Original Article

Brief Report

Effect of CD3δ Deficiency on Maturation of α/β and γ/δ T-Cell Lineages in Severe Combined Immunodeficiency

Harjit K. Dadi, Ph.D., Amos J. Simon, Ph.D., and Chaim M. Roifman, M.D.

N Engl J Med 2003; 349:1821-1828November 6, 2003

Article

The T-cell–receptor complex consists of the α and β or γ and δ variant chains, paired as mutually exclusive heterodimers in association with the invariant chains CD3γ, δ, ε, and ζ. T cells with α and β chains are referred to as α/β T cells, and those with γ and δ chains are called γ/δ T cells. During development, the CD3 protein complex plays an important part in the transition of thymocytes from CD4–CD8– double-negative immature precursors to a CD4+CD8+ double-positive stage and finally to the mature CD4+CD8– or CD4–CD8+ single-positive T cell.1-5 Selective deficiency of CD3 component γ, δ, ε, or ζ in mice, achieved by gene knockout, causes mild-to-severe, although incomplete, blockage of T-cell development.6-10 Similarly, CD3γ or CD3ε deficiency in humans brings about a partial arrest of T-cell maturation and only moderate immunodeficiency.11,12

We report a novel defect in the CD3δ gene in three members of a kindred with a form of severe combined immunodeficiency (SCID) characterized by the absence of T cells but normal numbers of B cells (T–B+ SCID). These three patients had an early arrest in T-cell development, with a nearly complete absence of circulating mature T cells and a complete lack of γ/δ T cells. Our results suggest that, unlike CD3ε and CD3γ, CD3δ is essential for T-cell development.

Case Report

We studied a kindred of Mennonite descent that shared multiple consanguineous links across several generations. Three patients with SCID were identified in this family. SCID was diagnosed in Patient 1 immediately after birth, after an examination performed because of previous cases in the family (Patients 2 and 3). She subsequently underwent bone marrow transplantation and is alive and well, with full immune reconstitution, three years later. Patient 2, a male cousin of Patient 1, was admitted at the age of two months because of fever, tachypnea, and tachycardia. Rapidly developing respiratory arrest required assisted ventilation, and he died of multiorgan failure. Adenovirus was identified in stool, urine, and bronchial secretions.

Patient 3, a male cousin of Patients 1 and 2, was well and thriving until two and a half months of age, when chronic diarrhea developed. At three and a half months of age, the patient was admitted with respiratory distress, lethargy, and jaundice. On examination, he was noted to have hepatomegaly, and liver-function tests were markedly abnormal. He was transferred from another hospital with increased respiratory distress and died 12 hours later from rapidly developing refractory hypotension, liver failure, pulmonary hemorrhage, disseminated intravascular coagulopathy, and hemorrhagic shock. Cytomegalovirus was identified in multiple tissues obtained at autopsy.

Flow-cytometric analyses of peripheral-blood lymphocytes from these patients showed a slight reduction in total lymphocyte counts in Patients 1 and 2 and a marked reduction in Patient 3 (Table 1Table 1Results of Flow-Cytometric Analysis of Patients' Lymphocytes.). The numbers of circulating mature CD3+ T cells were extremely low (3 to 7 cells per cubic millimeter), whereas CD4+ or CD8+ T cells were undetectable. In contrast, the number of B cells, as determined by staining for CD20, was either normal (in Patients 1 and 3) or increased (in Patient 2). The number of natural killer cells, as determined by staining for CD56, was normal in all patients.

An extreme deficiency of T cells in T–B+ SCID (with or without natural killer cells) is frequently associated with a small, dysplastic thymus, which is barely detectable by radiography or ultrasonography.13 In contrast, all three patients had a nearly normal sized thymus shadow on chest radiography. Analysis of thymus-gland tissue obtained by biopsy in Patient 1 and at autopsy from Patient 3 and stained with hematoxylin and eosin revealed preserved lobular structures with moderate populations of T-cell precursors. However, typical intralobar corticomedullary distinctions and Hassall's corpuscles were absent (not shown).

Methods

Assays of Phenotype and Function of Peripheral-Blood Lymphocytes

Cell-surface markers of peripheral-blood lymphocytes were determined by immunofluorescence antibody staining and flow cytometry (Epics V, Coulter Electronics) with antibodies purchased from Coulter Diagnostics. In vitro lymphocyte proliferation induced by phytohemagglutinin was assayed by standard means.

Analysis of Thymic Tissue

After written informed consent was obtained from the parents of the patients and control infants, samples of thymus tissue obtained by biopsy (Patient 1), at autopsy (Patient 3), and from four infants undergoing cardiac surgery were obtained for analysis. Then, 4-μm serial sections of frozen thymus tissue were mounted on glass slides, air-dried, and stained with hematoxylin and eosin or with specific antibodies raised against the various T-cell receptor, CD3, CD4, and CD8 chains.

