge. (2011) Parathyroid carcinoma: increasing incidence and changing presentation. ANZ Journal of Surgery 81:7-8, 528-532
CrossRef15
C. Christofer Juhlin, Felix Haglund, Takao Obara, Andrew Arnold, Catharina Larsson, Anders Höög. (2011) Absence of nucleolar parafibromin immunoreactivity in subsets of parathyroid malignant tumours. Virchows Archiv 459:1, 47-53
CrossRef16
Ariana R. Pichardo-Lowden, Andrea Manni, Brian D. Saunders, Maria J. Baker. (2011) Familial Hyperparathyroidism Due to a Germline Mutation of the <i>CDC73</i> Gene: Implications for Management and Age-Appropriate Testing of Relatives at Risk. Endocrine Practice 17:4, 602-609
CrossRef17
Stephen J. Marx. (2011) Hyperparathyroid Genes: Sequences Reveal Answers and Questions. Endocrine Practice 17:0, 18-27
CrossRef18
Rita Domingues, Rute A. Tomaz, Carmo Martins, Carla Nunes, Maria João Bugalho, Branca M. Cavaco. (2011) Identification of the first germline HRPT2 whole-gene deletion in a patient with primary hyperparathyroidism. Clinical Endocrinologyno-no
CrossRef19
Philippe Caron, William F. Simonds, Jean-Christophe Maiza, Mishaela Rubin, Tom Cantor, Louise Rousseau, John P. Bilezikian, Jean-Claude Souberbielle, Pierre D’Amour. (2011) Nontruncated amino-terminal parathyroid hormone overproduction in two patients with parathyroid carcinoma: a possible link to HRPT2 gene inactivation. Clinical Endocrinology 74:6, 694-698
CrossRef20
Janneke E Witteveen, Neveen A T Hamdy, Olaf M Dekkers, Job Kievit, Tom van Wezel, Bin T Teh, Johannes A Romijn, Hans Morreau. (2011) Downregulation of CASR expression and global loss of parafibromin staining are strong negative determinants of prognosis in parathyroid carcinoma. Modern Pathology 24:5, 688-697
CrossRef21
Ronald A DeLellis. (2011) Parathyroid tumors and related disorders. Modern Pathology 24, S78-S93
CrossRef22
Reza Rahbari, Alisha K. Holloway, Mei He, Elham Khanafshar, Orlo H. Clark, Electron Kebebew. (2011) Identification of Differentially Expressed MicroRNA in Parathyroid Tumors. Annals of Surgical Oncology 18:4, 1158-1165
CrossRef23
Branca Maria Cavaco, Rita Santos, Ana Félix, Davide Carvalho, José Manuel Lopes, Rita Domingues, Marta Sirgado, Nádia Rei, Fernando Fonseca, Jorge Rosa Santos, Luís Sobrinho, Valeriano Leite. (2011) Identification of De Novo Germline Mutations in the HRPT2 Gene in Two Apparently Sporadic Cases with Challenging Parathyroid Tumor Diagnoses. Endocrine Pathology 22:1, 44-52
CrossRef24
Emanuele Ferri, Enrico Armato, Francisco José García Purriños, Riccardo Manconi. (2011) Carcinoma hiperfuncionante paratiroideo con extensión mediastínica. Acta Otorrinolaringológica Española
CrossRef25
Ricardo Pedrini Cruz, Alexandre Vontobel Padoin, Daniel Weiss Vilhordo, Anselmo Hoffmann, Cláudio Corá Mottin. (2011) Use of a gamma probe to identify and guide resection of recurrent parathyroid carcinoma: Report of a case. Surgery Today 41:2, 237-241
CrossRef26
Christine J. O’Neill, Conan Chan, James Symons, Diana L. Learoyd, Stan B. Sidhu, Leigh W. Delbridge, Anthony Gill, Mark S. Sywak. (2011) Parathyroid Carcinoma Encountered After Minimally Invasive Focused Parathyroidectomy may not Require Further Radical Surgery. World Journal of Surgery 35:1, 147-153
CrossRef27
Maria Inês Alvelos, Maria Mendes, Paula Soares. (2011) Molecular Alterations in Sporadic Primary Hyperparathyroidism. Genetics Research International 2011, 1-7
CrossRef28
Ronald A. DeLellis, Sandra J. Shin, Diana O. Treaba. 2011. Immunohistology of Endocrine Tumors. , 291-339.
