Original Article
A Novel Coronavirus Associated with Severe Acute Respiratory Syndrome
N Engl J Med 2003; 348:1953-1966May 15, 2003
- Abstract
Background
A worldwide outbreak of severe acute respiratory syndrome (SARS) has been associated with exposures originating from a single ill health care worker from Guangdong Province, China. We conducted studies to identify the etiologic agent of this outbreak.
Methods
We received clinical specimens from patients in seven countries and tested them, using virus-isolation techniques, electron-microscopical and histologic studies, and molecular and serologic assays, in an attempt to identify a wide range of potential pathogens.
Results
None of the previously described respiratory pathogens were consistently identified. However, a novel coronavirus was isolated from patients who met the case definition of SARS. Cytopathological features were noted in Vero E6 cells inoculated with a throat-swab specimen. Electron-microscopical examination revealed ultrastructural features characteristic of coronaviruses. Immunohistochemical and immunofluorescence staining revealed reactivity with group I coronavirus polyclonal antibodies. Consensus coronavirus primers designed to amplify a fragment of the polymerase gene by reverse transcription–polymerase chain reaction (RT-PCR) were used to obtain a sequence that clearly identified the isolate as a unique coronavirus only distantly related to previously sequenced coronaviruses. With specific diagnostic RT-PCR primers we identified several identical nucleotide sequences in 12 patients from several locations, a finding consistent with a point-source outbreak. Indirect fluorescence antibody tests and enzyme-linked immunosorbent assays made with the new isolate have been used to demonstrate a virus-specific serologic response. This virus may never before have circulated in the U.S. population.
Conclusions
A novel coronavirus is associated with this outbreak, and the evidence indicates that this virus has an etiologic role in SARS. Because of the death of Dr. Carlo Urbani, we propose that our first isolate be named the Urbani strain of SARS-associated coronavirus.
Media in This Article
Figure 1
Vero E6 cells Inoculated with Oropharyngeal Specimens from Patients with SARS.Figure 2
Ultrastructural Characteristics of SARS-Associated Coronavirus Grown in Vero E6 Cells.Article Activity
- Article
In late 2002, cases of life-threatening respiratory disease with no identifiable cause were reported from Guangdong Province, China; they were followed by reports from Vietnam, Canada, and Hong Kong of severe febrile respiratory illness that spread to household members and health care workers. The syndrome was designated “severe acute respiratory syndrome” (SARS) in March 2003,1-5 and global efforts to understand the cause of this illness and prevent its spread were instituted in March 2003. Many cases can be linked through chains of transmission to a health care worker from Guangdong Province, China, who visited Hong Kong, where he was hospitalized with SARS and died. Clinical specimens from patients meeting the case definition of SARS were sent to the Centers for Disease Control and Prevention (CDC) by collaborators in Vietnam, Singapore, Thailand, Hong Kong, Canada, Taiwan, and the United States as part of the etiologic investigation. In this report, we describe the efforts of the CDC to detect a wide range of possible etiologic agents for this disease outbreak, and we describe the identification and initial characterization of a novel coronavirus associated with cases of SARS.
Methods
General Approach
The nonspecific nature of the clinical presentation of patients with SARS and the urgency of finding a cause required that clinical specimens be tested rapidly for a broad range of viral, bacterial, chlamydial, and rickettsial agents (the CDC case definition of SARS is available as Supplementary Appendix 1 with the full text of this article at http://www.nejm.org). Laboratory testing focused foremost on known respiratory pathogens, especially those that might specifically target the lower respiratory tract through the progression of disease. A combination of traditional methods was applied, including virus isolation in suckling mice and cell culture, electron microscopy, histopathological examination, serologic analysis, and general and specialized bacterial culture techniques. The molecular techniques of polymerase chain reaction (PCR), reverse-transcription PCR (RT-PCR), and real-time PCR were used. Priority was given to testing for the following agents: yersinia, mycoplasma, chlamydia, legionella, Coxiella burnetii, spotted fever and typhus group rickettsiae, influenzaviruses A and B, Paramyxovirinae and Pneumovirinae subfamily viruses (specifically, human respiratory syncytial virus and human metapneumovirus), Mastadenoviridae, Herpetoviridae, Picornaviridae, Old and New World hantaviruses, and Old World arenaviruses.
Biosafety
Given the serious nature of SARS and the suggestion of person-to-person transmission, it was decided to handle all clinical specimens in a biosafety level 3 environment. All division into aliquots, pipetting, and culture attempts were performed in laminar-flow safety cabinets in a biosafety level 3 laboratory. Serum specimens that were tested serologically outside the laboratory were exposed to 60Co gamma irradiation at 2×106 rad while frozen on dry ice. Initial division into aliquots, handling, and culturing were undertaken in a biosafety level 3 laboratory area in which no culturing of known viruses is done. A similar environment was used when specimens from which nucleic acid was to be extracted were placed in a solution of chaotropic salts; after this step, the specimens were removed to other areas for completion of the extraction protocols.
Isolation of Virus
To identify viruses associated with SARS, we inoculated a variety of clinical specimens (blood, serum, material from oropharyngeal swabs or washings, material from nasopharyngeal swabs, and tissues of major organs collected at autopsy) onto a number of continuous cell lines, including Vero E6, NCI-H292, MDCK, LLC-MK2, and B95-8 cells, and into suckling ICR mice by the intracranial and intraperitoneal routes. All cultures were observed daily for cytopathic effect. Maintenance medium was replenished at day 7, and cultures were terminated 14 days after inoculation. Any cultures exhibiting identifiable cytopathic effect were subjected to several procedures to identify the cause of the effect. Suckling mice were observed daily for 14 days, and we further tested any sick or dead mice by preparing a brain suspension that was filtered and subcultured. Mice that remained well after 14 days were euthanized, and their test results were recorded as negative. Tissue-culture samples showing cytopathic effect were prepared for electron-microscopical examination. Negative-stain electron-microscopical specimens were prepared by drying culture supernatant, mixed 1:1 with 2.5 percent paraformaldehyde, onto Formvarcarbon-coated grids and staining with 2 percent methylamine tungstate. Thin-section electron-microscopical specimens were prepared by fixing a washed cell pellet with 2.5 percent glutaraldehyde and embedding it in epoxy resin. For RT-PCR assays, cell-culture supernatants were placed in lysis buffer. In addition, a master seed was prepared from the remaining culture supernatant and cells by freeze-thawing the culture flask, clarifying the thawed contents by centrifugation at 1000×g, and dispensing the supernatant into aliquots stored in gas phase over liquid nitrogen. The master seed was subcultured into 850-cm2 roller bottles of Vero E6 cells for the preparation of formalin-fixed positive control cells for immunohistochemical analysis, mixed with normal E6 cells, and gamma-irradiated for preparation of spot slides for indirect fluorescence antibody tests or extracted with detergent and gamma-irradiated for use as an enzyme-linked immunosorbent assay (ELISA) antigen for antibody tests.
Serologic Analysis
Spot slides were prepared by applying 15 μl of the suspension of gamma-irradiated mixed infected and noninfected cells onto 12-well Teflon-coated slides. Slides were allowed to air dry before being fixed in acetone. Slides were then stored at –70°C until used for indirect fluorescence antibody tests.6 An ELISA antigen was prepared by detergent extraction of infected Vero E6 cells and subsequent gamma irradiation.7 The optimal dilution (1:1000) for the use of this antigen was determined by checkerboard titration against serum from a patient with SARS in the convalescent phase; a control antigen, similarly prepared from uninfected Vero E6 cells, was used to control for specific reactivity of tested serum. The conjugates used were goat antihuman IgG, IgA, and IgM conjugated to fluorescein isothiocyanate and horseradish peroxidase (Kirkegaard and Perry), for the indirect fluorescence antibody test and ELISA, respectively. Specificity and cross-reactivity of a variety of serum samples to the newly identified virus were evaluated by using the tests described above. For this evaluation, we used serum from patients with SARS in Singapore, Bangkok, and Hong Kong and serum from healthy blood donors from the CDC serum bank and from persons infected with known human coronaviruses (human coronaviruses OC43 and 229E) (samples provided by E. Walsh and A. Falsey, University of Rochester School of Medicine and Dentistry, Rochester, N.Y.).
Pathological and Immunohistochemical Studies
Formalin-fixed, paraffin-embedded Vero E6 cells infected with the novel coronavirus and tissues obtained from patients with SARS were stained with hematoxylin and eosin and various immunohistochemical stains. Immunohistochemical assays were based on a method described previously for hantavirus.8 In brief, 4-μm sections were deparaffinized, rehydrated, and digested in Proteinase K for 15 minutes. Slides were then incubated for 60 minutes at room temperature with monoclonal antibodies, polyclonal antiserum, or ascitic fluids derived from animal species with reactivities to various known coronaviruses, and with a convalescent-phase serum specimen from a patient with SARS.
Optimal dilutions of the primary antibodies were determined by titration experiments with cells infected with the new coronavirus and with noninfected cells or, when available, with concentrations recommended by the manufacturers. After sequential application of the appropriate biotinylated link antibody, avidin–alkaline phosphatase complex, and naphthol–fast red substrate, sections were counterstained in Mayer's hematoxylin and mounted with aqueous mounting medium. We used the following antibody and tissue controls: serum specimens from noninfected animals, various coronavirus-infected cell cultures and animal tissues, noninfected cell cultures, and normal human and animal tissues. Tissues from patients were also tested by immunohistochemical assays for various other viral and bacterial pulmonary pathogens. In addition, a bronchoalveolar-lavage specimen was available from one patient with SARS for thin-section electron-microscopical evaluation.
Molecular Analyses
RNA extracts were prepared from 100 μl of each specimen (or culture supernatant) with the automated NucliSens extraction system (bioMérieux). Oligonucleotide primers used for amplification and sequencing of the SARS-related coronavirus were designed from alignments of open reading frame 1b of the coronavirus polymerase gene sequences obtained from GenBank, including human coronaviruses 229E and OC43 (accession numbers X69721 and AF124989, respectively), canine coronavirus (AF124986), feline infectious peritonitis virus (AF124987), porcine transmissible gastroenteritis virus (Z34093), porcine epidemic diarrhea virus (NC_003436), bovine coronavirus (NC_003045), porcine hemagglutinating encephalomyelitis virus (AF124988), sialodacryoadenitis virus (AF124990), mouse hepatitis virus (NC_001846), turkey coronavirus (AF124991), and avian infectious bronchitis virus (NC_001451). Primer pair IN-2 (+) 5'GGGTT-GGGACTATCCTAAGTGTGA3' and IN-4 (–) 5'TAACACACAACICCATCATCA3' was previously designed to conserved regions of open reading frame 1b to achieve broad reactivity with the genus coronavirus. These primers were used to amplify DNA from SARS isolates, and the amplicon sequences obtained were used to design SARS-specific primers Cor-p-F2 (+) 5'CTAACATGCTTAGGATAATGG3', Cor-p-F3 (+) 5'GCCTCTCTTGTTCTTGCTCGC3', and Cor-p-R1 (–) 5'CAGGTAAGCGTAAAACTCATC3', which were used in turn to test patient specimens. Primers used for specific amplification of human metapneumovirus have been described previously.9 Well-characterized primer sets for other respiratory virus pathogens (unpublished data), including human respiratory syncytial virus, parainfluenzaviruses 1, 2, and 3, influenzaviruses A and B, adenovirus, and picornavirus (rhinovirus and enterovirus), were also used to test clinical specimens in this study (primers available on request). All specimens were tested for human glyceraldehyde-3-phosphate dehydrogenase to confirm RNA integrity and control for RT-PCR inhibition.
One primer for each set was 5'-end-labeled with fluorescent dye 6-carboxyfluorescein (6-FAM) to facilitate GeneScan analysis. One-step amplification reactions were performed with the Access RT-PCR System (Promega) as previously described.9 Positive and negative RT-PCR controls, containing standardized viral RNA extracts, and nuclease-free water were included in each run. Amplified 6-FAM–labeled products were analyzed by capillary electrophoresis on an ABI 3100 Prism Genetic Analyzer with GeneScan software (version 3.1.2). Specimens were considered positive for SARS-associated coronavirus if the amplification products were within 1 nucleotide of the expected product size (368 nucleotides for Cor-p-F2 or Cor-p-R1 and 348 nucleotides for Cor-p-F3 or Cor-p-R1) for both specific primer sets, as confirmed by a second PCR reaction from another aliquot of RNA extract in a separate laboratory. Where DNA yield was sufficient, the amplified products were also sequenced. The microarray used in this study was an expanded version of an array previously described.10,11
For sequencing, amplicons were purified with ExoSAP-IT (USB). Both strands of unlabeled products (or one strand of the 6-FAM–labeled products) were sequenced on an ABI PRISM 3100 Genetic Analyzer with use of a fluorescent dye-terminator kit (ABI). The nucleotide sequences were edited with Sequencher for Power Macintosh (version 3.1.1, Gene Codes). The partial nucleotide sequences of the polymerase gene were aligned with published coronavirus sequences, using CLUSTAL W for Unix (version 1.7).12 Phylogenetic trees were computed by maximum parsimony, distance, and maximum likelihood–based criteria analysis with PAUP (version 4.0.d10).13
Results
Virus Isolation
Two cell lines, Vero E6 cells and NCI-H292 cells, inoculated with oropharyngeal specimens from Patient 16 (a 46-year-old male physician with an epidemiologic link to a hospital with multiple patients with SARS) initially showed cytopathic effect (Table 1Table 1
Specimens from Patients with SARS That Were Positive for SARS-Associated Coronavirus by One or More Methods.). Blood, nasopharyngeal, and throat-swab specimens were collected on March 12, day 1 after onset. At that time, the patient's physical examination was normal except for fever and shortness of breath. During the course of the disease, his status worsened, and he died. A rhinovirus was isolated from the inoculated NCI-H292 cells. Further study suggested that this virus was not associated with patients with SARS, so it will not be discussed here.Cytopathic effect in the Vero E6 cells was first noted on the fifth post-inoculation day. The cytopathic effect was focal, with cell rounding and a refractive appearance in the affected cells (Figure 1Figure 1
Vero E6 cells Inoculated with Oropharyngeal Specimens from Patients with SARS.) that was soon followed by cell detachment. The cytopathic effect quickly spread to involve the entire cell monolayer within 24 to 48 hours. Subculture of material after preparation of a master seed resulted in the rapid appearance of cytopathic effect, as noted above, and in complete destruction of the monolayer in the inoculated flasks within 48 hours. Similar cytopathic effect has since been noted in four additional cultures: three cultures of respiratory specimens (two oropharyngeal washes and one sputum specimen) and one culture of a suspension of kidney tissue obtained at autopsy. In these specimens, the initial cytopathic effect was observed between day 2 and day 4 and, as noted above, the cytopathic effect rapidly progressed to involve the entire cell monolayer.Examination of cytopathic-effect–positive Vero E6 cells by thin-section electron microscopy revealed characteristic coronavirus particles within the cisternae of the rough endoplasmic reticulum and in vesicles (Figure 2AFigure 2
Ultrastructural Characteristics of SARS-Associated Coronavirus Grown in Vero E6 Cells.).14,15 Extracellular particles were found in large clusters and adhering to the surface of the plasma membrane. Negative-stain electron microscopy identified coronavirus particles, 80 to 140 nm in diameter, with 20-to-40-nm complex surface projections surrounding the periphery (Figure 2B). Hemagglutinin esterase-type glycoprotein projections were not seen.Molecular Analysis
A 405-nucleotide segment of the coronavirus polymerase gene open reading frame 1b was amplified from the isolation material by RT-PCR with the broadly reactive primer set IN-2–IN-4. In contrast, this primer set produced no specific band against uninfected cells.
When compared with other human and animal coronaviruses, the nucleotide and deduced amino acid sequence from this region had similarity scores ranging from 0.56 to 0.63 and from 0.57 to 0.74, respectively. The highest sequence similarity was obtained with group II coronaviruses. The maximum-parsimony tree obtained from the nucleotide-sequence alignment is shown in Figure 3Figure 3
Estimated Maximum-Parsimony Tree Based on the Sequence Alignment of 405 Nucleotides of the Coronavirus Polymerase Gene Open Reading Frame 1b (Nucleotide Numbers 15173 to 15578 Based on Bovine Coronavirus Complete Genome Accession Number NC_003045) Comparing SARS Coronavirus with Other Human and Animal Coronaviruses.. Bootstrap analyses of the internal nodes at the internal branches of the tree provided strong evidence that the SARS-associated coronavirus is genetically distinct from other known coronaviruses. The microarray analyses from infected and uninfected cell cultures gave a positive signal for a group of eight oligonucleotides derived from two virus families: Coronaviridae and Astroviridae. All of the astroviruses and two of the coronavirus oligonucleotides share a consensus sequence motif that maps to the extreme 3' end of astroviruses and two members of the coronavirus family: avian infectious bronchitis and turkey coronavirus.16 Results were consistent with the identity of the isolate as a coronavirus.Immunohistochemical and Histopathological Analysis and Electron-Microscopical Analysis of Bronchoalveolar-Lavage Fluid
Lung tissues were obtained at autopsy from three patients and by open-lung biopsy in one patient, 14 to 19 days after the onset of SARS. Confirmatory laboratory evidence of infection with coronavirus was available for two patients (Patients 6 and 17) and included PCR amplification of coronavirus nucleic acids from tissues, viral isolation from bronchoalveolar-lavage fluid, or detection of serum antibodies reactive with coronavirus (Table 1). For two patients, no samples were available for molecular, cell-culture, or serologic analysis; however, the condition of both patients met the CDC definition of probable SARS, and both had strong epidemiologic links with laboratory-confirmed cases of SARS. Histopathological evaluation of lung tissues from the four patients showed diffuse alveolar damage at various levels of progression and severity. Changes included hyaline-membrane formation, interstitial mononuclear inflammatory infiltrates, and desquamation of pneumocytes in alveolar spaces (Figure 4AFigure 4
Histopathological Evaluation of Lung Tissue from a Patient with SARS and Immunohistochemical Staining of Vero E6 Culture Cells Infected with SARS-Associated Coronavirus.). Other findings identified in some patients included focal intraalveolar hemorrhage, necrotic inflammatory debris in small airways, and organizing pneumonia. Multinucleated syncytial cells were identified in the intraalveolar spaces of two patients who died 14 and 17 days after onset of illness. These cells contained abundant vacuolated cytoplasm with cleaved and convoluted nuclei. No obvious intranuclear or intracytoplasmic viral inclusions were identified (Figure 4B), and electron-microscopical examination of a limited number of these syncytial cells revealed no coronavirus particles. No definitive immunostaining was identified in tissues from SARS patients with the use of a battery of immunohistochemical stains reactive with coronaviruses from antigenic groups I, II, and III. In addition, no staining of patient tissues was identified with the use of immunohistochemical stains for influenzaviruses A and B, adenoviruses, Hendra and Nipah viruses, human metapneumovirus, respiratory syncytial virus, measles virus, Mycoplasma pneumoniae, and Chlamydia pneumoniae.Evaluation of Vero E6 cells infected with coronavirus isolated from a patient with SARS revealed viral cytopathic effect that included occasional multinucleated syncytial cells but no obvious viral inclusions (Figure 4C). Immunohistochemical assays with various antibodies reactive with coronaviruses from antigenic group I, including human coronavirus 229E, feline infectious peritonitis virus 1, and porcine transmissible gastroenteritis virus, and with an immune serum specimen from a patient with SARS demonstrated strong cytoplasmic and membranous staining of infected cells (Figure 4C and Table 2Table 2
Immunohistochemical Reactivities of Various Polyclonal Group I Anti-Coronavirus Reference Antiserum Samples with a Coronavirus Isolated from a Patient with SARS and with Selected Antigenic Group I Coronaviruses.); however, cross-reactivity with the same immune human serum sample and feline infectious peritonitis virus 1 antigen was not observed. No staining was identified with any of several monoclonal or polyclonal antibodies reactive with coronaviruses in antigenic group II (human coronavirus OC43, bovine coronavirus, and mouse hepatitis virus) or group III (turkey coronavirus and avian infectious bronchitis virus). Electron-microscopical examination of bronchoalveolar-lavage fluid from one patient revealed many coronavirus-infected cells (Figure 5Figure 5
Ultrastructural Characteristics of a Coronavirus-Infected Cell in Bronchoalveolar-Lavage Fluid from a Patient with SARS, with Numerous Intracellular and Extracellular Particles.).Serologic Analysis
Spot slides with infected cells reacted with serum from patients with probable SARS in the convalescent phase. Screening of a panel of serum from patients with suspected SARS from Hong Kong, Bangkok, Singapore, and the United States showed a high level of specific reaction with infected cells and conversion from negative to positive reactivity or diagnostic rises in the indirect fluorescence antibody test by a factor of four. Similarly, tests of these same serum samples with the ELISA antigen showed high specific signal in the convalescent-phase samples and conversion from negative to positive antibody reactivity or diagnostic increases in titer (Table 3Table 3
Results of Serologic Testing with Both Indirect Fluorescence Antibody (IFA) Test and Indirect Enzyme-Linked Immunosorbent Assay (ELISA) in Patients with SARS Tested against a Newly Isolated Coronavirus (200300592).). Information from the limited number of samples tested thus far suggests that antibody is first detectable in these two tests between one and two weeks after the onset of symptoms in the patient. Indirect fluorescence antibody testing and ELISA of a panel of 384 randomly selected serum samples (from U.S. blood donors) were negative for antibodies to the new coronavirus, with the exception of 1 specimen that had minimal reactivity on ELISA. A panel of paired human serum samples with diagnostic increases (by a factor of four or more) in antibody (with very high titers to the homologous viral antigen in the convalescent-phase serum) to the two known human coronaviruses, OC43 (13 pairs) and 229E (14 pairs), showed no reactivity in either acute- or convalescent-phase serum with the newly isolated coronavirus by either the indirect fluorescence antibody test or the ELISA.Patients
Nineteen patients with SARS have been identified as infected with the new coronavirus by virus isolation, RT-PCR, or serologic tests; all have direct or indirect links to the SARS outbreak in Hong Kong or Guangdong Province, China (Table 1). We were able to amplify by RT-PCR and obtain the virus sequence from clinical specimens or virus isolates from 12 of these patients. All 12 sequences were identical to those of the first isolate as noted above. For four convalescent patients, infection was detected serologically alone; for nine patients it was detected by RT-PCR alone; for three by virus isolation and RT-PCR; for two by virus isolation, RT-PCR, and serologic analysis; and for one by RT-PCR and serologic analysis. We found none of the coronavirus-infected patients to be infected with human metapneumovirus. In only one patient was both SARS coronavirus and another respiratory virus detected; Patient 16 had both SARS coronavirus and a rhinovirus. A variety of respiratory pathogens were also identified by RT-PCR in other patients whose samples were submitted for SARS testing, including 5 with human metapneumoviruses (sequencing showed that each was distinct) and 12 with rhinoviruses (sequencing showed that each was distinct). None of the patients who were positive for human metapneumovirus had pneumonia.
Discussion
The isolation of a novel coronavirus from the respiratory secretions of a patient with SARS and the subsequent demonstration of this virus or a serologic response to this virus in others with SARS demonstrate an etiologic association between this virus and SARS. The discovery of this new virus occurred through a broad-based and multidisciplinary effort by clinical, epidemiologic, and laboratory investigators and speaks to the power of a global collaborative effort to address the ever-present threat of emerging infectious diseases.17
The three known groups of coronavirus are associated with a variety of diseases of humans and domestic animals, including gastroenteritis and upper and lower respiratory tract disease. Although the known human coronaviruses are associated with a mild disease (the common cold), the ability of coronavirus of animals to cause severe disease raises the possibility that coronavirus could also cause more severe disease in humans. Other than rare instances in children or immunocompromised patients, it appears that the SARS-related coronavirus may be the first example of a coronavirus that causes severe disease in humans. The novel human coronavirus identified in this study shares antigenic features with various group I coronaviruses, but genetic comparisons suggest it is distinct from group I coronaviruses and from coronaviruses in groups II and III. The factor or factors responsible for this apparent dichotomy remain to be elucidated; however, correlation between antigenic and genetic characteristics of these viruses is occasionally unclear, and the placement of some other human coronaviruses within specific antigenic groups has not always been well defined.18-20
The identification of this novel coronavirus relied on classic tissue-culture isolation to amplify the pathogen and then on electron-microscopical studies to identify the type of virus, a member of the family Coronaviridae, and molecular studies to confirm the identity of the virus, characterize its unique nature, and help link it to the disease. The discovery of this new virus underscores the importance of versatile techniques such as virus isolation and electron microscopy in identifying etiologic pathogens. As with previous outbreak investigations, electron microscopy proved to be a rapid technique that did not require specific reagents for or prior knowledge of a particular agent but that could nevertheless categorize a pathogen on the basis of its appearance and morphogenesis.21-24
In this report, we describe infection in 19 SARS patients with well-defined direct or indirect epidemiologic links either to the outbreak in Hong Kong or to Guangdong Province, China, the origin of the index patient in Hong Kong. As expected with a point-source outbreak, the sequences from a limited region of the polymerase gene are identical. Coronaviruses with identical sequences have also been detected in patients with SARS in Canada.5 The virus was found in multiple specimens, including lung and kidney tissue extracts by virus isolation or RT-PCR, bronchoalveolar-lavage specimens by electron microscopy and PCR, and sputum or upper respiratory tract swab, aspirate, or wash specimens by RT-PCR or virus isolation. Although we tested specimens from the coronavirus-positive patients for a variety of other respiratory pathogens, including human metapneumovirus, by RT-PCR, none were detected in these coronavirus-positive patients except for a rhinovirus in Patient 16. The relation between this novel coronavirus and disease is further evidenced by detection of virus in lung tissue and a bronchoalveolar-lavage specimen, thus placing the virus at the site of diseased tissue. We were not, however, able to demonstrate coronavirus antigens in patient tissues by histologic and immunohistochemical methods or to demonstrate a direct involvement in the pathologic process. Neither were we able to demonstrate SARS-associated coronavirus infection in all suspected patients with SARS.
Possible reasons for the inability to demonstrate infection in some patients with suspected SARS include the lack of sufficient sensitivity of the assays to detect the pathogen and the immune response and the timing and type of specimens tested. For example, we have not yet received convalescent-phase serum specimens from many patients with suspected SARS and have not serologically ruled out infection in many such patients. In addition, we are just beginning to study the type and timing of clinical specimens most likely to support a diagnosis of infection with this new virus. We have made rapid progress in developing our diagnostic assays and are continuing to improve them for the detection of this virus or an immune response to it. In addition, the case definition of SARS is very broad and most likely includes other infectious diseases. We are also continuing to test for other infectious agents that might be associated with SARS, including those that might contribute to the severity of disease or increase the efficiency of viral transmission. Further clinical analysis of patients with SARS in whom there is laboratory confirmation of infection with the new coronavirus might help refine the case definition further.
The apparent lack of antibody in all serum specimens except those from patients with SARS suggests that this virus has not previously circulated in humans. Certainly, it has not circulated widely in humans, which is further evidence of an association between infection with this novel coronavirus and SARS. Presumably, this virus originated in animals and mutated or recombined in a fashion that permitted it to infect, cause disease, and pass from person to person. The available sequence data for this novel coronavirus suggest that it is distinct from those previously reported in animals and humans and that the parent virus has not yet been discovered. The isolation and growth of a human-derived coronavirus in Vero E6 cells were unexpected. The only human or animal coronavirus that has been shown to grow in Vero cells is porcine epidemic diarrhea virus (isolated in China from pigs), and it requires the addition of trypsin to culture medium for growth in Vero E6 cells.25 However, like the sequences of the other known coronaviruses, the sequences for porcine epidemic diarrhea virus are distinct from those of SARS-associated coronavirus, indicating that porcine epidemic diarrhea virus is not the parent virus to this new coronavirus. Because of the death of Dr. Carlo Urbani during the investigation, we propose that our first isolate be named the Urbani strain of SARS-associated coronavirus.
Pathological studies in patients who died with SARS show diffuse alveolar damage as the most notable feature, a finding consistent with the severe respiratory illness seen in some patients with SARS. The primary histopathological lesions seen in the lungs of four patients we studied are consistent with a nonspecific response to acute lung injury that can be caused by infectious agents, trauma, drugs, or toxic chemicals. However, the multinucleated syncytial cells without viral inclusions seen in the lungs of two patients, including one patient positive by PCR, serologic, and virus-isolation methods, are suggestive of a number of viral infections, including measles and parainfluenzavirus, respiratory syncytial virus, and Nipah virus infection. Syncytia have occasionally been observed in culture cells inoculated with other group I and II coronaviruses that infect humans,26-28 but they are more often described in culture cells infected with animal coronaviruses.29-31 To our knowledge, syncytial cells have not been previously described in human tissues infected with coronaviruses.
We did not detect antigens of viruses associated with syncytial formation or SARS-associated coronavirus in these patient tissues, despite the severe pulmonary pathological processes. To detect this novel coronavirus antigen, we used an extensive panel of antibodies against coronaviruses representative of the three antigenic groups. The failure of these antiserum specimens to react with coronavirus antigens in the lung tissues of these patients could be attributed to clearance of viral antigens by the host immune response during the late stage of disease. The tissues of the four patients evaluated by immunohistochemical assays were obtained approximately two to three weeks into the course of the illness. For many viral infections, viral antigens and nucleic acids are cleared within two weeks of disease onset.8,32 It is also possible that the pulmonary damage associated with SARS is not caused directly by the virus but represents a secondary effect of cytokines or other factors induced by viral infection proximal to but not within the lung tissue. In influenzavirus infections, viral antigens are seen predominantly in respiratory epithelial cells of large airways and are only rarely identified in pulmonary parenchyma, despite concomitant and occasionally severe interstitial pneumonitis.33
The clinical virology of this new disease is obviously in its infancy, and there is much to be learned about the behavior of the pathogen in the human host. For example, patterns of viral shedding, including timing and site, and the timing and characteristics of the host immune response, when defined, will help us understand disease transmission, infection-control practices, and strategies for developing vaccines. The CDC, in conjunction with other groups, is planning epidemiologic studies to address these and a wide range of other issues including risk factors for infection and severe disease and the efficacy of infection-control measures. These types of studies should help us refine and focus our efforts to control and treat SARS.
The investigation of the SARS outbreak serves as a positive template for laboratory and epidemiologic response to possible future infectious-disease pandemics. The rapid isolation and characterization of the novel coronavirus associated with SARS have allowed for the timely development of diagnostic tests that should aid our ability to understand the epidemiology of SARS and its prevention. Early recognition of this novel coronavirus has also made it possible to investigate antiviral compounds promptly and to begin developing vaccines. The speed with which this novel coronavirus was detected, characterized, and linked to SARS is a tribute to the power of the prompt communication and exchange of information among the World Health Organization collaborating laboratories about virus-isolation systems, PCR primers and virus sequences, and other diagnostic methods. This collaborative approach can be invaluable in our efforts to understand and control emerging public health threats.
This article was published at www.nejm.org on April 10, 2003.