Western Blotting

Thymocytes obtained from Patient 1 or from normal thymus were isolated by centrifugation and lysed in 50 μl of lysis buffer (20 mM TRIS [pH 7.4], 150 mM sodium chloride, 1 percent Igepal CA-630, 5 mM EDTA, 2 mM sodium orthovanadate, and 1 mM phenylmethylsulfonylfluoride), incubated on ice for 15 minutes, and then centrifuged for 10 minutes at 12,000×g. The proteins in the supernatant were analyzed by a standard Western blotting technique with the use of antibodies against T-cell receptor α (SC-9100), T-cell receptor β (SC-5277), T-cell receptor γ (SC-9854), T-cell receptor δ (SC-1578), CD3γ (SC-1125), CD3δ (SC-1128), CD3ε (SC-1179), CD3ζ (SC-1239), guanine nucleotide–binding protein α-inhibitory subunit 3 (Gα-3, SC-262), CD4 (SC-7219), CD8α (SC-7970), and CD3β (SC-9147), all purchased from Santa Cruz Biotechnology.

Preparation of RNA, Genomic DNA, and Complementary DNA

RNA was prepared from thymocytes from the patients and controls with the use of the RNeasy kit (Qiagen), according to the manufacturer's suggestions. Random, primed first-strand complementary DNA (cDNA) was synthesized from 5 μg of total RNA with the use of SuperScript II RNase H Reverse Transcriptase (Invitrogen). Genomic DNA was prepared from Epstein–Barr virus–transformed B-cell lines established from cells from both the patients and the controls or from peripheral-blood mononuclear cells obtained from other family members after Ficoll–Hypaque gradient centrifugation with use of the Wizard genomic DNA–purification kit (Promega), according to the manufacturer's suggestions. Then, cDNA was used to amplify the CD3δ coding sequence in a polymerase chain reaction (PCR) with use of the primers 5'ATCTACTGGATGAGTTCCGCTGGGAG3' and 5'CTGCTTCTAGAAGCCACCAGTCTCAG3'.

To amplify exon 2 of CD3δ from genomic DNA by PCR, the primer sequences 5'AACTGTGATATTTTTTCCCCTT3' and 5'CAACCCAAAGGGTTCAGGAAGCAC3' were used. The resultant PCR products were resolved on 1 percent agarose gels, and the appropriate bands were removed and purified with use of the Qiaex II agarose-gel extraction kit (Qiagen). The purified products were directly sequenced with use of the Thermo Sequenase radiolabeled terminator cycle-sequencing kit (Amersham).

Microarray Analysis

The labeled probe was prepared as recommended by the manufacturers of the microarray (Affymetrix), and microarray analysis was performed at the Centre for Applied Genomics (Hospital for Sick Children, Toronto). Briefly, 20 μg of total RNA from patient and control thymocytes was used as a template for the synthesis of double-stranded cDNA. The cDNA was purified and used as a template for in vitro transcription with biotin-labeled nucleotides (Enzo Diagnostics). Labeled cRNA was fragmented and hybridized to Human Genechip microarrays (HG-U95A and HG-U133A, Affymetrix), which can detect 12,000 and 22,400 messenger RNA (mRNA) species, respectively, all representing annotated genes. The microarrays were scanned and the output files inspected for hybridization artifacts. Arrays without substantial artifacts were analyzed with the use of Microarray suite 5.0 software.14,15

The expression value for each gene was determined by calculating the average differences in intensity (perfect-match intensity minus mismatch intensity) of the pairs of probes for each gene and ensuring that the gene was present in the array. The differences in expression were calculated by comparing the values for the level of expression of genes from the patient divided by that for the controls. The results have been deposited in the Gene Expression Omnibus at http://www.ncbi.nlm.nih.gov/geo/ (accession number GSE 609).

Results

Microarray Analysis of Gene Expression in the Thymus of Patient 1

The combination of profound lymphocytopenia and a partially preserved thymus structure suggested that the defect in the three patients with SCID was restricted to T cells and involved a gene controlling T-cell differentiation. To identify the putative genetic defect, we compared gene expression in the thymus of Patient 1 with that of a normal thymus, using oligonucleotide microarrays. Remarkably, only a relatively small number of gene products known to regulate T-cell development were substantially altered in the patient, as compared with the control (Figure 1AFigure 1Gene-Microarray Analysis of Thymocytes from Patient 1. and Figure 1B). Of particular interest were a reduction in T-cell receptor α and T-cell receptor β transcripts by a factor of 4.3 and 1.6, respectively; a reduction in transcripts of CD3δ and CD3ζ by a factor of 2.3; and increases in T-cell receptor δ and T-cell receptor γ mRNA by a factor of 1.5 and 2.5, respectively (Figure 1A, Figure 1B, and Figure 1C).

Identification of a Premature Stop Codon in CD3δ

Despite the lower-than-normal level of CD3δ and CD3ζ transcripts in the thymus of Patient 1 (as estimated by microarray analysis), we were able to detect mRNA for both CD3 chains and for CD3γ and CD3ε using standard reverse-transcriptase PCR (data not shown). Sequence analysis of the CD3γ, CD3ε, and CD3ζ cDNA did not demonstrate any abnormalities. However, sequencing of the CD3δ PCR product from Patient 1 revealed a homozygous C-to-T transition at nucleotide position 202, predicting a premature stop codon, with a truncation at residue 68 (R68stop) in the extracellular domain of the protein. The patient's genomic DNA contained this homozygous mutation in exon 2 of the CD3δ gene (Figure 2AFigure 2Segregation and Characterization of CD3δ Deficiency in the Pedigree., Figure 2B, and Figure 2C).