CrossRef29
Jessica MacKenzie-Feder, Sandra Sirrs, Donald Anderson, Jibran Sharif, Aneal Khan. (2011) Primary Hyperparathyroidism: An Overview. International Journal of Endocrinology 2011, 1-8
CrossRef30
Laura Giusti, Filomena Cetani, Federica Ciregia, Ylenia Da Valle, Elena Donadio, Gino Giannaccini, Chiara Banti, Elena Pardi, Federica Saponaro, Fulvio Basolo, Piero Berti, Paolo Miccoli, Aldo Pinchera, Claudio Marcocci, Antonio Lucacchini. (2011) A proteomic approach to study parathyroid glands. Molecular BioSystems 7:3, 687
CrossRef31
Hee Kyung Kim, Young Lyun Oh, Seok-Hyung Kim, Dong Youn Lee, Ho-Cheol Kang, Ji In Lee, Hye Won Jang, Kyu Yeon Hur, Jae Hyeon Kim, Yong Ki Min, Jae Hoon Chung, Sun Wook Kim. (2011) Parafibromin immunohistochemical staining to differentiate parathyroid carcinoma from parathyroid adenoma. Head & Neckn/a-n/a
CrossRef32
Joel T. Adler, Rebecca S. Sippel, Herbert Chen. (2010) New Trends in Parathyroid Surgery. Current Problems in Surgery 47:12, 958-1017
CrossRef33
John M. Sharretts, Electron Kebebew, William F. Simonds. (2010) Parathyroid Cancer. Seminars in Oncology 37:6, 580-590
CrossRef34
Keisuke Enomoto, Shinya Uchino, Akiko Ito, Shin Watanabe, Hiroshi Shibuya, Yukie Enomoto, Shiro Noguchi. (2010) The Surgical Strategy and the Molecular Analysis of Patients with Parathyroid Cancer. World Journal of Surgery 34:11, 2604-2610
CrossRef35
Yosuke Nakamura, Hideyuki Kataoka, Takema Sakoda, Yasushi Horie, Hiroya Kitano. (2010) Nonfunctional parathyroid carcinoma. International Journal of Clinical Oncology 15:5, 500-503
CrossRef36
J-H Zhang, L M Panicker, E M Seigneur, L Lin, C D House, W Morgan, W C Chen, H Mehta, M Haj-Ali, Z-X Yu, W F Simonds. (2010) Cytoplasmic polyadenylation element binding protein is a conserved target of tumor suppressor HRPT2/CDC73. Cell Death and Differentiation 17:10, 1551-1565
CrossRef37
C. Christofer Juhlin, Inga-Lena Nilsson, Kenth Johansson, Felix Haglund, Andrea Villablanca, Anders Höög, Catharina Larsson. (2010) Parafibromin and APC as Screening Markers for Malignant Potential in Atypical Parathyroid Adenomas. Endocrine Pathology 21:3, 166-177
CrossRef38
Tuck Y. Yong, Jordan Y. Z. Li. (2010) Mediastinal parathyroid carcinoma presenting with severe skeletal manifestations. Journal of Bone and Mineral Metabolism 28:5, 591-594
CrossRef39
Nadia Talat, Klaus-Martin Schulte. (2010) Clinical Presentation, Staging and Long-Term Evolution of Parathyroid Cancer. Annals of Surgical Oncology 17:8, 2156-2174
CrossRef40
Sungdae Moon, Ju-Hee Kim, Ju-Yun Shim, Yu-Bae Ahn, Ki-Ho Song, Bong-Yun Cha, Lee-So Maeng, Je-Ho Han. (2010) Analysis of aberrantly spliced HRPT2 transcripts and the resulting proteins in HPT-JT syndrome. Molecular Genetics and Metabolism 100:4, 365-371