We are indebted to Ann R. Falsey and Edward E. Walsh, Rochester General Hospital, University of Rochester School of Medicine and Dentistry; Linda Saif, Ohio Agricultural Research and Development Center, Ohio State University, and the staff of the Hanoi French Hospital, Hanoi, Vietnam; to John Black, James Guy, Miladin Kostovic, Julia Ridpath, Joan Beck, Edward Dubovi, Sanjay Kapil, Chris Grant, David Swayne, Julian Leibowitz, and S.A. Naqi for the provision of reference serum, monoclonal antibodies, and coronavirus control tissues; to the many private and public health physicians and laboratorians who treated patients with SARS or provided clinical materials for evaluation for their assistance and cooperation; and to Claudia Chesley for editorial review of the manuscript. This article is dedicated to the memory of Carlo Urbani.
Source Information
From the Special Pathogens Branch (T.G.K., J.A.C., P.E.R.), Respiratory and Enteric Virus Branch (D.E., T.P., S.E., S.T., P.R., W.J.B., L.J.A.), Infectious Disease Pathology Activity (C.S.G., S.R.Z., C.D.H., W.-J.S., J.G., C.D.P.), Influenza Branch (N.C.), Division of Bacterial and Mycotic Diseases (B.F.), and Office of the Director, Division of Viral and Rickettsial Diseases (J.W.L.), and Office of the Director, National Center for Infectious Diseases (J.M.H.), National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta; the World Health Organization, Hanoi, Vietnam (C.U.); the Government Virus Unit, Queen Mary Hospital, Hong Kong, China (W.L.); the International Emerging Infectious Diseases Program, Bangkok, Thailand (S.F.D.); the Department of Pathology, Singapore General Hospital (A.-E.L.); the University of California, San Francisco (J.D.); and the Center for Disease Control, Department of Health, Taipei, Taiwan (J.-Y. Y.).
Carlo Urbani, M.D., is deceased.
Members of the SARS (Severe Acute Respiratory Syndrome) Working Group are listed in the Appendix.
Appendix
Members of the SARS Working Group include the following (asterisks indicate group members temporarily assigned from other CDC sections): A.D.L. Cannon, M. Curtis,* B. Farrar, L. Morgan, L. Pezzanite,* A.J. Sanchez, K.A. Slaughter, T.L. Stevens, P.C. Stockton, K.D. Wagoner, A. Sanchez, S. Nichol, M. Vincent, J. Osborne, J. Honig, B.R. Erickson (Special Pathogens Branch, Division of Viral and Rickettsial Diseases, National Center for Infectious Diseases, CDC); B. Holloway, K. McCaustland (DNA Chemistry Section, Scientific Resources Program, National Center for Infectious Diseases); J. Lingappa, L. Lowe, S. Scott, X. Lu, Y. Villamarzo, B. Cook, Q. Chen, C. Birge, B. Shu, M. Pallansch (Respiratory and Enteric Virus Branch, Division of Viral and Rickettsial Diseases); K.M. Tatti, T. Morken, C. Smith, P. Greer, E. White, T. McGlothen, J. Bhatnagar, M. Patel, J. Bartlett, J. Montague, W. Lee, M. Packard (Infectious Diseases Pathology Activity, Division of Viral and Rickettsial Diseases); H.A. Thompson (Viral and Rickettsial Zoonoses Branch); A. Moen, K. Fukuda, T. Uyeki, S. Harper, A. Klimov, S. Lindstrom (Influenza Branch, Division of Viral and Rickettsial Diseases); R. Benson, G. Carlone, R. Facklam, P. Fields, P. Levett, L. Mayer, D. Talkington, W.L. Thacker, M.L.C. Tondella, C. Whitney (Division of Bacterial and Mycotic Diseases, National Center for Infectious Diseases); B. Robertson, D. Warnock (SARS Laboratory Team); J.T. Brooks, S. Schrag, N. Rosenstein (SARS Epidemiology Team); R. Arthur (SARS International Team); D. Ganem (University of California, San Francisco); S.M. Poutanen (Department of Laboratory Medicine and Pathobiology, University of Toronto); T.-J. Chen (Center for Disease Control, Department of Health, Taiwan); C.-H. Hsiao (Department of Pathology, National Taiwan University Hospital, Taipei, Taiwan); N.G. Wai-Fu (Yan Chai Hospital, Hong Kong); M. Ho (K. Wah Hospital, Hong Kong); T.-K. Keung (Princess Margaret Hospital, Hong Kong); K.H. Nghiem, H.K.L. Nguyen, M.Q. Le (Department of Virology, National Institute of Hygiene and Epidemiology, Hanoi, Vietnam); H.H.T. Nguyen, L.T. Hoang (National Institute of Hygiene and Epidemiology, Hanoi, Vietnam); T.H. Vu, H.Q. Vu (Hanoi French Hospital, Hanoi, Vietnam); WHO SARS Investigation Team, Vietnam; S. Chunsuttiwat (Ministry of Public Health, Thailand); WHO Vietnam; and the WHO SARS Collaborating Laboratory Network: Centers for Disease Control and Prevention, Atlanta; Public Health Laboratory Service, Central Public Health Laboratory, London; Government Virus Unit, Hong Kong; Prince of Wales Hospital, the Chinese University of Hong Kong, Hong Kong; Queen Mary Hospital, Hong Kong; Centers for Disease Control, Beijing, China; Erasmus Universiteit, National Influenza Center, Rotterdam, the Netherlands; Federal Laboratories for Health Canada, Winnipeg, Man., Canada; Bernhard Nocht Institute, Hamburg, Germany; Institut für Virologie, Marburg, Germany; National Institute of Infectious Disease, Tokyo, Japan.
- References
References
1
Acute respiratory syndrome in China — update 3: disease outbreak reported. Geneva: World Health Organization, February 2003.
2
Update: outbreak of severe acute respiratory syndrome -- worldwide, 2003. MMWR Morb Mortal Wkly Rep 2003;52:241-248
Medline3
Tsang KW ,Ho PL ,Ooi GC , et al. A cluster of cases of severe acute respiratory syndrome in Hong Kong. N Engl J Med 2003;348:1975-1983
Full Text | Web of Science4
Lee N ,Hui D ,Wu A , et al. A major outbreak of severe acute respiratory syndrome in Hong Kong. N Engl J Med 2003;348:1984-19925
Poutanen SM ,Low DE ,Henry B , et al. Identification of severe acute respiratory syndrome in Canada. N Engl J Med 2003;348:1993-2003
Full Text | Web of Science6
Wulff H ,Lange JV . Indirect immunofluorescence for the diagnosis of Lassa fever infection. Bull World Health Organ 1975;52:429-436
Web of Science | Medline7
Ksiazek TG ,West CP ,Rollin PE ,Jahrling PB ,Peters CJ . ELISA for the detection of antibodies to Ebola viruses. J Infect Dis 1999;179:Suppl 1:S192-S198
CrossRef | Web of Science | Medline8
Zaki S ,Greer PW ,Coffield LM , et al. Hantavirus pulmonary syndrome: pathogenesis of an emerging infectious disease. Am J Pathol 1995;146:552-579
Web of Science | Medline9
Falsey AR ,Erdman D ,Anderson LJ ,Walsh EE . Human metapneumovirus infections in young and elderly adults. J Infect Dis 2003;87:785-790
CrossRef | Web of Science10
Wang D ,Coscoy L ,Zylberberg M , et al. Microarray-based detection and genotyping of viral pathogens. Proc Natl Acad Sci U S A 2002;99:15687-15692
CrossRef | Web of Science | Medline11
Bohlander SK ,Espinosa R III ,Le Beau MM ,Rowley JD ,Diaz MO . A method for the rapid sequence-independent amplification of microdissected chromosomal material. Genomics 1992;13:1322-1324
CrossRef | Web of Science | Medline12
Thompson JD ,Higgins DG ,Gibson TJ . CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673-4680
CrossRef | Web of Science | Medline13
Swofford DL. PAUP 4.0: phylogenetic analysis using parsimony (and other methods). Sunderland, Mass.: Sinauer, 1999.
14
Becker WB ,McIntosh K ,Dees JH ,Chanock RM . Morphogenesis of avian infectious bronchitis virus and a related human virus (strain 229E). J Virol 1967;1:1019-1027
Medline15
Oshiro LS ,Schieble JH ,Lennette EH . Electron microscopic studies of coronavirus. J Gen Virol 1971;12:161-168
CrossRef | Web of Science | Medline16
Jonassen CM ,Jonassen TO ,Grinde B . A common RNA motif in the 3' end of the genomes of astroviruses, avian infectious bronchitis virus and an equine rhinovirus. J Gen Virol 1998;79:715-718
Web of Science | Medline17
Smolinski MS, Hamburg MA, Lederberg J, eds. Microbial threats to health: emergence, detection, and response. Washington, D.C.: National Academy Press, 2003.
18
McIntosh K ,Kapikian AZ ,Hardison KA ,Hartley JW ,Chanock RM . Antigenic relationships among the coronaviruses of man and between human and animal coronaviruses. J Immunol 1969;102:1109-1118
Web of Science | Medline19
Bradburne AF . Antigenic relationships amongst coronaviruses. Arch Gesamte Virusforsch 1970;31:352-364
CrossRef | Medline20
Bradburne AF ,Somerset BA . Coronavirus antibody titres in sera of healthy adults and experimentally infected volunteers. J Hyg (Lond) 1972;70:235-244
CrossRef | Web of Science | Medline21
Hazelton PR ,Gelderblom HR . Electron microscopy for rapid diagnosis of infectious agents in emergent situations. Emerg Infect Dis 2003;9:294-303
Web of Science | Medline22
Johnson KM ,Lange JV ,Webb PA ,Murphy FA . Isolation and partial characterisation of a new virus causing acute haemorrhagic fever in Zaire. Lancet 1977;1:569-571
CrossRef | Web of Science | Medline23
Chua KB ,Bellini WJ ,Rota PA , et al. Nipah virus: a recently emergent deadly paramyxovirus. Science 2000;288:1432-1435
CrossRef | Web of Science | Medline24
Murray K ,Selleck P ,Hooper P , et al. A morbillivirus that caused fatal disease in horses and humans. Science 1995;268:94-97
CrossRef | Web of Science | Medline25
Hofmann M ,Wyler R . Propagation of the virus of porcine epidemic diarrhea in cell culture. J Clin Microbiol 1988;26:2235-2239
Web of Science | Medline26
Bruckova M ,McIntosh K ,Kapikian AZ ,Chanock RM . The adaption of two human coronavirus strains (OC38 and OC43) to growth in cell monolayers. Proc Soc Exp Biol Med 1970;135:431-435
Web of Science | Medline27
Patterson S ,Macnaughton MR . Replication of human respiratory coronavirus strain 229E in human macrophages. J Gen Virol 1982;60:307-314
CrossRef | Web of Science | Medline28
Luby JP ,Clinton R ,Kurtz S . Adaptation of human enteric coronavirus to growth in cell lines. J Clin Virol 1999;12:43-51
CrossRef | Web of Science | Medline29
Lavi E ,Wang Q ,Weiss SR ,Gonatas NK . Syncytia formation induced by coronavirus infection is associated with fragmentation and rearrangement of the Golgi apparatus. Virology 1996;221:325-334
CrossRef | Web of Science | Medline30
Kusanagi K ,Kuwahara H ,Katoh T , et al. Isolation and serial propagation of porcine epidemic diarrhea virus in cell cultures and partial characterization of the isolate. J Vet Med Sci 1992;54:313-318
CrossRef | Web of Science | Medline31
Jacobse-Geels HE ,Horzinek MC . Expression of feline infectious peritonitis coronavirus antigens on the surface of feline macrophage-like cells. J Gen Virol 1983;64:1859-1866
CrossRef | Web of Science | Medline32
Wong KT ,Shieh W-J ,Kumar S , et al. Nipah virus infection: pathology and pathogenesis of an emerging paramyxoviral zoonosis. Am J Pathol 2002;161:2153-2167
CrossRef | Web of Science | Medline33
Guarner J ,Shieh WJ ,Dawson J , et al. Immunohistochemical and in situ hybridization studies of influenza A virus infection in human lungs. Am J Clin Pathol 2000;114:227-233
CrossRef | Web of Science | Medline
- Citing Articles (671)
Citing Articles
1
Christopher D. Sibley, Gisele Peirano, Deirdre L. Church. (2012) Molecular Methods for Pathogen and Microbial Community Detection and Characterization: Current and Potential Application in Diagnostic Microbiology. Infection, Genetics and Evolution
CrossRef2
J. Glenn Morris, Allison Greenspan, Kelly Howell, Lisa M. Gargano, Joanne Mitchell, Jeffrey L. Jones, Morris Potter, Alexander Isakov, Christopher Woods, James M. Hughes. (2012) Southeastern Center for Emerging Biologic Threats Tabletop Exercise: Foodborne Toxoplasmosis Outbreak on College Campuses. Biosecurity and Bioterrorism: Biodefense Strategy, Practice, and Science120127080653003
CrossRef3
Betsy Foxman. 2012. Applications of Molecular Tools to Infectious Disease Epidemiology. , 23-39.
CrossRef4
Anna-Winona Struck, Marco Axmann, Susanne Pfefferle, Christian Drosten, Bernd Meyer. (2012) A Hexapeptide of the Receptor-Binding Domain of SARS Corona Virus Spike Protein Blocks Viral Entry into Host Cells via the Human Receptor ACE2. Antiviral Research
CrossRef5
Ulrich Spengler, Hans-Peter Fischer, Wolfgang H. Caselmann. 2012. Liver Disease Associated with Viral Infections. , 629-643.
CrossRef6
Hyun Lee, Jaime Torres, Lena Truong, Rima Chaudhuri, Anuradha Mittal, Michael E. Johnson. (2012) Reducing agents affect inhibitory activities of compounds: Results from Multiple Drug Targets. Analytical Biochemistry
CrossRef7
Kenichi Akaji, Hiroyuki Konno, Hironori Mitsui, Kenta Teruya, Yasuhiro Shimamoto, Yasunao Hattori, Takeshi Ozaki, Masami Kusunoki, Akira Sanjoh. (2011) Structure-Based Design, Synthesis, and Evaluation of Peptide-Mimetic SARS 3CL Protease Inhibitors. Journal of Medicinal Chemistry111109134938004
CrossRef8
Charles-Édouard Luyt, Alain Combes, Jean-Louis Trouillet, Ania Nieszkowska, Jean Chastre. (2011) Virus-induced acute respiratory distress syndrome: Epidemiology, management and outcome. La Presse Médicale
CrossRef9
Kalina T. Zlateva, Kelly M. Crusio, Andrey M. Leontovich, Chris Lauber, Eric Claas, Alexander A. Kravchenko, Willy J.M. Spaan, Alexander E. Gorbalenya. (2011) Design and validation of consensus-degenerate hybrid oligonucleotide primers for broad and sensitive detection of corona- and toroviruses. Journal of Virological Methods 177:2, 174-183
CrossRef10
Yan-fei Qi, Hong Zhang, Juan Wang, Yanfang Jiang, Jinhua Li, Ye Yuan, Shiyao Zhang, Kun Xu, Yangguang Li, Juan Li, Junqi Niu, Enbo Wang. (2011) In vitro anti-hepatitis B and SARS virus activities of a titanium-substituted-heteropolytungstate. Antiviral Research
CrossRef11
Juan Zhang, Ding Wang, Yue Li, Qing Zhao, Ailong Huang, Jian Zheng, Weixian Chen. (2011) SARS Coronavirus Nucleocapsid Protein Monoclonal Antibodies Developed Using a Prokaryotic Expressed Protein. Hybridoma 30:5, 481-485
CrossRef12
K. S. McLoughlin. (2011) Microarrays for Pathogen Detection and Analysis. Briefings in Functional Genomics and Proteomics
CrossRef13
Han-Xin Lin, Yan Feng, Xinming Tu, Xuesen Zhao, Chih-Heng Hsieh, Lauren Griffin, Murray Junop, Chengsheng Zhang. (2011) Characterization of the spike protein of human coronavirus NL63 in receptor binding and pseudotype virus entry. Virus Research 160:1-2, 283-293
CrossRef14
Kathryn A. Radigan, Richard G. Wunderink. (2011) Epidemic Viral Pneumonia and Other Emerging Pathogens. Clinics in Chest Medicine 32:3, 451-467
CrossRef15
Wei-Chen Cheng, Jau-Chi Huang, Cheng-Yuan Liou. (2011) Segmentation of DNA using simple recurrent neural network. Knowledge-Based Systems
CrossRef16
Fei Gao, Jiaqi Lu, Huochun Yao, Zuzhang Wei, Qian Yang, Shishan Yuan. (2011) Cis-acting structural element in 5′ UTR is essential for infectivity of porcine reproductive and respiratory syndrome virus. Virus Research
CrossRef17
A. N. Vlasova, R. Halpin, S. Wang, E. Ghedin, D. J. Spiro, L. J. Saif. (2011) Molecular characterization of a new species in the genus Alphacoronavirus associated with mink epizootic catarrhal gastroenteritis. Journal of General Virology 92:6, 1369-1379
CrossRef18
Graham Simmons, Stephanie Bertram, Ilona Glowacka, Imke Steffen, Chawaree Chaipan, Juliet Agudelo, Kai Lu, Andrew J. Rennekamp, Heike Hofmann, Paul Bates, Stefan Pöhlmann. (2011) Different host cell proteases activate the SARS-coronavirus spike-protein for cell–cell and virus–cell fusion. Virology 413:2, 265-274
CrossRef19
Thi Thanh Hanh Nguyen, Hwa-Ja Ryu, Se-Hoon Lee, Soonwook Hwang, Vincent Breton, Joon Haeng Rhee, Doman Kim. (2011) Virtual screening identification of novel severe acute respiratory syndrome 3C-like protease inhibitors and in vitro confirmation. Bioorganic & Medicinal Chemistry Letters 21:10, 3088-3091
CrossRef20
Philip J. Landrigan, Jonathan Ripp, Ramon J. C. Murphy, Luz Claudio, Jennifer Jao, Braden Hexom, Harrison G. Bloom, Taraneh Shirazian, Ebby Elahi, Jeffrey P. Koplan. (2011) New Academic Partnerships in Global Health: Innovations at Mount Sinai School of Medicine. Mount Sinai Journal of Medicine: A Journal of Translational and Personalized Medicine 78:3, 471-483
CrossRef21
I Chen Hsing. (2011) Acute lung injury and acute respiratory distress syndrome: experimental and clinical investigations. Journal of Geriatric Cardiology 8:1, 44-54
CrossRef22
Yohichi Kumaki, Miles K. Wandersee, Aaron J. Smith, Yanchen Zhou, Graham Simmons, Nathan M. Nelson, Kevin W. Bailey, Zachary G. Vest, Joseph K.-K. Li, Paul Kay-Sheung Chan, Donald F. Smee, Dale L. Barnard. (2011) Inhibition of severe acute respiratory syndrome coronavirus replication in a lethal SARS-CoV BALB/c mouse model by stinging nettle lectin, Urtica dioica agglutinin. Antiviral Research 90:1, 22-32
CrossRef23
Hongkai Wu, Jinwen Wang, Riqiang Deng, Ke Xing, Yuanyan Xiong, Junfeng Huang, Xionglei He, Xunzhang Wang. (2011) Benefits of random-priming: Exhaustive survey of a cDNA library from lung tissue of a SARS patient. Journal of Medical Virology 83:4, 574-586
CrossRef24
Aslak Widerøe Kristoffersen, Svein Arne Nordbø, Anne-Gro Wesenberg Rognlien, Andreas Christensen, Henrik Døllner. (2011) Coronavirus Causes Lower Respiratory Tract Infections Less Frequently Than RSV in Hospitalized Norwegian Children. The Pediatric Infectious Disease Journal 30:4, 279-283
CrossRef25
Andreas V. Hadjinicolaou, Gabriella A. Farcas, Victoria L. Demetriou, Tony Mazzulli, Susan M. Poutanen, Barbara M. Willey, Donald E. Low, Jagdish Butany, Sylvia L. Asa, Kevin C. Kain, Leondios G. Kostrikis. (2011) Development of a molecular-beacon-based multi-allelic real-time RT-PCR assay for the detection of human coronavirus causing severe acute respiratory syndrome (SARS-CoV): a general methodology for detecting rapidly mutating viruses. Archives of Virology 156:4, 671-680
CrossRef26
Rudi L. Cilibrasi, Paul M.B. Vitányi. (2011) A Fast Quartet tree heuristic for hierarchical clustering. Pattern Recognition 44:3, 662-677
CrossRef27
Guo-hui Chang, Bao-jun Luo, Pin Lu, Lei Lin, Xiao-yan Wu, Jing Li, Yi Hu, Qing-yu Zhu. (2011) Construction and genetic analysis of murine hepatitis virus strain A59 Nsp16 temperature sensitive mutant and the revertant virus. Virologica Sinica 26:1, 19-29
CrossRef28
Cheng-Chang Chen, Jens Krüger, Issara Sramala, Hao-Jen Hsu, Peter Henklein, Yi-Ming Arthur Chen, Wolfgang B. Fischer. (2011) ORF8a of SARS-CoV forms an ion channel: Experiments and molecular dynamics simulations. Biochimica et Biophysica Acta (BBA) - Biomembranes 1808:2, 572-579
CrossRef29
Daniel A. Janies, Travis Treseder, Boyan Alexandrov, Farhat Habib, Jennifer J. Chen, Renato Ferreira, Ümit Çatalyürek, Andrés Varón, Ward C. Wheeler. (2011) The Supramap project: linking pathogen genomes with geography to fight emergent infectious diseases. Cladistics 27:1, 61-66
CrossRef30
Bhaskar DasGupta, Ming-Yang Kao, Ion Măndoiu. 2011. Algorithmic Issues in DNA Barcoding Problems. , 129-142.
CrossRef31
Dominic E. Dwyer, Peter D. Kirkland. (2011) Influenza: One Health in action. New South Wales Public Health Bulletin 22:6, 123
CrossRef32
Lisa M. Runco, J. Robert Coleman. (2011) Harnessing DNA Synthesis to Develop Rapid Responses to Emerging and Pandemic Pathogens. Journal of Pathogens 2011, 1-7
CrossRef33
Yohichi Kumaki, Jane Ennis, Ramtin Rahbar, Jeffrey D. Turner, Miles K. Wandersee, Aaron J. Smith, Kevin W. Bailey, Zachary G. Vest, Jason R. Madsen, Joseph K.-K. Li, Dale L. Barnard. (2011) Single-dose intranasal administration with mDEF201 (adenovirus vectored mouse interferon-alpha) confers protection from mortality in a lethal SARS-CoV BALB/c mouse model. Antiviral Research 89:1, 75-82
CrossRef34
Irene Briguglio, Sandra Piras, Paola Corona, Antonio Carta. (2011) Inhibition of RNA Helicases of ssRNA+ Virus Belonging to Flaviviridae, Coronaviridae and Picornaviridae Families. International Journal of Medicinal Chemistry 2011, 1-22
CrossRef35
K. H. Chan, J. S. Malik Peiris, S. Y. Lam, L. L. M. Poon, K. Y. Yuen, W. H. Seto. (2011) The Effects of Temperature and Relative Humidity on the Viability of the SARS Coronavirus. Advances in Virology 2011, 1-7
CrossRef36
Eduardo J. Ezyaguirre, David H. Walker, Sherif Zaki. 2011. Immunohistology of Infectious Diseases. , 58-82.
CrossRef37
Harvey Moldofsky, John Patcai. (2011) Chronic widespread musculoskeletal pain, fatigue, depression and disordered sleep in chronic post-SARS syndrome; a case-controlled study. BMC Neurology 11:1, 37
CrossRef38
Hsien-Hua Liao, Yao-Chen Wang, Miles Chen, Hsien-Yu Tsai, Johnson Lin, Shui-Tein Chen, Gregory Tsay, Sun-Long Cheng. (2011) Down-regulation of granulocyte-macrophage colony-stimulating factor by 3C-like proteinase in transfected A549 human lung carcinoma cells. BMC Immunology 12:1, 16
CrossRef39
E. K. Wheeler, C. A. Hara, J. Frank, J. Deotte, S. B. Hall, W. Benett, C. Spadaccini, N. R. Beer. (2011) Under-three minute PCR: Probing the limits of fast amplification. The Analyst 136:18, 3707
CrossRef40
Evan Skowronski, W. Ian Lipkin. 2011. Molecular Microbial Surveillance and Discovery in Bioforensics. , 173-185.
CrossRef41
Catherine L. Murray, Thomas S. Oh, Charles M. Rice. 2011. Keeping Track of Viruses. , 137-153.
CrossRef42
Bryan Corrin, Andrew G. Nicholson. 2011. Infectious diseases. , 155-262.
CrossRef43
S. J. OLSEN, S. THAMTHITIWAT, S. CHANTRA, M. CHITTAGANPITCH, A. M. FRY, J. M. SIMMERMAN, H. C. BAGGETT, T. C. T. PERET, D. ERDMAN, R. BENSON, D. TALKINGTON, L. THACKER, M. L. TONDELLA, J. WINCHELL, B. FIELDS, W. L. NICHOLSON, S. MALONEY, L. F. PERUSKI, K. UNGCHUSAK, P. SAWANPANYALERT, S. F. DOWELL. (2010) Incidence of respiratory pathogens in persons hospitalized with pneumonia in two provinces in Thailand. Epidemiology and Infection 138:12, 1811-1822
CrossRef44
C. Geller, S. Fontanay, M. Mourer, H. Massimba Dibama, J.-B. Regnouf-de-Vains, C. Finance, R.E. Duval. (2010) Antiseptic properties of two calix[4]arenes derivatives on the human coronavirus 229E. Antiviral Research 88:3, 343-346
CrossRef45
Ronald N. Kostoff. (2010) The highly cited SARS research literature. Critical Reviews in Microbiology 36:4, 299-317
CrossRef46
Larry J. Anderson, Suxiang Tong. (2010) Update on SARS research and other possibly zoonotic coronaviruses. International Journal of Antimicrobial Agents 36, S21-S25
CrossRef47
Guo-hui Chang, Andrew Dividson, Lei Lin, Matt Wilson, Stuart G. Siddell, Qing-yu Zhu. (2010) Establishment of the eukaryotic cell lines for inducible control of SARS-CoV nucleocapsid gene expression. Virologica Sinica 25:5, 361-368
CrossRef48
Yuxuan Hou, Cheng Peng, Meng Yu, Yan Li, Zhenggang Han, Fang Li, Lin-Fa Wang, Zhengli Shi. (2010) Angiotensin-converting enzyme 2 (ACE2) proteins of different bat species confer variable susceptibility to SARS-CoV entry. Archives of Virology 155:10, 1563-1569
CrossRef49
Carole Buecher, Sek Mardy, Wei Wang, Veasna Duong, Sirenda Vong, Monica Naughtin, Astrid Vabret, François Freymuth, Vincent Deubel, Philippe Buchy. (2010) Use of a multiplex PCR/RT-PCR approach to assess the viral causes of influenza-like illnesses in Cambodia during three consecutive dry seasons. Journal of Medical Virology 82:10, 1762-1772
CrossRef50
David S.C. Hui, Paul K.S. Chan. (2010) Severe Acute Respiratory Syndrome and Coronavirus. Infectious Disease Clinics of North America 24:3, 619-638
CrossRef51
Yoko Moriyama, Hiromichi Hamada, Mineyuki Okada, Nozomi Tsuchiya, Hiromi Maru, Yuri Shirato, Yasuhiro Maeda, Yosuke Hirose, Masaki Yoshida, Yoh Omura, Takafumi Honda, Ayako Muto, Kitami Hayashi, Masaru Terai. (2010) Distinctive clinical features of human bocavirus in children younger than 2 years. European Journal of Pediatrics 169:9, 1087-1092
CrossRef52
Susan J. Bender, Susan R. Weiss. (2010) Pathogenesis of Murine Coronavirus in the Central Nervous System. Journal of Neuroimmune Pharmacology 5:3, 336-354
CrossRef53
Kai Zhao, Binyan Yang, Yanquan Xu, Changyou Wu. (2010) CD8+ T cell response in HLA-A*0201 transgenic mice is elicited by epitopes from SARS-CoV S protein. Vaccine 28:41, 6666-6674
CrossRef54
T. Watabe, H. Kishino. (2010) Structural Considerations in the Fitness Landscape of a Virus. Molecular Biology and Evolution 27:8, 1782-1791
CrossRef55
M. Khadadah, S. Essa, Z. Higazi, N. Behbehani, W. Al-Nakib. (2010) Respiratory syncytial virus and human rhinoviruses are the major causes of severe lower respiratory tract infections in Kuwait. Journal of Medical Virology 82:8, 1462-1467
CrossRef56
Yanlin Ma, Xiaohang Tong, Xiaoling Xu, Xuemei Li, Zhiyong Lou, Zihe Rao. (2010) Structures of the N- and C-terminal domains of MHV-A59 nucleocapsid protein corroborate a conserved RNA-protein binding mechanism in coronavirus. Protein & Cell 1:7, 688-697
CrossRef57
Eeuri Nam, Changhee Lee. (2010) Contribution of the porcine aminopeptidase N (CD13) receptor density to porcine epidemic diarrhea virus infection. Veterinary Microbiology 144:1-2, 41-50
CrossRef58
Enrique Álvarez, Marta L. DeDiego, Jose L. Nieto-Torres, Jose M. Jiménez-Guardeño, Laura Marcos-Villar, Luis Enjuanes. (2010) The envelope protein of severe acute respiratory syndrome coronavirus interacts with the non-structural protein 3 and is ubiquitinated. Virology 402:2, 281-291
CrossRef59
M. Yu, M. Tachedjian, G. Crameri, Z. Shi, L.-F. Wang. (2010) Identification of key amino acid residues required for horseshoe bat angiotensin-I converting enzyme 2 to function as a receptor for severe acute respiratory syndrome coronavirus. Journal of General Virology 91:7, 1708-1712
CrossRef60
Deepali Kumar, Atul Humar. (2010) Respiratory Viral Infections in Transplant and Oncology Patients. Infectious Disease Clinics of North America 24:2, 395-412
CrossRef61
Lia van der Hoek, Gabriele Ihorst, Klaus Sure, Astrid Vabret, Ronald Dijkman, Michel de Vries, Johannes Forster, Ben Berkhout, Klaus Uberla. (2010) Burden of disease due to human coronavirus NL63 infections and periodicity of infection. Journal of Clinical Virology 48:2, 104-108
CrossRef62
R. Ramajayam, Kian-Pin Tan, Hun-Ge Liu, Po-Huang Liang. (2010) Synthesis, docking studies, and evaluation of pyrimidines as inhibitors of SARS-CoV 3CL protease. Bioorganic & Medicinal Chemistry Letters 20:12, 3569-3572
CrossRef63
Minna Risku, Suvi Lappalainen, Sirpa Räsänen, Timo Vesikari. (2010) Detection of human coronaviruses in children with acute gastroenteritis. Journal of Clinical Virology 48:1, 27-30
CrossRef64
Shih-Cheng Chen, René C.L. Olsthoorn. (2010) Group-specific structural features of the 5′-proximal sequences of coronavirus genomic RNAs. Virology 401:1, 29-41
CrossRef65
Stephen E Lapinsky. (2010) Epidemic viral pneumonia. Current Opinion in Infectious Diseases 23:2, 139-144
CrossRef66
Gayle Ritchie, David J. Harvey, Friederike Feldmann, Ute Stroeher, Heinz Feldmann, Louise Royle, Raymond A. Dwek, Pauline M. Rudd. (2010) Identification of N-linked carbohydrates from severe acute respiratory syndrome (SARS) spike glycoprotein. Virology 399:2, 257-269
CrossRef67
Mark H. Wilcox, Robert C. Spencer. 2010. Healthcare-Associated Infections. .