The same homozygous mutation was detected in genomic DNA from the closely related Patients 2 and 3 (Figure 2A). Both a normal and mutated CD3δ allele were detected in the genomic DNA sequence of the parents of all three patients, consistent with the occurrence of autosomal recessive inheritance. Compatible with this mode of inheritance, siblings of Patients 1, 2, and 3 were either heterozygous for the CD3δ mutation or completely normal (Figure 2A). The stop codon within exon 2 can explain the reduction in CD3δ mRNA (by a factor of 2.3) in the thymus of Patient 1 through a nonsense-mediated decay mechanism.16,17 Despite the presence of detectable, albeit reduced, levels of CD3δ mRNA (Figure 2D), CD3δ protein was undetectable by Western blotting (Figure 2E). The immunodeficiency in these patients thus appears to arise from a heritable mutation of the CD3δ gene that prevents the synthesis of the CD3δ protein.

Proteins of the CD3 Complex in CD3δ–/– Thymocytes

In comparison with the levels of mRNA for CD3γ and CD3ε in normal thymocytes, the levels in thymocytes from Patient 1 were marginally altered (Figure 1C). However, the levels of CD3γ and CD3ε proteins were lower in the patient's thymocytes than in normal control samples (Figure 3Figure 3Expression of T-Cell Receptor (TCR) and CD3 Subunits in Thymocytes from Patient 1.), possibly because CD3 complexes lacking CD3δ are rapidly degraded. A similar universal reduction in the expression of CD3 subunits was found in murine CD3ζ–/– thymocytes.7 Unlike the CD3γ and CD3ε subunits, the CD3ζ mRNA level was lower (by a factor of 2.3) in the patient's thymocytes than in the control samples, and levels of the CD3ζ protein were undetectable on Western blot analysis (Figure 3).

These CD3 subunits were also assessed immunohistochemically in the thymus tissue of Patient 1 (Figure 4Figure 4Immunohistochemical Analysis of Thymus Tissue from the Patient and an Age-Matched Control Subject (×20).). Normal thymus showed strong reactivity with antibodies against CD3γ, CD3δ, CD3ε, and CD3ζ. In contrast, CD3δ, CD3ε, and CD3ζ were not detected in the patient's thymus. Despite the lack of expression of these CD3 chains, the degree of staining for CD3γ was similar to that in the control thymus (Figure 4), suggesting that CD3γ, even at low cytoplasmic levels, may be transported to the cell membrane independently of the other CD3 chains.

Arrest of CD3δ–/– Thymocytes at the CD4–CD8– Stage of Development

The thymocytes of Patient 1 contained twice as much precursor T-cell receptor α (pTα) gene transcript as did control thymocytes (Figure 1B and Figure 1C). Since the pTα gene is expressed exclusively by immature thymocytes, these results indicate a block early in the differentiation of T cells in the patient's thymus. Such a block could cause immature CD4– CD8– double-negative thymocytes to accumulate. Indeed, we found reduced levels of CD4, CD8α, and CD8β1 mRNA and protein in CD3δ–/– thymocytes (Figure 1 and Figure 3), and immunohistochemical analysis of CD3δ–/– thymus sections was negative for both CD4 and CD8 (not shown). These results are all consistent with an arrest of differentiation at the CD4–CD8– stage of T-cell development.

The γ/δ Lineage in CD3δ Deficiency

The normal thymus contains only a very small number of γ/δ T cells, and these cells constitute up to 5 percent of circulating lymphocytes.18 The thymocytes from Patient 1 contained increased levels of T-cell receptor γ and T-cell receptor δ transcripts (Figure 1) and protein (Figure 3). However, γ/δ T cells could not be detected by flow cytometry in the peripheral blood of the three patients with CD3δ deficiency (Table 1) or by immunohistochemical analysis of sections obtained from the thymus, lymph nodes, spleen, or gut of Patient 3 (not shown). These results indicate that although the T-cell receptor γ and δ chains are produced, they are not correctly assembled and transported to the cell surface in the absence of CD3δ.

Discussion

Our three patients with SCID presented with low numbers of circulating T cells and normal numbers of peripheral B cells. This phenotype is typical of SCID caused by mutations in the gene for the common gamma chain (γc), Janus kinase 3 (Jak3), or interleukin-7 receptor α (IL-7Rα).19-21 The γc and Jak3 genes are also important in the development of natural killer cells, and the numbers and function of natural killer cells are compromised in many, although not all,22,23 such cases of SCID. In SCID arising from aberrations in the IL-7Rα gene, natural killer cells are preserved.24,25 Although our patients had a phenotype in which T cells were absent and B cells and natural killer cells were present, analysis of their γc, Jak3, and IL-7Rα genes revealed no abnormality (data not shown). To define the molecular basis for the immunodeficiency in these patients, we used oligonucleotide microarray analysis of thymocytes isolated from biopsy material as a source of mRNA of T-cell lineage.