CrossRef41
B. Givi, J.P. Shah. (2010) Parathyroid Carcinoma. Clinical Oncology 22:6, 498-507
CrossRef42
Steven A Lietman, Emily L Germain-Lee, Michael A Levine. (2010) Hypercalcemia in children and adolescents. Current Opinion in Pediatrics 22:4, 508-515
CrossRef43
Sarah J Johnson. (2010) Changing clinicopathological practice in parathyroid disease. Histopathology 56:7, 835-851
CrossRef44
John M. Sharretts, William F. Simonds. (2010) Clinical and molecular genetics of parathyroid neoplasms. Best Practice & Research Clinical Endocrinology & Metabolism 24:3, 491-502
CrossRef45
Euan A Ashley, Atul J Butte, Matthew T Wheeler, Rong Chen, Teri E Klein, Frederick E Dewey, Joel T Dudley, Kelly E Ormond, Aleksandra Pavlovic, Alexander A Morgan, Dmitry Pushkarev, Norma F Neff, Louanne Hudgins, Li Gong, Laura M Hodges, Dorit S Berlin, Caroline F Thorn, Katrin Sangkuhl, Joan M Hebert, Mark Woon, Hersh Sagreiya, Ryan Whaley, Joshua W Knowles, Michael F Chou, Joseph V Thakuria, Abraham M Rosenbaum, Alexander Wait Zaranek, George M Church, Henry T Greely, Stephen R Quake, Russ B Altman. (2010) Clinical assessment incorporating a personal genome. The Lancet 375:9725, 1525-1535
CrossRef46
W. Cross Dudney, Donald Bodenner, Brendan C. Stack. (2010) Parathyroid Carcinoma. Otolaryngologic Clinics of North America 43:2, 441-453
CrossRef47
Paul J. Newey, Michael R. Bowl, Treena Cranston, Rajesh V. Thakker. (2010) Cell division cycle protein 73 homolog ( CDC73 ) mutations in the hyperparathyroidism-jaw tumor syndrome (HPT-JT) and parathyroid tumors. Human Mutation 31:3, 295-307
CrossRef48
Jeremy Cox, Mike Stearns. 2010. Symptoms, Differential Diagnosis and Management. , 143-163.
CrossRef49
C. Christofer Juhlin, Anders Höög. (2010) Parafibromin as a Diagnostic Instrument for Parathyroid Carcinoma-Lone Ranger or Part of the Posse?. International Journal of Endocrinology 2010, 1-5
CrossRef50
Y.-J. Yang, J.-W. Han, H.-D. Youn, E.-J. Cho. (2010) The tumor suppressor, parafibromin, mediates histone H3 K9 methylation for cyclin D1 repression. Nucleic Acids Research 38:2, 382-390
CrossRef51
Yoon-Shick Yom, Myung-Jun Lee, Hyun-Woo Lim, Jeong-Ho Park, Sung-Tae Kim, Yu-Mi Lee, Dong-Ju Yang, Youn-Zoo Cho, Moon-Il Park, Kang-Woo Lee, Keun-Young Park, Dong-Mee Lim, Byung Joon Kim. (2010) A Case of Coexistence of Parathyroid and Papillary Thyroid Carcinoma. Journal of Korean Endocrine Society 25:1, 61
CrossRef52
Andrew Arnold, Kelly Lauter. 2010. Genetics of Hyperparathyroidism Including Parathyroid Cancer. , 141-148.
