Original Article
Identification of Severe Acute Respiratory Syndrome in Canada
N Engl J Med 2003; 348:1995-2005May 15, 2003
- Abstract
Background
Severe acute respiratory syndrome (SARS) is a condition of unknown cause that has recently been recognized in patients in Asia, North America, and Europe. This report summarizes the initial epidemiologic findings, clinical description, and diagnostic findings that followed the identification of SARS in Canada.
Methods
SARS was first identified in Canada in early March 2003. We collected epidemiologic, clinical, and diagnostic data from each of the first 10 cases prospectively as they were identified. Specimens from all cases were sent to local, provincial, national, and international laboratories for studies to identify an etiologic agent.
Results
The patients ranged from 24 to 78 years old; 60 percent were men. Transmission occurred only after close contact. The most common presenting symptoms were fever (in 100 percent of cases) and malaise (in 70 percent), followed by nonproductive cough (in 100 percent) and dyspnea (in 80 percent) associated with infiltrates on chest radiography (in 100 percent). Lymphopenia (in 89 percent of those for whom data were available), elevated lactate dehydrogenase levels (in 80 percent), elevated aspartate aminotransferase levels (in 78 percent), and elevated creatinine kinase levels (in 56 percent) were common. Empirical therapy most commonly included antibiotics, oseltamivir, and intravenous ribavirin. Mechanical ventilation was required in five patients. Three patients died, and five have had clinical improvement. The results of laboratory investigations were negative or not clinically significant except for the amplification of human metapneumovirus from respiratory specimens from five of nine patients and the isolation and amplification of a novel coronavirus from five of nine patients. In four cases both pathogens were isolated.
Conclusions
SARS is a condition associated with substantial morbidity and mortality. It appears to be of viral origin, with patterns suggesting droplet or contact transmission. The role of human metapneumovirus, a novel coronavirus, or both requires further investigation.
Media in This Article
Figure 1
Pedigree of the Epidemiologically Linked Toronto Patients with SARS.Figure 2
Timeline of Events in the Epidemiologically Linked Canadian Cases of SARS.Article Activity
- Article
Severe acute respiratory syndrome (SARS) is a condition of unknown cause that has recently been recognized in patients in Asia, North America, and Europe. As defined by the World Health Organization (WHO), a suspected case is disease in a person with a documented fever (temperature, >38°C), lower respiratory tract symptoms, and contact with a person believed to have had SARS or a history of travel to a geographic area where there has been documented transmission of the illness. A suspected case that involves chest radiographic findings of pneumonia, acute respiratory distress syndrome (ARDS), or an unexplained respiratory illness resulting in death with autopsy results demonstrating the pathology of ARDS without an identifiable cause is considered a probable case.1
This report summarizes the initial epidemiologic findings, clinical description, and diagnostic findings that followed the identification of SARS in Canada.
Methods and Results
Description of the Outbreak
Toronto
The first cases in Toronto were linked to members of a multigenerational family of Hong Kong descent who live in Toronto (Figure 1Figure 1
Pedigree of the Epidemiologically Linked Toronto Patients with SARS. and Figure 2Figure 2Timeline of Events in the Epidemiologically Linked Canadian Cases of SARS.). The Toronto index case (Patient 1) and her husband traveled to Hong Kong to visit relatives from February 13 through February 23, 2003. While in Hong Kong visiting their son, Patient 1 and her husband stayed at Hotel A from February 18 through February 21. Another hotel guest, who eventually was identified as the source patient for SARS in Hong Kong, also stayed on the same floor at Hotel A.2 Patient 1 and her husband stayed in the hotel only at night, spending the days visiting their son. They returned to their apartment in Toronto, which they shared with two sons, a daughter-in-law, and a five-month-old grandson (Household A), on February 23, 2003.Patient 1, a 78-year-old woman with a history of type 2 diabetes and coronary heart disease, had fever, anorexia, myalgias, a sore throat, and mild nonproductive cough two days after returning home. Three days later, her family physician noted pharyngeal erythema but no other abnormalities on physical examination. An oral antibiotic was prescribed, and she was sent home. Two days later, she noted the development of increasing cough with dyspnea. She died three days later, on March 5, at home, nine days after the onset of her illness. An autopsy was not performed.
The index patient's 43-year-old son (Patient 2), who had an underlying history of type 2 diabetes and hypertension, had fever and diaphoresis on February 27, two days after his mother first noted symptoms. Within approximately five days he became afebrile, but concurrently, a nonproductive cough, chest pain, and dyspnea developed. A chest radiograph revealed moderate air-space disease in the right middle and lower lobes, for which he received antibiotics. Because of persistent symptoms, he was assessed at a hospital and noted to have a fever (temperature, 39.8°C) and an oxygen saturation of 82 percent while breathing room air. A chest radiograph revealed bibasilar air-space disease. He was admitted to the hospital with a diagnosis of community-acquired pneumonia and was supported with noninvasive ventilation and treated with broad-spectrum antibiotics. Antituberculous medication and airborne precautions were added when tuberculosis was considered after the first day of his admission. Contact precautions were also added, given uncertainty about the underlying infectious agent. By day 2 of his admission, his respiratory status had deteriorated, and he was intubated and received mechanical ventilation. Despite intensive physiological support, multiorgan dysfunction syndrome developed, and he died on March 13, 2003, 6 days after admission, and 15 days after becoming ill. All routine investigations for etiologic agents were negative. At autopsy, the lung tissue revealed diffuse alveolar damage consistent with pathologic manifestations of ARDS. Intraalveolar and interstitial mononuclear cells suggesting a possible viral cause were also noted, but no viral cytopathic effect was seen. Examination of the liver revealed microvesicular fatty change, focal hemorrhages, and hepatocyte necrosis with scattered acidophilic bodies, but no viral inclusions were seen. The spleen showed large areas of probable ischemic necrosis and some atypical lymphocytes in periarteriolar sheaths. Further information on the evaluation for specific pathogens is given below.