This analysis revealed a reduction in mRNA transcripts for all the chains of the CD3 complex except CD3γ, as well as in mRNA transcripts for the α and β T-cell receptor chains. Extensive biochemical studies have demonstrated that T-cell development is dependent on the function of the CD3 complex,26-30 and mice deficient in CD3γ, CD3δ, CD3ε, or CD3ζ have a variable degree of impairment of thymocyte maturation from the CD4–CD8– to the CD4+CD8+ stage.6-10 Our three patients, who had virtually no mature T cells, carried a deleterious mutation in the region of CD3δ that encodes the extracellular domain of CD3δ. The mutation, a homozygous C-to-T transition that produced a premature stop codon, resulted in a complete lack of CD3δ protein in thymocytes. Although only the CD3δ gene of the CD3 complex was found to harbor a mutation, levels of both the CD3γ and CD3ε subunits were reduced in CD3δ–/– thymocytes, and CD3ζ was undetectable by Western blotting. This pattern may reflect the normal content of CD3 subunits in very immature thymocytes.31

Precursors of the α/β T-cell lineage undergo three major stages of maturation, defined by the expression of CD4 and CD8. The earliest precursors are designated double-negative, expressing neither CD4 nor CD8. They progress to a stage of dual expression of CD4 and CD8 (double-positive) before committing to the expression of either CD4 or CD8 alone (single-positive) and leaving the thymus. The transition from the double-negative to the double-positive stage requires a productive rearrangement of the T-cell receptor β gene, followed by signaling through a complex formed by the β chain of the T-cell receptor and the invariant pTα chain.1,2 This unit noncovalently associates with the CD3 chains to signal and promote thymocyte differentiation.1-5 Subsequently, the T-cell receptor α gene rearranges to allow formation of the mature T-cell–receptor α/β complex.1,32

In our Patient 1, the increased level of pTα transcript and the absence of a T-cell–receptor β gene product in the CD3δ–/– thymocytes are consistent with the properties of immature T cells that have not rearranged the T-cell receptor α locus and therefore do not display α/β receptors. The marked reduction in CD4 and CD8 mRNA and proteins points to a developmental arrest of these immature cells at the double-negative stage of α/β T-cell maturation. Moreover, the lack of detectable γ/δ T cells indicates that the development of this lineage is also arrested in patients with CD3δ deficiency.

Supported by the Canadian Centre for Primary Immunodeficiency and by grants from the Jeffrey Modell Foundation and the Canadian Institutes of Health Research. Dr. Roifman is also supported by the Audrey and Donald Campbell Chair of Immunology at the Hospital for Sick Children at the University of Toronto.

We are indebted to Linda Quintal, Sandra Mendonca, Wilson Chan, and Dr. Chao Lu for technical assistance and assistance with manuscript preparation; and to Drs. Johanna Rommens, Michael Julius, and Nigel Sharfe for critical review of the manuscript.

Source Information

From the Divisions of Immunology and Allergy and the Infection, Immunity, Injury and Repair Program, the Research Institute and the Hospital for Sick Children, University of Toronto, Toronto.

Address reprint requests to Dr. Roifman at the Division of Immunology and Allergy and the Infection, Immunity, Injury and Repair Program, Hospital for Sick Children, 555 University Ave., Toronto, ON M5G 1X8, Canada, or at chaim.roifman@sickkids.ca.

References

References

1. 1

   von Boehmer H, Fehling HJ. Structure and function of the pre-T cell receptor. Annu Rev Immunol 1997;15:433-452
   CrossRef | Web of Science | Medline

2. 2

   Groettrup M, Ungewiss K, Azogui O, et al. A novel disulfide-linked heterodimer on pre-T cells consists of the T cell receptor beta chain and a 33 kd glycoprotein. Cell 1993;75:283-294
   CrossRef | Web of Science | Medline

3. 3

   Saint-Ruf C, Ungewiss K, Groettrup M, Bruno L, Fehling HJ, von Boehmer H. Analysis and expression of a cloned pre-T cell receptor gene. Science 1994;266:1208-1212
   CrossRef | Web of Science | Medline

4. 4

   Berger MA, Dave V, Rhodes MR, et al. Subunit composition of pre-T cell receptor complexes expressed by primary thymocytes: CD3 delta is physically associated but not functionally required. J Exp Med 1997;186:1461-1467
   CrossRef | Web of Science | Medline

5. 5

   van Oers NS, von Boehmer H, Weiss A. The pre-T cell receptor (TCR) complex is functionally coupled to the TCR-zeta subunit. J Exp Med 1995;182:1585-1590
   CrossRef | Web of Science | Medline

6. 6

   Love PE, Shores EW, Johnson MD, et al. T cell development in mice that lack the ζ chain of the T cell antigen receptor complex. Science 1993;261:918-921
   CrossRef | Web of Science | Medline

7. 7

   Malissen M, Gillet A, Rocha B, et al. T cell development in mice lacking the CD3-ζ/η gene. EMBO J 1993;12:4347-4355
   Web of Science | Medline

8. 8

   Malissen M, Gillet A, Ardouin L, et al. Altered T cell development in mice with a targeted mutation of the CD3-ε gene. EMBO J 1995;14:4641-4653
   Web of Science | Medline