CrossRef53
Takahiro Okamoto, Masatoshi Iihara, Takao Obara, Toshihiko Tsukada. (2009) Parathyroid Carcinoma: Etiology, Diagnosis, and Treatment. World Journal of Surgery 33:11, 2343-2354
CrossRef54
Gunnar Westin, Peyman Björklund, Göran Åkerström. (2009) Molecular Genetics of Parathyroid Disease. World Journal of Surgery 33:11, 2224-2233
CrossRef55
Roger Y. W. Shih, Sarah Fackler, Stephen Maturo, Mark W. True, Joseph Brennan, David Wells. (2009) Parathyroid Carcinoma in Multiple Endocrine Neoplasia Type 1 with a Classic Germline Mutation. Endocrine Practice 15:6, 567-572
CrossRef56
Maurizio Iacobone, Giulia Masi, Luisa Barzon, Andrea Porzionato, Veronica Macchi, Francesco Antonio Ciarleglio, Giorgio Palù, Raffaele Caro, Giovanni Viel, Gennaro Favia. (2009) Hyperparathyroidism–jaw tumor syndrome: a report of three large kindred. Langenbeck's Archives of Surgery 394:5, 817-825
CrossRef57
Amy G. Fiedler, Christopher Rossi, Cynthia A. Gingalewski. (2009) Parathyroid carcinoma in a child: an unusual case of an ectopically located malignant parathyroid gland with tumor invading the thymus. Journal of Pediatric Surgery 44:8, 1649-1652
CrossRef58
A. Falchetti, F. Marini, F. Giusti, L. Cavalli, T. Cavalli, M. L. Brandi. (2009) DNA-based test: when and why to apply it to primary hyperparathyroidism clinical phenotypes. Journal of Internal Medicine 266:1, 69-83
CrossRef59
P. J. Newey, M. R. Bowl, R. V. Thakker. (2009) Parafibromin - functional insights. Journal of Internal Medicine 266:1, 84-98
CrossRef60
Benjamin J. Wilkins, James S. Lewis. (2009) Non-Functional Parathyroid Carcinoma: A Review of the Literature and Report of a Case Requiring Extensive Surgery. Head and Neck Pathology 3:2, 140-149
CrossRef61
Todd McMullen, Greg Bodie, Anthony Gill, Catharina Ihre-Lundgren, Albert Shun, Mary Bergin, Graham Stevens, Leigh Delbridge. (2009) Hyperparathyroidism After Irradiation for Childhood Malignancy. International Journal of Radiation Oncology*Biology*Physics 73:4, 1164-1168
CrossRef62
P.E. Goretzki, D. Wirowski, K. Schwarz, P. Pohl, H. Böhner, A. Starke, B.J. Lammers. (2009) Indikation und Durchführung endokrin-chirurgischer Operationen. Der Chirurg 80:2, 122-129
CrossRef63
O. Rozenblatt-Rosen, T. Nagaike, J. M. Francis, S. Kaneko, K. A. Glatt, C. M. Hughes, T. LaFramboise, J. L. Manley, M. Meyerson. (2009) The tumor suppressor Cdc73 functionally associates with CPSF and CstF 3' mRNA processing factors. Proceedings of the National Academy of Sciences 106:3, 755-760
CrossRef64
Gustavo G. Fernandez-Ranvier, Elham Khanafshar, David Tacha, Mariwil Wong, Electron Kebebew, Quan-Yang Duh, Orlo H. Clark. (2009) Defining a molecular phenotype for benign and malignant parathyroid tumors. Cancer 115:2, 334-344
CrossRef65
Jennifer L. Hunt. 2009. Molecular Endocrine Pathology. , 296-304.
CrossRef66
LORETTA L.Y. TSE, JOHN K.C. CHAN. 2009. Thyroid and Parathyroid. , 1597-1685.
CrossRef67
Jennifer L. Hunt. (2009) Molecular Alterations in Hereditary and Sporadic Thyroid and Parathyroid Diseases. Advances in Anatomic Pathology 16:1, 23-32
CrossRef68
Ronald A. DeLellis, Yuri E. Nikiforov. 2009. Thyroid and Parathyroid Glands. , 563-646.