CrossRef68
Eric J. Snijder, Stuart G. Siddell, Alexander E. Gorbalenya. 2010. The Order Nidovirales. .
CrossRef69
Dean D. Erdman. 2010. Propagation and Identification of Viruses. .
CrossRef70
Brian W. J. Mahy, Frederick A. Murphy. 2010. The Emergence and Re-Emergence of Viral Diseases. .
CrossRef71
Stuart G. Siddell, John Ziebuhr, Eric J. Snijder. 2010. Coronaviruses, Toroviruses, and Arteriviruses. .
CrossRef72
Sara E Miller. 2010. Electron Microscopy of Viral Infections. , 173-196.
CrossRef73
Brigitte A Wevers, Lia van der Hoek. (2010) Renin–angiotensin system in human coronavirus pathogenesis. Future Virology 5:2, 145-161
CrossRef74
Diane Leland, Marie Louise Landry. 2010. Virus Isolation. , 98-112.
CrossRef75
Shiori Haga, Noriyo Nagata, Tadashi Okamura, Norio Yamamoto, Tetsutaro Sata, Naoki Yamamoto, Takehiko Sasazuki, Yukihito Ishizaka. (2010) TACE antagonists blocking ACE2 shedding caused by the spike protein of SARS-CoV are candidate antiviral compounds. Antiviral Research 85:3, 551-555
CrossRef76
Burke A. Cunha. (2010) Preface. Infectious Disease Clinics of North America 24:1, xiii-xvii
CrossRef77
Robert L Atmar, Stephen B Greenberg. 2010. Respiratory Virus Infections. , 246-271.
CrossRef78
David M Whiley, Theo P Sloots. 2010. Molecular Amplification Methods in Diagnostic Virology. , 19-39.
CrossRef79
Young Bae Ryu, Su-Jin Park, Young Min Kim, Ju-Yeon Lee, Woo Duck Seo, Jong Sun Chang, Ki Hun Park, Mun-Chual Rho, Woo Song Lee. (2010) SARS-CoV 3CLpro inhibitory effects of quinone-methide triterpenes from Tripterygium regelii. Bioorganic & Medicinal Chemistry Letters 20:6, 1873-1876
CrossRef80
Yi-Ting Fang, Chiou-Feng Lin, Pao-Chi Liao, Yu-Min Kuo, Shuying Wang, Trai-Ming Yeh, Chi-Chang K. Shieh, Ih-Jen Su, Huan-Yao Lei, Yee-Shin Lin. (2010) Annexin A2 on lung epithelial cell surface is recognized by severe acute respiratory syndrome-associated coronavirus spike domain 2 antibodies. Molecular Immunology 47:5, 1000-1009
CrossRef81
Patrick Tang, Charles Chiu. (2010) Metagenomics for the discovery of novel human viruses. Future Microbiology 5:2, 177-189
CrossRef82
Yu-xuan Hou, Cheng Peng, Zheng-gang Han, Peng Zhou, Ji-guo Chen, Zheng-li Shi. (2010) Immunogenicity of the spike glycoprotein of Bat SARS-like coronavirus. Virologica Sinica 25:1, 36-44
CrossRef83
Tae-Young Ahn, Chih-Jung Kuo, Hun-Ge Liu, Deok-Chan Ha, Po-Huang Liang, Young-Sik Jung. (2010) Synthesis and Evaluation of Benzoquinolinone Derivatives as SARS-CoV 3CL Protease Inhibitors. Bulletin of the Korean Chemical Society 31:1, 87-91
CrossRef84
Tatsuhiko Suzuki, Koji Wada, Yuko Wada, Hideaki Kagitani, Tetsuya Arioka, Koji Maeda, Kenichi Kida. (2010) The Validity of Mass Body Temperature Screening with Ear Thermometers in a Warm Thermal Environment. The Tohoku Journal of Experimental Medicine 222:2, 89-95
CrossRef85
Hui-Min Wang, Po-Huang Liang. (2010) Picornaviral 3C protease inhibitors and the dual 3C protease/coronaviral 3C-like protease inhibitors. Expert Opinion on Therapeutic Patents 20:1, 59-71
CrossRef86
Chi Wai Yip, Chung Chau Hon, Mang Shi, Tommy Tsan-Yuk Lam, Ken Yan-Ching Chow, Fanya Zeng, Frederick Chi-Ching Leung. (2009) Phylogenetic perspectives on the epidemiology and origins of SARS and SARS-like coronaviruses. Infection, Genetics and Evolution 9:6, 1185-1196
CrossRef87
Youmin Kang, Aoshuang Chen, Bin Wang, Guoxing Zheng. (2009) Protein Transfer Enhances Cellular Immune Responses to DNA Vaccination Against SARS-CoV. Viral Immunology 22:6, 417-422
CrossRef88
Ying Guo, Jennifer Tisoncik, Susanna McReynolds, Michael Farzan, Bellur S. Prabhakar, Thomas Gallagher, Lijun Rong, Michael Caffrey. (2009) Identification of a New Region of SARS-CoV S Protein Critical for Viral Entry. Journal of Molecular Biology 394:4, 600-605
CrossRef89
Craig W. Day, Ralph Baric, Sui Xiong Cai, Matt Frieman, Yohichi Kumaki, John D. Morrey, Donald F. Smee, Dale L. Barnard. (2009) A new mouse-adapted strain of SARS-CoV as a lethal model for evaluating antiviral agents in vitro and in vivo. Virology 395:2, 210-222
CrossRef90
Andy T.Y. Lau, Jen-Fu Chiu. (2009) Biomarkers of lung-related diseases: Current knowledge by proteomic approaches. Journal of Cellular Physiology 221:3, 535-543
CrossRef91
Xiaoping Zhang, Jingxue Wang, Kun Wen, Zhirong Mou, Liyun Zou, Xiaoyan Che, Bing Ni, Yuzhang Wu. (2009) Antibody Binding Site Mapping of SARS-CoV Spike Protein Receptor-Binding Domain by a Combination of Yeast Surface Display and Phage Peptide Library Screening. Viral Immunology 22:6, 407-415
CrossRef92
Rui P. Moreno, Andrew Rhodes, Jean-Daniel Chiche. (2009) The ongoing H1N1 flu pandemic and the intensive care community: challenges, opportunities, and the duties of scientific societies and intensivists. Intensive Care Medicine 35:12, 2005-2008
CrossRef93
Sake J. de Vlas, Wu-Chun Cao, Jan Hendrik Richardus. (2009) Documenting the SARS epidemic in mainland China. Tropical Medicine & International Health 14, 1-3
CrossRef94
Melissa M. Coughlin, John Babcook, Bellur S. Prabhakar. (2009) Human monoclonal antibodies to SARS-coronavirus inhibit infection by different mechanisms. Virology 394:1, 39-46
CrossRef95
Dan Feng, Sake J. de Vlas, Li-Qun Fang, Xiao-Na Han, Wen-Juan Zhao, Shen Sheng, Hong Yang, Zhong-Wei Jia, Jan Hendrik Richardus, Wu-Chun Cao. (2009) The SARS epidemic in mainland China: bringing together all epidemiological data. Tropical Medicine & International Health 14, 4-13
CrossRef96
Shunsuke Kohyama, Satoshi Ohno, Tatsuya Suda, Maiko Taneichi, Shoichi Yokoyama, Masahito Mori, Akiharu Kobayashi, Hidenori Hayashi, Tetsuya Uchida, Masanori Matsui. (2009) Efficient induction of cytotoxic T lymphocytes specific for severe acute respiratory syndrome (SARS)-associated coronavirus by immunization with surface-linked liposomal peptides derived from a non-structural polyprotein 1a. Antiviral Research 84:2, 168-177
CrossRef97
T. Kuri, X. Zhang, M. Habjan, L. Martinez-Sobrido, A. Garcia-Sastre, Z. Yuan, F. Weber. (2009) Interferon priming enables cells to partially overturn the SARS coronavirus-induced block in innate immune activation. Journal of General Virology 90:11, 2686-2694
CrossRef98
L. Xu, Y. Zhang, Y. Liu, Z. Chen, H. Deng, Z. Ma, H. Wang, Z. Hu, F. Deng. (2009) Angiotensin-converting enzyme 2 (ACE2) from raccoon dog can serve as an efficient receptor for the spike protein of severe acute respiratory syndrome coronavirus. Journal of General Virology 90:11, 2695-2703
CrossRef99
Say Li Kong, Paul Chui, Bing Lim, Manuel Salto-Tellez. (2009) Elucidating the molecular physiopathology of acute respiratory distress syndrome in severe acute respiratory syndrome patients. Virus Research 145:2, 260-269
CrossRef100
Chak-Ming Chan, Ho Tsoi, Wing-Man Chan, Shenyu Zhai, Ching-On Wong, Xiaoqiang Yao, Wood-Yee Chan, Stephen Kwok-Wing Tsui, Ho Yin Edwin Chan. (2009) The ion channel activity of the SARS-coronavirus 3a protein is linked to its pro-apoptotic function. The International Journal of Biochemistry & Cell Biology 41:11, 2232-2239
CrossRef101
Y. Ma, Y. Feng, D. Liu, G. F. Gao. (2009) Avian influenza virus, Streptococcus suis serotype 2, severe acute respiratory syndrome-coronavirus and beyond: molecular epidemiology, ecology and the situation in China. Philosophical Transactions of the Royal Society B: Biological Sciences 364:1530, 2725-2737
CrossRef102
Samuel R. Dominguez, Christine C. Robinson, Kathryn V. Holmes. (2009) Detection of four human coronaviruses in respiratory infections in children: A one-year study in Colorado. Journal of Medical Virology 81:9, 1597-1604
CrossRef103
Shaman Muradrasoli, Nahla Mohamed, Ákos Hornyák, Jan Fohlman, Björn Olsen, Sándor Belák, Jonas Blomberg. (2009) Broadly targeted multiprobe QPCR for detection of coronaviruses: Coronavirus is common among mallard ducks (Anas platyrhynchos). Journal of Virological Methods 159:2, 277-287
CrossRef104
E. A. Dondurei, L. V. Osidak, E. G. Golovacheva, A. K. Golovanova, I. V. Amosova, L. N. Gladchenko. (2009) Acute Viral Infections with Combined Involvement of the Respiratory and Gastrointestinal Tracts in Children. Therapy with Interferon. Bulletin of Experimental Biology and Medicine 148:2, 283-286
CrossRef105
Chloé Geller, Stéphane Fontanay, Chantal Finance, Raphaël E. Duval. (2009) A new Sephadex™-based method for removing microbicidal and cytotoxic residues when testing antiseptics against viruses: Experiments with a human coronavirus as a model. Journal of Virological Methods 159:2, 217-226
CrossRef106
H. E. Field. (2009) Bats and Emerging Zoonoses: Henipaviruses and SARS. Zoonoses and Public Health 56:6-7, 278-284
CrossRef107
Rachel L Roper, Kristina E Rehm. (2009) SARS vaccines: where are we?. Expert Review of Vaccines 8:7, 887-898
CrossRef108
P. Chen, T. Hu, M. Jiang, D. Guo. (2009) Synthesis in Escherichia coli cells and characterization of the active exoribonuclease of severe acute respiratory syndrome coronavirus. Molecular Biology 43:3, 410-417
CrossRef109
Li-li Xu, Zhi-hong Hu, Hua-lin Wang, Xiao Han, Fei Deng. (2009) Evaluation of sensitivities and specificities of SARS-CoV detection by real-time quantitative reverse transcription-PCR assays. Virologica Sinica 24:3, 187-193
CrossRef110
Tiancen Hu, Yu Zhang, Lianwei Li, Kuifeng Wang, Shuai Chen, Jing Chen, Jianping Ding, Hualiang Jiang, Xu Shen. (2009) Two adjacent mutations on the dimer interface of SARS coronavirus 3C-like protease cause different conformational changes in crystal structure. Virology 388:2, 324-334
CrossRef111
Ke Xu, Bo-Jian Zheng, Rong Zeng, Wei Lu, Yong-Ping Lin, Liang Xue, Li Li, Lei-Lei Yang, Chen Xu, Jie Dai, Fei Wang, Qing Li, Qing-Xi Dong, Rui-Fu Yang, Jia-Rui Wu, Bing Sun. (2009) Severe acute respiratory syndrome coronavirus accessory protein 9b is a virion-associated protein. Virology 388:2, 279-285
CrossRef112
Satoshi Ohno, Shunsuke Kohyama, Maiko Taneichi, Osamu Moriya, Hidenori Hayashi, Hiroshi Oda, Masahito Mori, Akiharu Kobayashi, Toshitaka Akatsuka, Tetsuya Uchida, Masanori Matsui. (2009) Synthetic peptides coupled to the surface of liposomes effectively induce SARS coronavirus-specific cytotoxic T lymphocytes and viral clearance in HLA-A*0201 transgenic mice. Vaccine 27:29, 3912-3920
CrossRef113
Y. P. Wu, Z. H. Liu, R. Wei, S. D. Pan, N. Y. Mao, B. Chen, J. J. Han, F. S. Zhang, U. Holmskov, Z. L. Xia, P. G. de Groot, K. B. M. Reid, W. B. Xu, G. L. Sorensen. (2009) Elevated Plasma Surfactant Protein D (SP-D) Levels and a Direct Correlation with Anti-severe Acute Respiratory Syndrome Coronavirus-specific IgG Antibody in SARS Patients. Scandinavian Journal of Immunology 69:6, 508-515
CrossRef114
Thomas Regnier, Diganta Sarma, Koushi Hidaka, Usman Bacha, Ernesto Freire, Yoshio Hayashi, Yoshiaki Kiso. (2009) New developments for the design, synthesis and biological evaluation of potent SARS-CoV 3CLpro inhibitors. Bioorganic & Medicinal Chemistry Letters 19:10, 2722-2727
CrossRef115
Min Zhuang, Hong Jiang, Yasuhiro Suzuki, Xiaoguang Li, Peng Xiao, Takashi Tanaka, Hong Ling, Baofeng Yang, Hiroki Saitoh, Lianfeng Zhang, Chuan Qin, Kazuo Sugamura, Toshio Hattori. (2009) Procyanidins and butanol extract of Cinnamomi Cortex inhibit SARS-CoV infection. Antiviral Research 82:1, 73-81
CrossRef116
Vanessa Ditt, Oliver Schildgen. (2009) Severe acute respiratory syndrome-coronavirus and human coronavirus-NL63: an updated overview. Reviews in Medical Microbiology 20:2, 19-28
CrossRef117
Johannes Brug, Arja R. Aro, Jan Hendrik Richardus. (2009) Risk Perceptions and Behaviour: Towards Pandemic Control of Emerging Infectious Diseases. International Journal of Behavioral Medicine 16:1, 3-6
CrossRef118
Jin-Yan Chen, Wan-Nan Chen, Kwok-Man Vincent Poon, Bo-Jian Zheng, Xu Lin, Yong-Xiang Wang, Yu-Mei Wen. (2009) Interaction between SARS-CoV helicase and a multifunctional cellular protein (Ddx5) revealed by yeast and mammalian cell two-hybrid systems. Archives of Virology 154:3, 507-512
CrossRef119
Hui Hu, Xianqing Huang, Ling Tao, Yi Huang, Bao-an Cui, Hanzhong Wang. (2009) Comparative analysis of the immunogenicity of SARS-CoV nucleocapsid DNA vaccine administrated with different routes in mouse model. Vaccine 27:11, 1758-1763
CrossRef120
Kelly R. Bright, Enue E. Sicairos-Ruelas, Patricia M. Gundy, Charles P. Gerba. (2009) Assessment of the Antiviral Properties of Zeolites Containing Metal Ions. Food and Environmental Virology 1:1, 37-41
CrossRef121
Ponraj Prabakaran, Zhongyu Zhu, Xiaodong Xiao, Arya Biragyn, Antony S Dimitrov, Christopher C Broder, Dimiter S Dimitrov. (2009) Potent human monoclonal antibodies against SARS CoV, Nipah and Hendra viruses. Expert Opinion on Biological Therapy 9:3, 355-368
CrossRef122
Bridget S. Banach, Jan M. Orenstein, Linda M. Fox, Scott H. Randell, Anne H. Rowley, Susan C. Baker. (2009) Human airway epithelial cell culture to identify new respiratory viruses: Coronavirus NL63 as a model. Journal of Virological Methods 156:1-2, 19-26
CrossRef123
Kexia Yan, Wenjie Tan, Huijuan Wang, Yue Wang, Xiangmin Zhang, Yan Li, Li Ruan. (2009) SARS-CoV Spike Proteins Expressed by the Vaccinia Virus Tiantan Strain: Secreted SQ Protein Induces Robust Neutralization Antibody in Mice. Viral Immunology 22:1, 57-66
CrossRef124
M. Barcena, G. T. Oostergetel, W. Bartelink, F. G. A. Faas, A. Verkleij, P. J. M. Rottier, A. J. Koster, B. J. Bosch. (2009) Cryo-electron tomography of mouse hepatitis virus: Insights into the structure of the coronavirion. Proceedings of the National Academy of Sciences 106:2, 582-587
CrossRef125
ROBERT A. ERLANDSON. 2009. Role of Electron Microscopy in Modern Diagnostic Surgical Pathology. , 71-84.
CrossRef126
I-Jung Liu, Chuan-Liang Kao, Szu-Chia Hsieh, Ming-Tsair Wey, Lon-Sing Kan, Wei-Kung Wang. (2009) Identification of a minimal peptide derived from heptad repeat (HR) 2 of spike protein of SARS-CoV and combination of HR1-derived peptides as fusion inhibitors. Antiviral Research 81:1, 82-87
CrossRef127
Anna de Lang, Tracey Baas, Saskia L Smits, Michael G Katze, Albert DME Osterhaus, Bart L Haagmans. (2009) Unraveling the complexities of the interferon response during SARS-CoV infection. Future Virology 4:1, 71-78
CrossRef128
A. Bosch, R. M. Pintó, F. S. Le Guyader. 2009. Viral contaminants of molluscan shellfish: detection and characterisation. , 83-107.
CrossRef129
Saqib I. Dara, J. Christopher Farmer. (2009) Preparedness Lessons from Modern Disasters and Wars. Critical Care Clinics 25:1, 47-65
CrossRef130
M. M. Becker, R. L. Graham, E. F. Donaldson, B. Rockx, A. C. Sims, T. Sheahan, R. J. Pickles, D. Corti, R. E. Johnston, R. S. Baric, M. R. Denison. (2008) Synthetic recombinant bat SARS-like coronavirus is infectious in cultured cells and in mice. Proceedings of the National Academy of Sciences 105:50, 19944-19949
CrossRef131
Ka To Shum, Julian A. Tanner. (2008) Differential Inhibitory Activities and Stabilisation of DNA Aptamers against the SARS Coronavirus Helicase. ChemBioChem 9:18, 3037-3045
CrossRef132
J. Yang, E. James, M. Roti, L. Huston, J. A. Gebe, W. W. Kwok. (2008) Searching immunodominant epitopes prior to epidemic: HLA class II-restricted SARS-CoV spike protein epitopes in unexposed individuals. International Immunology 21:1, 63-71
CrossRef133
Te-Cheng Lien, Chun-Sung Sung, Chen-Hsen Lee, Hsin-Kuo Kao, Ying-Che Huang, Cheng-Yi Liu, Reury-Perng Perng, Jia-Horng Wang. (2008) Characteristic features and outcomes of severe acute respiratory syndrome found in severe acute respiratory syndrome intensive care unit patients. Journal of Critical Care 23:4, 557-564
CrossRef134
Zhongde Ye, Chung Kai Wong, Peng Li, Yong Xie. (2008) A SARS-CoV protein, ORF-6, induces caspase-3 mediated, ER stress and JNK-dependent apoptosis. Biochimica et Biophysica Acta (BBA) - General Subjects 1780:12, 1383-1387
CrossRef135
Mina Nakauchi, Hiroaki Kariwa, Yasuhiro Kon, Kentaro Yoshii, Akihiko Maeda, Ikuo Takashima. (2008) Analysis of severe acute respiratory syndrome coronavirus structural proteins in virus-like particle assembly. Microbiology and Immunology 52:12, 625-630
CrossRef136
Arnaud Gagneur, Sophie Vallet, Pierre J. Talbot, Marie-Christine Legrand-Quillien, Bertrand Picard, Christopher Payan, Jacques Sizun. (2008) Outbreaks of human coronavirus in a paediatric and neonatal intensive care unit. European Journal of Pediatrics 167:12, 1427-1434
CrossRef137
Regina K. Rowe, Jason W. Suszko, Andrew Pekosz. (2008) Roles for the recycling endosome, Rab8, and Rab11 in hantavirus release from epithelial cells. Virology 382:2, 239-249
CrossRef138
Kenichi Akaji, Hiroyuki Konno, Mari Onozuka, Ayumi Makino, Hiroyuki Saito, Kazuto Nosaka. (2008) Evaluation of peptide-aldehyde inhibitors using R188I mutant of SARS 3CL protease as a proteolysis-resistant mutant. Bioorganic & Medicinal Chemistry 16:21, 9400-9408
CrossRef139
Staci A. Fischer. (2008) Emerging Viruses in Transplantation: There Is More to Infection After Transplant Than CMV and EBV. Transplantation 86:10, 1327-1339
CrossRef140
Shui-Mei Wang, Yu-Fen Chang, Yi-Ming Arthur Chen, Chin-Tien Wang. (2008) Severe acute respiratory syndrome coronavirus nucleocapsid protein confers ability to efficiently produce virus-like particles when substituted for the human immunodeficiency virus nucleocapsid domain. Journal of Biomedical Science 15:6, 719-729
CrossRef141
K. Ratia, S. Pegan, J. Takayama, K. Sleeman, M. Coughlin, S. Baliji, R. Chaudhuri, W. Fu, B. S. Prabhakar, M. E. Johnson, S. C. Baker, A. K. Ghosh, A. D. Mesecar. (2008) A noncovalent class of papain-like protease/deubiquitinase inhibitors blocks SARS virus replication. Proceedings of the National Academy of Sciences 105:42, 16119-16124
CrossRef142
Albert D. M. E. Osterhaus. (2008) New Respiratory Viruses of Humans. The Pediatric Infectious Disease Journal 27:Supplement, S71-S74
CrossRef143
Yu-chen Xia, Zhi-hong Hu, Zhi-juan Qiu, Zhong-bin Ma, Hua-lin Wang, Fei Deng. (2008) An improved culture system for virus isolation and detection. Virologica Sinica 23:5, 345-351
CrossRef144
Arun K. Ghosh, Gangli Gong, Valerie Grum-Tokars, Debbie C. Mulhearn, Susan C. Baker, Melissa Coughlin, Bellur S. Prabhakar, Katrina Sleeman, Michael E. Johnson, Andrew D. Mesecar. (2008) Design, synthesis and antiviral efficacy of a series of potent chloropyridyl ester-derived SARS-CoV 3CLpro inhibitors. Bioorganic & Medicinal Chemistry Letters 18:20, 5684-5688
CrossRef145
Alex G. Taranto, Paulo Carvalho, Mitchell A. Avery. (2008) QM/QM studies for Michael reaction in coronavirus main protease (3CLPro). Journal of Molecular Graphics and Modelling 27:3, 275-285
CrossRef146
Michael R. Roner, Charles E. Carraher, Salima Dhanji, Girish Barot. (2008) Antiviral and Anticancer Activity of Cisplatin Derivatives of Tilorone. Journal of Inorganic and Organometallic Polymers and Materials 18:3, 374-383
CrossRef147
Shunxin Wang, Feng Guo, Kangtai Liu, Hongliang Wang, Shuan Rao, Peng Yang, Chengyu Jiang. (2008) Endocytosis of the receptor-binding domain of SARS-CoV spike protein together with virus receptor ACE2. Virus Research 136:1-2, 8-15
CrossRef148
Sriram Kammila, Dipankar Das, Pravin K. Bhatnagar, Hoon H. Sunwoo, Gustavo Zayas-Zamora, Malcolm King, Mavanur R. Suresh. (2008) A rapid point of care immunoswab assay for SARS-CoV detection. Journal of Virological Methods 152:1-2, 77-84
CrossRef149
A. Gagneur, E. Dirson, S. Audebert, S. Vallet, M. C. Legrand-Quillien, Y. Laurent, M. Collet, J. Sizun, E. Oger, C. Payan. (2008) Materno-fetal transmission of human coronaviruses: a prospective pilot study. European Journal of Clinical Microbiology & Infectious Diseases 27:9, 863-866
CrossRef150
Ling-Hon Matthew Chu, Siu-Hong Chan, Sau-Na Tsai, Yi Wang, Christopher Hon-Ki Cheng, Kam-Bo Wong, Mary Miu-Yee Waye, Sai-Ming Ngai. (2008) Fusion core structure of the severe acute respiratory syndrome coronavirus (SARS-CoV): In search of potent SARS-CoV entry inhibitors. Journal of Cellular Biochemistry 104:6, 2335-2347
CrossRef151
C.-Y. Lu, H.-Y. Huang, T.-H. Yang, L.-Y. Chang, C.-Y. Lee, L.-M. Huang. (2008) siRNA silencing of angiotensin-converting enzyme 2 reduced severe acute respiratory syndrome-associated coronavirus replications in Vero E6 cells. European Journal of Clinical Microbiology & Infectious Diseases 27:8, 709-715
CrossRef152
Philippe Roingeard. (2008) Viral detection by electron microscopy: past, present and future. Biology of the Cell 100:8, 491
CrossRef153
Tsui-Yi Peng, Kuan-Rong Lee, Woan-Yuh Tarn. (2008) Phosphorylation of the arginine/serine dipeptide-rich motif of the severe acute respiratory syndrome coronavirus nucleocapsid protein modulates its multimerization, translation inhibitory activity and cellular localization. FEBS Journal 275:16, 4152-4163
CrossRef154
Yasser EL‐Manzalawy, Drena Dobbs, Vasant Honavar. (2008) Predicting linear B‐cell epitopes using string kernels. Journal of Molecular Recognition 21:4, 243-255
CrossRef155
T.P. Sloots, D.M. Whiley, S.B. Lambert, M.D. Nissen. (2008) Emerging respiratory agents: New viruses for old diseases?. Journal of Clinical Virology 42:3, 233-243
CrossRef156
Cecilia Santamaría, Analía Urueña, Cristina Videla, Ariel Suarez, Cecilia Ganduglia, Guadalupe Carballal, Pablo Bonvehi, Marcela Echavarría. (2008) Epidemiological study of influenza virus infections in young adult outpatients from Buenos Aires, Argentina. Influenza and Other Respiratory Viruses 2:4, 131-134
CrossRef157
Marta L. DeDiego, Lecia Pewe, Enrique Alvarez, Maria Teresa Rejas, Stanley Perlman, Luis Enjuanes. (2008) Pathogenicity of severe acute respiratory coronavirus deletion mutants in hACE-2 transgenic mice. Virology 376:2, 379-389
CrossRef158
Heidi Smuts. (2008) Human coronavirus NL63 infections in infants hospitalised with acute respiratory tract infections in South Africa. Influenza and Other Respiratory Viruses 2:4, 135-138
CrossRef159
Ruchi Ratra, Sunil K. Lal. (2008) Functional genomics as a tool in virus research. Indian Journal of Microbiology 48:2, 195-201
CrossRef160
Yohichi Kumaki, Craig W. Day, Miles K. Wandersee, Bradley P. Schow, Justin S. Madsen, Dixon Grant, Jason P. Roth, Donald F. Smee, Lawrence M. Blatt, Dale L. Barnard. (2008) Interferon alfacon 1 inhibits SARS-CoV infection in human bronchial epithelial Calu-3 cells. Biochemical and Biophysical Research Communications 371:1, 110-113
CrossRef161
Ghee-Chee Phua, Joseph Govert. (2008) Mechanical Ventilation in an Airborne Epidemic. Clinics in Chest Medicine 29:2, 323-328
CrossRef162
Noriyo Nagata, Naoko Iwata, Hideki Hasegawa, Shuetsu Fukushi, Ayako Harashima, Yuko Sato, Masayuki Saijo, Fumihiro Taguchi, Shigeru Morikawa, Tetsutaro Sata. (2008) Mouse-Passaged Severe Acute Respiratory Syndrome-Associated Coronavirus Leads to Lethal Pulmonary Edema and Diffuse Alveolar Damage in Adult but Not Young Mice. The American Journal of Pathology 172:6, 1625-1637
CrossRef163
Sagar U. Kapadia, Ian D. Simon, John K. Rose. (2008) SARS vaccine based on a replication-defective recombinant vesicular stomatitis virus is more potent than one based on a replication-competent vector. Virology 376:1, 165-172
CrossRef164
Anna Golda, Krzysztof Pyrc. (2008) Recent antiviral strategies against human coronavirus-related respiratory illnesses. Current Opinion in Pulmonary Medicine 14:3, 248-253
CrossRef165
Isabelle Imbert, Eric J. Snijder, Maria Dimitrova, Jean-Claude Guillemot, Patrick Lécine, Bruno Canard. (2008) The SARS-Coronavirus PLnc domain of nsp3 as a replication/transcription scaffolding protein. Virus Research 133:2, 136-148
CrossRef166
David S Hui, Paul KS Chan. (2008) Clinical features, pathogenesis and immunobiology of severe acute respiratory syndrome. Current Opinion in Pulmonary Medicine 14:3, 241-247
CrossRef167
Jianli Dong, Juan P. Olano, Jere W. McBride, David H. Walker. (2008) Emerging Pathogens: Challenges and Successes of Molecular Diagnostics. The Journal of Molecular Diagnostics 10:3, 185-197
CrossRef168
Yingchun Zeng, Linbai Ye, Shengli Zhu, Hong Zheng, Peng Zhao, Weijia Cai, Liya Su, Yinglong She, Zhenghui Wu. (2008) The nucleocapsid protein of SARS-associated coronavirus inhibits B23 phosphorylation. Biochemical and Biophysical Research Communications 369:2, 287-291
CrossRef169
Y XIAO, Q MENG, X YIN, Y GUAN, Y LIU, C LI, M WANG, G LIU, T TONG, L WANG. (2008) Pathological Changes in Masked Palm Civets Experimentally Infected by Severe Acute Respiratory Syndrome (SARS) Coronavirus. Journal of Comparative Pathology 138:4, 171-179
CrossRef170
H.-X. Lin, Y. Feng, G. Wong, L. Wang, B. Li, X. Zhao, Y. Li, F. Smaill, C. Zhang. (2008) Identification of residues in the receptor-binding domain (RBD) of the spike protein of human coronavirus NL63 that are critical for the RBD-ACE2 receptor interaction. Journal of General Virology 89:4, 1015-1024
CrossRef171
Yi-Ming Shao, Wen-Bin Yang, Tun-Hsun Kuo, Keng-Chang Tsai, Chun-Hung Lin, An-Suei Yang, Po-Huang Liang, Chi-Huey Wong. (2008) Design, synthesis, and evaluation of trifluoromethyl ketones as inhibitors of SARS-CoV 3CL protease. Bioorganic & Medicinal Chemistry 16:8, 4652-4660
CrossRef172
Valerie Grum-Tokars, Kiira Ratia, Adrian Begaye, Susan C. Baker, Andrew D. Mesecar. (2008) Evaluating the 3C-like protease activity of SARS-Coronavirus: Recommendations for standardized assays for drug discovery. Virus Research 133:1, 63-73
CrossRef173
Amy C. Sims, Susan E. Burkett, Boyd Yount, Raymond J. Pickles. (2008) SARS-CoV replication and pathogenesis in an in vitro model of the human conducting airway epithelium. Virus Research 133:1, 33-44
CrossRef174
R. Huang, I. Agranovski, O. Pyankov, S. Grinshpun. (2008) Removal of viable bioaerosol particles with a low-efficiency HVAC filter enhanced by continuous emission of unipolar air ions. Indoor Air 18:2, 106-112
CrossRef175
Luis Enjuanes, Marta L. DeDiego, Enrique Álvarez, Damon Deming, Tim Sheahan, Ralph Baric. (2008) Vaccines to prevent severe acute respiratory syndrome coronavirus-induced disease. Virus Research 133:1, 45-62
CrossRef176
Yong-Kyu Chu, Georgia D. Ali, Fuli Jia, Qianjun Li, David Kelvin, Ronald C. Couch, Kevin S. Harrod, Julie A. Hutt, Cheryl Cameron, Susan R. Weiss, Colleen B. Jonsson. (2008) The SARS-CoV ferret model in an infection–challenge study. Virology 374:1, 151-163
CrossRef177
Yong Guo, Christine Korteweg, Michael A. McNutt, Jiang Gu. (2008) Pathogenetic mechanisms of severe acute respiratory syndrome. Virus Research 133:1, 4-12
CrossRef178
Zhengli Shi, Zhihong Hu. (2008) A review of studies on animal reservoirs of the SARS coronavirus. Virus Research 133:1, 74-87
CrossRef179
Daniel Janies, Farhat Habib, Boyan Alexandrov, Andrew Hill, Diego Pol. (2008) Evolution of genomes, host shifts and the geographic spread of SARS-CoV and related coronaviruses. Cladistics 24:2, 111-130
CrossRef180
Chun Li, Lili Xing, Xin Wang. (2008) 2-D graphical representation of protein sequences and its application to coronavirus phylogeny. BMB Reports 41:3, 217-222
CrossRef181
Lichun Li, Hyojeung Kang, Pinghua Liu, Nick Makkinje, Shawn T. Williamson, Julian L. Leibowitz, David P. Giedroc. (2008) Structural Lability in Stem–Loop 1 Drives a 5′ UTR–3′ UTR Interaction in Coronavirus Replication. Journal of Molecular Biology 377:3, 790-803
CrossRef182
S. Bialasiewicz, D.M. Whiley, S.B. Lambert, K. Jacob, C. Bletchly, D. Wang, M.D. Nissen, T.P. Sloots. (2008) Presence of the newly discovered human polyomaviruses KI and WU in Australian patients with acute respiratory tract infection. Journal of Clinical Virology 41:2, 63-68
CrossRef183
Yasushi Ami, Noriyo Nagata, Kazuya Shirato, Rie Watanabe, Naoko Iwata, Keiko Nakagaki, Shuetsu Fukushi, Masayuki Saijo, Shigeru Morikawa, Fumihiro Taguchi. (2008) Co-infection of respiratory bacterium with severe acute respiratory syndrome coronavirus induces an exacerbated pneumonia in mice. Microbiology and Immunology 52:2, 118-127
CrossRef184
Jeffrey Kahn. (2008) Human bocavirus: clinical significance and implications. Current Opinion in Pediatrics 20:1, 62-66
CrossRef185
Bingke Bai, Xinya Lu, Jin Meng, Qinxue Hu, Panyong Mao, Baojing Lu, Ze Chen, Zhiming Yuan, Hanzhong Wang. (2008) Vaccination of mice with recombinant baculovirus expressing spike or nucleocapsid protein of SARS-like coronavirus generates humoral and cellular immune responses. Molecular Immunology 45:4, 868-875
CrossRef186
Hongliang Wang, Peng Yang, Kangtai Liu, Feng Guo, Yanli Zhang, Gongyi Zhang, Chengyu Jiang. (2008) SARS coronavirus entry into host cells through a novel clathrin- and caveolae-independent endocytic pathway. Cell Research 18:2, 290-301
CrossRef187
Gavin M. Joynt. 2008. Severe Acute Respiratory Syndrome (SARS). , 61-66.