9. 9

   Haks MC, Krimpenfort P, Borst J, Kruisbeek AM. The CD3γ chain is essential for development of both the TCRαβ and TCRγδ lineages. EMBO J 1998;17:1871-1882
   CrossRef | Web of Science | Medline

10. 10

    Dave VP, Cao Z, Browne C, et al. CD3δ deficiency arrests development of the αβ but not the γδ T cell lineage. EMBO J 1997;16:1360-1370
    CrossRef | Web of Science | Medline

11. 11

    Soudais C, de Villartay JP, Le Deist F, Fischer A, Lisowska-Grospierre B. Independent mutations of the human CD3-ε gene resulting in a T cell receptor/CD3 complex immunodeficiency. Nat Genet 1993;3:77-81
    CrossRef | Web of Science | Medline

12. 12

    Arnaiz-Villena A, Timon M, Corell A, Perez-Aciego P, Martin-Villa JM, Regueiro JR. Primary immunodeficiency caused by mutations in the gene encoding the CD3-γ subunit of the T-lymphocyte receptor. N Engl J Med 1992;327:529-533
    Full Text | Web of Science | Medline

13. 13

    Ammann AJ, Hong R. Disorders of the T-cell system. In: Stiehm ER, ed. Immunologic disorders in infants and children. 3rd ed. Philadelphia: W.B. Saunders, 1989:257-315.
    

14. 14

    Cheung VG, Morley M, Aguilar F, Massimi A, Kucherlapati R, Childs G. Making and reading microarrays. Nat Genet 1999;21:Suppl:15-19
    CrossRef | Web of Science | Medline

15. 15

    Lipshutz RJ, Fodor SPA, Gingeras TR, Lockhart DJ. High density synthetic oligonucleotide arrays. Nat Genet 1999;21:Suppl:20-24
    CrossRef | Web of Science | Medline

16. 16

    Frischmeyer PA, Dietz HC. Nonsense-mediated mRNA decay in health and disease. Hum Mol Genet 1999;8:1893-1900
    CrossRef | Web of Science | Medline

17. 17

    Liu HX, Cartegni L, Zhang MQ, Krainer AR. A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes. Nat Genet 2001;27:55-58
    Web of Science | Medline

18. 18

    Bank I, Reshef A, Beniaminov M, Rosenthal E, Rechavi G, Monselise Y. Role of γ/δ T cells in a patient with CD4⁺CD3^- lymphocytosis, hypereosinophilia, and high levels of IgE. J Allergy Clin Immunol 1998;102:621-630
    CrossRef | Web of Science | Medline

19. 19

    Noguchi M, Yi H, Rosenblatt HM, et al. Interleukin-2 receptor gamma chain mutation results in X-linked severe combined immunodeficiency in humans. Cell 1993;73:147-157
    CrossRef | Web of Science | Medline

20. 20

    Macchi P, Villa A, Giliani S, et al. Mutations of Jak-3 gene in patients with autosomal severe combined immune deficiency (SCID). Nature 1995;377:65-68
    CrossRef | Web of Science | Medline

21. 21

    Russell SM, Tayebi N, Nakajima H, et al. Mutation of Jak3 in a patient with SCID: essential role of Jak3 in lymphoid development. Science 1995;270:797-800
    CrossRef | Web of Science | Medline

22. 22

    Sharfe N, Shahar M, Roifman CM. An interleukin-2 receptor γ chain mutation with normal thymus morphology. J Clin Invest 1997;100:3036-3043
    CrossRef | Web of Science | Medline

23. 23

    Schmalstieg FC, Leonard WJ, Noguchi M, et al. Missense mutation in exon 7 of the common γ chain causes a moderate form of X-linked combined immunodeficiency. J Clin Invest 1995;95:1169-1173
    CrossRef | Web of Science | Medline

24. 24

    Puel A, Ziegler SF, Buckley RH, Leonard WJ. Defective IL7R expression in T(-) B(+)NK(+) severe combined immunodeficiency. Nat Genet 1998;20:394-397
    CrossRef | Web of Science | Medline

25. 25

    Roifman CM, Zhang J, Chitayat D, Sharfe N. A partial deficiency of interleukin-7Rα is sufficient to abrogate T-cell development and cause severe combined immunodeficiency. Blood 2000;96:2803-2807
    Web of Science | Medline

26. 26

    Sussman JJ, Bonifacino JS, Lippincott-Schwartz J, et al. Failure to synthesize the T-cell CD3-zeta chain: structure and function of a partial T cell receptor complex. Cell 1988;52:85-95
    CrossRef | Web of Science | Medline

27. 27

    Hall C, Berkhout B, Alarcon B, Sancho J, Wileman T, Terhorst C. Requirements for cell surface expression of the human TCR/CD3 complex in non-T cells. Int Immunol 1991;3:359-368
    CrossRef | Web of Science | Medline

28. 28

    Kappes DJ, Tonegawa S. Surface expression of alternative forms of the TCR/CD3 complex. Proc Natl Acad Sci U S A 1991;88:10619-10623
    CrossRef | Web of Science | Medline