CrossRef69
Ronald A. DeLellis. (2008) Challenging Lesions in the Differential Diagnosis of Endocrine Tumors: Parathryoid Carcinoma. Endocrine Pathology 19:4, 221-225
CrossRef70
Linwah Yip, Raja R. Seethala, Marina N. Nikiforova, Yuri E. Nikiforov, Jennifer B. Ogilvie, Sally E. Carty, John H. Yim. (2008) Loss of heterozygosity of selected tumor suppressor genes in parathyroid carcinoma. Surgery 144:6, 949-955
CrossRef71
Claudio Marcocci, Filomena Cetani, Mishaela R Rubin, Shonni J Silverberg, Aldo Pinchera, John P Bilezikian. (2008) Parathyroid Carcinoma. Journal of Bone and Mineral Research 23:12, 1869-1880
CrossRef72
L. Lin, J.-H. Zhang, L. M. Panicker, W. F. Simonds. (2008) The parafibromin tumor suppressor protein inhibits cell proliferation by repression of the c-myc proto-oncogene. Proceedings of the National Academy of Sciences 105:45, 17420-17425
CrossRef73
Aram N. Demirjian, Joseph M. Grossman, Jean L. Chan, Sareh Parangi. (2008) Parathyroid carcinoma and neurofibromatosis. Surgery 144:5, 827-829
CrossRef74
Shonali Deb, Moorthy P Ponnusamy, Shantibhusan Senapati, Parama Dey, Surinder K Batra. (2008) Human PAF complexes in endocrine tumors and pancreatic cancer. Expert Review of Endocrinology & Metabolism 3:5, 557-565
CrossRef75
Jennifer L. Hunt. (2008) Molecular Diagnosis in Head and Neck: What a Surgical Pathologist Must Know. Head and Neck Pathology 2:2, 99-102
CrossRef76
Filomena Cetani, Elena Pardi, Chiara Banti, Simona Borsari, Elena Ambrogini, Edda Vignali, Luisella Cianferotti, Giuseppe Viccica, Aldo Pinchera, Claudio Marcocci. (2008) HRPT2 gene analysis and the diagnosis of parathyroid carcinoma. Expert Review of Endocrinology & Metabolism 3:3, 377-389
CrossRef77
Marta S. Sarquis, Leticia G. Silveira, Flavio J. Pimenta, Eduardo P. Dias, Bin T. Teh, Eitan Friedman, Ricardo S. Gomez, Gabriela C. Tavares, Charis Eng, Luiz De Marco. (2008) Familial hyperparathyroidism: surgical outcome after 30 years of follow-up in three families with germline HRPT2 mutations. Surgery 143:5, 630-640
CrossRef78
Yoshihiro Tominaga, Toyonori Tsuzuki, Susumu Matsuoka, Nobuaki Uno, Tetsuhiko Sato, Syuichi Shimabukuro, Norihiko Goto, Takaharu Nagasaka, Kazuharu Uchida. (2008) Expression of Parafibromin in Distant Metastatic Parathyroid Tumors in Patients with Advanced Secondary Hyperparathyroidism Due to Chronic Kidney Disease. World Journal of Surgery 32:5, 815-821
CrossRef79
Electron Kebebew. (2008) Parathyroid Carcinoma, a Rare but Important Disorder for Endocrinologists, Primary Care Physicians, and Endocrine Surgeons. Thyroid 18:4, 385-386
CrossRef80
Sang-Hyuk Lee, Seung-Suk Lee, Sung-Min Jin, Jin-Hwan Kim, Young-Soo Rho. (2008) Predictive Factors for Central Compartment Lymph Node Metastasis in Thyroid Papillary Microcarcinoma. The Laryngoscope 118:4, 659-662
CrossRef81
Hua-chuan Zheng, Hiroyuki Takahashi, Xiao-han Li, Takuo Hara, Shinji Masuda, Yi-fu Guan, Yasuo Takano. (2008) Downregulated parafibromin expression is a promising marker for pathogenesis, invasion, metastasis and prognosis of gastric carcinomas. Virchows Archiv 452:2, 147-155
CrossRef82
Maurizio Iacobone, Luisa Barzon, Andrea Porzionato, Giulia Masi, Veronica Macchi, Filippo Marino, Giovanni Viel, Gennaro Favia. (2007) Parafibromin expression, single-gland involvement, and limited parathyroidectomy in familial isolated hyperparathyroidism. Surgery 142:6, 984-991
CrossRef83
Deborah J Marsh, Michael A Hahn, Viive M Howell, Anthony J Gill. (2007) Molecular diagnosis of primary hyperparathyroidism in familial cancer syndromes. Expert Opinion on Medical Diagnostics 1:3, 377-392
CrossRef84
Sylvia L. Asa, Shereen Ezzat. 2007. Endocrine Organs. .