CrossRef188
Mo Yang, Margaret H.L. Ng, Chi Kong Li, Paul K.S. Chan, Chang Liu, Jie Yu Ye, Beng H. Chong. (2008) Thrombopoietin levels increased in patients with severe acute respiratory syndrome. Thrombosis Research 122:4, 473-477
CrossRef189
Philip Keith Pattemore, Lance C. Jennings. 2008. Epidemiology of Respiratory Infections. , 435-452.
CrossRef190
Antoine Rabbat, Gérard J. Huchon. 2008. Nonbacterial Pneumonia. , 351-364.
CrossRef191
Chunying Niu, Jiang Yin, Jianmin Zhang, John C. Vederas, Michael N.G. James. (2008) Molecular docking identifies the binding of 3-chloropyridine moieties specifically to the S1 pocket of SARS-CoV Mpro. Bioorganic & Medicinal Chemistry 16:1, 293-302
CrossRef192
Mark Bartlam, Xiaoyu Xue, Zihe Rao. (2008) The search for a structural basis for therapeutic intervention against the SARS coronavirus. Acta Crystallographica Section A Foundations of Crystallography 64:1, 204-213
CrossRef193
Qingang Yang, Lili Chen, Xuchang He, Zhenting Gao, Xu Shen, Donglu Bai. (2008) Design and Synthesis of Cinanserin Analogs as Severe Acute Respiratory Syndrome Coronavirus 3CL Protease Inhibitors. CHEMICAL & PHARMACEUTICAL BULLETIN 56:10, 1400-1405
CrossRef194
Sean P. Elliott, C. George Ray. 2008. Viral Infections of the Lower Respiratory Tract. , 481-489.
CrossRef195
K.-Y. Hwa, W. M. Lin, Y.-I. Hou, T.-M. Yeh. (2008) Peptide Mimicrying Between SARS Coronavirus Spike Protein and Human Proteins Reacts with SARS Patient Serum. Journal of Biomedicine and Biotechnology 2008, 1-9
CrossRef196
Chung-Hua Hsu, Kung-Chang Hwang, Chung-Liang Chao, Steve G. N. Chang, Mei-Shang Ho, Jaung-Geng Lin, Hen-Hong Chang, Shung-Te Kao, Yi-Ming Chen, Pesus Chou. (2008) An Evaluation of the Additive Effect of Natural Herbal Medicine on SARS or SARS-Like Infectious Diseases in 2003: A Randomized, Double-Blind, and Controlled Pilot Study. Evidence-Based Complementary and Alternative Medicine 5:3, 355-362
CrossRef197
Betty Shuc Han Wills, Janice M. Morse. (2008) Responses of Chinese Elderly to the Threat of Severe Acute Respiratory Syndrome (SARS) in a Canadian Community. Public Health Nursing 25:1, 57-68
CrossRef198
Noriyo Nagata, Naoko Iwata, Hideki Hasegawa, Yuko Sato, Shigeru Morikawa, Masayuki Saijo, Shigeyuki Itamura, Takehiko Saito, Yasushi Ami, Takato Odagiri, Masato Tashiro, Tetsutaro Sata. (2007) Pathology and virus dispersion in cynomolgus monkeys experimentally infected with severe acute respiratory syndrome coronavirus via different inoculation routes. International Journal of Experimental Pathology 88:6, 403-414
CrossRef199
Xinya Lu, Yao Chen, Bingke Bai, Hui Hu, Ling Tao, Jihong Yang, Jianjun Chen, Ze Chen, Zhihong Hu, Hanzhong Wang. (2007) Immune responses against severe acute respiratory syndrome coronavirus induced by virus-like particles in mice. Immunology 122:4, 496-502
CrossRef200
Yu-Ching Lee, Sy-Jye C. Leu, Chaur-Jong Hu, Neng-Yao Shih, I-Jen Huang, Hsueh-Hsia Wu, Wen-Shyang Hsieh, Bor-Luen Chiang, Wen-Ta Chiu, Yi-Yuan Yang. (2007) Chicken single-chain variable fragments against the SARS-CoV spike protein. Journal of Virological Methods 146:1-2, 104-111
CrossRef201
Jane D. Siegel, Emily Rhinehart, Marguerite Jackson, Linda Chiarello. (2007) 2007 Guideline for Isolation Precautions: Preventing Transmission of Infectious Agents in Health Care Settings. American Journal of Infection Control 35:10, S65-S164
CrossRef202
Jianqiang Zhang, James S. Guy, Eric J. Snijder, Doug A. Denniston, Peter J. Timoney, Udeni B.R. Balasuriya. (2007) Genomic characterization of equine coronavirus. Virology 369:1, 92-104
CrossRef203
Tanya A. Miura, Jieru Wang, Kathryn V. Holmes, Robert J. Mason. (2007) Rat coronaviruses infect rat alveolar type I epithelial cells and induce expression of CXC chemokines. Virology 369:2, 288-298
CrossRef204
Jinzhi Tan, Yuri Kusov, Doris Mutschall, Stefanie Tech, Krishna Nagarajan, Rolf Hilgenfeld, Christian L. Schmidt. (2007) The “SARS-unique domain” (SUD) of SARS coronavirus is an oligo(G)-binding protein. Biochemical and Biophysical Research Communications 364:4, 877-882
CrossRef205
N. Lee, P.K.S. Chan, I.T. Yu, K.K. Tsoi, G. Lui, J.J.Y. Sung, C.S. Cockram. (2007) Co-circulation of human metapneumovirus and SARS-associated coronavirus during a major nosocomial SARS outbreak in Hong Kong. Journal of Clinical Virology 40:4, 333-337
CrossRef206
Margareta Ieven. (2007) Currently used nucleic acid amplification tests for the detection of viruses and atypicals in acute respiratory infections. Journal of Clinical Virology 40:4, 259-276
CrossRef207
Liang Lin, Jianmin Shao, Maomao Sun, Jinxiu Liu, Gongjin Xu, Xumin Zhang, Ningzhi Xu, Rong Wang, Siqi Liu. (2007) Identification of phosphorylation sites in the nucleocapsid protein (N protein) of SARS-coronavirus. International Journal of Mass Spectrometry 268:2-3, 296-303
CrossRef208
Marc Desforges, Tina C. Miletti, Mylène Gagnon, Pierre J. Talbot. (2007) Activation of human monocytes after infection by human coronavirus 229E. Virus Research 130:1-2, 228-240
CrossRef209
Xiuping Shao, Xiaojie Guo, Frank Esper, Carla Weibel, Jeffrey S. Kahn. (2007) Seroepidemiology of group I human coronaviruses in children. Journal of Clinical Virology 40:3, 207-213
CrossRef210
Arun K. Ghosh, Kai Xi, Valerie Grum-Tokars, Xiaoming Xu, Kiira Ratia, Wentao Fu, Katherine V. Houser, Susan C. Baker, Michael E. Johnson, Andrew D. Mesecar. (2007) Structure-based design, synthesis, and biological evaluation of peptidomimetic SARS-CoV 3CLpro inhibitors. Bioorganic & Medicinal Chemistry Letters 17:21, 5876-5880
CrossRef211
Daniel H. Libraty, Kimberly M. O'Neil, Lauren M. Baker, Luz P. Acosta, Remigio M. Olveda. (2007) Human CD4+ memory T-lymphocyte responses to SARS coronavirus infection. Virology 368:2, 317-321
CrossRef212
Xiaonan Fang, Jinrong Gao, Hong Zheng, Baozong Li, Lingbao Kong, Yijuan Zhang, Wei Wang, Yingchun Zeng, Linbai Ye. (2007) The membrane protein of SARS-CoV suppresses NF-κB activation. Journal of Medical Virology 79:10, 1431-1439
CrossRef213
José María Navarro-Marí, Mercedes Pérez-Ruiz. (2007) Virus respiratorios: viejos y nuevos virus. Revisión de métodos diagnósticos. Enfermedades Infecciosas y Microbiología Clínica 25, 60-65
CrossRef214
Chuan-hai Zhang, Xin-jian Liu, Yi-fei Wang, Jia-hai Lu, Huan-ying Zheng, Sheng Xiong, Mei-ying Zhang, Qiu-ying Liu. (2007) Immune responses and histopathological changes in rabbits immunized with inactivated SARS coronavirus. Virologica Sinica 22:5, 360-365
CrossRef215
Ping Chen, Miao Jiang, Tao Hu, Qingzhen Liu, Xiaojiang S. Chen, Deyin Guo. (2007) Biochemical Characterization of Exoribonuclease Encoded by SARS Coronavirus. Journal of Biochemistry and molecular biology 40:5, 649-655
CrossRef216
Lei Ba, Christopher E. Yi, Linqi Zhang, David D. Ho, Zhiwei Chen. (2007) Heterologous MVA-S prime Ad5-S boost regimen induces high and persistent levels of neutralizing antibody response against SARS coronavirus. Applied Microbiology and Biotechnology 76:5, 1131-1136
CrossRef217
Mark Bartlam, Yuanyuan Xu, Zihe Rao. (2007) Structural proteomics of the SARS coronavirus: a model response to emerging infectious diseases. Journal of Structural and Functional Genomics 8:2-3, 85-97
CrossRef218
Frank Q. Li, James P. Tam, Ding Xiang Liu. (2007) Cell cycle arrest and apoptosis induced by the coronavirus infectious bronchitis virus in the absence of p53. Virology 365:2, 435-445
CrossRef219
Seweryn Bialasiewicz, David M. Whiley, Stephen B. Lambert, David Wang, Michael D. Nissen, Theo P. Sloots. (2007) A newly reported human polyomavirus, KI virus, is present in the respiratory tract of Australian children. Journal of Clinical Virology 40:1, 15-18
CrossRef220
Purnima Kumar, Vithiagaran Gunalan, Boping Liu, Vincent T.K. Chow, Julian Druce, Chris Birch, Mike Catton, Burtram C. Fielding, Yee-Joo Tan, Sunil K. Lal. (2007) The nonstructural protein 8 (nsp8) of the SARS coronavirus interacts with its ORF6 accessory protein. Virology 366:2, 293-303
CrossRef221
Youjun Feng, George F. Gao. (2007) Towards our understanding of SARS-CoV, an emerging and devastating but quickly conquered virus. Comparative Immunology, Microbiology and Infectious Diseases 30:5-6, 309-327
CrossRef222
Pinhong Wang, Yaqing Chang, Jinhai Yu, Chunyan Li, Gaorong Xu. (2007) Acute peristome edema disease in juvenile and adult sea cucumbers Apostichopus japonicus (Selenka) reared in North China. Journal of Invertebrate Pathology 96:1, 11-17
CrossRef223
Nan Yang, Julian A. Tanner, Bo-Jian Zheng, Rory M. Watt, Ming-Liang He, Lin-Yu Lu, Jie-Qing Jiang, Ka-To Shum, Yong-Ping Lin, Kin-Ling Wong, Marie C. M. Lin, Hsiang-Fu Kung, Hongzhe Sun, Jian-Dong Huang. (2007) Bismuth Complexes Inhibit the SARS Coronavirus. Angewandte Chemie 119:34, 6584-6588
CrossRef224
Nan Yang, Julian A. Tanner, Bo-Jian Zheng, Rory M. Watt, Ming-Liang He, Lin-Yu Lu, Jie-Qing Jiang, Ka-To Shum, Yong-Ping Lin, Kin-Ling Wong, Marie C. M. Lin, Hsiang-Fu Kung, Hongzhe Sun, Jian-Dong Huang. (2007) Bismuth Complexes Inhibit the SARS Coronavirus. Angewandte Chemie International Edition 46:34, 6464-6468
CrossRef225
Mary C. Hu, Taff Jones, Richard T. Kenney, Dale L. Barnard, David S. Burt, George H. Lowell. (2007) Intranasal Protollin-formulated recombinant SARS S-protein elicits respiratory and serum neutralizing antibodies and protection in mice. Vaccine 25:34, 6334-6340
CrossRef226
Zhijie Xiao, Bin Lian, Jun Chen, H. Henry Teng. (2007) Design and application of the method for isolating magnetotactic bacteria. Chinese Journal of Geochemistry 26:3, 252-258
CrossRef227
ZhengXue Liu, ZhanHui Wang, YingLe Liu, Wei Dong, YiPeng Qi. (2007) Analysis of proteins that interact with nucleocapsid protein of SARS-CoV using 15-mer phage-displayed library. Chinese Science Bulletin 52:15, 2072-2080
CrossRef228
Z. Zhu, S. Chakraborti, Y. He, A. Roberts, T. Sheahan, X. Xiao, L. E. Hensley, P. Prabakaran, B. Rockx, I. A. Sidorov, D. Corti, L. Vogel, Y. Feng, J.-O. Kim, L.-F. Wang, R. Baric, A. Lanzavecchia, K. M. Curtis, G. J. Nabel, K. Subbarao, S. Jiang, D. S. Dimitrov. (2007) Potent cross-reactive neutralization of SARS coronavirus isolates by human monoclonal antibodies. Proceedings of the National Academy of Sciences 104:29, 12123-12128
CrossRef229
Benoît Callendret, Valérie Lorin, Pierre Charneau, Philippe Marianneau, Hugues Contamin, Jean-Michel Betton, Sylvie van der Werf, Nicolas Escriou. (2007) Heterologous viral RNA export elements improve expression of severe acute respiratory syndrome (SARS) coronavirus spike protein and protective efficacy of DNA vaccines against SARS. Virology 363:2, 288-302
CrossRef230
G.-p. Zhao. (2007) SARS molecular epidemiology: a Chinese fairy tale of controlling an emerging zoonotic disease in the genomics era. Philosophical Transactions of the Royal Society B: Biological Sciences 362:1482, 1063-1081
CrossRef231
Robert McLean. 2007. The Introduction and Emergence of Wildlife Diseases in North America. , 261-278.
CrossRef232
Ajoy Basak, Abhijit Mitra, Sarmistha Basak, Carolyn Pasko, Michel Chrétien, Pamela Seaton. (2007) A Fluorogenic Peptide Containing the Processing Site of Human SARS Corona Virus S-Protein: Kinetic Evaluation and NMR Structure Elucidation. ChemBioChem 8:9, 1029-1037
CrossRef233
Rana Hajizadeh, Hiroe Sato, James Carlisle, Michele T. Nadaf, Whitney Evans, Bryan E. Shepherd, Robert F. Miller, Spyros A. Kalams, Wonder Puryear Drake. (2007) Mycobacterium tuberculosis Antigen 85A Induces Th-1 Immune Responses in Systemic Sarcoidosis. Journal of Clinical Immunology 27:4, 445-454
CrossRef234
Gary W.K. Wong, Ting F. Leung. (2007) Bird flu: lessons from SARS. Paediatric Respiratory Reviews 8:2, 171-176
CrossRef235
Jennifer A Maynard, Ryan Myhre, Benjamin Roy. (2007) Microarrays in infection and immunity. Current Opinion in Chemical Biology 11:3, 306-315
CrossRef236
Yan Wei-ming, Huang Jia-quan, Luo Xiao-ping, Ning Qin. (2007) Expression of prothrombinase/fibroleukin gene fg12 in lung impairment in a murine severe acute respiratory syndrome model. Virologica Sinica 22:3, 181-192
CrossRef237
Tatsuhiko Kakisaka, Tadashi Kondo, Tetsuya Okano, Kiyonaga Fujii, Kazufumi Honda, Mitsufumi Endo, Akihiko Tsuchida, Tatsuya Aoki, Takao Itoi, Fuminori Moriyasu, Tesshi Yamada, Harubumi Kato, Toshihide Nishimura, Satoru Todo, Setsuo Hirohashi. (2007) Plasma proteomics of pancreatic cancer patients by multi-dimensional liquid chromatography and two-dimensional difference gel electrophoresis (2D-DIGE): Up-regulation of leucine-rich alpha-2-glycoprotein in pancreatic cancer. Journal of Chromatography B 852:1-2, 257-267
CrossRef238
Hui-Min Wang, Po-Huang Liang. (2007) Pharmacophores and biological activities of severe acute respiratory syndrome viral protease inhibitors. Expert Opinion on Therapeutic Patents 17:5, 533-546
CrossRef239
Silke Stertz, Mike Reichelt, Martin Spiegel, Thomas Kuri, Luis Martínez-Sobrido, Adolfo García-Sastre, Friedemann Weber, Georg Kochs. (2007) The intracellular sites of early replication and budding of SARS-coronavirus. Virology 361:2, 304-315
CrossRef240
Tomoshige Kino, George P. Chrousos. (2007) Virus-mediated modulation of the host endocrine signaling systems: clinical implications. Trends in Endocrinology & Metabolism 18:4, 159-166
CrossRef241
Rikke Leth-Larsen, Fei Zhong, Vincent T.K. Chow, Uffe Holmskov, Jinhua Lu. (2007) The SARS coronavirus spike glycoprotein is selectively recognized by lung surfactant protein D and activates macrophages. Immunobiology 212:3, 201-211
CrossRef242
Yu-Ching Lee, Sy-Jye C. Leu, Han-Chang Hung, Hsueh-Hsia Wu, I.-Jen Huang, Wen-Shyang Hsieh, Wen-Ta Chiu, Ming-Song Hsieh, Tsui-Fen Cheng, Yi-Yuan Yang. (2007) A dominant antigenic epitope on SARS-CoV spike protein identified by an avian single-chain variable fragment (scFv)-expressing phage. Veterinary Immunology and Immunopathology 117:1-2, 75-85
CrossRef243
Jun Chen, Kanta Subbarao. (2007) The Immunobiology of SARS *. Annual Review of Immunology 25:1, 443-472
CrossRef244
L. J. Anderson. (2007) Human Bocavirus: A New Viral Pathogen. Clinical Infectious Diseases 44:7, 911-912
CrossRef245
RANGARAJAN SAMPATH, THOMAS A. HALL, CHRISTIAN MASSIRE, FENG LI, LAWRENCE B. BLYN, MARK W. ESHOO, STEVEN A. HOFSTADLER, DAVID J. ECKER. (2007) Rapid Identification of Emerging Infectious Agents Using PCR and Electrospray Ionization Mass Spectrometry. Annals of the New York Academy of Sciences 1102:1, 109-120
CrossRef246
Krzysztof Pyrc, Ben Berkhout, Lia van der Hoek. (2007) Identification of new human coronaviruses. Expert Review of Anti-infective Therapy 5:2, 245-253
CrossRef247
Ryan E Longman, Timothy RB Johnson. (2007) Viral respiratory disease in pregnancy. Current Opinion in Obstetrics and Gynecology 19:2, 120-125
CrossRef248
Chad M. Petit, Vladimir N. Chouljenko, Arun Iyer, Robin Colgrove, Michael Farzan, David M. Knipe, K.G. Kousoulas. (2007) Palmitoylation of the cysteine-rich endodomain of the SARS–coronavirus spike glycoprotein is important for spike-mediated cell fusion. Virology 360:2, 264-274
CrossRef249
Yvonne R Chan, Alison Morris. (2007) Molecular diagnostic methods in pneumonia. Current Opinion in Infectious Diseases 20:2, 157-164
CrossRef250
X. B. Ke, H. Y. Zhu, X. P. Gao, J. W. Liu, Z. F. Zheng. (2007) High-Performance Ceramic Membranes with a Separation Layer of Metal Oxide Nanofibers. Advanced Materials 19:6, 785-790
CrossRef251
Feng Ge, Yonghu Luo, Pei Xiong Liew, Eugene Hung. (2007) Derivation of a novel SARS–coronavirus replicon cell line and its application for anti-SARS drug screening. Virology 360:1, 150-158
CrossRef252
Hua Yu, Li-Fang Jiang, Dan-Yun Fang, Hui-Jun Yan, Jing-Jiao Zhou, Jun-Mei Zhou, Yu Liang, Yang Gao, Wei Zhao, Bei-Guo Long. (2007) Selection of SARS-Coronavirus-specific B cell epitopes by phage peptide library screening and evaluation of the immunological effect of epitope-based peptides on mice. Virology 359:2, 264-274
CrossRef253
T. H. Rainer, N. Lee, M. Ip, A. P. Galvani, G. E. Antonio, K. T. Wong, D. P. N. Chan, A. W. H. Ng, K. K. Shing, S. S. L. Chau, P. Mak, P. K. S. Chan, A. T. Ahuja, D. S. Hui, J. J. Y. Sung. (2007) Features discriminating SARS from other severe viral respiratory tract infections. European Journal of Clinical Microbiology & Infectious Diseases 26:2, 121-129
CrossRef254
Ting-Wai Lee, Maia M. Cherney, Jie Liu, Karen Ellis James, James C. Powers, Lindsay D. Eltis, Michael N.G. James. (2007) Crystal Structures Reveal an Induced-fit Binding of a Substrate-like Aza-peptide Epoxide to SARS Coronavirus Main Peptidase. Journal of Molecular Biology 366:3, 916-932
CrossRef255
Thomas Mourez, Astrid Vabret, Yang Han, Julia Dina, Loïc Legrand, Sandrine Corbet, François Freymuth. (2007) Baculovirus expression of HCoV-OC43 nucleocapsid protein and development of a Western blot assay for detection of human antibodies against HCoV-OC43. Journal of Virological Methods 139:2, 175-180
CrossRef256
Xiaoyu Xue, Haitao Yang, Wei Shen, Qi Zhao, Jun Li, Kailin Yang, Cheng Chen, Yinghua Jin, Mark Bartlam, Zihe Rao. (2007) Production of Authentic SARS-CoV Mpro with Enhanced Activity: Application as a Novel Tag-cleavage Endopeptidase for Protein Overproduction. Journal of Molecular Biology 366:3, 965-975
CrossRef257
Georgie Fear, Slavko Komarnytsky, Ilya Raskin. (2007) Protease inhibitors and their peptidomimetic derivatives as potential drugs. Pharmacology & Therapeutics 113:2, 354-368
CrossRef258
S. Escutenaire, N. Mohamed, M. Isaksson, P. Thorén, B. Klingeborn, S. Belák, M. Berg, J. Blomberg. (2007) SYBR Green real-time reverse transcription-polymerase chain reaction assay for the generic detection of coronaviruses. Archives of Virology 152:1, 41-58
CrossRef259
Yung-Liang Wan, Pei-Kwei Tsay, Yun-Chung Cheung, Ping-Cherng Chiang, Chun-Hua Wang, Ying-Huang Tsai, Han-Ping Kuo, Kuo-Chien Tsao, Tzou-Yien Lin. (2007) A Correlation between the Severity of Lung Lesions on Radiographs and Clinical Findings in Patients with Severe Acute Respiratory Syndrome. Korean Journal of Radiology 8:6, 466
CrossRef260
Sonia Zúñiga, Isabel Sola, Jose L. Moreno, Patricia Sabella, Juan Plana-Durán, Luis Enjuanes. (2007) Coronavirus nucleocapsid protein is an RNA chaperone. Virology 357:2, 215-227
CrossRef261
Masahiro Kitabatake, Shingo Inoue, Fumihiko Yasui, Shoji Yokochi, Masaaki Arai, Kouichi Morita, Hisatoshi Shida, Minoru Kidokoro, Fukashi Murai, Mai Quynh Le, Kyosuke Mizuno, Kouji Matsushima, Michinori Kohara. (2007) SARS-CoV spike protein-expressing recombinant vaccinia virus efficiently induces neutralizing antibodies in rabbits pre-immunized with vaccinia virus. Vaccine 25:4, 630-637
CrossRef262
Hongliang Wang, Shuan Rao, Chengyu Jiang. (2007) Molecular pathogenesis of severe acute respiratory syndrome. Microbes and Infection 9:1, 119-126
CrossRef263
Mao-Chang Su, Yu-Tang Hsieh, Yi-Hsi Wang, An-Shen Lin, Yu-Hsiu Chung, Meng-Chih Lin. (2007) Exercise Capacity and Pulmonary Function in Hospital Workers Recovered from Severe Acute Respiratory Syndrome. Respiration 74:5, 511-516
CrossRef264
Lauren J. Stockman, Mehran S. Massoudi, Rita Helfand, Dean Erdman, Alison M. Siwek, Larry J. Anderson, Umesh D. Parashar. (2007) Severe Acute Respiratory Syndrome in Children. The Pediatric Infectious Disease Journal 26:1, 68-74
CrossRef265
Tetsutaro Sata. (2007) Pathogenesis of Viral Infection in Esophagus, Trachea and Lung. Nihon Kikan Shokudoka Gakkai Kaiho 58:2, 97-102
CrossRef266
Apiradee Theamboonlers, Rujipat Samransamruajkit, Chittima Thongme, Alongkorn Amonsin, Voranush Chongsrisawat, Yong Poovorawan. (2007) Human Coronavirus Infection among Children with Acute Lower Respiratory Tract Infection in Thailand. Intervirology 50:2, 71-77
CrossRef267
Xue Zhang, Kailang Wu, Xin Yue, Ying Zhu, Jianguo Wu. (2007) Inhibition of SARS-CoV Gene Expression by Adenovirus-Delivered Small Hairpin RNA. Intervirology 50:2, 63-70
CrossRef268
Gu-Choul Shin, Yoon-Seok Chung, In-Soo Kim, Hae-Wol Cho, Chun Kang. (2006) Preparation and characterization of a novel monoclonal antibody specific to severe acute respiratory syndrome-coronavirus nucleocapsid protein. Virus Research 122:1-2, 109-118
CrossRef269
Susanna Esposito, Samantha Bosis, Hubert G.M. Niesters, Elena Tremolati, Enrica Begliatti, Alessandro Rognoni, Claudia Tagliabue, Nicola Principi, Albert D.M.E. Osterhaus. (2006) Impact of human coronavirus infections in otherwise healthy children who attended an emergency department. Journal of Medical Virology 78:12, 1609-1615
CrossRef270
Mark R. Looney. (2006) Newly Recognized Causes of Acute Lung Injury: Transfusion of Blood Products, Severe Acute Respiratory Syndrome, and Avian Influenza. Clinics in Chest Medicine 27:4, 591-600
CrossRef271
Qian Feng, Yingying Liu, Xiuxia Qu, Hongkui Deng, Mingxiao Ding, Terence L.T. Lau, Albert Cheung-Hoi Yu, Jianguo Chen. (2006) Baculovirus Surface Display of SARS Coronavirus (SARS-CoV) Spike Protein and Immunogenicity of the Displayed Protein in Mice Models. DNA and Cell Biology 25:12, 668-673
CrossRef272
Bianca M. Bussmann, Sven Reiche, Lotta H. Jacob, Jan Matthias Braun, Christian Jassoy. (2006) Antigenic and cellular localisation analysis of the severe acute respiratory syndrome coronavirus nucleocapsid protein using monoclonal antibodies. Virus Research 122:1-2, 119-126
CrossRef273
Charles E. Carraher, Theodore S. Sabir, Michael R. Roner, Kimberely Shahi, Robert E. Bleicher, Joanne L. Roehr, Kelly D. Bassett. (2006) Synthesis of Organotin Polyamine Ethers Containing Acyclovir and their Preliminary Anticancer and Antiviral Activity. Journal of Inorganic and Organometallic Polymers and Materials 16:3, 249-257
CrossRef274
Jung-Yien CHIEN, Po-Ren HSUEH, Wern-Cherng CHENG, Chong-Jen YU, Pan-Chyr YANG. (2006) Temporal changes in cytokine/chemokine profiles and pulmonary involvement in severe acute respiratory syndrome. Respirology 11:6, 715-722
CrossRef275
Helen E. Ambrose, Jonathan P. Clewley. (2006) Virus discovery by sequence-independent genome amplification. Reviews in Medical Virology 16:6, 365-383
CrossRef276
Zheng Fan, Yue Zhuo, Xinyu Tan, Zhi Zhou, Jiangang Yuan, Boqin Qiang, Jinghua Yan, Xiaozhong Peng, George F. Gao. (2006) SARS-CoV nucleocapsid protein binds to hUbc9, a ubiquitin conjugating enzyme of the sumoylation system. Journal of Medical Virology 78:11, 1365-1373
CrossRef277
L He, Y Ding, Q Zhang, X Che, Y He, H Shen, H Wang, Z Li, L Zhao, J Geng, Y Deng, L Yang, J Li, J Cai, L Qiu, K Wen, X Xu, S Jiang. (2006) Expression of elevated levels of pro-inflammatory cytokines in SARS-CoV-infected ACE2 + cells in SARS patients: relation to the acute lung injury and pathogenesis of SARS. The Journal of Pathology 210:3, 288-297
CrossRef278
Chao Qian, Di Qin, Qiao Tang, Yi Zeng, Guixia Tang, Chun Lu. (2006) Identification of a B-cell antigenic epitope at the N-terminus of SARS-CoV M protein and characterization of monoclonal antibody against the protein. Virus Genes 33:2, 147-156
CrossRef279
Miriam E.R. Darnell, Deborah R. Taylor. (2006) Evaluation of inactivation methods for severe acute respiratory syndrome coronavirus in noncellular blood products. Transfusion 46:10, 1770-1777
CrossRef280
Jan Balzarini, Els Keyaerts, Leen Vijgen, Herman Egberink, Erik De Clercq, Marc Van Ranst, Svetlana S. Printsevskaya, Eugenia N. Olsufyeva, Svetlana E. Solovieva, Maria N. Preobrazhenskaya. (2006) Inhibition of feline (FIPV) and human (SARS) coronavirus by semisynthetic derivatives of glycopeptide antibiotics. Antiviral Research 72:1, 20-33
CrossRef281
Keiji Kuba, Yumiko Imai, Shuan Rao, Chengyu Jiang, Josef M. Penninger. (2006) Lessons from SARS: control of acute lung failure by the SARS receptor ACE2. Journal of Molecular Medicine 84:10, 814-820
CrossRef282
Dong H. Qian, Guo J. Zhu, Li Z. Wu, Guo X. Hua. (2006) Isolation and characterization of a coronavirus from pigeons with pancreatitis. American Journal of Veterinary Research 67:9, 1575-1579
CrossRef283
Wonder Puryear Drake, Lee S Newman. (2006) Mycobacterial antigens may be important in sarcoidosis pathogenesis. Current Opinion in Pulmonary Medicine 12:5, 359-363
CrossRef284
Bart L. Haagmans, Albert D.M.E. Osterhaus. (2006) Coronaviruses and their therapy. Antiviral Research 71:2-3, 397-403
CrossRef285
Bruno Sainz, Eric C. Mossel, William R. Gallaher, William C. Wimley, C.J. Peters, Russell B. Wilson, Robert F. Garry. (2006) Inhibition of severe acute respiratory syndrome-associated coronavirus (SARS-CoV) infectivity by peptides analogous to the viral spike protein. Virus Research 120:1-2, 146-155
CrossRef286
Tara M. Vogt, Marta A. Guerra, Elaine W. Flagg, Thomas G. Ksiazek, Sara A. Lowther, Paul M. Arguin. (2006) Risk of Severe Acute Respiratory Syndrome?Associated Coronavirus Transmission Aboard Commercial Aircraft. Journal of Travel Medicine 13:5, 268-272
CrossRef287
Brian Tripet, Daniel J. Kao, Scott A. Jeffers, Kathryn V. Holmes, Robert S. Hodges. (2006) Template-based coiled-coil antigens elicit neutralizing antibodies to the SARS-coronavirus. Journal of Structural Biology 155:2, 176-194
CrossRef288
Pamela Hamill, Derek Hudson, Richard Y. Kao, Polly Chow, Meera Raj, Hongyan Xu, Martin J. Richer, François Jean. (2006) Development of a red-shifted fluorescence-based assay for SARS-coronavirus 3CL protease: identification of a novel class of anti-SARS agents from the tropical marine sponge Axinella corrugata. Biological Chemistry 387:8, 1063-1074
CrossRef289
Cornelis A. M. de Haan, Peter J. M. Rottier. (2006) Hosting the severe acute respiratory syndrome coronavirus: specific cell factors required for infection. Cellular Microbiology 8:8, 1211-1218
CrossRef290
Jian Ping Liu, Jing Zhang, Hao Lu, Sally EM Bell-Syer, Jian Ping Liu. 2006. Chinese herbal medicines for treating diabetic foot ulcers. .