29. 29

    Buferne M, Luton F, Letourneur F, et al. Role of CD3δ in surface expression of the TCR/CD3 complex and in activation for killing analyzed with a CD3δ-negative cytotoxic T lymphocyte variant. J Immunol 1992;148:657-664
    Web of Science | Medline

30. 30

    Wileman T, Carson GR, Concino M, Ahmed A, Terhorst C. The γ and ε subunits of the CD3 complex inhibit pre-Golgi degradation of newly synthesized T cell antigen receptors. J Cell Biol 1990;110:973-986
    CrossRef | Web of Science | Medline

31. 31

    Haynes BF, Heinly CS. Early human T cell development: analysis of the human thymus at the time of initial entry of hematopoietic stem cells into the fetal thymic microenvironment. J Exp Med 1995;181:1445-1458
    CrossRef | Web of Science | Medline

32. 32

    Carrasco YR, Navarro MN, de Yebenes VG, Ramiro AR, Toribio ML. Regulation of surface expression of the human pre-T cell receptor complex. Semin Immunol 2002;14:325-334
    CrossRef | Web of Science | Medline

Citing Articles (43)

Citing Articles

1. 1

   Rebecca H. Buckley. (2012) The long quest for neonatal screening for severe combined immunodeficiency. Journal of Allergy and Clinical Immunology
   CrossRef

2. 2

   Jennifer M. Puck. (2012) Laboratory technology for population-based screening for severe combined immunodeficiency in neonates: The winner is T-cell receptor excision circles. Journal of Allergy and Clinical Immunology
   CrossRef

3. 3

   Grace P. Yu, Kari C. Nadeau, David R. Berk, Geneviève de Saint Basile, Nathalie Lambert, Perrine Knapnougel, Joseph Roberts, Kristina Kavanau, Elizabeth Dunn, E. Richard Stiehm, David B. Lewis, Dale T. Umetsu, Jennifer M. Puck, Morton J. Cowan. (2011) Genotype, phenotype, and outcomes of nine patients with T-B+NK+ SCID. Pediatric Transplantation 15:7, 733-741
   CrossRef

4. 4

   Nufar Marcus, Hidetoshi Takada, Jason Law, Morton J. Cowan, Juana Gil, Jose R. Regueiro, Diego Plaza Lopez de Sabando, Eduardo Lopez-Granados, Jignesh Dalal, Wilhelm Friedrich, Hoenig Manfred, Imelda Celine Hanson, Eyal Grunebaum, William T. Shearer, Chaim M. Roifman. (2011) Hematopoietic stem cell transplantation for CD3δ deficiency. Journal of Allergy and Clinical Immunology 128:5, 1050-1057
   CrossRef

5. 5

   Juana Gil, Elena M. Busto, Beatriz Garcillán, Carmen Chean, Maria Cruz García-Rodríguez, Andrea Díaz-Alderete, Joaquín Navarro, Jesús Reiné, Angeles Mencía, Dolores Gurbindo, Cristina Beléndez, Isabel Gordillo, Marlena Duchniewicz, Kerstin Höhne, Félix García-Sánchez, Eduardo Fernández-Cruz, Eduardo López-Granados, Wolfgang W.A. Schamel, Miguel A. Moreno-Pelayo, María J. Recio, José R. Regueiro. (2011) A leaky mutation in CD3D differentially affects αβ and γδ T cells and leads to a Tαβ–Tγδ+B+NK+ human SCID. Journal of Clinical Investigation 121:10, 3872-3876
   CrossRef

6. 6

   Mark D. Berzsenyi, David J. Woollard, Catriona A. McLean, Scott Preiss, Victoria M. Perreau, Michael R. Beard, D. Scott Bowden, Benjamin C. Cowie, Shuo Li, Anne M. Mijch, Stuart K. Roberts. (2011) Down-regulation of intra-hepatic T-cell signaling associated with GB virus C in a HCV/HIV co-infected group with reduced liver disease. Journal of Hepatology 55:3, 536-544
   CrossRef

7. 7

   Rebecca H. Buckley. (2011) Transplantation of hematopoietic stem cells in human severe combined immunodeficiency: longterm outcomes. Immunologic Research 49:1-3, 25-43
   CrossRef

8. 8

   Chaim M. Roifman, Harjit Dadi, Raz Somech, Amit Nahum, Nigel Sharfe. (2010) Characterization of ζ-associated protein, 70 kd (ZAP70)–deficient human lymphocytes. Journal of Allergy and Clinical Immunology 126:6, 1226-1233.e1
   CrossRef

9. 9

   Daniel J.B. Marks, Craig R. Seymour, Gavin W. Sewell, Farooq Z. Rahman, Andrew M. Smith, Sara A. McCartney, Stuart L. Bloom. (2010) Inflammatory bowel diseases in patients with adaptive and complement immunodeficiency disorders. Inflammatory Bowel Diseases 16:11, 1984-1992
   CrossRef

10. 10

    Shaohua Chen, Lijian Yang, Xiaoye Lu, Bo Li, John Yeuk-Hon Chan, Dongqing Cai, Yangqiu Li. (2010) Gene expression profiling of CD3γ, δ, ε, and ζ chains in CD4<SUP>+</SUP> and CD8<SUP>+</SUP> T cells from human umbilical cord blood. Hematology 15:4, 230-235
    CrossRef