CrossRef85
T Iwata, N Mizusawa, Y Taketani, M Itakura, K Yoshimoto. (2007) Parafibromin tumor suppressor enhances cell growth in the cells expressing SV40 large T antigen. Oncogene 26:42, 6176-6183
CrossRef86
C. J. Haven, M. van Puijenbroek, M. H. Tan, B. T. Teh, G. J. Fleuren, T. van Wezel, H. Morreau. (2007) Identification of MEN1 and HRPT2 somatic mutations in paraffin-embedded (sporadic) parathyroid carcinomas. Clinical Endocrinology 67:3, 370-376
CrossRef87
Shanthi M. Colaço, Ming Si, Emily Reiff, Orlo H. Clark. (2007) Hyperparathyroidism after radioactive iodine therapy. The American Journal of Surgery 194:3, 323-327
CrossRef88
G. Y. Meyer-Rochow, R. Alvarado, M. S. Sywak, S. B Sidhu, L. W. Delbridge, A. J. Gill. (2007) Letter 2: Intraoperative diagnosis and treatment of parathyroid cancer and atypical parathyroid adenoma (Br J Surg 2007; 94: 566–570). British Journal of Surgery 94:8, 1044-1044
CrossRef89
Prem Sahasranam, Michael T. Tran, Hezla Mohamed, Theodore C. Friedman. (2007) Multiglandular Parathyroid Carcinoma: A Case Report and Brief Review. Southern Medical Journal 100:8, 841-844
CrossRef90
Shamlal Mangray, Ronald A. Delellis. (2007) Parafibromin in the Diagnosis of Parathyroid Carcinoma. Advances in Anatomic Pathology 14:4, 299-301
CrossRef91
J Zhao, A Yart, S Frigerio, A Perren, P Schraml, C Weisstanner, T Stallmach, W Krek, H Moch. (2007) Sporadic human renal tumors display frequent allelic imbalances and novel mutations of the HRPT2 gene. Oncogene 26:23, 3440-3449
CrossRef92
Kenneth D. McMilin, Susmita Dasgupta. (2007) Allogeneic Transplantation and the Risk for Transmission of Genetic Disease: The Heritable Cancer Disorders. Stem Cells and Development 16:2, 191-212
CrossRef93
Y. Yamashita, T. Akiyama, N. Mizusawa, K. Yoshimoto, M. Goto. (2007) A case of hyperparathyroidism-jaw tumour syndrome found in the treatment of an ossifying fibroma in the maxillary bone. International Journal of Oral and Maxillofacial Surgery 36:4, 365-369
CrossRef94
K J Bradley, M R Bowl, S E Williams, B N Ahmad, C J Partridge, A L Patmanidi, A M Kennedy, N Y Loh, R V Thakker. (2007) Parafibromin is a nuclear protein with a functional monopartite nuclear localization signal. Oncogene 26:8, 1213-1221
CrossRef95
Viive M. Howell, John W. Cardinal, Anne-Louise Richardson, Oliver Gimm, Bruce G. Robinson, Deborah J. Marsh. (2006) Rapid Mutation Screening for HRPT2 and MEN1 Mutations Associated with Familial and Sporadic Primary Hyperparathyroidism. The Journal of Molecular Diagnostics 8:5, 559-566
CrossRef96
Chun Zhang, Dong Kong, Min-Han Tan, Donald L. Pappas, Peng-Fei Wang, Jindong Chen, Leslie Farber, Nian Zhang, Han-Mo Koo, Michael Weinreich, Bart O. Williams, Bin Tean Teh. (2006) Parafibromin inhibits cancer cell growth and causes G1 phase arrest. Biochemical and Biophysical Research Communications 350:1, 17-24