CrossRef291
Chao Liu, Junmin Chen, Chao Liu. 2006. Endothelin receptor antagonists for pulmonary arterial hypertension. .
CrossRef292
Christoph Meier, A. Radu Aricescu, Rene Assenberg, Robin T. Aplin, Robert J.C. Gilbert, Jonathan M. Grimes, David I. Stuart. (2006) The Crystal Structure of ORF-9b, a Lipid Binding Protein from the SARS Coronavirus. Structure 14:7, 1157-1165
CrossRef293
D.-Q. Wei, R. Zhang, Q.-S. Du, W.-N. Gao, Y. Li, H. Gao, S.-Q. Wang, X. Zhang, A.-X. Li, S. Sirois, K.-C. Chou. (2006) Anti-SARS drug screening by molecular docking. Amino Acids 31:1, 73-80
CrossRef294
Robert Snelgrove, Emily Gwyer, Tracy Hussell. (2006) Modulation of immunity to respiratory viral infection. Future Virology 1:4, 471-481
CrossRef295
Ian Brierley, Francisco J. Dos Ramos. (2006) Programmed ribosomal frameshifting in HIV-1 and the SARS–CoV. Virus Research 119:1, 29-42
CrossRef296
Pei-Win Cheng, Lean-Teik Ng, Lien-Chai Chiang, Chun-Ching Lin. (2006) ANTIVIRAL EFFECTS OF SAIKOSAPONINS ON HUMAN CORONAVIRUS 229E IN VITRO. Clinical and Experimental Pharmacology and Physiology 33:7, 612-616
CrossRef297
Giuseppe Gerna, Giulia Campanini, Francesca Rovida, Elena Percivalle, Antonella Sarasini, Antonietta Marchi, Fausto Baldanti. (2006) Genetic variability of human coronavirus OC43-, 229E-, and NL63-like strains and their association with lower respiratory tract infections of hospitalized infants and immunocompromised patients. Journal of Medical Virology 78:7, 938-949
CrossRef298
Adnan Mushtaq, Mohamed El-Azizi, Nancy Khardori. (2006) Category C Potential Bioterrorism Agents and Emerging Pathogens. Infectious Disease Clinics of North America 20:2, 423-441
CrossRef299
Yuxian He, Jingjing Li, Lanying Du, Xuxia Yan, Guangan Hu, Yusen Zhou, Shibo Jiang. (2006) Identification and characterization of novel neutralizing epitopes in the receptor-binding domain of SARS-CoV spike protein: Revealing the critical antigenic determinants in inactivated SARS-CoV vaccine. Vaccine 24:26, 5498-5508
CrossRef300
Christina K. Johnsen, Blenda Böttiger, Jens Blom. (2006) Confirmation of electron microscopy results by direct testing of viruses adhered to grids using nucleic acid amplification techniques. Journal of Virological Methods 134:1-2, 92-98
CrossRef301
Denise J. Jamieson, Jane E. Ellis, Daniel B. Jernigan, Tracee A. Treadwell. (2006) Emerging infectious disease outbreaks: Old lessons and new challenges for obstetrician-gynecologists. American Journal of Obstetrics and Gynecology 194:6, 1546-1555
CrossRef302
Fischer, Staci A., Graham, Mary Beth, Kuehnert, Matthew J., Kotton, Camille N., Srinivasan, Arjun, Marty, Francisco M., Comer, James A., Guarner, Jeannette, Paddock, Christopher D., DeMeo, Dawn L., Shieh, Wun-Ju, Erickson, Bobbie R., Bandy, Utpala, DeMaria, Alfred Jr., Davis, Jeffrey P., Delmonico, Francis L., Pavlin, Boris, Likos, Anna, Vincent, Martin J., Sealy, Tara K., Goldsmith, Cynthia S., Jernigan, Daniel B., Rollin, Pierre E., Packard, Michelle M., Patel, Mitesh, Rowland, Courtney, Helfand, Rita F., Nichol, Stuart T., Fishman, Jay A., Ksiazek, Thomas, Zaki, Sherif R., the LCMV in Transplant Recipients Investigation Team. (2006) Transmission of Lymphocytic Choriomeningitis Virus by Organ Transplantation. New England Journal of Medicine 354:21, 2235-2249
Full Text303
Tracey Baas, Jeffery K. Taubenberger, Pek Yoon Chong, Paul Chui, Michael G. Katze. (2006) SARS-CoV Virus-Host Interactions and Comparative Etiologies of Acute Respiratory Distress Syndrome as Determined by Transcriptional and Cytokine Profiling of Formalin-Fixed Paraffin-Embedded Tissues. Journal of Interferon & Cytokine Research 26:5, 309-317
CrossRef304
B. C. Pien, J. R. Saah, S. E. Miller, C. W. Woods. (2006) Use of Sentinel Laboratories by Clinicians to Evaluate Potential Bioterrorism and Emerging Infections. Clinical Infectious Diseases 42:9, 1311-1324
CrossRef305
Marianna Ofner‐Agostini, Denise Gravel, L. Clifford McDonald, Marcus Lem, Shelley Sarwal, Allison McGeer, Karen Green, Mary Vearncombe, Virginia Roth, Shirley Paton, Mark Loeb, Andrew Simor. (2006) Cluster of Cases of Severe Acute Respiratory Syndrome Among Toronto Healthcare Workers After Implementation of Infection Control Precautions: A Case Series • . Infection Control and Hospital Epidemiology 27:5, 473-478
CrossRef306
Yuxian He, Jingjing Li, Shibo Jiang. (2006) A single amino acid substitution (R441A) in the receptor-binding domain of SARS coronavirus spike protein disrupts the antigenic structure and binding activity. Biochemical and Biophysical Research Communications 344:1, 106-113
CrossRef307
Ying‐Huang Tsai, Gwo‐Hwa Wan, Yao‐Kuang Wu, Kuo‐Chien Tsao. (2006) Airborne Severe Acute Respiratory Syndrome Coronavirus Concentrations in a Negative‐Pressure Isolation Room • . Infection Control and Hospital Epidemiology 27:5, 523-525
CrossRef308
Yeou-Ping Tsao, Jian-Yu Lin, Jia-Tsrong Jan, Chih-Hsiang Leng, Chen-Chung Chu, Yuh-Cheng Yang, Show-Li Chen. (2006) HLA-A
0201 T-cell epitopes in severe acute respiratory syndrome (SARS) coronavirus nucleocapsid and spike proteins. Biochemical and Biophysical Research Communications 344:1, 63-71
CrossRef309
E. S. McBryde, G. Gibson, A. N. Pettitt, Y. Zhang, B. Zhao, D. L. S. McElwain. (2006) Bayesian modelling of an epidemic of severe acute respiratory syndrome. Bulletin of Mathematical Biology 68:4, 889-917
CrossRef310
E Ng, G Kaw. 2006. IR Imagers as Fever Monitoring Devices. , 24-1-24-30.
CrossRef311
Michael W. Quasney. (2006) Angiotensin-converting enzyme genetic variation and lung injury: Are we genetically predisposed to develop acute respiratory distress syndrome?*. Critical Care Medicine 34:4, 1261-1262
CrossRef312
Lei Gao, Yong-Sheng Ding, Hua Dai, Shi-Huang Shao, Zhen-De Huang, Kuo-Chen Chou. (2006) A novel fingerprint map for detecting SARS-CoV. Journal of Pharmaceutical and Biomedical Analysis 41:1, 246-250
CrossRef313
Erik De Clercq. (2006) Potential antivirals and antiviral strategies against SARS coronavirus infections. Expert Review of Anti-infective Therapy 4:2, 291-302
CrossRef314
Chao-Sung Chang, Pey-Lan Du, Ing-Chung Huang. (2006) Nurses' perceptions of severe acute respiratory syndrome: relationship between commitment and intention to leave nursing. Journal of Advanced Nursing 54:2, 171-179
CrossRef315
Xie Xudong, Chen Junzhu, Wang Xingxiang, Zhang Furong, Liu Yanrong. (2006) Age- and gender-related difference of ACE2 expression in rat lung. Life Sciences 78:19, 2166-2171
CrossRef316
Yi-Qiang Cheng. (2006) Deciphering the Biosynthetic Codes for the Potent Anti-SARS-CoV Cyclodepsipeptide Valinomycin in Streptomyces tsusimaensis ATCC 15141. ChemBioChem 7:3, 471-477
CrossRef317
Jiahai Shi, Jianxing Song. (2006) The catalysis of the SARS 3C-like protease is under extensive regulation by its extra domain. FEBS Journal 273:5, 1035-1045
CrossRef318
Chang-Jer Wu, Yi-Lin Chan. (2006) Antiviral applications of RNAi for coronavirus. Expert Opinion on Investigational Drugs 15:2, 89-97
CrossRef319
Wenzhou Lv, Xiang Zheng, Min Yang, Yu Zhang, Ying Liu, Junxin Liu. (2006) Virus removal performance and mechanism of a submerged membrane bioreactor. Process Biochemistry 41:2, 299-304
CrossRef320
Deborah R. Taylor. (2006) Obstacles and advances in SARS vaccine development. Vaccine 24:7, 863-871
CrossRef321
Yuan-Pin Huang, Ching-Ho Wang. (2006) Development of attenuated vaccines from Taiwanese infectious bronchitis virus strains. Vaccine 24:6, 785-791
CrossRef322
Zhongyu Zhu, Antony S Dimitrov, Samitabh Chakraborti, Dimana Dimitrova, Xiaodong Xiao, Christopher C Broder, Dimiter S Dimitrov. (2006) Development of human monoclonal antibodies against diseases caused by emerging and biodefense-related viruses. Expert Review of Anti-infective Therapy 4:1, 57-66
CrossRef323
Brian W.J. Mahy. (2006) The diversity of viruses infecting humans. Biodiversity 7:1, 34-37
CrossRef324
Xuemei Liu, Mingming Zhang, Lin He, Youping Li, Youping Li. 2006. Chinese herbs combined with Western medicine for severe acute respiratory syndrome (SARS). .
CrossRef325
John M. Nicholls, Jagdish Butany, Leo L. M. Poon, Kwok H. Chan, Swan Lip Beh, Susan Poutanen, J. S. Malik Peiris, Maria Wong. (2006) Time Course and Cellular Localization of SARS-CoV Nucleoprotein and RNA in Lungs from Fatal Cases of SARS. PLoS Medicine 3:2, e27
CrossRef326
Ashraf Brik, Chung-Yi Wu, Chi-Huey Wong. (2006) Microtiter plate based chemistry and in situ screening: a useful approach for rapid inhibitor discovery. Organic & Biomolecular Chemistry 4:8, 1446
CrossRef327
Martin Spruth, Otfried Kistner, Helga Savidis-Dacho, Elisabeth Hitter, Brian Crowe, Marijan Gerencer, Peter Brühl, Leopold Grillberger, Manfred Reiter, Christa Tauer, Wolfgang Mundt, P. Noel Barrett. (2006) A double-inactivated whole virus candidate SARS coronavirus vaccine stimulates neutralising and protective antibody responses. Vaccine 24:5, 652-661
CrossRef328
Els Keyaerts, Leen Vijgen, Piet Maes, Griet Duson, Johan Neyts, Marc Van Ranst. (2006) Viral load quantitation of SARS-coronavirus RNA using a one-step real-time RT-PCR. International Journal of Infectious Diseases 10:1, 32-37
CrossRef329
Hideaki KIKUTA. (2006) Uirusu 56:2, 173-181
CrossRef330
Linqi Zhang, Fengwen Zhang, Wenjie Yu, Tian He, Jian Yu, Christopher E. Yi, Lei Ba, Wenhui Li, Michael Farzan, Zhiwei Chen, Kwok-Yung Yuen, David Ho. (2006) Antibody responses against SARS coronavirus are correlated with disease outcome of infected individuals. Journal of Medical Virology 78:1, 1-8
CrossRef331
Vera S F Chan, Kelvin Y K Chan, Yongxiong Chen, Leo L M Poon, Annie N Y Cheung, Bojian Zheng, Kwok-Hung Chan, William Mak, Hextan Y S Ngan, Xiaoning Xu, Gavin Screaton, Paul K H Tam, Jonathan M Austyn, Li-Chong Chan, Shea-Ping Yip, Malik Peiris, Ui-Soon Khoo, Chen-Lung S Lin. (2006) Homozygous L-SIGN (CLEC4M) plays a protective role in SARS coronavirus infection. Nature Genetics 38:1, 38-46
CrossRef332
Salomé Veiga, Yunyun Yuan, Xuqin Li, Nuno C. Santos, Gang Liu, Miguel A.R.B. Castanho. (2006) Why are HIV-1 fusion inhibitors not effective against SARS-CoV? Biophysical evaluation of molecular interactions. Biochimica et Biophysica Acta (BBA) - General Subjects 1760:1, 55-61
CrossRef333
Ryan Draker, Rachel L. Roper, Martin Petric, Raymond Tellier. (2006) The complete sequence of the bovine torovirus genome. Virus Research 115:1, 56-68
CrossRef334
Hongying MO, Guangqiao ZENG, Xiaolan REN, Hui LI, Changwen KE, Yaxia TAN, Chaoda CAI, Kefang LAI, Rongchang CHEN, Moira CHAN-YEUNG, Nanshan ZHONG. (2006) Longitudinal profile of antibodies against SARS-coronavirus in SARS patients and their clinical significance. Respirology 11:1, 49-53
CrossRef335
Xiaohong Yan, Qian Hao, Yongxin Mu, Khalid Amine Timani, Linbai Ye, Ying Zhu, Jianguo Wu. (2006) Nucleocapsid protein of SARS-CoV activates the expression of cyclooxygenase-2 by binding directly to regulatory elements for nuclear factor-kappa B and CCAAT/enhancer binding protein. The International Journal of Biochemistry & Cell Biology 38:8, 1417-1428
CrossRef336
Rana Domiati-Saad, Richard H. Scheuermann. (2006) Nucleic acid testing for viral burden and viral genotyping. Clinica Chimica Acta 363:1-2, 197-205
CrossRef337
Ping Wei, Keqiang Fan, Hao Chen, Liang Ma, Changkang Huang, Lei Tan, Dong Xi, Chunmei Li, Ying Liu, Aoneng Cao, Luhua Lai. (2006) The N-terminal octapeptide acts as a dimerization inhibitor of SARS coronavirus 3C-like proteinase. Biochemical and Biophysical Research Communications 339:3, 865-872
CrossRef338
Shin Matsuoka, Yasuyuki Kurihara, Kunihiro Yagihashi, Kyoko Okamoto, Hiroshi Niimi, Yasuo Nakajima. (2006) Thin-section CT assessment of spontaneous pneumomediastinum in interstitial lung disease: Correlation with serial changes in lung parenchymal abnormalities. Respiratory Medicine 100:1, 11-19
CrossRef339
Hiroaki Kariwa, Nobuhiro Fujii, Ikuo Takashima. (2006) Inactivation of SARS Coronavirus by Means of Povidone-Iodine, Physical Conditions and Chemical Reagents. Dermatology 212:1, 119-123
CrossRef340
Matthew Kaye, Julian Druce, Thomas Tran, Renata Kostecki, Doris Chibo, Jessica Morris, Mike Catton, Chris Birch. (2006) SARS–associated Coronavirus Replication in Cell Lines. Emerging Infectious Diseases 12:1, 128-133
CrossRef341
Khalid Amine Timani, Qingjiao Liao, Linbai Ye, Yingchun Zeng, Jing Liu, Yi Zheng, Li Ye, Xiaojun Yang, Kong Lingbao, Jingrong Gao, Ying Zhu. (2005) Nuclear/nucleolar localization properties of C-terminal nucleocapsid protein of SARS coronavirus. Virus Research 114:1-2, 23-34
CrossRef342
Xiaoling Yuan, Zhenyu Yao, Yajun Shan, Bo Chen, Zhen Yang, Jie Wu, Zhenhu Zhao, Jiapei Chen, Yuwen Cong. (2005) Nucleolar localization of non-structural protein 3b, a protein specifically encoded by the severe acute respiratory syndrome coronavirus. Virus Research 114:1-2, 70-79
CrossRef343
Erika Martina, Nikolaus Stiefl, Björn Degel, Franziska Schulz, Alexander Breuning, Markus Schiller, Radim Vicik, Knut Baumann, John Ziebuhr, Tanja Schirmeister. (2005) Screening of electrophilic compounds yields an aziridinyl peptide as new active-site directed SARS-CoV main protease inhibitor. Bioorganic & Medicinal Chemistry Letters 15:24, 5365-5369
CrossRef344
Mark Bartlam, Haitao Yang, Zihe Rao. (2005) Structural insights into SARS coronavirus proteins. Current Opinion in Structural Biology 15:6, 664-672
CrossRef345
Jai-hai LU, Zhong-min GUO, Wen-yu HAN, Guo-ling WANG, Ding-mei ZHANG, Yi-fei WANG, Sheng-yun SUN, Qin-he YANG, Huan-ying ZHENG, Bing L WONG, Nan-shan ZHONG. (2005) Preparation and development of equine hyperimmune globulin F(ab')2 against severe acute respiratory syndrome coronavirus1. Acta Pharmacologica Sinica 26:12, 1479-1484
CrossRef346
Masanobu Yamate, Makiko Yamashita, Toshiyuki Goto, Shoutaro Tsuji, Yong-Gang Li, Jiranan Warachit, Mikihiro Yunoki, Kazuyoshi Ikuta. (2005) Establishment of Vero E6 cell clones persistently infected with severe acute respiratory syndrome coronavirus. Microbes and Infection 7:15, 1530-1540
CrossRef347
Shiming Lin, Chih-Kung Lee, Shih-Yuan Lee, Chuan-Liang Kao, Chii-Wann Lin, An-Bang Wang, Su-Ming Hsu, Long-Sun Huang. (2005) Surface ultrastructure of SARS coronavirus revealed by atomic force microscopy. Cellular Microbiology 7:12, 1763-1770
CrossRef348
Man Cheng, Ceci W.L. Chan, Randy C.F. Cheung, Rama Kamesh Bikkavilli, Qi Zhao, Shannon W.N. Au, Paul K.S. Chan, Susanna S.T. Lee, Gregory Cheng, Walter K.K. Ho, Wing-Tai Cheung. (2005) Cross-reactivity of antibody against SARS-coronavirus nucleocapsid protein with IL-11. Biochemical and Biophysical Research Communications 338:3, 1654-1660
CrossRef349
Zhongping He, Chunhui Zhao, Qingming Dong, Hui Zhuang, Shujing Song, Guoai Peng, Dominic E. Dwyer. (2005) Effects of severe acute respiratory syndrome (SARS) coronavirus infection on peripheral blood lymphocytes and their subsets. International Journal of Infectious Diseases 9:6, 323-330
CrossRef350
James B. Mahony, Susan Richardson. (2005) Molecular Diagnosis of Severe Acute Respiratory Syndrome. The Journal of Molecular Diagnostics 7:5, 551-559
CrossRef351
Kuo-Chien Tsao, Guang-Wu Chen, Chung-Guei Huang, Ya-Ling Huang, Jing-Yi Lin, Mok-Chee Keng, Chien-Fen Sun, Shin-Ru Shih. (2005) False positive antibody results against human T-cell lymphotropic virus in patients with severe acute respiratory syndrome. Journal of Medical Virology 77:3, 331-336
CrossRef352
Kumar Singh Saikatendu, Jeremiah S. Joseph, Vanitha Subramanian, Tom Clayton, Mark Griffith, Kin Moy, Jeffrey Velasquez, Benjamin W. Neuman, Michael J. Buchmeier, Raymond C. Stevens, Peter Kuhn. (2005) Structural Basis of Severe Acute Respiratory Syndrome Coronavirus ADP-Ribose-1″-Phosphate Dephosphorylation by a Conserved Domain of nsP3. Structure 13:11, 1665-1675
CrossRef353
Gary W. K. Wong, David S. C. Hui. (2005) Current Understanding of Severe Acute Respiratory Syndrome (SARS). Clinical Pulmonary Medicine 12:6, 337-340
CrossRef354
Nan Hong, Xiangke Du, Zhongshi Nie, Sijun Li. (2005) Diffusion-weighted MR study of femoral head avascular necrosis in severe acute respiratory syndrome patients. Journal of Magnetic Resonance Imaging 22:5, 661-664
CrossRef355
Maria Cristina Keightley, Peter Sillekens, Wim Schippers, Charles Rinaldo, Kirsten St. George. (2005) Real-time NASBA detection of SARS-associated coronavirus and comparison with real-time reverse transcription-PCR. Journal of Medical Virology 77:4, 602-608
CrossRef356
Jeffrey S. Kahn, Kenneth McIntosh. (2005) History and Recent Advances in Coronavirus Discovery. The Pediatric Infectious Disease Journal 24:Supplement, S223-S227
CrossRef357
Douglas Horejsh, Federico Martini, Maria Rosaria Capobianchi. 2005. BeadCons: Detection of Nucleic Acid Sequences by Flow Cytometry. .