11. 11

    Rebecca H. Buckley. (2010) B-cell function in severe combined immunodeficiency after stem cell or gene therapy: A review. Journal of Allergy and Clinical Immunology 125:4, 790-797
    CrossRef

12. 12

    Vibhuti P. Dave. (2009) Hierarchical role of CD3 chains in thymocyte development. Immunological Reviews 232:1, 22-33
    CrossRef

13. 13

    (2009) Microarray Analysis of Gene Expression Affected by Water-extracts of Pinelliae rhizoma in a Hypoxic Model of Cultured Rat Cortical Cells. Journal of Life Science 19:7, 905-916
    CrossRef

14. 14

    Capucine Picard, Stéphanie Dogniaux, Karine Chemin, Zofia Maciorowski, Annick Lim, Fabienne Mazerolles, Frédéric Rieux-Laucat, Marie-Claude Stolzenberg, Marianne Debre, Jean-Paul Magny, Françoise Le Deist, Alain Fischer, Claire Hivroz. (2009) Hypomorphic mutation of ZAP70 in human results in a late onset immunodeficiency and no autoimmunity. European Journal of Immunology 39:7, 1966-1976
    CrossRef

15. 15

    Christine McCusker, Simon Hotte, Francoise Le Deist, Aaron F. Hirschfeld, David Mitchell, Van-Hung Nguyen, Remi Gagnon, Bruce Mazer, Stuart E. Turvey, Nada Jabado. (2009) Relative CD4 lymphopenia and a skewed memory phenotype are the main immunologic abnormalities in a child with Omenn syndrome due to homozygous RAG1-C2633T hypomorphic mutation. Clinical Immunology 131:3, 447-455
    CrossRef

16. 16

    Lawrence R. Shiow, Kenneth Paris, Matthew C. Akana, Jason G. Cyster, Ricardo U. Sorensen, Jennifer M. Puck. (2009) Severe combined immunodeficiency (SCID) and attention deficit hyperactivity disorder (ADHD) associated with a coronin-1A mutation and a chromosome 16p11.2 deletion. Clinical Immunology 131:1, 24-30
    CrossRef

17. 17

    Kevin A. Strauss, Erik G. Puffenberger, Nancy Bunin, Nicholas L. Rider, Mary C. Morton, James T. Eastman, D. Holmes Morton. (2008) Clinical application of DNA microarrays: Molecular diagnosis and HLA matching of an Amish child with severe combined immune deficiency. Clinical Immunology 128:1, 31-38
    CrossRef

18. 18

    Raul M. Torres, John Imboden, Harry W. Schroeder. 2008. Antigen receptor genes, gene products, and co-receptors. , 53-77.
    CrossRef

19. 19

    Raz Somech, Gino R. Somers, David Chitayat, Eyal Grunebaum, Adelle Atkinson, Elena Kolomietz, Chaim M Roifman. (2008) Fatal lung fibrosis associated with immunodeficiency and gonadal dysgenesis in 46XX sisters—A new syndrome. American Journal of Medical Genetics Part A 146A:1, 8-14
    CrossRef

20. 20

    Kellie J. Archer, Ryan V. Kimes. (2008) Empirical characterization of random forest variable importance measures. Computational Statistics & Data Analysis 52:4, 2249-2260
    CrossRef

21. 21

    Qinghai Hu, Zhiming Pan, Shovel Deen, Songshu Meng, Xueyu Zhang, Xiaoyan Zhang, Xin-an Jiao. (2007) New alleles of chicken CD8α and CD3d found in Chinese native and western breeds. Veterinary Immunology and Immunopathology 120:3-4, 223-233
    CrossRef

22. 22

    Marina Cavazzana-Calvo, Alain Fischer. (2007) Gene therapy for severe combined immunodeficiency: are we there yet?. Journal of Clinical Investigation 117:6, 1456-1465
    CrossRef

23. 23

    Punita Ponda, Susan J. Schuval, Blanka Kaplan, Peter Logalbo, Joseph L. Roberts, Vincent R. Bonagura. (2006) Interleukin 7 receptor α-chain-mutation severe combined immunodeficiency without lymphopenia: correction with haploidentical T-cell–depleted bone marrow transplantation. Annals of Allergy, Asthma & Immunology 97:6, 755-758
    CrossRef

24. 24

    E.A.J. Thomassen, E.H.A. Dekking, A. Thompson, K.L. Franken, Ö. Sanal, J.P. Abrahams, M.J.D. van Tol, F. Koning. (2006) The Impact of Single Amino Acid Substitutions in CD3γ on the CD3ϵγ Interaction and T-Cell Receptor–CD3 Complex Formation. Human Immunology 67:8, 579-588
    CrossRef

25. 25

    Jessica M. Lindvall, K. Emelie M. Blomberg, Anna Berglöf, C.I. Edvard Smith. (2006) Distinct gene expression signature in Btk-defective T1 B-cells. Biochemical and Biophysical Research Communications 346:2, 461-469
    CrossRef