CrossRef97
Thomas G Kelly, Trisha M Shattuck, Miguel Reyes-Mugica, Andrew F Stewart, William F Simonds, Robert Udelsman, Andrew Arnold, Thomas O Carpenter. (2006) Surveillance for Early Detection of Aggressive Parathyroid Disease: Carcinoma and Atypical Adenoma in Familial Isolated Hyperparathyroidism Associated With a Germline HRPT2 Mutation. Journal of Bone and Mineral Research 21:10, 1666-1671
CrossRef98
Anthony J. Gill, Adele Clarkson, Oliver Gimm, Juliane Keil, Henning Dralle, Viive M. Howell, Deborah J. Marsh. (2006) Loss of Nuclear Expression of Parafibromin Distinguishes Parathyroid Carcinomas and Hyperparathyroidism-Jaw Tumor (HPT-JT) Syndrome-related Adenomas From Sporadic Parathyroid Adenomas and Hyperplasias. The American Journal of Surgical Pathology1140-1149
CrossRef99
Shonni J Silverberg, John P Bilezikian. (2006) The diagnosis and management of asymptomatic primary hyperparathyroidism. Nature Clinical Practice Endocrinology & Metabolism 2:9, 494-503
CrossRef100
Flávio Juliano Pimenta, Letícia Ferreira Gontijo Silveira, Gabriela Cordeiro Tavares, Andreza Campos Silva, Paolla Freitas Perdigão, Wagner Henriques Castro, Marcus Vinícius Gomez, Bin Tean Teh, Luiz De Marco, Ricardo Santiago Gomez. (2006) HRPT2 gene alterations in ossifying fibroma of the jaws. Oral Oncology 42:7, 735-739
CrossRef101
Noriko Mizusawa, Shinya Uchino, Takeo Iwata, Masaru Tsuyuguchi, Yasuyo Suzuki, Tsunenori Mizukoshi, Yoshio Yamashita, Akihiro Sakurai, Shinichi Suzuki, Mutsuo Beniko, Hideki Tahara, Masato Fujisawa, Nobuyuki Kamata, Kenji Fujisawa, Tohru Yashiro, Daisuke Nagao, Hossain Md. Golam, Toshiaki Sano, Shiro Noguchi, Katsuhiko Yoshimoto. (2006) Genetic analyses in patients with familial isolated hyperparathyroidism and hyperparathyroidism?jaw tumour syndrome. Clinical Endocrinology 65:1, 9-16
CrossRef102
Payam S. Pahlavan, Marianne C. Severin. (2006) Parathyroid carcinoma: A rare case with mandibular brown tumor. Wiener klinische Wochenschrift 118:5-6, 175-179
CrossRef103
K. J. Bradley, B. M. Cavaco, M. R. Bowl, B. Harding, T. Cranston, C. Fratter, G. M. Besser, M. Conceicao Pereira, M. W. J. Davie, N. Dudley, V. Leite, G. P. Sadler, A. Seller, R. V. Thakker. (2006) Parafibromin mutations in hereditary hyperparathyroidism syndromes and parathyroid tumours. Clinical Endocrinology 64:3, 299-306
CrossRef104
O. Gimm, K. Lorenz, P. Nguyen Thanh, U. Schneyer, M. Bloching, V. M. Howell, D. J. Marsh, B. T. Teh, U. Krause, H. Dralle. (2006) Das familiäre Nebenschilddrüsenkarzinom. Der Chirurg 77:1, 15-24
CrossRef105
Bing Zhu, Yong Zheng, Anh-Dung Pham, Subhrangsu S. Mandal, Hediye Erdjument-Bromage, Paul Tempst, Danny Reinberg. (2005) Monoubiquitination of Human Histone H2B: The Factors Involved and Their Roles in HOX Gene Regulation. Molecular Cell 20:4, 601-611