CrossRef358
Mei-Shang Ho, Wei-Ju Chen, Hour-Young Chen, Szu-Fong Lin, Min-Chin Wang, Jiali Di, Yen-Ta Lu, Ching-Lung Liu, Shan-Chwen Chang, Chung-Liang Chao, Chwan-Chuen King, Jeng-Min Chiou, Ih-Jen Su, Jyh-Yuan Yang. (2005) Neutralizing Antibody Response and SARS Severity. Emerging Infectious Diseases 11:11, 1730-1737
CrossRef359
Yujia Zhai, Fei Sun, Xuemei Li, Hai Pang, Xiaoling Xu, Mark Bartlam, Zihe Rao. (2005) Insights into SARS-CoV transcription and replication from the structure of the nsp7–nsp8 hexadecamer. Nature Structural & Molecular Biology
CrossRef360
Kathryn E. Follis, Joanne York, Jack H. Nunberg. (2005) Serine-scanning mutagenesis studies of the C-terminal heptad repeats in the SARS coronavirus S glycoprotein highlight the important role of the short helical region. Virology 341:1, 122-129
CrossRef361
L-L. Chen, C-W. Hsu, Y-C. Tian, J-T. Fang. (2005) Rhabdomyolysis associated with acute renal failure in patients with severe acute respiratory syndrome. International Journal of Clinical Practice 59:10, 1162-1166
CrossRef362
Qihan Li, Lichun Wang, Chenghong Dong, Yanchun Che, Li Jiang, Longding Liu, Hongling Zhao, Yun Liao, Yi Sheng, Shaozhong Dong, Shaohui Ma. (2005) The interaction of the SARS coronavirus non-structural protein 10 with the cellular oxido-reductase system causes an extensive cytopathic effect. Journal of Clinical Virology 34:2, 133-139
CrossRef363
Tania Ivens, Christel Van den Eynde, Koen Van Acker, Erik Nijs, Géry Dams, Eva Bettens, Asa Ohagen, Rudi Pauwels, Kurt Hertogs. (2005) Development of a homogeneous screening assay for automated detection of antiviral agents active against severe acute respiratory syndrome-associated coronavirus. Journal of Virological Methods 129:1, 56-63
CrossRef364
Cheng-Wen Lin, Fuu-Jen Tsai, Chang-Hai Tsai, Chien-Chen Lai, Lei Wan, Tin-Yun Ho, Chang-Chi Hsieh, Pei-Dawn Lee Chao. (2005) Anti-SARS coronavirus 3C-like protease effects of Isatis indigotica root and plant-derived phenolic compounds. Antiviral Research 68:1, 36-42
CrossRef365
Jau-Ling Huang, Hui-Tsu Lin, Yu-Ming Wang, Yi-Chien Yeh, Konan Peck, Bai-Ling Lin, Huan-Wun Liu, Ann Chen, Chang-Shen Lin. (2005) Rapid and sensitive detection of multiple genes from the SARS-Coronavirus using quantitative RT-PCR with dual systems. Journal of Medical Virology 77:2, 151-158
CrossRef366
S. L. Grace. (2005) The Occupational and Psychosocial Impact of SARS on Academic Physicians in Three Affected Hospitals. Psychosomatics 46:5, 385-391
CrossRef367
M. Y. Y. Lai, P. K. C. Cheng, W. W. L. Lim. (2005) Survival of Severe Acute Respiratory Syndrome Coronavirus. Clinical Infectious Diseases 41:7, e67-e71
CrossRef368
M. Dell'Omodarme, M. C. Prati. (2005) The probability of failing in detecting an infectious disease at entry points into a country. Statistics in Medicine 24:17, 2669-2679
CrossRef369
Jiun-Jie Shie, Jim-Min Fang, Tun-Hsun Kuo, Chih-Jung Kuo, Po-Huang Liang, Hung-Jyun Huang, Yin-Ta Wu, Jia-Tsrong Jan, Yih-Shyun E. Cheng, Chi-Huey Wong. (2005) Inhibition of the severe acute respiratory syndrome 3CL protease by peptidomimetic α,β-unsaturated esters. Bioorganic & Medicinal Chemistry 13:17, 5240-5252
CrossRef370
Qing-Jiao LIAO, Lin-Bai YE, Khalid Amine TIMANI, Ying-Chun ZENG, Ying-Long SHE, Li YE, Zheng-Hui WU. (2005) Activation of NF-kappaB by the Full-length Nucleocapsid Protein of the SARS Coronavirus. Acta Biochimica et Biophysica Sinica 37:9, 607-612
CrossRef371
Xin-Wei Wang, Jin-Song Li, Ting-Kai Guo, Bei Zhen, Qing-Xin Kong, Bin Yi, Zhong Li, Nong Song, Min Jin, Wen-Jun Xiao, Xiu-Mei Zhu, Chang-Qing Gu, Jing Yin, Wei Wei, Wei Yao, Chao Liu, Jian-Feng Li, Guo-Rong Ou, Min-Nian Wang, Tong-Yu Fang, Gui-Jie Wang, Yao-Hui Qiu, Huai-Huan Wu, Fu-Huan Chao, Jun-Wen Li. (2005) Concentration and detection of SARS coronavirus in sewage from Xiao Tang Shan Hospital and the 309th Hospital. Journal of Virological Methods 128:1-2, 156-161
CrossRef372
Ran-Yi Liu, Li-Zhi Wu, Bi-Jun Huang, Jia-Ling Huang, Yan-Ling Zhang, Miao-La Ke, Jun-Mei Wang, Wei-Ping Tan, Ru-Hua Zhang, Han-Kui Chen, Yi-Xin Zeng, Wenlin Huang. (2005) Adenoviral expression of a truncated S1 subunit of SARS-CoV spike protein results in specific humoral immune responses against SARS-CoV in rats. Virus Research 112:1-2, 24-31
CrossRef373
John V. Williams. (2005) The Clinical Presentation and Outcomes of Children Infected with Newly Identified Respiratory Tract Viruses. Infectious Disease Clinics of North America 19:3, 569-584
CrossRef374
Linda Chui, Michael Drebot, Anton Andonov, Astrid Petrich, Martin Glushek, James Mahony. (2005) Comparison of 9 different PCR primers for the rapid detection of severe acute respiratory syndrome coronavirus using 2 RNA extraction methods. Diagnostic Microbiology and Infectious Disease 53:1, 47-55
CrossRef375
Ralph A. Tripp, Lia M. Haynes, Deborah Moore, Barbara Anderson, Azaibi Tamin, Brian H. Harcourt, Les P. Jones, Mamadi Yilla, Gregory J. Babcock, Thomas Greenough, Donna M. Ambrosino, Rene Alvarez, Justin Callaway, Sheana Cavitt, Kurt Kamrud, Harold Alterson, Jonathan Smith, Jennifer L. Harcourt, Congrong Miao, Raj Razdan, James A. Comer, Pierre E. Rollin, Thomas G. Ksiazek, Anthony Sanchez, Paul A. Rota, William J. Bellini, Larry J. Anderson. (2005) Monoclonal antibodies to SARS-associated coronavirus (SARS-CoV): Identification of neutralizing and antibodies reactive to S, N, M and E viral proteins. Journal of Virological Methods 128:1-2, 21-28
CrossRef376
Matthias Niedrig, Katrin Leitmeyer, Wilina Lim, Malik Peiris, John S. Mackenzie, Maria Zambon. (2005) First external quality assurance of antibody diagnostic for SARS-new coronavirus. Journal of Clinical Virology 34:1, 22-25
CrossRef377
S. T. Lai. (2005) Treatment of severe acute respiratory syndrome. European Journal of Clinical Microbiology & Infectious Diseases 24:9, 583-591
CrossRef378
Y. S. Lin, C. F. Lin, Y. T. Fang, Y. M. Kuo, P. C. Liao, T. M. Yeh, K. Y. Hwa, C. C. K. Shieh, J. H. Yen, H. J. Wang, I. J. Su, H. Y. Lei. (2005) Antibody to severe acute respiratory syndrome (SARS)-associated coronavirus spike protein domain 2 cross-reacts with lung epithelial cells and causes cytotoxicity. Clinical and Experimental Immunology 141:3, 500-508
CrossRef379
Anthony Y. C. Kuk, Stefan Ma. (2005) The estimation of SARS incubation distribution from serial interval data using a convolution likelihood. Statistics in Medicine 24:16, 2525-2537
CrossRef380
Bao-jian Li, Qingquan Tang, Du Cheng, Chuan Qin, Frank Y Xie, Qiang Wei, Jun Xu, Yijia Liu, Bo-jian Zheng, Martin C Woodle, Nanshan Zhong, Patrick Y Lu. (2005) Using siRNA in prophylactic and therapeutic regimens against SARS coronavirus in Rhesus macaque. Nature Medicine
CrossRef381
L. A. Mandell. (2005) Etiologies of Acute Respiratory Tract Infections. Clinical Infectious Diseases 41:4, 503-506
CrossRef382
Yu Lung Lau, JS Malik Peiris. (2005) Pathogenesis of severe acute respiratory syndrome. Current Opinion in Immunology 17:4, 404-410
CrossRef383
Keiji Kuba, Yumiko Imai, Shuan Rao, Hong Gao, Feng Guo, Bin Guan, Yi Huan, Peng Yang, Yanli Zhang, Wei Deng, Linlin Bao, Binlin Zhang, Guang Liu, Zhong Wang, Mark Chappell, Yanxin Liu, Dexian Zheng, Andreas Leibbrandt, Teiji Wada, Arthur S Slutsky, Depei Liu, Chuan Qin, Chengyu Jiang, Josef M Penninger. (2005) A crucial role of angiotensin converting enzyme 2 (ACE2) in SARS coronavirus–induced lung injury. Nature Medicine 11:8, 875-879
CrossRef384
Makiko Yamashita, Masanobu Yamate, Gui-Mei Li, Kazuyoshi Ikuta. (2005) Susceptibility of human and rat neural cell lines to infection by SARS-coronavirus. Biochemical and Biophysical Research Communications 334:1, 79-85
CrossRef385
Yanbin Wang, Zhaorui Chang, Jing Ouyang, Haiyan Wei, Renquan Yang, Yangong Chao, Jianguo Qu, Jianwei Wang, Tao Hung. (2005) Profiles of IgG Antibodies to Nucleocapsid and Spike Proteins of the SARS-Associated Coronavirus in SARS Patients. DNA and Cell Biology 24:8, 521-527
CrossRef386
Ai-Lian Hei, Jian-Ping Cai. (2005) Development of a Method for Concentrating and Purifying SARS Coronavirus RNA by a Magnetic Bead Capture System. DNA and Cell Biology 24:8, 479-484
CrossRef387
Rong-Hong Hua, Yun-Feng Wang, Zhi-Gao Bu, Yan-Jun Zhou, Jin-Ying Ge, Xi-Jun Wang, Guang-Zhi Tong. (2005) Identification and Antigenic Epitope Mapping of Immunodominant Region Amino Residues 510 to 672 on the Spike Protein of the Severe Acute Respiratory Syndrome Coronavirus. DNA and Cell Biology 24:8, 503-509
CrossRef388
S. Chen, D. Lu, M. Zhang, J. Che, Z. Yin, S. Zhang, W. Zhang, X. Bo, Y. Ding, S. Wang. (2005) Double-antigen sandwich ELISA for detection of antibodies to SARS-associated coronavirus in human serum. European Journal of Clinical Microbiology & Infectious Diseases 24:8, 549-553
CrossRef389
D. Pinna, A. Sampson-Johannes, M. Clementi, G. Poli, S. Rossini, L. Lin, E. Vicenzi. (2005) Amotosalen photochemical inactivation of severe acute respiratory syndrome coronavirus in human platelet concentrates. Transfusion Medicine 15:4, 269-276
CrossRef390
Leo L.M. Poon, Cynthia S.W. Leung, Kwok H. Chan, Kwok Y. Yuen, Yi Guan, Joseph S.M. Peiris. (2005) Recurrent mutations associated with isolation and passage of SARS coronavirus in cells from non-human primates. Journal of Medical Virology 76:4, 435-440
CrossRef391
Daniel K Ng, Wing-Fai Lau, Keung-Kit Chan, Benjamin C Pau, Yuen-Yu Lam, Eric Y Chan, Jackson C Ho. (2005) Severe acute respiratory syndrome coronavirus infection in children. Pediatrics International 47:4, 452-455
CrossRef392
Xiaonan Fang, Linbai Ye, Khalid Amine Timani, Shanshan Li, Yingchun Zen, Meng Zhao, Hong Zheng, Zhenghui Wu. (2005) Peptide Domain Involved in the Interaction between Membrane Protein and Nucleocapsid Protein of SARS-associated Coronavirus. Journal of Biochemistry and molecular biology 38:4, 381-385
CrossRef393
Satoru Itoyama, Naoto Keicho, Minako Hijikata, Tran Quy, Nguyen Chi Phi, Hoang Thuy Long, Le Dang Ha, Vo Van Ban, Ikumi Matsushita, Hideki Yanai, Fumiko Kirikae, Teruo Kirikae, Tadatoshi Kuratsuji, Takehiko Sasazuki. (2005) Identification of an alternative 5′-untranslated exon and new polymorphisms of angiotensin-converting enzyme 2 gene: Lack of association with SARS in the Vietnamese population. American Journal of Medical Genetics Part A 136A:1, 52-57
CrossRef394
Jinzhu Duan, Xiyun Yan, Xueming Guo, Wuchun Cao, Wei Han, Cai Qi, Jing Feng, Dongling Yang, Guangxia Gao, Gang Jin. (2005) A human SARS-CoV neutralizing antibody against epitope on S2 protein. Biochemical and Biophysical Research Communications 333:1, 186-193
CrossRef395
Chia-Wei Lai, Yao-Chi Chung, Yiu-Kay Lai, Margaret Dah-Tsyr Chang, Yu-Chen Hu. (2005) Expression and Purification of N and E Proteins from Severe Acute Respiratory Syndrome (SARS)-Associated Coronavirus: a Comparative Study. Biotechnology Letters 27:13, 883-891
CrossRef396
Chuan Qin, Jianwei Wang, Qiang Wei, Mingpeng She, Wayne A Marasco, Hong Jiang, Xinming Tu, Hua Zhu, Lili Ren, Hong Gao, Li Guo, Lan Huang, Renquan Yang, Zhe Cong, Lan Guo, Yanbin Wang, Yali Liu, Yili Sun, Shumin Duan, Jianguo Qu, Liangbiao Chen, Wei Tong, Li Ruan, Peimao Liu, Hua Zhang, Jianmin Zhang, Huiyuan Zhang, Depei Liu, Qian Liu, Tao Hong, Wei He. (2005) An animal model of SARS produced by infection ofMacaca mulatta with SARS coronavirus. The Journal of Pathology 206:3, 251-259
CrossRef397
Inmaculada Casas, Francisco Pozo. (2005) Síndrome respiratorio agudo grave, gripe aviar e infección por metapneumovirus humano. Enfermedades Infecciosas y Microbiología Clínica 23:7, 438-448
CrossRef398
Zhan Zhang, Yi-Wu Xie, Jiling Hong, Xin Zhang, Sui Yi Kwok, Xiaowu Huang, Sai Wah Wong, Bing-Lou Wong, . (2005) Purification of severe acute respiratory syndrome hyperimmune globulins for intravenous injection from convalescent plasma. Transfusion 45:7, 1160-1164
CrossRef399
Yuxian He, Shibo Jiang. (2005) Vaccine Design for Severe Acute Respiratory Syndrome Coronavirus. Viral Immunology 18:2, 327-332
CrossRef400
Yi-ming Zhou, Ren-quan Yang, Sheng-ce Tao, Ze Li, Qiong Zhang, Hua-fang Gao, Zhi-wei Zhang, Jian-yu Du, Pei-xuan Zhu, Li-li Ren, Liang Zhang, Dong Wang, Lan Guo, Yan-bin Wang, Yong Guo, Yan Zhang, Chuan-zan Zhao, Can Wang, Di Jiang, Yan-hua Liu, Hua-wei Yang, Li Rong, Yan-jun Zhao, Shuang An, Zhe Li, Xiao-dong Fan, Jian-wei Wang, Yun Cheng, Ou Liu, Zhong Zheng, Huan-cong Zuo, Quan-zhong Shan, Li Ruan, Zhan-xiu Lü, Tao Hung, Jing Cheng. (2005) The design and application of DNA chips for early detection of SARS-CoV from clinical samples. Journal of Clinical Virology 33:2, 123-131
CrossRef401
Shixia Wang, Pavlo Sakhatskyy, Te-Hui W. Chou, Shan Lu. (2005) Assays for the assessment of neutralizing antibody activities against Severe Acute Respiratory Syndrome (SARS) associated coronavirus (SCV). Journal of Immunological Methods 301:1-2, 21-30
CrossRef402
Maofeng Qiu, Yuling Shi, Zhaobiao Guo, Zeliang Chen, Rongqiao He, Runsheng Chen, Dongsheng Zhou, Erhei Dai, Xiaoyi Wang, Bingyin Si, Yajun Song, Jingxiang Li, Ling Yang, Jin Wang, Hongxia Wang, Xin Pang, Junhui Zhai, Zongmin Du, Ying Liu, Yong Zhang, Linhai Li, Jian Wang, Bing Sun, Ruifu Yang. (2005) Antibody responses to individual proteins of SARS coronavirus and their neutralization activities. Microbes and Infection 7:5-6, 882-889
CrossRef403
T Li, Y Zhang, L Fu, C Yu, X Li, Y Li, X Zhang, Z Rong, Y Wang, H Ning, R Liang, W Chen, L A Babiuk, Z Chang. (2005) siRNA targeting the Leader sequence of SARS-CoV inhibits virus replication. Gene Therapy 12:9, 751-761
CrossRef404
Chuan-hai Zhang, Jia-hai Lu, Yi-fei Wang, Huan-ying Zheng, Sheng Xiong, Mei-ying Zhang, Xin-jian Liu, Jiu-xiang Li, Zhuo-yue Wan, Xin-ge Yan, Shu-Yuan Qi, Zhiyong Cui, Biliang Zhang. (2005) Immune responses in Balb/c mice induced by a candidate SARS-CoV inactivated vaccine prepared from F69 strain. Vaccine 23:24, 3196-3201
CrossRef405
Jun Zhou, Wei Wang, Qiong Zhong, Wei Hou, Zhanqiu Yang, Shu-Yuan Xiao, Runqing Zhu, Zhijiao Tang, Yong Wang, Qiaoyang Xian, Hongbing Tang, Li Wen. (2005) Immunogenicity, safety, and protective efficacy of an inactivated SARS-associated coronavirus vaccine in rhesus monkeys. Vaccine 23:24, 3202-3209
CrossRef406
Betty H. Robertson, Janet K.A. Nicholson. (2005) NEW MICROBIOLOGY TOOLS FOR PUBLIC HEALTH AND THEIR IMPLICATIONS 1. Annual Review of Public Health 26:1, 281-302
CrossRef407
Wenhui Li, Chengsheng Zhang, Jianhua Sui, Jens H Kuhn, Michael J Moore, Shiwen Luo, Swee-Kee Wong, I-Chueh Huang, Keming Xu, Natalya Vasilieva, Akikazu Murakami, Yaqing He, Wayne A Marasco, Yi Guan, Hyeryun Choe, Michael Farzan. (2005) Receptor and viral determinants of SARS-coronavirus adaptation to human ACE2. The EMBO Journal 24:8, 1634-1643
CrossRef408
Matthew P. Muller, George Tomlinson, Thomas J. Marrie, Patrick Tang, Allison McGeer, Donald E. Low, Allan S. Detsky, Wayne L. Gold. (2005) Can Routine Laboratory Tests Discriminate between Severe Acute Respiratory Syndrome and Other Causes of Community‐Acquired Pneumonia?. Clinical Infectious Diseases 40:8, 1079-1086
CrossRef409
Els Keyaerts, Leen Vijgen, Piet Maes, Johan Neyts, Marc Van Ranst. (2005) Growth kinetics of SARS-coronavirus in Vero E6 cells. Biochemical and Biophysical Research Communications 329:3, 1147-1151
CrossRef410
Keqiang Fan, Liang Ma, Xiaofeng Han, Huanhuan Liang, Ping Wei, Ying Liu, Luhua Lai. (2005) The substrate specificity of SARS coronavirus 3C-like proteinase. Biochemical and Biophysical Research Communications 329:3, 934-940
CrossRef411
Ling Ni, Jieqing Zhu, Junjie Zhang, Meng Yan, George F. Gao, Po Tien. (2005) Design of recombinant protein-based SARS-CoV entry inhibitors targeting the heptad-repeat regions of the spike protein S2 domain. Biochemical and Biophysical Research Communications 330:1, 39-45
CrossRef412
Yat Wah Kwan, Chi Wai Leung, Man Chun Chiu. (2005) Diarrhoea as the presenting sign in an adolescent suffering from severe acute respiratory syndrome. European Journal of Pediatrics 164:4, 227-230
CrossRef413
Emi Hamano, Minako Hijikata, Satoru Itoyama, Tran Quy, Nguyen Chi Phi, Hoang Thuy Long, Le Dang Ha, Vo Van Ban, Ikumi Matsushita, Hideki Yanai, Fumiko Kirikae, Teruo Kirikae, Tadatoshi Kuratsuji, Takehiko Sasazuki, Naoto Keicho. (2005) Polymorphisms of interferon-inducible genes OAS-1 and MxA associated with SARS in the Vietnamese population. Biochemical and Biophysical Research Communications 329:4, 1234-1239
CrossRef414
Kow-Tong Chen, Shiing-Jer Twu, Hsiao-Ling Chang, Yi-Chun Wu, Chu-Tzu Chen, Ting-Hsiang Lin, Sonja J. Olsen, Scott F. Dowell, Ih-Jen Su. (2005) SARS in Taiwan: an overview and lessons learned. International Journal of Infectious Diseases 9:2, 77-85
CrossRef415
David A Groneberg, Susan M Poutanen, Donald E Low, Hartmut Lode, Tobias Welte, Peter Zabel. (2005) Treatment and vaccines for severe acute respiratory syndrome. The Lancet Infectious Diseases 5:3, 147-155
CrossRef416
Takashi Ebihara, Rika Endo, Xiaoming Ma, Nobuhisa Ishiguro, Hideaki Kikuta. (2005) Detection of human coronavirus NL63 in young children with bronchiolitis. Journal of Medical Virology 75:3, 463-465
CrossRef417
Yossef Kliger, Erez Y. Levanon, Doron Gerber. (2005) From genome to antivirals: SARS as a test tube. Drug Discovery Today 10:5, 345-352
CrossRef418
D. Xu, Z. Zhang, L. Jin, F. Chu, Y. Mao, H. Wang, M. Liu, M. Wang, L. Zhang, G. F. Gao, F. S. Wang. (2005) Persistent shedding of viable SARS-CoV in urine and stool of SARS patients during the convalescent phase. European Journal of Clinical Microbiology & Infectious Diseases 24:3, 165-171
CrossRef419
Tswen-Kei Tang, Mark P.-J. Wu, Shui-Tsung Chen, Ming-Hon Hou, Ming-Hsiang Hong, Fu-Ming Pan, Hui-Ming Yu, Jenn-Han Chen, Chen-Wen Yao, Andrew H.-J. Wang. (2005) Biochemical and immunological studies of nucleocapsid proteins of severe acute respiratory syndrome and 229E human coronaviruses. PROTEOMICS 5:4, 925-937
CrossRef420
Wun-Ju Shieh, Cheng-Hsiang Hsiao, Christopher D. Paddock, Jeannette Guarner, Cynthia S. Goldsmith, Kathleen Tatti, Michelle Packard, Laurie Mueller, Mu-Zong Wu, Pierre Rollin, Ih-Jen Su, Sherif R. Zaki. (2005) Immunohistochemical, in situ hybridization, and ultrastructural localization of SARS-associated coronavirus in lung of a fatal case of severe acute respiratory syndrome in Taiwan. Human Pathology 36:3, 303-309
CrossRef421
Yi SHI, De Hua YANG, Jie XIONG, Jie JIA, Bing HUANG, You Xin JIN. (2005) Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs. Cell Research 15:3, 193-200
CrossRef422
Jia-Ling Huang, Jian Huang, Zhao-Hui Duan, Jing Wei, Jun Min, Xiao-Hong Luo, Jian-Guo Li, Wei-Ping Tan, Li-Zhi Wu, Ran-Yi Liu, Yan Li, Jing Shao, Bi-Jun Huang, Yi-Xin Zeng, Wenlin Huang. (2005) Th2 predominance and CD8+ memory T cell depletion in patients with severe acute respiratory syndrome. Microbes and Infection 7:3, 427-436
CrossRef423
Jacquelyn J. Bower, Xianglin Shi. (2005) Environmental Health Research in the Post-Genome Era: New Fields, New Challenges, and New Opportunities. Journal of Toxicology and Environmental Health, Part B 8:2, 71-94
CrossRef424
Paul K.S. Chan, Esther Y.M. Liu, Danny T.M. Leung, Jo L.K. Cheung, C.H. Ma, Frankie C.H. Tam, Mamie Hui, John S. Tam, Pak Leong Lim. (2005) Evaluation of a recombinant nucleocapsid protein-based assay for Anti-SARS-CoV IgG detection. Journal of Medical Virology 75:2, 181-184
CrossRef425
Kwok Hong Chu, Wai Kay Tsang, Colin S. Tang, Man Fai Lam, Fernand M. Lai, Ka Fai To, Ka Shun Fung, Hon Lok Tang, Wing Wa Yan, Hilda W.H. Chan, Thomas S.T. Lai, Kwok Lung Tong, Kar Neng Lai. (2005) Acute renal impairment in coronavirus-associated severe acute respiratory syndrome. Kidney International 67:2, 698-705
CrossRef426
Kao-Jean Huang, Ih-Jen Su, Michel Theron, Yi-Chun Wu, Shu-Kuan Lai, Ching-Chuan Liu, Huan-Yao Lei. (2005) An interferon-?-related cytokine storm in SARS patients. Journal of Medical Virology 75:2, 185-194
CrossRef427
W.F. Leong, H.C. Tan, E.E. Ooi, D.R. Koh, Vincent T.K. Chow. (2005) Microarray and real-time RT-PCR analyses of differential human gene expression patterns induced by severe acute respiratory syndrome (SARS) coronavirus infection of Vero cells. Microbes and Infection 7:2, 248-259
CrossRef428
Cecilia Cheng, Mike W. L. Cheung. (2005) Psychological Responses to Outbreak of Severe Acute Respiratory Syndrome: A Prospective, Multiple Time-Point Study. Journal of Personality 73:1, 261-285
CrossRef429
W. J. CHNG, H. C. LAI, A. EARNEST, P. KUPERAN. (2005) Haematological parameters in severe acute respiratory syndrome. Clinical and Laboratory Haematology 27:1, 15-20
CrossRef430
Francesca Rovida, Elena Percivalle, Maurizio Zavattoni, Maria Torsellini, Antonella Sarasini, Giulia Campanini, Stefania Paolucci, Fausto Baldanti, M. Grazia Revello, Giuseppe Gerna. (2005) Monoclonal antibodies versus reverse transcription-PCR for detection of respiratory viruses in a patient population with respiratory tract infections admitted to hospital. Journal of Medical Virology 75:2, 336-347
CrossRef431
Yee-Joo Tan, Seng Gee Lim, Wanjin Hong. (2005) Characterization of viral proteins encoded by the SARS-coronavirus genome. Antiviral Research 65:2, 69-78
CrossRef432
Danuta M. Skowronski, Caroline Astell, Robert C. Brunham, Donald E. Low, Martin Petric, Rachel L. Roper, Pierre J. Talbot, Theresa Tam, Lorne Babiuk. (2005) Severe Acute Respiratory Syndrome (SARS): A Year in Review. Annual Review of Medicine 56:1, 357-381
CrossRef433
JM Nicholls, T Kuiken. 2005. Pathology and Pathogenesis. , 72-78.
CrossRef434
C Drosten, KH Chan, LLM Poon. 2005. Viral Diagnosis of SARS. , 64-71.
CrossRef435
Paul A Rota, Xin Liu, Byron T Cook, Suxiang Tong. 2005. Structure of the Genome of SARS CoV. , 58-63.
CrossRef436
, . (2005) Strategies adopted and lessons learnt during the severe acute respiratory syndrome crisis in Singapore. Reviews in Medical Virology 15:1, 57-70
CrossRef437
Y. Cheng, R. Wong, Y. O. Y. Soo, W. S. Wong, C. K. Lee, M. H. L. Ng, P. Chan, K. C. Wong, C. B. Leung, G. Cheng. (2005) Use of convalescent plasma therapy in SARS patients in Hong Kong. European Journal of Clinical Microbiology & Infectious Diseases 24:1, 44-46
CrossRef438
Felicia Li Sher Tan, Wee Lim Loo, Seck Guan Tan, Chow Yin Wong, Yu-Meng Tan. (2005) Severe acute respiratory syndrome in surgical patients: a diagnostic dilemma. ANZ Journal of Surgery 75:1-2, 21-26
CrossRef439
Umesh D Parashar, Angela Merianos, Cathy Roth, Larry J Anderson. 2005. Preparing for a Possible Resurgence of SARS. , 231-238.
CrossRef440
Kang Cai, Todd M Gierman, JoAnn Hotta, Christopher J Stenland, Douglas C Lee, Dominique Y Pifat, Steve R Petteway. (2005) Ensuring the Biologic Safety of Plasma-Derived Therapeutic Proteins. BioDrugs 19:2, 79-96
CrossRef441
Yi Shi, Haifeng Luo, Jie Jia, Jie Xiong, Dehua Yang, Bing Huang, Youxin Jin. (2005) Antisense downregulation of SARS-CoV gene expression in Vero E6 cells. The Journal of Gene Medicine 7:1, 97-107
CrossRef442
Eric Bergeron, Martin J. Vincent, Louise Wickham, Josée Hamelin, Ajoy Basak, Stuart T. Nichol, Michel Chrétien, Nabil G. Seidah. (2005) Implication of proprotein convertases in the processing and spread of severe acute respiratory syndrome coronavirus. Biochemical and Biophysical Research Communications 326:3, 554-563
CrossRef443
Thomas M File, Kenneth W T Tsang. (2005) Severe Acute Respiratory Syndrome. Treatments in Respiratory Medicine 4:2, 95-106
CrossRef444
Samson SY. Wong, KY Yuen. (2005) The severe acute respiratory syndrome (SARS). Journal of Neurovirology 11:5, 455-468
CrossRef445
Dan-Dan Lu, Su-Hong Chen, Shi-Meng Zhang, Min-Li Zhang, Wei Zhang, Xiao-Chen Bo, Sheng-Qi Wang. (2005) Screening of specific antigens for SARS clinical diagnosis using a protein microarray. The Analyst 130:4, 474
CrossRef446
James W LeDuc. 2005. Public Health Response: A View from a Region with a Low Incidence of SARS. , 169-175.
CrossRef447
David M Hwang, Dean W Chamberlain, Susan M Poutanen, Donald E Low, Sylvia L Asa, Jagdish Butany. (2005) Pulmonary pathology of severe acute respiratory syndrome in Toronto. Modern Pathology 18:1, 1-10
CrossRef448
Malik Peiris, Albert DME Osterhaus. 2005. Aetiology of SARS. , 50-57.
CrossRef449
Pei-Lan Shao, Po-Ren Hsueh, Luan-Yin Chang, Chun-Yi Lu, Chuan-Liang Kao, Yu-Ping Chiang, Hsiang-Yi Huang, Fu-Yuan Huang, Chin-Yun Lee, Lung-Ji Chang, T.-C. Wu, Li-Min Huang. (2005) Development of immunoglobulin G enzyme-linked immunosorbent assay for the serodiagnosis of severe acute respiratory syndrome. Journal of Biomedical Science 12:1, 59-64
CrossRef450
Di Qu, Bojian Zheng, Xin Yao, Yi Guan, Zheng-Hong Yuan, Nan-Shan Zhong, Li-Wei Lu, Jian-Ping Xie, Yu-Mei Wen. (2005) Intranasal immunization with inactivated SARS-CoV (SARS-associated coronavirus) induced local and serum antibodies in mice. Vaccine 23:7, 924-931
CrossRef451
F. S. Wang, F. L. Chu, L. Jin, Y. G. Li, Z. Zhang, D. Xu, M. Shi, H. Wu, J.-M. Moulds. (2005) Acquired but reversible loss of erythrocyte complement receptor 1 (CR1, CD35) and its longitudinal alteration in patients with severe acute respiratory syndrome. Clinical and Experimental Immunology 139:1, 112-119
CrossRef452
Linda J Saif. 2005. Comparative Biology of Animal Coronaviruses: Lessons for SARS. , 84-99.
CrossRef453
Mu-Chin Shih, Konan Peck, Wen-Ling Chan, Yen-Ping Chu, Jui-Chang Chen, Chang-Hai Tsai, Jan-Gowth Chang. (2005) SARS-CoV Infection Was from at Least Two Origins in the Taiwan Area. Intervirology 48:2-3, 124-132
CrossRef454
Kanta Subbarao. 2005. Vaccines. , 203-212.
CrossRef455
Hiroyuki Kogaki, Yoshiaki Uchida, Nobuyuki Fujii, Yoshihiro Kurano, Kazushige Miyake, Yasuji Kido, Hiroaki Kariwa, Ikuo Takashima, Hiko Tamashiro, Ai-Ee Ling, Masahisa Okada. (2005) Novel rapid immunochromatographic test based on an enzyme immunoassay for detecting nucleocapsid antigen in SARS-associated coronavirus. Journal of Clinical Laboratory Analysis 19:4, 150-159
CrossRef456
Xueying Shi, Encong Gong, Dongxia Gao, Bo Zhang, Jie Zheng, Zifen Gao, Yanfeng Zhong, Wanzhong Zou, Bingquan Wu, Weigang Fang, Songlin Liao, Shenglan Wang, Zhigang Xie, Min Lu, Lin Hou, Haohao Zhong, Hongquan Shao, Ning Li, Congrong Liu, Fei Pei, Jingping Yang, Yuping Wang, Zhihui Han, Xiaohong Shi, Qianying Zhang, Jiangfeng You, Xiang Zhu, Jiang Gu. (2005) Severe Acute Respiratory Syndrome Associated Coronavirus Is Detected in Intestinal Tissues of Fatal Cases. The American Journal of Gastroenterology 100:1, 169-176
CrossRef457
Manuel Salto-Tellez, Emily Tan, Bing Lim. (2005) ARDS in SARS: cytokine mediators and treatment implications. Cytokine 29:2, 92-94
CrossRef458
Lauren Ancel Meyers, Babak Pourbohloul, M.E.J. Newman, Danuta M. Skowronski, Robert C. Brunham. (2005) Network theory and SARS: predicting outbreak diversity. Journal of Theoretical Biology 232:1, 71-81
CrossRef459
Vin-Cent Wu, Jenq-Wen Huang, Po-Ren Hsueh, Ya-Fei Yang, Hung-Bin Tsai, Wei-Chih Kan, Hong-Wei Chang, Kwan-Dun Wu. (2005) Renal hypouricemia is an ominous sign in patients with severe acute respiratory syndrome. American Journal of Kidney Diseases 45:1, 88-95
CrossRef460
Kwok-yung Yuen, Nam-shan Zhong. 2005. SARS: A Historical Perspective from Hong Kong. , 1-12.