26. 26

    Rieux-Laucat, Frédéric, Hivroz, Claire, Lim, Annick, Mateo, Véronique, Pellier, Isabelle, Selz, Françoise, Fischer, Alain, Le Deist, Françoise, . (2006) Inherited and Somatic CD3ζ Mutations in a Patient with T-Cell Deficiency. New England Journal of Medicine 354:18, 1913-1921
    Full Text

27. 27

    Alain Fischer, Geneviève de Saint Basile, Françoise Le Deist. (2005) CD3 deficiencies. Current Opinion in Allergy and Clinical Immunology 5:6, 491-495
    CrossRef

28. 28

    Charlotte Cunningham-Rundles, Prashant P. Ponda. (2005) Molecular defects in T- and B-cell primary immunodeficiency diseases. Nature Reviews Immunology 5:11, 880-892
    CrossRef

29. 29

    C. R. Weiler, J. L. Bankers-Fulbright. (2005) Common Variable Immunodeficiency: Test Indications and Interpretations. Mayo Clinic Proceedings 80:9, 1187-1200
    CrossRef

30. 30

    Francisco A. Bonilla, I. Leonard Bernstein, David A. Khan, Zuhair K. Ballas, Javier Chinen, Michael M. Frank, Lisa J. Kobrynski, Arnold I. Levinson, Bruce Mazer, Robert P. Nelson, Jordan S. Orange, John M. Routes, William T. Shearer, Ricardo U. Sorensen. (2005) Practice parameter for the diagnosis and management of primary immunodeficiency. Annals of Allergy, Asthma & Immunology 94:5, S1-S63
    CrossRef

31. 31

    Hidetoshi Takada, Akihiko Nomura, Chaim M. Roifman, Toshiro Hara. (2005) Severe combined immunodeficiency caused by a splicing abnormality of the CD3? gene. European Journal of Pediatrics 164:5, 311-314
    CrossRef

32. 32

    Floor Weerkamp, Edwin F.E. de Haas, Brigitta A.E. Naber, W. Marieke Comans-Bitter, Ad J.J.C. Bogers, Jacques J.M. van Dongen, Frank J.T. Staal. (2005) Age-related changes in the cellular composition of the thymus in children. Journal of Allergy and Clinical Immunology 115:4, 834-840
    CrossRef

33. 33

    Chaim M Roifman. (2005) Studies of patients' thymi aid in the discovery and characterization of immunodeficiency in humans. Immunological Reviews 203:1, 143-155
    CrossRef

34. 34

    Alain Fischer, Francoise Le Deist, Salima Hacein-Bey-Abina, Isabelle Andre-Schmutz, Genevieve de Saint Basile, Jean-Pierre de Villartay, Marina Cavazzana-Calvo. (2005) Severe combined immunodeficiency. A model disease for molecular immunology and therapy. Immunological Reviews 203:1, 98-109
    CrossRef

35. 35

    Kee Chan, Jennifer M. Puck. (2005) Development of population-based newborn screening for severe combined immunodeficiency. Journal of Allergy and Clinical Immunology 115:2, 391-398
    CrossRef

36. 36

    Chaim M Roifman. (2004) CD3δ immunodeficiency. Current Opinion in Allergy and Clinical Immunology 4:6, 479-484
    CrossRef

37. 37

    Rebecca H. Buckley. (2004) The multiple causes of human SCID. Journal of Clinical Investigation 114:10, 1409-1411
    CrossRef

38. 38

    Geneviève de Saint Basile, Frédéric Geissmann, Elisabeth Flori, Béatrice Uring-Lambert, Claire Soudais, Marina Cavazzana-Calvo, Anne Durandy, Nada Jabado, Alain Fischer, Françoise Le Deist. (2004) Severe combined immunodeficiency caused by deficiency in either the δ or the ε subunit of CD3. Journal of Clinical Investigation 114:10, 1512-1517
    CrossRef

39. 39

    A. M. HOLM, E. A. SIVERTSEN, S. H. TUNHEIM, T. HAUG, V. BJERKELI, A. YNDESTAD, P. AUKRUST, S. S. FROLAND. (2004) Gene expression analysis of peripheral T cells in a subgroup of common variable immunodeficiency shows predominance of CCR7- effector-memory T cells. Clinical and Experimental Immunology 138:2, 278-289
    CrossRef

40. 40

    Laura M. Moore, Melinda Rathkopf, Diane C. Napoli. (2004) Severe Combined Immunodeficiency: A Case Report and Literature Review. Pediatric Asthma, Allergy & Immunology 17:3, 216-225
    CrossRef

41. 41

    Javier Chinen, William T Shearer. (2004) Advances in Asthma, Allergy and Immunology Series 2004: Basic and clinical immunology. Journal of Allergy and Clinical Immunology 114:2, 398-405
    CrossRef

42. 42

    Rebecca H. Buckley. (2004) M olecular D efects in H uman S evere C ombined I mmunodeficiency and A pproaches to I mmune R econstitution. Annual Review of Immunology 22:1, 625-655
    CrossRef

43. 43

    Fischer, Alain, . (2003) Have We Seen the Last Variant of Severe Combined Immunodeficiency?. New England Journal of Medicine 349:19, 1789-1792
    Full Text