CrossRef106
N. Rawat, N. Khetan, D. W. Williams, J. N. Baxter. (2005) Parathyroid carcinoma. British Journal of Surgery 92:11, 1345-1353
CrossRef107
Michael A Hahn, Deborah J Marsh. (2005) Identification of a functional bipartite nuclear localization signal in the tumor suppressor parafibromin. Oncogene 24:41, 6241-6248
CrossRef108
Maurizio Iacobone, Cesare Ruffolo, Franco Lumachi, Gennaro Favia. (2005) Results of iterative surgery for persistent and recurrent parathyroid carcinoma. Langenbeck's Archives of Surgery 390:5, 385-390
CrossRef109
Alberto Falchetti, Alessandro Franchi, Cesare Bordi, Carmelo Mavilia, Laura Masi, Federica Cioppi, Raffaella Recenti, Lucia Picariello, Francesca Marini, Francesca Del Monte, Valentina Ghinoi, Valentina Martineti, Annalisa Tanini, Maria Luisa Brandi. (2005) Azidothymidine Induces Apoptosis and Inhibits Cell Growth and Telomerase Activity of Human Parathyroid Cancer Cells in Culture. Journal of Bone and Mineral Research 20:3, 410-418
CrossRef110
Elizabeth A. Mittendorf, Christopher R. McHenry. (2005) Parathyroid carcinoma. Journal of Surgical Oncology 89:3, 136-142
CrossRef111
Elisabeth Edstr
m Elder, Grahame Elder, Catharina Larsson. (2005) Pheochromocytoma and functional paraganglioma syndrome: No longer the 10% tumor. Journal of Surgical Oncology 89:3, 193-201
CrossRef112
Ronald A DeLellis. (2005) Parathyroid Carcinoma. Advances in Anatomic Pathology 12:2, 53-61
CrossRef113
K. J. BRADLEY, M. R. HOBBS, I. D. BULEY, J. D. CARPTEN, B. M. CAVACO, J. E. FARES, P. LAIDLER, S. MANEK, C. M. ROBBINS, I. S. SALTI, N. W. THOMPSON, C. E. JACKSON, R. V. THAKKER. (2005) Uterine tumours are a phenotypic manifestation of the hyperparathyroidism-jaw tumour syndrome. Journal of Internal Medicine 257:1, 18-26
CrossRef114
Allen M. Spiegel. (2004) Focus on hereditary endocrine neoplasia. Cancer Cell 6:4, 327-332
CrossRef115
J.M. Cabezas Agrícola. (2004) Hipercalcemia. Medicine - Programa de Formación Médica Continuada Acreditado 9:17, 1055-1062
CrossRef116
Ajay Bhatia, Stephen Cannon, Tim Briggs, Richard W Keen. (2004) Chondrosarcoma in Association With Primary Hyperparathyroidism. Journal of Bone and Mineral Research 19:7, 1200-1203
CrossRef117
Gary L. Clayman, Hernan E. Gonzalez, Adel El-Naggar, Rena Vassilopoulou-Sellin. (2004) Parathyroid carcinoma: Evaluation and interdisciplinary management. Cancer 100:5, 900-905
CrossRef118
Deborah J Marsh, Hans Morreau, Bin T Teh. (2004) HRPT2 and parathyroid cancer. The Lancet Oncology 5:2, 78
CrossRef119
Weinstein, Lee S., Simonds, William F., . (2003) HRPT2, a Marker of Parathyroid Cancer. New England Journal of Medicine 349:18, 1691-1692
Full Text120
E. Seeman. (2001) Clinical and Basic Research Papers: October 2003 Selections. International Bone and Mineral Society Knowledge Environment 1:1, 20040123-0
CrossRef