CrossRef461
Christopher M. Booth, Thomas E. Stewart. (2005) Severe acute respiratory syndrome and critical care medicine: The Toronto experience. Critical Care Medicine 33:Supplement, S53-S60
CrossRef462
Chang-Jer Wu, Hui-Wen Huang, Chiu-Yi Liu, Cheng-Fong Hong, Yi-Lin Chan. (2005) Inhibition of SARS-CoV replication by siRNA. Antiviral Research 65:1, 45-48
CrossRef463
Mamadi Yilla, Brian H. Harcourt, Carole J. Hickman, Marcia McGrew, Azaibi Tamin, Cynthia S. Goldsmith, William J. Bellini, Larry J. Anderson. (2005) SARS-coronavirus replication in human peripheral monocytes/macrophages. Virus Research 107:1, 93-101
CrossRef464
Haitao Yang, Weiqing Xie, Xiaoyu Xue, Kailin Yang, Jing Ma, Wenxue Liang, Qi Zhao, Zhe Zhou, Duanqing Pei, John Ziebuhr, Rolf Hilgenfeld, Kwok Yung Yuen, Luet Wong, Guangxia Gao, Saijuan Chen, Zhu Chen, Dawei Ma, Mark Bartlam, Zihe Rao. (2005) Design of Wide-Spectrum Inhibitors Targeting Coronavirus Main Proteases. PLoS Biology 3:10, e324
CrossRef465
Gabriel M Leung, Anthony J Hedley, Tai Hing Lam, Azra C Ghani, Christl A Donnelly, Christophe Fraser, Steven Riley, Neil M Ferguson, Roy M Anderson. 2005. Transmission Dynamics and Control of the Viral Aetiological Agent of SARS. , 111-130.
CrossRef466
Nada Kuljic-Kapulica, Biljana Srdic, Ljilja Mijatov-Ukropina, Ljubica Stojsic-Dzunja. (2005) SARS corona virus: A new dilemma. Medicinski pregled 58:1-2, 43-46
CrossRef467
V. M. Supekar, C. Bruckmann, P. Ingallinella, E. Bianchi, A. Pessi, A. Carfi. (2004) Structure of a proteolytically resistant core from the severe acute respiratory syndrome coronavirus S2 fusion protein. Proceedings of the National Academy of Sciences 101:52, 17958-17963
CrossRef468
Nan-Shan Zhong, Gary W.K. Wong. (2004) Epidemiology of severe acute respiratory syndrome (SARS): adults and children. Paediatric Respiratory Reviews 5:4, 270-274
CrossRef469
Yuxian He, Yusen Zhou, Pamela Siddiqui, Shibo Jiang. (2004) Inactivated SARS-CoV vaccine elicits high titers of spike protein-specific antibodies that block receptor binding and virus entry. Biochemical and Biophysical Research Communications 325:2, 445-452
CrossRef470
C.W. Leung, W.K. Chiu. (2004) Clinical picture, diagnosis, treatment and outcome of severe acute respiratory syndrome (SARS) in children. Paediatric Respiratory Reviews 5:4, 275-288
CrossRef471
Haibin Luo, Fei Ye, Tao Sun, Liduo Yue, Shuying Peng, Jing Chen, Guowei Li, Yi Du, Youhua Xie, Yiming Yang, Jianhua Shen, Yuan Wang, Xu Shen, Hualiang Jiang. (2004) In vitro biochemical and thermodynamic characterization of nucleocapsid protein of SARS. Biophysical Chemistry 112:1, 15-25
CrossRef472
Yan Li, Chunqing Luo, Wei Li, Zhao Xu, Changqing Zeng, Shenli Bi, Jun Yu, Jun Wu, Huanming Yang. (2004) Structure-Based Preliminary Analysis of Immunity and Virulence of SARS Coronavirus. Viral Immunology 17:4, 528-534
CrossRef473
Yu-Lung Lau. (2004) SARS: future research and vaccine. Paediatric Respiratory Reviews 5:4, 300-303
CrossRef474
Shu-Sin Chng, Truong-Giang Hoang, Wei-Woon Wayne Lee, Mun-Pun Tham, Hui Yvonne Ling, Teck-Peng Loh. (2004) Synthetic studies towards anti-SARS agents: application of an indium-mediated allylation of α-aminoaldehydes as the key step towards an intermediate. Tetrahedron Letters 45:52, 9501-9504
CrossRef475
J S M Peiris, Y Guan, K Y Yuen. (2004) Severe acute respiratory syndrome. Nature Medicine 10:12s, S88-S97
CrossRef476
Thomas J. Marrie. (2004) Empiric treatment of ambulatory community-acquired pneumonia: always include treatment for atypical agents. Infectious Disease Clinics of North America 18:4, 829-841
CrossRef477
William R. Jarvis. (2004) The State of the Science of health care epidemiology, infection control, and patient safety, 2004. American Journal of Infection Control 32:8, 496-503
CrossRef478
A.M. Li, H.K. So, W. Chu, P.C. Ng, K.L. Hon, W.K. Chiu, C.W. Leung, Y.S. Yau, W.K. Mo, T.F. Fok. (2004) Radiological and pulmonary function outcomes of children with SARS. Pediatric Pulmonology 38:6, 427-433
CrossRef479
James. D. Cherry. (2004) The chronology of the 2002–2003 SARS mini pandemic. Paediatric Respiratory Reviews 5:4, 262-269
CrossRef480
P.-R. Hsueh, L.-M. Huang, P.-J. Chen, C.-L. Kao, P.-C. Yang. (2004) Chronological evolution of IgM, IgA, IgG and neutralisation antibodies after infection with SARS-associated coronavirus. Clinical Microbiology and Infection 10:12, 1062-1066
CrossRef481
Xueqing Han, Mark Bartlam, Ying-hua Jin, Xiangtao Liu, Xiaojing He, Xuepeng Cai, Qingqe Xie, Zihe Rao. (2004) The expression of SARS–CoV M gene in P. Pastoris and the diagnostic utility of the expression product. Journal of Virological Methods 122:1, 105-111
CrossRef482
Catherine So-kum Tang, Chi-yan Wong. (2004) Factors influencing the wearing of facemasks to prevent the severe acute respiratory syndrome among adult Chinese in Hong Kong. Preventive Medicine 39:6, 1187-1193
CrossRef483
Arjun Srinivasan, Lawrence C. McDonald, Daniel Jernigan, Rita Helfand, Kathleen Ginsheimer, John Jernigan, Linda Chiarello, Raymond Chinn, Umesh Parashar, Larry Anderson, Denise Cardo, . (2004) Foundations of the Severe Acute Respiratory Syndrome Preparedness and Response Plan for Healthcare Facilities • . Infection Control and Hospital Epidemiology 25:12, 1020-1025
CrossRef484
D. Adachi, G. Johnson, R. Draker, M. Ayers, T. Mazzulli, P.J. Talbot, R. Tellier. (2004) Comprehensive detection and identification of human coronaviruses, including the SARS-associated coronavirus, with a single RT-PCR assay. Journal of Virological Methods 122:1, 29-36
CrossRef485
Guy Vernet. (2004) Molecular diagnostics in virology. Journal of Clinical Virology 31:4, 239-247
CrossRef486
Lionel A. Mandell. (2004) Epidemiology and etiology of community-acquired pneumonia. Infectious Disease Clinics of North America 18:4, 761-776
CrossRef487
S. Shichijo, N. Keicho, H.T. Long, T. Quy, N.C. Phi, L.D. Ha, V.V. Ban, S. Itoyama, C.-J. Hu, N. Komatsu, T. Kirikae, F. Kirikae, S. Shirasawa, M. Kaji, T. Fukuda, M. Sata, T. Kuratsuji, K. Itoh, T. Sasazuki. (2004) Assessment of synthetic peptides of severe acute respiratory syndrome coronavirus recognized by long-lasting immunity. Tissue Antigens 64:5, 600-607
CrossRef488
Mei-Shang Ho, Ih-Jen Su. (2004) Preparing to prevent severe acute respiratory syndrome and other respiratory infections. The Lancet Infectious Diseases 4:11, 684-689
CrossRef489
Ka-tak Wong, Gregory E. Antonio, David S. C. Hui, Catherine Ho, Po-nin Chan, Wing-hung Ng, Kwok-kuen Shing, Alan Wu, Nelson Lee, Florence Yap, Gavin M. Joynt, Joseph J. Y. Sung, Anil T. Ahuja. (2004) Severe Acute Respiratory Syndrome. Journal of Computer Assisted Tomography 28:6, 790-795
CrossRef490
Yi Ren, Qing-Yu He, Jianqing Fan, Brian Jones, Yuan Zhou, Yi Xie, Chung-Yan Cheung, Adrian Wu, Jen-Fu Chiu, J. S. Malik Peiris, Paul Kwong Hang Tam. (2004) The use of proteomics in the discovery of serum biomarkers from patients with severe acute respiratory syndrome. PROTEOMICS 4:11, 3477-3484
CrossRef491
Paul A Tambyah. (2004) Severe acute respiratory syndrome from the trenches, at a Singapore university hospital. The Lancet Infectious Diseases 4:11, 690-696
CrossRef492
G. Magiorkinis, E. Magiorkinis, D. Paraskevis, A.M. Vandamme, M. Van Ranst, V. Moulton, A. Hatzakis. (2004) Phylogenetic analysis of the full-length SARS-CoV sequences: Evidence for phylogenetic discordance in three genomic regions. Journal of Medical Virology 74:3, 369-372
CrossRef493
Chun-Hua Hsu, Tzu-Ping Ko, Hui-Ming Yu, Tswen-Kei Tang, Shui-Tsung Chen, Andrew H.-J. Wang. (2004) Immunological, structural, and preliminary X-ray diffraction characterizations of the fusion core of the SARS-coronavirus spike protein. Biochemical and Biophysical Research Communications 324:2, 761-767
CrossRef494
Yuxian He, Yusen Zhou, Shuwen Liu, Zhihua Kou, Wenhui Li, Michael Farzan, Shibo Jiang. (2004) Receptor-binding domain of SARS-CoV spike protein induces highly potent neutralizing antibodies: implication for developing subunit vaccine. Biochemical and Biophysical Research Communications 324:2, 773-781
CrossRef495
Qi-Shi Du, Shu-Qing Wang, Yu Zhu, Dong-Qing Wei, Hong Guo, Suzanne Sirois, Kuo-Chen Chou. (2004) Polyprotein cleavage mechanism of SARS CoV Mpro and chemical modification of the octapeptide. Peptides 25:11, 1857-1864
CrossRef496
LLM Poon, Y Guan, JM Nicholls, KY Yuen, JSM Peiris. (2004) The aetiology, origins, and diagnosis of severe acute respiratory syndrome. The Lancet Infectious Diseases 4:11, 663-671
CrossRef497
Y.-M. Tan, P.K.H. Chow, B.-H. Tan, A. Kurup, B.K.T. Tan, F.L.S. Tan, J. Seldrup, D.M.K. Heng, B. Ang, J. Green, C.-Y. Wong, K.-C. Soo. (2004) Management of inpatients exposed to an outbreak of severe acute respiratory syndrome (SARS). Journal of Hospital Infection 58:3, 210-215
CrossRef498
D. G. Maki. (2004) SARS Revisited: The Challenge of Controlling Emerging Infectious Diseases at the Local, Regional, Federal, and Global Levels. Mayo Clinic Proceedings 79:11, 1359-1366
CrossRef499
Els Keyaerts, Leen Vijgen, Piet Maes, Johan Neyts, Marc Van Ranst. (2004) In vitro inhibition of severe acute respiratory syndrome coronavirus by chloroquine. Biochemical and Biophysical Research Communications 323:1, 264-268
CrossRef500
Leonard R Krilov. (2004) Emerging infectious disease issues in international adoptions: severe acute respiratory syndrome (SARS), avian influenza and measles. Current Opinion in Infectious Diseases 17:5, 391-395
CrossRef501
Jan E. Blanchard, Nadine H. Elowe, Carly Huitema, Pascal D. Fortin, Jonathan D. Cechetto, Lindsay D. Eltis, Eric D. Brown. (2004) High-Throughput Screening Identifies Inhibitors of the SARS Coronavirus Main Proteinase. Chemistry & Biology 11:10, 1445-1453
CrossRef502
Hu Xianming, Deng Yongzhi, Wang Jun, Li Heping, Li Mei, Lu Zuxun. (2004) Short term outcome and risk factors for mortality in adults with critical severe acute respiratory syndrome (SARS). Journal of Huazhong University of Science and Technology [Medical Sciences] 24:5, 514-517
CrossRef503
Heike Hofmann, Stefan Pöhlmann. (2004) Cellular entry of the SARS coronavirus. Trends in Microbiology 12:10, 466-472
CrossRef504
Runtao He, Andrew Leeson, Melissa Ballantine, Anton Andonov, Lindsay Baker, Frederick Dobie, Yan Li, Nathalie Bastien, Heinz Feldmann, Ute Strocher, Steven Theriault, Todd Cutts, Jingxin Cao, Timothy F. Booth, Frank A. Plummer, Shaun Tyler, Xuguang Li. (2004) Characterization of protein–protein interactions between the nucleocapsid protein and membrane protein of the SARS coronavirus. Virus Research 105:2, 121-125
CrossRef505
Wei‐Kung Wang, Shey‐Ying Chen, I.‐Jung Liu, Chuan‐Liang Kao, Hui‐Ling Chen, Bor‐Liang Chiang, Jann‐Tay Wang, Wang‐Hwei Sheng, Po‐Ren Hsueh, Chao‐Fu Yang, Pan‐Chyr Yang, Shan‐Chwen Chang, . (2004) Temporal Relationship of Viral Load, Ribavirin, Interleukin (IL)–6, IL‐8, and Clinical Progression in Patients with Severe Acute Respiratory Syndrome. Clinical Infectious Diseases 39:7, 1071-1075
CrossRef506
Miriam E.R. Darnell, Kanta Subbarao, Stephen M. Feinstone, Deborah R. Taylor. (2004) Inactivation of the coronavirus that induces severe acute respiratory syndrome, SARS-CoV. Journal of Virological Methods 121:1, 85-91
CrossRef507
Jyh-Lyh Juang, Tsan-Chi Chen, Shih Sheng Jiang, Chao A Hsiung, Wei-Chen Chen, Guang-Wu Chen, Shiang-Ming Lin, Jih-Hui Lin, Shu-Chun Chiu, Yiu-Kay Lai. (2004) Coupling multiplex RT-PCR to a gene chip assay for sensitive and semiquantitative detection of severe acute respiratory syndrome-coronavirus. Laboratory Investigation 84:9, 1085-1091
CrossRef508
Yuchun Nie, Peigang Wang, Xuanling Shi, Guangwen Wang, Jian Chen, Aihua Zheng, Wei Wang, Zai Wang, Xiuxia Qu, Min Luo, Lei Tan, Xijun Song, Xiaolei Yin, Jianguo Chen, Mingxiao Ding, Hongkui Deng. (2004) Highly infectious SARS-CoV pseudotyped virus reveals the cell tropism and its correlation with receptor expression. Biochemical and Biophysical Research Communications 321:4, 994-1000
CrossRef509
P. Richard Verbeek, Ian W. McClelland, Alexis C. Silverman, Robert J. Burgess. (2004) Loss of Paramedic Availability in an Urban Emergency Medical Services System during a Severe Acute Respiratory Syndrome Outbreak. Academic Emergency Medicine 11:9, 973-978
CrossRef510
William D. Rawlinson, Zubair M. Waliuzzaman, Michael Fennell, James R. Appleman, Craig D. Shimasaki, Ian W. Carter. (2004) New point of care test is highly specific but less sensitive for influenza virus A and B in children and adults. Journal of Medical Virology 74:1, 127-131
CrossRef511
Wency W Ho, Elsie Hui, Timothy Kwok, Jean Woo. (2004) An outbreak of Severe Acute Respiratory Syndrome in a nursing home: Lessons to learn. Geriatrics and Gerontology International 4:s1, S186-S189
CrossRef512
S. F. Dowell, J. M. Simmerman, D. D. Erdman, J.-S. J. Wu, A. Chaovavanich, M. Javadi, J.-Y. Yang, L. J. Anderson, S. Tong, M. S. Ho. (2004) Severe Acute Respiratory Syndrome Coronavirus on Hospital Surfaces. Clinical Infectious Diseases 39:5, 652-657
CrossRef513
Xiaodong Xiao, Yang Feng, Samitabh Chakraborti, Dimiter S. Dimitrov. (2004) Oligomerization of the SARS-CoV S glycoprotein: dimerization of the N-terminus and trimerization of the ectodomain. Biochemical and Biophysical Research Communications 322:1, 93-99
CrossRef514
Eddie Y.K Ng, G.J.L Kawb, W.M Chang. (2004) Analysis of IR thermal imager for mass blind fever screening. Microvascular Research 68:2, 104-109
CrossRef515
Huo-Shu H Houng, David Norwood, George V Ludwig, Wellington Sun, Minta Lin, David W Vaughn. (2004) Development and evaluation of an efficient 3′-noncoding region based SARS coronavirus (SARS-CoV) RT-PCR assay for detection of SARS-CoV infections. Journal of Virological Methods 120:1, 33-40
CrossRef516
Paul K.S. Chan, Ka-Fai To, Anthony W.I. Lo, Jo L.K. Cheung, Ida Chu, Florence W.L. Au, Joanna H.M. Tong, John S. Tam, Joseph J.Y. Sung, Ho-Keung Ng. (2004) Persistent infection of SARS coronavirus in colonic cells in vitro. Journal of Medical Virology 74:1, 1-7
CrossRef517
Erik De Clercq. (2004) Antivirals and antiviral strategies. Nature Reviews Microbiology 2:9, 704-720
CrossRef518
Y.-W. W. Fung, L. T. Lau, F. P.-F. Wong, K.-W. Choi, T.-N. Chau, S.-T. Lai, C. G. Wang, N. Dillon, A. C.-H. Yu. (2004) Use of Clinical Criteria and Molecular Diagnosis to More Effectively Monitor Patients Recovering after Severe Acute Respiratory Syndrome Coronavirus Infection. Clinical Infectious Diseases 39:4, 604-606
CrossRef519
Khalid Amine Timani, Li Ye, Linbai Ye, Ying Zhu, Zhenghui Wu, Zuojiong Gong. (2004) Cloning, sequencing, expression, and purification of SARS-associated coronavirus nucleocapsid protein for serodiagnosis of SARS. Journal of Clinical Virology 30:4, 309-312
CrossRef520
Elisabetta Traggiai, Stephan Becker, Kanta Subbarao, Larissa Kolesnikova, Yasushi Uematsu, Maria Rita Gismondo, Brian R Murphy, Rino Rappuoli, Antonio Lanzavecchia. (2004) An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nature Medicine 10:8, 871-875
CrossRef521
Cheng Luo, Haibin Luo, Suxin Zheng, Chunshan Gui, Liduo Yue, Changying Yu, Tao Sun, Peilan He, Jing Chen, Jianhua Shen, Xiaomin Luo, Yixue Li, Hong Liu, Donglu Bai, Jingkang Shen, Yiming Yang, Fangqiu Li, Jianping Zuo, Rolf Hilgenfeld, Gang Pei, Kaixian Chen, Xu Shen, Hualiang Jiang. (2004) Nucleocapsid protein of SARS coronavirus tightly binds to human cyclophilin A. Biochemical and Biophysical Research Communications 321:3, 557-565
CrossRef522
John Ziebuhr. (2004) Molecular biology of severe acute respiratory syndrome coronavirus. Current Opinion in Microbiology 7:4, 412-419
CrossRef523
David SC Hui, Gary WK Wong. (2004) Advancements in the battle against severe acute respiratory syndrome. Expert Opinion on Pharmacotherapy 5:8, 1687-1693
CrossRef524
O Y Cheung, J W M Chan, C K Ng, C K Koo. (2004) The spectrum of pathological changes in severe acute respiratory syndrome (SARS). Histopathology 45:2, 119-124
CrossRef525
Hai-Feng Chen, Jian-Hua Yao, Jing Sun, Qiang Li, Feng Li, Bo-Tao Fan, Shen-Gang Yuan. (2004) Discovery of anti-SARS coronavirus drug based on molecular docking and database screening. Chinese Journal of Chemistry 22:8, 882-887
CrossRef526
H Dutronc, M Dupon, G Cipriano, S Lafarie, M.-E Lafon, H.-J.-A Fleury, F Bocquentin, D Neau, J.-M Ragnaud. (2004) Syndrome respiratoire aigu sévère : à propos d'un cas de transmission indirecte du Coronavirus. La Revue de Médecine Interne 25:8, 607-609
CrossRef527
Peter A Lim, Yee Sien Ng, Boon Keng Tay. (2004) Impact of a viral respiratory epidemic on the practice of medicine and rehabilitation: Severe acute respiratory syndrome. Archives of Physical Medicine and Rehabilitation 85:8, 1365-1370
CrossRef528
Tracy Hussell, Robert Snelgrove, Ian R. Humphreys, Andrew E. Williams. (2004) Co-stimulation: novel methods for preventing viral-induced lung inflammation. Trends in Molecular Medicine 10:8, 379-386
CrossRef529
Chui Miu Lam, Shell Fean Wong, Tse Ngong Leung, Kam Ming Chow, Wai Cho Yu, Tin Yau Wong, Sik To Lai, Lau Cheung Ho. (2004) A case-controlled study comparing clinical course and outcomes of pregnant and non-pregnant women with severe acute respiratory syndrome. BJOG: An International Journal of Obstetrics and Gynaecology 111:8, 771-774
CrossRef530
R W K Li, K W C Leung, F C S Sun, L P Samaranayake. (2004) Severe Acute Respiratory Syndrome (SARS) and the GDP. Part I: Epidemiology, virology, pathology and general health issues. British Dental Journal 197:2, 77-80
CrossRef531
X Liu, M Zhang, L He, Y Li, Xuemei Liu. 2004. Chinese herbs combined with western medicine for severe acute respiratory syndrome (SARS). .
CrossRef532
Leo L.M Poon, Bonnie W.Y Wong, Kwok Hung Chan, Cynthia S.W Leung, Kwok Yung Yuen, Yi Guan, Joseph S.M Peiris. (2004) A one step quantitative RT-PCR for detection of SARS coronavirus with an internal control for PCR inhibitors. Journal of Clinical Virology 30:3, 214-217
CrossRef533
Bojian Zheng, Ming-Liang He, King-Ling Wong, Ching Tung Lum, Leo L.M. Poon, Ying Peng, Yi Guan, Marie C.M. Lin, Hsiang-Fu Kung. (2004) Potent Inhibition of SARS-Associated Coronavirus (SCoV) Infection and Replication by Type I Interferons (IFN- α/β ) but Not by Type II Interferon (IFN- γ ). Journal of Interferon & Cytokine Research 24:7, 388-390
CrossRef534
Li-Rung Huang, Chi-Ming Chiu, Shiou-Hwei Yeh, Wen-Hung Huang, Po-Ren Hsueh, Wen-Zieh Yang, Jyh-Yuan Yang, Ih-Jen Su, Shan-Chwen Chang, Pei-Jer Chen. (2004) Evaluation of antibody responses against SARS coronaviral nucleocapsid or spike proteins by immunoblotting or ELISA. Journal of Medical Virology 73:3, 338-346
CrossRef535
Martin Spiegel, Andreas Pichlmair, Elke Mühlberger, Otto Haller, Friedemann Weber. (2004) The antiviral effect of interferon-beta against SARS-Coronavirus is not mediated by MxA protein. Journal of Clinical Virology 30:3, 211-213
CrossRef536
T. HUSSELL, A. WILLIAMS. (2004) Ménage à trois of bacterial and viral pulmonary pathogens delivers coup de grace to the lung. Clinical & Experimental Immunology 137:1, 8-11
CrossRef537
Zhang Qinfen, Cui Jinming, Huang Xiaojun, Zheng Huanying, Huang Jicheng, Fang Ling, Li Kunpeng, Zhang Jingqiang. (2004) The life cycle of SARS coronavirus in Vero E6 cells. Journal of Medical Virology 73:3, 332-337
CrossRef538
Huimin Yan, Gengfu Xiao, Jiamin Zhang, Yuanyang Hu, Fang Yuan, David K. Cole, Congyi Zheng, George F. Gao. (2004) SARS coronavirus induces apoptosis in Vero E6 Cells. Journal of Medical Virology 73:3, 323-331
CrossRef539
Tetsuya Mizutani, Shuetsu Fukushi, Masayuki Saijo, Ichiro Kurane, Shigeru Morikawa. (2004) Phosphorylation of p38 MAPK and its downstream targets in SARS coronavirus-infected cells. Biochemical and Biophysical Research Communications 319:4, 1228-1234
CrossRef540
Qingfa Wu, Zuyuan Xu, Tian Wei, Haipang Zeng, Jingxiang Li, Haixue Gang, Min Sun, Fangbo Jiang, Xiang Wang, Wei Dong, Ling Yang, Jian Wang. (2004) Development of Taqman RT-nested PCR system for clinical SARS-CoV detection. Journal of Virological Methods 119:1, 17-23
CrossRef541
Ronghong Hua, Yanjun Zhou, Yunfeng Wang, Yuzhuo Hua, Guangzhi Tong. (2004) Identification of two antigenic epitopes on SARS-CoV spike protein. Biochemical and Biophysical Research Communications 319:3, 929-935
CrossRef542
Heike Hofmann, Martina Geier, Andrea Marzi, Mandy Krumbiegel, Matthias Peipp, Georg H Fey, Thomas Gramberg, Stefan Pöhlmann. (2004) Susceptibility to SARS coronavirus S protein-driven infection correlates with expression of angiotensin converting enzyme 2 and infection can be blocked by soluble receptor. Biochemical and Biophysical Research Communications 319:4, 1216-1221
CrossRef543
Y. O. Y. Soo, Y. Cheng, R. Wong, D. S. Hui, C. K. Lee, K. K. S. Tsang, M. H. L. Ng, P. Chan, G. Cheng, J. J. Y. Sung. (2004) Retrospective comparison of convalescent plasma with continuing high-dose methylprednisolone treatment in SARS patients. Clinical Microbiology and Infection 10:7, 676-678
CrossRef544
JAMES D. CHERRY, PAUL KROGSTAD. (2004) SARS: The First Pandemic of the 21st Century. Pediatric Research 56:1, 1-5
CrossRef545
N HONG, X DU. (2004) Avascular necrosis of bone in severe acute respiratory syndrome. Clinical Radiology 59:7, 602-608
CrossRef546
Kar Neng Lai, Kenneth W. Tsang, Wing Hong Seto, Clara G. C. Ooi. (2004) Clinical, laboratory, and radiologic manifestation of SARS. Current Infectious Disease Reports 6:3, 213-219
CrossRef547
Renaat AAM Peleman. (2004) New and re-emerging infectious diseases: epidemics in waiting. Current Opinion in Anaesthesiology 17:3, 265-270
CrossRef548
Alexander Bukreyev, Elaine W Lamirande, Ursula J Buchholz, Leatrice N Vogel, William R Elkins, Marisa St Claire, Brian R Murphy, Kanta Subbarao, Peter L Collins. (2004) Mucosal immunisation of African green monkeys (Cercopithecus aethiops) with an attenuated parainfluenza virus expressing the SARS coronavirus spike protein for the prevention of SARS. The Lancet 363:9427, 2122-2127
CrossRef549
Norio Yamamoto, Rongge Yang, Yoshiyuki Yoshinaka, Shinji Amari, Tatsuya Nakano, Jindrich Cinatl, Holger Rabenau, Hans Wilhelm Doerr, Gerhard Hunsmann, Akira Otaka, Hirokazu Tamamura, Nobutaka Fujii, Naoki Yamamoto. (2004) HIV protease inhibitor nelfinavir inhibits replication of SARS-associated coronavirus. Biochemical and Biophysical Research Communications 318:3, 719-725
CrossRef550
Yu Ho, Pi-Hsiu Lin, Catherine Y.Y Liu, Su-Ping Lee, Yu-Chan Chao. (2004) Assembly of human severe acute respiratory syndrome coronavirus-like particles. Biochemical and Biophysical Research Communications 318:4, 833-838
CrossRef551
Thomas W. F. Chin, Clarence Chant, Rosemary Tanzini, Janice Wells. (2004) Severe Acute Respiratory Syndrome (SARS): The Pharmacist’s Role. Pharmacotherapy 24:6, 705-712
CrossRef552
Chih-Jung Kuo, Ya-Hui Chi, John T.-A Hsu, Po-Huang Liang. (2004) Characterization of SARS main protease and inhibitor assay using a fluorogenic substrate. Biochemical and Biophysical Research Communications 318:4, 862-867
CrossRef553
Arthur Chun-Wing LAU, Loletta Kit-Ying SO, Flora Pui-Ling MIU, Raymond Wai-Hung YUNG, Edwin POON, Thomas Man-Tat CHEUNG, Loretta Yin-Chun YAM. (2004) Outcome of coronavirus-associated severe acute respiratory syndrome using a standard treatment protocol. Respirology 9:2, 173-183
CrossRef554
Jieqing Zhu, Gengfu Xiao, Yanhui Xu, Fang Yuan, Congyi Zheng, Yueyong Liu, Huimin Yan, David K Cole, John I Bell, Zihe Rao, Po Tien, George F Gao. (2004) Following the rule: formation of the 6-helix bundle of the fusion core from severe acute respiratory syndrome coronavirus spike protein and identification of potent peptide inhibitors. Biochemical and Biophysical Research Communications 319:1, 283-288
CrossRef555
M. D. Christian, S. M. Poutanen, M. R. Loutfy, M. P. Muller, D. E. Low. (2004) Severe Acute Respiratory Syndrome. Clinical Infectious Diseases 38:10, 1420-1427
CrossRef556
Michel Theron. (2004) Prevalence of non-pneumonic infections with SARS-correlated virus. The Lancet 363:9423, 1825
CrossRef557
Timothy H Rainer. (2004) Severe acute respiratory syndrome. Current Opinion in Pulmonary Medicine 10:3, 159-165
CrossRef558
Lim, Poh Lian, Kurup, Asok, Gopalakrishna, Gowri, Chan, Kwai Peng, Wong, Christopher W., Ng, Lee Ching, Se-Thoe, Su Yun, Oon, Lynette, Bai, Xinlai, Stanton, Lawrence W., Ruan, Yijun, Miller, Lance D., Vega, Vinsensius B., James, Lyn, Ooi, Peng Lim, Kai, Chew Suok, Olsen, Sonja J., Ang, Brenda, Leo, Yee-Sin, . (2004) Laboratory-Acquired Severe Acute Respiratory Syndrome. New England Journal of Medicine 350:17, 1740-1745
Full Text559
Jann-Tay Wang, Shan-Chwen Chang. (2004) Severe acute respiratory syndrome. Current Opinion in Infectious Diseases 17:2, 143-148
CrossRef560
Mark Loeb. (2004) Pneumonia in the elderly. Current Opinion in Infectious Diseases 17:2, 127-130
CrossRef561
Jin Gu, Aiwen Wu, Jiyou Li, Xiaopeng Zhang, Jian Fang, Ming Li, Yunfeng Yao, Yang Ke, Jiang Gu, Mingzhe Chen, Weicheng You. (2004) An assessment of World Health Organization criteria for severe acute respiratory syndrome in patients with cancer. Cancer 100:7, 1374-1378
CrossRef562
Kuan-Chih Chow, Cheng-Hsiang Hsiao, Tze-Yi Lin, Chi-Long Chen, Shiow-Her Chiou. (2004) Detection of Severe Acute Respiratory Syndrome-Associated Coronavirus in Pneumocytes of the Lung. American Journal of Clinical Pathology 121:4, 574-580
CrossRef563
C. K. WONG, C. W. K. LAM, A. K. L. WU, W. K. IP, N. L. S. LEE, I. H. S. CHAN, L. C. W. LIT, D. S. C. HUI, M. H. M. CHAN, S. S. C. CHUNG, J. J. Y. SUNG. (2004) Plasma inflammatory cytokines and chemokines in severe acute respiratory syndrome. Clinical & Experimental Immunology 136:1, 95-103
CrossRef564
Felissa R Lashley. (2004) Emerging infectious diseases: vulnerabilities, contributing factors and approaches. Expert Review of Anti-infective Therapy 2:2, 299-316
CrossRef565
Hiroshi Ushijima, Yuki Eshita. (2004) Foreward: Molecular epidemiology of viral infection in Asia. Pediatrics International 46:2, 202-206
CrossRef566
Radford G. Davis. (2004) The ABCs of bioterrorism for veterinarians, focusing on Category A agents. Journal of the American Veterinary Medical Association 224:7, 1084-1095
CrossRef567
S Vallet. (2004) Detection of human Coronavirus 229E in nasal specimens in large scale studies using an RT-PCR hybridization assay. Molecular and Cellular Probes 18:2, 75-80
CrossRef568
G. Simmons, J. D. Reeves, A. J. Rennekamp, S. M. Amberg, A. J. Piefer, P. Bates. (2004) Characterization of severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike glycoprotein-mediated viral entry. Proceedings of the National Academy of Sciences 101:12, 4240-4245
CrossRef569
Shuwen Liu, Gengfu Xiao, Yibang Chen, Yuxian He, Jinkui Niu, Carlos R Escalante, Huabao Xiong, James Farmar, Asim K Debnath, Po Tien, Shibo Jiang. (2004) Interaction between heptad repeat 1 and 2 regions in spike protein of SARS-associated coronavirus: implications for virus fusogenic mechanism and identification of fusion inhibitors. The Lancet 363:9413, 938-947
CrossRef570
Hugh Pennington. (2004) Opinion: Politics, media and microbiologists. Nature Reviews Microbiology 2:3, 259-262
CrossRef571
Michael J. Stanhope, James R. Brown, Heather Amrine-Madsen. (2004) Evidence from the evolutionary analysis of nucleotide sequences for a recombinant history of SARS-CoV. Infection, Genetics and Evolution 4:1, 15-19
CrossRef572
Lingamanaidu V. Ravichandran, Nicholas M. Dean, Eric G. Marcusson. (2004) Use of Antisense Oligonucleotides in Functional Genomics and Target Validation. Oligonucleotides 14:1, 49-64
CrossRef573
Peigang Wang, Jian Chen, Aihua Zheng, Yuchun Nie, Xuanling Shi, Wei Wang, Guangwen Wang, Min Luo, Huijun Liu, Lei Tan, Xijun Song, Zai Wang, Xiaolei Yin, Xiuxia Qu, Xiaojing Wang, Tingting Qing, Mingxiao Ding, Hongkui Deng. (2004) Expression cloning of functional receptor used by SARS coronavirus. Biochemical and Biophysical Research Communications 315:2, 439-444
CrossRef574
Patrick CY Woo, Susanna KP Lau, Hoi-wah Tsoi, Kwok-hung Chan, Beatrice HL Wong, Xiao-yan Che, Victoria KP Tam, Sidney CF Tam, Vincent CC Cheng, Ivan FN Hung, Samson SY Wong, Bo-jian Zheng, Yi Guan, Kwok-yung Yuen. (2004) Relative rates of non-pneumonic SARS coronavirus infection and SARS coronavirus pneumonia. The Lancet 363:9412, 841-845
CrossRef575
V Lopez. (2004) Nursing care of patients with severe acute respiratory syndrome in the intensive care unit: case reports in Hong Kong. International Journal of Nursing Studies 41:3, 263-272
CrossRef576
V. C. C. Cheng, I. F. N. Hung, B. S. F. Tang, C. M. Chu, M. M. L. Wong, K. H. Chan, A. K. L. Wu, D. M. W. Tse, K. S. Chan, B. J. Zheng, J. S. M. Peiris, J. J. Y. Sung, K. Y. Yuen. (2004) Viral Replication in the Nasopharynx Is Associated with Diarrhea in Patients with Severe Acute Respiratory Syndrome. Clinical Infectious Diseases 38:4, 467-475
CrossRef577
Atul Humar, Ian McGilvray, Murray J. Phillips, Gary A. Levy. (2004) Severe acute respiratory syndrome and the liver. Hepatology 39:2, 291-294
CrossRef578
Mau-Sun Chang, Yen-Ta Lu, Shin-Tsung Ho, Chao-Chih Wu, Tsai-Yin Wei, Chia-Ju Chen, Yun-Ting Hsu, Po-Chen Chu, Ching-Hsin Chen, Jien-Ming Chu, Ya-Lin Jan, Chia-Chien Hung, Chi-Chen Fan, Yuh-Cheng Yang. (2004) Antibody detection of SARS-CoV spike and nucleocapsid protein. Biochemical and Biophysical Research Communications 314:4, 931-936
CrossRef579
Natalie Keeler, Jairam Lingappa. (2004) Severe acute respiratory syndrome: public health response and clinical practice update for an emerging disease. Current Opinion in Pediatrics 16:1, 61-69
CrossRef580
Sameer Syed, Abdus Saleem. (2004) Severe Acute Respiratory Syndrome Epidemiology and Control. Laboratory Medicine 35:2, 112-116
CrossRef581
Dimiter S. Dimitrov. (2004) Virus entry: molecular mechanisms and biomedical applications. Nature Reviews Microbiology 2:2, 109-122
CrossRef582
Stephen E Lapinsky, John T Granton. (2004) Critical care lessons from severe acute respiratory syndrome. Current Opinion in Critical Care 10:1, 53-58
CrossRef583
A. Berger, C. Drosten, H. W. Doerr, W. Preiser. (2004) Das SARS-assoziierte Coronavirus – Die erste Pandemie des 21. Jahrhunderts / The SARS-associated coronavirus – The first pandemic of the 21st century. LaboratoriumsMedizin 28:1, 42-55
CrossRef584
Jian Ping Liu, Lise Lotte Gluud, Bodil Als-Nielsen, Christian Gluud, Jian Ping Liu. 2004. Artificial and bioartificial support systems for liver failure. .
CrossRef585
L. L. M Poon, K. H. Chan, J. S. M. Peiris. (2004) Editorial Commentary: Crouching Tiger, Hidden Dragon: The Laboratory Diagnosis of Severe Acute Respiratory Syndrome. Clinical Infectious Diseases 38:2, 297-299
CrossRef586
Shih Sheng Jiang, Tsan‐Chi Chen, Jyh‐Yuan Yang, Chao A. Hsiung, Ih‐Jen Su, Ying‐Lan Liu, Po‐Cheng Chen, Jyh‐Lyh Juang. (2004) Sensitive and Quantitative Detection of Severe Acute Respiratory Syndrome Coronavirus Infection by Real‐Time Nested Polymerase Chain Reaction. Clinical Infectious Diseases 38:2, 293-296
CrossRef587
Ho-Sheng Wu, Yueh-Chun Hsieh, In-Jen Su, Ting-Hsiang Lin, Shu-Chun Chiu, Yu-Fen Hsu, Jih-Hui Lin, Mei-Ching Wang, Jeou-Yuan Chen, Pei-Wen Hsiao, Geen-Dong Chang, Andrew H. -J. Wang, Hsien-Wei Ting, Chih-Ming Chou, Chang-Jen Huang. (2004) Early detection of antibodies against various structural proteins of the SARS-associated coronavirus in SARS patients. Journal of Biomedical Science 11:1, 117-126
CrossRef588
A. Berger, Ch. Drosten, H.W. Doerr, M. Stürmer, W. Preiser. (2004) Severe acute respiratory syndrome (SARS)—paradigm of an emerging viral infection. Journal of Clinical Virology 29:1, 13-22
CrossRef589
Keith C. Meyer. (2004) Lung infections and aging. Ageing Research Reviews 3:1, 55-67
CrossRef590
T.-N Jang, D.Y Yeh, S.-H Shen, C.-H Huang, J.-S Jiang, S.-J Kao. (2004) Severe acute respiratory syndrome in Taiwan: analysis of epidemiological characteristics in 29 cases. Journal of Infection 48:1, 23-31
CrossRef591
REGINA K. ROWE, STEVEN L. BRODY, ANDREW PEKOSZ. (2004) DIFFERENTIATED CULTURES OF PRIMARY HAMSTER TRACHEALAIRWAY EPITHELIAL CELLS. In Vitro Cellular & Developmental Biology - Animal 40:10, 303
CrossRef592
Mitsuo KAKU, Hiroyuki KUNISHIMA, Keiji KANEMITSU. (2004) General Remarks: Effective Strategies for Preventing and Controlling SARS Infection-Prevention from the Point of View of Epidemiology-. JOURNAL OF THE JAPANESE ASSOCIATION OF RURAL MEDICINE 52:5, 805-811
CrossRef593
Joyce Yee-Hing Hui, Timothy Yu-Wai Hon, Michael Kwok-Wai Yang, Danny Hing-Yan Cho, Wing-Hang Luk, Ronee Yun-Yee Chan, Kin-Sang Chan, Tony Kwok-Loon Loke, James Chi-Sang Chan. (2004) High-Resolution Computed Tomography Is Useful for Early Diagnosis of Severe Acute Respiratory Syndrome–Associated Coronavirus Pneumonia in Patients with Normal Chest Radiographs. Journal of Computer Assisted Tomography 28:1, 1-9
CrossRef594
Alexander C. Vlantis, Raymond K. Y. Tsang, Duncan K. K. Wong, John K. S. Woo, C. Andrew van Hasselt. (2004) The Impact of Severe Acute Respiratory Syndrome on Otorhinolaryngological Services at The Prince of Wales Hospital in Hong Kong. The Laryngoscope 114:1, 171-174
CrossRef595
ASUNCI??N MEJ??AS, SUSANA CH??VEZ-BUENO, OCTAVIO RAMILO. (2004) Human metapneumovirus: a not so new virus. The Pediatric Infectious Disease Journal 23:1, 1-7
CrossRef596
Raymond C H So, Joshua Ko, Yvonne W Y Yuan, James J Lam, Lobo Louie. (2004) Severe Acute Respiratory Syndrome and Sport. Sports Medicine 34:15, 1023-1033
CrossRef597
BERNADETTE G. VAN DEN HOOGEN, D. M. E. OSTERHAUS, RON A. M. FOUCHIER. (2004) Clinical impact and diagnosis of human metapneumovirus infection. The Pediatric Infectious Disease Journal 23:Supplement, S25-S32
CrossRef598
F C Smales, L P Samaranyake. (2003) Maintaining dental education and specialist dental care during an outbreak of a new coronavirus infection. Part 2:Control of the disease, then elimination. British Dental Journal 195:12, 679-681
CrossRef599
Olsen, Sonja J., Chang, Hsiao-Ling, Cheung, Terence Yung-Yan, Tang, Antony Fai-Yu, Fisk, Tamara L., Ooi, Steven Peng-Lim, Kuo, Hung-Wei, Jiang, Donald Dah-Shyong, Chen, Kow-Tong, Lando, Jim, Hsu, Kwo-Hsiung, Chen, Tzay-Jinn, Dowell, Scott F., . (2003) Transmission of the Severe Acute Respiratory Syndrome on Aircraft. New England Journal of Medicine 349:25, 2416-2422
Full Text600
Grant, Paul R., Garson, Jeremy A., Tedder, Richard S., , Chan, Paul K.S., Tam, John S., Sung, Joseph J.Y., . (2003) Detection of SARS Coronavirus in Plasma by Real-Time RT-PCR. New England Journal of Medicine 349:25, 2468-2469
Full Text601
Peiris, Joseph S.M., Yuen, Kwok Y., Osterhaus, Albert D.M.E., Stöhr, Klaus, . (2003) The Severe Acute Respiratory Syndrome. New England Journal of Medicine 349:25, 2431-2441
Full Text602
J.S.M Peiris. (2003) Severe Acute Respiratory Syndrome (SARS). Journal of Clinical Virology 28:3, 245-247
CrossRef603
Leo L.M. Poon, Kwok Hung Chan, On Kei Wong, Wing Cheong Yam, Kwok Yung Yuen, Yi Guan, Y.M.Dennis Lo, Joseph S.M. Peiris. (2003) Early diagnosis of SARS Coronavirus infection by real time RT-PCR. Journal of Clinical Virology 28:3, 233-238
CrossRef604
Krishna Narayanan, Kyongmin Hwang Kim, Shinji Makino. (2003) Characterization of N protein self-association in coronavirus ribonucleoprotein complexes. Virus Research 98:2, 131-140
CrossRef605
Lok Ting Lau, Yin-Wan Wendy Fung, Freda Pui-Fan Wong, Selma Sau-Wah Lin, Chen Ran Wang, Hui Li Li, Natalie Dillon, Richard A Collins, John Siu-Lun Tam, Paul K.S Chan, Chen G Wang, Albert Cheung-Hoi Yu. (2003) A real-time PCR for SARS-coronavirus incorporating target gene pre-amplification. Biochemical and Biophysical Research Communications 312:4, 1290-1296
CrossRef606
Konrad Stadler, Vega Masignani, Markus Eickmann, Stephan Becker, Sergio Abrignani, Hans-Dieter Klenk, Rino Rappuoli. (2003) SARS — beginning to understand a new virus. Nature Reviews Microbiology 1:3, 209-218
CrossRef607
Xiaodong Xiao, Samitabh Chakraborti, Anthony S Dimitrov, Kosi Gramatikoff, Dimiter S Dimitrov. (2003) The SARS-CoV S glycoprotein: expression and functional characterization. Biochemical and Biophysical Research Communications 312:4, 1159-1164
CrossRef608
T.F Leung, G.W.K Wong, K.L.E Hon, T.F Fok. (2003) Severe acute respiratory syndrome (SARS) in children: epidemiology, presentation and management. Paediatric Respiratory Reviews 4:4, 334-339
CrossRef609
L. A. Mandell, J. G. Bartlett, S. F. Dowell, T. M. File, D. M. Musher, C. Whitney. (2003) Update of Practice Guidelines for the Management of Community-Acquired Pneumonia in Immunocompetent Adults. Clinical Infectious Diseases 37:11, 1405-1433
CrossRef610
Philip W. H. Peng, David T. Wong, David Bevan, Michael Gardam. (2003) Infection control and anesthesia: Lessons learned from the Toronto SARS outbreak. Canadian Journal of Anesthesia/Journal canadien d'anesthésie 50:10, 989-997
CrossRef611
Thijs Kuiken, Ron Fouchier, Guus Rimmelzwaan, Albert Osterhaus. (2003) Emerging viral infections in a rapidly changing world. Current Opinion in Biotechnology 14:6, 641-646
CrossRef612
Andrew Davidson, Stuart Siddell. (2003) Potential for antiviral treatment of severe acute respiratory syndrome. Current Opinion in Infectious Diseases 16:6, 565-571
CrossRef613
Sonia Navas-Martin, Susan R. Weiss. (2003) SARS: Lessons Learned from Other Coronaviruses. Viral Immunology 16:4, 461-474
CrossRef614
F C Smales, L P Samaranyake. (2003) Maintaining dental education and specialist dental care during an outbreak of a new coronavirus infection. Part 1: A deadly viral epidemic begins. British Dental Journal 195:10, 557-561
CrossRef615
John NICHOLLS, Xiao-Ping DONG, Gu JIANG, Malik PEIRIS. (2003) SARS: clinical virology and pathogenesis. Respirology 8:s1, S6-S8
CrossRef616
Moira CHAN-YEUNG, Rui-Heng XU. (2003) SARS: epidemiology. Respirology 8:s1, S9-S14
CrossRef617
Sanjay Manocha, Keith R. Walley, James A. Russell. (2003) Severe acute respiratory distress syndrome (SARS): A critical care perspective. Critical Care Medicine 31:11, 2684-2692
CrossRef618
WK LAM, NS ZHONG, WC TAN. (2003) Overview on SARS in Asia and the World. Respirology 8:s1, S2-S5
CrossRef619
Runtao He, Andrew Leeson, Anton Andonov, Yan Li, Nathalie Bastien, Jingxin Cao, Carla Osiowy, Frederick Dobie, Todd Cutts, Melissa Ballantine, Xuguang Li. (2003) Activation of AP-1 signal transduction pathway by SARS coronavirus nucleocapsid protein. Biochemical and Biophysical Research Communications 311:4, 870-876
CrossRef620
Bonnie Ching-Ha Kwan, Chi-Bon Leung, Cheuk-Chun Szeto, Angela Yee-Moon Wang, Philip Kam-Tao Li. (2003) Severe acute respiratory syndrome in a hemodialysis patient. American Journal of Kidney Diseases 42:5, 1069-1074
CrossRef621
Gaik Cheng OOI, Ma DAQING. (2003) SARS: radiological features. Respirology 8:s1, S15-S19
CrossRef622
Ping-Nam Wong, Siu-Ka Mak, Kin-Yee Lo, Gensy M.W Tong, Yuk Wong, Chi-Leung Watt, Andrew K.M Wong. (2003) Clinical presentation and outcome of severe acute respiratory syndrome in dialysis patients. American Journal of Kidney Diseases 42:5, 1075-1081
CrossRef623
M.L. Ng, S.H. Tan, E.E. See, E.E. Ooi, A.E. Ling. (2003) Early events of SARS coronavirus infection in vero cells. Journal of Medical Virology 71:3, 323-331
CrossRef624
D.A. Groneberg. (2003) Severe acute respiratory syndrome: global initiatives for disease diagnosis. QJM 96:11, 845-852
CrossRef625
G Antonio. (2003) Imaging in Severe Acute Respiratory Syndrome (SARS). Clinical Radiology 58:11, 825-832
CrossRef626
Peter A Cameron, Timothy H Rainer. (2003) Severe acute respiratory syndrome (SARS). Emergency Medicine Australasia 15:5-6, 413-417
CrossRef627
NS Zhong, BJ Zheng, YM Li, LLM Poon, ZH Xie, KH Chan, PH Li, SY Tan, Q Chang, JP Xie, XQ Liu, J Xu, DX Li, KY Yuen, JSM Peiris, Y Guan. (2003) Epidemiology and cause of severe acute respiratory syndrome (SARS) in Guangdong, People's Republic of China, in February, 2003. The Lancet 362:9393, 1353-1358
CrossRef628
Annelies Wilder-Smith, Hoe Nam Leong, Jorge S. Villacian. (2003) In-flight transmission of Severe Acute Respiratory Syndrome (SARS): A Case Report. Journal of Travel Medicine 10:5, 299-300
CrossRef629
(2003) The potential impact of SARS on organ transplantation: Exercise caution. Pediatric Transplantation 7:5, 345-347
CrossRef630
P Bossi, A Guihot, S Ansart, F Bricaire. (2003) Actualités sur le syndrome respiratoire aigu sévère. La Revue de Médecine Interne 24:10, 672-680
CrossRef631
Hsing I. Chen, Shang Jyh Kao, David Wang, Ru Ping Lee, Chain Fa Su. (2003) Acute respiratory distress syndrome. Journal of Biomedical Science 10:6, 588-592
CrossRef632
Wai K Leung, Ka-fai To, Paul K.S Chan, Henry L.Y Chan, Alan K.L Wu, Nelson Lee, Kwok Y Yuen, Joseph J.Y Sung. (2003) Enteric involvement of severe acute respiratory syndrome-associated coronavirus infection1 1The authors thank Man-yee Yung, Sara Fung, Dr. Bonnie Kwan, and Dr. Thomas Li for their help in retrieving patient information.. Gastroenterology 125:4, 1011-1017
CrossRef633
Xiao Ping Chen, Guan Han Li, Xiao Ping Tang, Yuan Xiong, Xie Jie Chen, Yunzhen Cao. (2003) Lack of Severe Acute Respiratory Syndrome in 19 AIDS Patients Hospitalized Together. JAIDS Journal of Acquired Immune Deficiency Syndromes 34:2, 242-243
CrossRef634
Gary W.K. Wong, Albert M. Li, P.C. Ng, Tai F. Fok. (2003) Severe acute respiratory syndrome in children. Pediatric Pulmonology 36:4, 261-266
CrossRef635
Michael M. C. Lai. (2003) SARS virus: The beginning of the unraveling of a new coronavirus. Journal of Biomedical Science 10:6, 664-675
CrossRef636
Wei Cui, Ying Fan, Wei Wu, Feng Zhang, Jun‐ying Wang, An‐ping Ni. (2003) Expression of Lymphocytes and Lymphocyte Subsets in Patients with Severe Acute Respiratory Syndrome. Clinical Infectious Diseases 37:6, 857-859
CrossRef637
Guttmacher, Alan E., Collins, Francis S., . (2003) Welcome to the Genomic Era. New England Journal of Medicine 349:10, 996-998
Full Text638
G. Chowell, P.W. Fenimore, M.A. Castillo-Garsow, C. Castillo-Chavez. (2003) SARS outbreaks in Ontario, Hong Kong and Singapore: the role of diagnosis and isolation as a control mechanism. Journal of Theoretical Biology 224:1, 1-8
CrossRef639
AVINASH K. SHETTY, ELIZABETH TREYNOR, DAVID W. HILL, KATHLEEN M. GUTIERREZ, ANN WARFORD, ELLEN JO BARON. (2003) Comparison of conventional viral cultures with direct fluorescent antibody stains for diagnosis of community-acquired respiratory virus infections in hospitalized children. The Pediatric Infectious Disease Journal 22:9, 789-794
CrossRef640
Kenneth W. TSANG, Thomas Y. MOK, Poon C. WONG, Gaik C. OOI. (2003) Severe acute respiratory syndrome (SARS) in Hong Kong. Respirology 8:3, 259-265
CrossRef641
T. B. Knudsen, T. N. Kledal, O. Andersen, J. Eugen-Olsen, T. B. Kristiansen. (2003) Severe Acute Respiratory Syndrome - a New Coronavirus from the Chinese Dragon's Lair*. Scandinavian Journal of Immunology 58:3, 277-284
CrossRef642
J. L. N. WOOD, J. R. NEWTON, J. DALY, A. W. PARK, J. A. MUMFORD. (2003) It's all in the mix: infection transmission in populations. Equine Veterinary Journal 35:6, 526-528
CrossRef643
Leng, Qibin, , Bentwich, Zvi, . (2003) A Novel Coronavirus and SARS. New England Journal of Medicine 349:7, 709-709
Full Text644
Jean-Francois Viret, Reinhard Glück, Christian Moser. (2003) Development of a SARS vaccine: an industrial perspective on the global race against a global disease. Expert Review of Vaccines 2:4, 465-467
CrossRef645
Henry L.Y. Chan, Stephen K.W. Tsui, Joseph J.Y. Sung. (2003) Coronavirus in severe acute respiratory syndrome (SARS). Trends in Molecular Medicine 9:8, 323-325
CrossRef646
Wei Jia, Wenyuan Gao. (2003) Is traditional Chinese medicine useful in the treatment of SARS?. Phytotherapy Research 17:7, 840-841
CrossRef647
Teri J Franks, Pek Y Chong, Paul Chui, Jeffrey R Galvin, Raina M Lourens, Ann H Reid, Elena Selbs, Col Peter L Mcevoy, Col Dennis L Hayden, Junya Fukuoka, Jeffery K Taubenberger, William D Travis. (2003) Lung pathology of severe acute respiratory syndrome (SARS): a study of 8 autopsy cases from Singapore. Human Pathology 34:8, 743-748
CrossRef648
Christian Drosten, Wolfgang Preiser, Stephan Günther, Herbert Schmitz, Hans Wilhelm Doerr. (2003) Severe acute respiratory syndrome: identification of the etiological agent. Trends in Molecular Medicine 9:8, 325-327
CrossRef649
Li, Gang, Chen, XuejuanXu, Anlong, . (2003) Profile of Specific Antibodies to the SARS-Associated Coronavirus. New England Journal of Medicine 349:5, 508-509
Full Text650
Philip A. Marsden, Qin Ning, Laisum S. Fung, Xioping Luo, Yue Chen, Michael Mendicino, Anand Ghanekar, Jeremy A. Scott, Teresa Miller, Camie W.Y. Chan, Mathew W.C. Chan, Wei He, Reginald M. Gorczynski, David R. Grant, David A. Clark, M. James Phillips, Gary A. Levy. (2003) The Fgl2/fibroleukin prothrombinase contributes to immunologically mediated thrombosis in experimental and human viral hepatitis. Journal of Clinical Investigation 112:1, 58-66
CrossRef651
Christian Drosten. (2003) SARS: Weltreise eines neuen Virus. Biologie in unserer Zeit 33:4, 212-213
CrossRef652
Qing Duan, Hong Zhu, Yi Yang, Weihua Li, Yusen Zhou, Jun He, Kun He, Haojie Zhang, Tao Zhou, Lihua Song, Yonghua Gan, Hua Tan, Baofeng Jin, Huiyan Li, Tingting Zuo, Dehui Chen, Xuemin Zhang. (2003) Reovirus, isolated from SARS patients. Chinese Science Bulletin 48:13, 1293-1296
CrossRef653
Yanqing Ding, Huijun Wang, Hong Shen, Zhuguo Li, Jian Geng, Huixia Han, Junjie Cai, Xin Li, Wei Kang, Desheng Weng, Yaodan Lu, Dehua Wu, Li He, Kaitai Yao. (2003) The clinical pathology of severe acute respiratory syndrome (SARS): a report from China. The Journal of Pathology 200:3, 282-289
CrossRef654
Thijs Kuiken, Ron AM Fouchier, Martin Schutten, Guus F Rimmelzwaan, Geert van Amerongen, Debby van Riel, Jon D Laman, Ton de Jong, Gerard van Doornum, Wilina Lim, Ai Ee Ling, Paul KS Chan, John S Tam, Maria C Zambon, Robin Gopal, Christian Drosten, Sylvie van der Werf, Nicolas Escriou, Jean-Claude Manuguerra, Klaus Stöhr, J S Malik Peiris, Albert DME Osterhaus. (2003) Newly discovered coronavirus as the primary cause of severe acute respiratory syndrome. The Lancet 362:9380, 263-270
CrossRef655
Ling-Ling Chen, Hong-Yu Ou, Ren Zhang, Chun-Ting Zhang. (2003) ZCURVE_CoV: a new system to recognize protein coding genes in coronavirus genomes, and its applications in analyzing SARS-CoV genomes. Biochemical and Biophysical Research Communications 307:2, 382-388
CrossRef656
W NGANKEE. (2003) Severe acute respiratory syndrome (SARS). International Journal of Obstetric Anesthesia 12:3, 151-152
CrossRef657
P. Sampathkumar, Z. Temesgen, T. F. Smith, R. L. Thompson. (2003) SARS: Epidemiology, Clinical Presentation, Management, and Infection Control Measures. Mayo Clinic Proceedings 78:7, 882-890
CrossRef658
D. G. Maki. (2003) SARS: 1918 Revisited? The Urgent Need for Global Collaboration in Public Health. Mayo Clinic Proceedings 78:7, 813-816
CrossRef659
Rong Shi, Wenli Ma, Qinghua Wu, Bao Zhang, Yanbin Song, Qiuye Guo, Weiwei Xiao, Yan Wang, Wenling Zheng. (2003) Design and application of 60mer oligonucleotide microarray in SARS coronavirus detection. Chinese Science Bulletin 48:12, 1165-1169
CrossRef660
Fiona J. Cooke, Daniel S. Shapiro. (2003) Global outbreak of severe acute respiratory syndrome (SARS). International Journal of Infectious Diseases 7:2, 80-85
CrossRef661
Lei Gao, Ji Qi, Haibin Wei, Yigang Sun, Bailin Hao. (2003) Molecular phylogeny of coronaviruses including human SARS-CoV. Chinese Science Bulletin 48:12, 1170-1174
CrossRef662
Zhen Qi, Yu Hu, Wei Li, Yanjun Chen, Zhihua Zhang, Shiwei Sun, Hongchao Lu, Jingfen Zhang, Dongbo Bu, Lunjiang Ling, Runsheng Chen. (2003) Phylogeny of SARS-CoV as inferred from complete genome comparison. Chinese Science Bulletin 48:12, 1175-1178
CrossRef663
Drazen, Jeffrey M., Campion, Edward W., . (2003) SARS, the Internet, and the Journal. New England Journal of Medicine 348:20, 2029-2029
Full Text664
Holmes, Kathryn V., . (2003) SARS-Associated Coronavirus. New England Journal of Medicine 348:20, 1948-1951
Full Text665
Wenzel, Richard P., Edmond, Michael B., . (2003) Managing SARS amidst Uncertainty. New England Journal of Medicine 348:20, 1947-1948
Full Text666
G. Bhaskar, Rakesh Lodha, S. K. Kabra. (2003) Severe acute respiratory syndrome (SARS). The Indian Journal of Pediatrics 70:5, 401-405
CrossRef667
Earl G Brown, Jason A Tetro. (2003) Comparative analysis of the SARS coronavirus genome: a good start to a long journey. The Lancet 361:9371, 1756-1757
CrossRef668
Dimitrios P Kontoyiannis, Renata Pasqualini, Wadih Arap. (2003) Aminopeptidase N inhibitors and SARS. The Lancet 361:9368, 1558
CrossRef669
Yijun Ruan, Chia Lin Wei, Ai Ee Ling, Vinsensius B Vega, Herve Thoreau, Su Yun Se Thoe, Jer-Ming Chia, Patrick Ng, Kuo Ping Chiu, Landri Lim, Tao Zhang, Kwai Peng Chan, Lynette Oon Lin Ean, Mah Lee Ng, Sin Yee Leo, Lisa FP Ng, Ee Chee Ren, Lawrence W Stanton, Philip M Long, Edison T Liu. (2003) Comparative full-length genome sequence analysis of 14 SARS coronavirus isolates and common mutations associated with putative origins of infection. The Lancet 361:9371, 1779-1785
CrossRef670
David Wang, Anatoly Urisman, Yu-Tsueng Liu, Michael Springer, Thomas G. Ksiazek, Dean D. Erdman, Elaine R. Mardis, Matthew Hickenbotham, Vincent Magrini, James Eldred, J. Phillipe Latreille, Richard K. Wilson, Don Ganem, Joseph L. DeRisi. (2003) Viral Discovery and Sequence Recovery Using DNA Microarrays. PLoS Biology 1:2, e2
CrossRef671
John Ziebuhr. (2003) SARS – Unprecedented global response to a newly emerging disease. International Journal of Medical Microbiology 293:4, 229-231
CrossRef
- Letters