On March 8 and 9, because of concern about possible tuberculosis in the family, the remaining five adult family members and their three children (5 months old, 9 years old, and 17 years old), who had all been exposed to the index patient, underwent screening chest radiography. All had fever, cough, dyspnea, or all three, as well as abnormal chest radiographs, except for the three children and the husband of Patient 3, who were and continue to be asymptomatic with normal chest radiographs. SARS was considered to be a possible explanation for these abnormalities and for the deaths of Patient 1 and Patient 2, who in retrospect met the criteria for probable SARS. (Patient 1 met almost all of the criteria, although an autopsy and microbiologic investigations were not completed to rule out identifiable causes.) In the light of this possible explanation, each of the symptomatic adults was reassessed on March 13. One met the criteria for suspected SARS (Patient 4), and three met the criteria for probable SARS (Patient 3, Patient 5, and Patient 6). All four were admitted to the hospital, three of them to intensive care units; one patient required mechanical ventilation. All four were treated with broad-spectrum antibiotics, oseltamivir, and intravenous ribavirin and have recovered fully, with the exception of two who continue to have mild dyspnea on exertion approximately three weeks after the onset of their illness.
As a result of media attention, three additional cases of SARS were identified. The first case was in a previously healthy 37-year-old female family physician of Asian descent (Patient 7) who saw Patient 2 and his wife (Patient 4) on March 6, when they were both symptomatic. Patient 7 had a severe headache on March 9, followed by fevers (temperatures of up to 40°C), myalgias, and malaise. Four days later, a nonproductive cough developed, and she was noted to have fever (temperature, 38.5°C) and tachypnea with an oxygen saturation of 100 percent on room air. Chest radiography revealed a subtle left basilar infiltrate. She was admitted to a medical ward with a diagnosis of suspected SARS and has subsequently recovered, coincident with receiving broad-spectrum antibiotics, oseltamivir, and intravenous ribavirin.
The second additional identified case was in a 76-year-old man of non-Asian descent (Patient 8) who had a history of type 2 diabetes, coronary heart disease, and hypertension and who was evaluated at the hospital to which Patient 2 was admitted. Patient 8 was assessed in the emergency department on March 7 for atrial fibrillation and observed overnight on a gurney separated by a cotton curtain 1 to 2 m from Patient 2, who was being held overnight without respiratory or contact precautions awaiting an inpatient hospital bed. Patient 8 was discharged home on March 8, and two days later he had fever (temperatures of up to 40°C), diaphoresis, and fatigue. A chest radiograph revealed right-upper-lobe and bibasilar interstitial infiltrates; despite antibiotic treatment, a nonproductive cough and worsening dyspnea subsequently developed, along with hypothermia (temperature, 36.6°C) and an oxygen saturation of 70 percent on room air. He was admitted to an intensive care unit with a diagnosis of probable SARS and required intubation and ventilation. Despite receiving broad-spectrum antibiotics, oseltamivir, intravenous ribavirin, and intensive support, he died on March 21, 5 days after admission and 12 days after the onset of his illness. An autopsy was performed, the results of which were pending at this writing.
The third additional case (in Patient 9) was unrelated to this family cluster. He is a 62-year-old man of non-Asian descent with a history of atrial fibrillation who had chest pain, sore throat, and lightheadedness, followed by cough, dyspnea, and fever, while traveling in Southeast Asia in early March. On his return to Toronto on March 14, he was admitted to the hospital with a diagnosis of probable SARS and was treated with broad-spectrum antibiotics, oseltamivir, and intravenous ribavirin. Two days after admission, his respiratory status worsened and he required intubation and ventilation. His condition has since stabilized and is slowly improving, but he continues to require ventilatory support 16 days after the onset of his illness.
Vancouver
The only case in Vancouver was in Patient 10, a 55-year-old, previously healthy man who traveled with his wife to Hong Kong and Bali from February 20 through March 6, 2003. While visiting Hong Kong from February 20 to February 24, Patient 10 and his wife also stayed in Hotel A, but on a different floor from Patient 1, Patient 6, and the hotel guest who was eventually identified as the source patient for SARS in Hong Kong. When in the hotel, Patient 10 and his wife did not eat at a common dining facility, nor did they entertain or visit other guests in the hotel. While traveling, two days after leaving Hong Kong, Patient 10 had malaise followed two days later by fever (temperature, 39.4°C), chills, and headache. Progressive dyspnea and a nonproductive cough developed a day later. After returning to Vancouver on March 7, he was assessed and found to have a temperature of 38.5°C, an oxygen saturation of 45 percent on room air, and mixed air-space and reticular opacification diffusely on chest radiography. He was admitted to the intensive care unit, and within 24 hours he required intubation and ventilation to maintain adequate oxygenation. He was soon recognized as having probable SARS and has been treated with broad-spectrum antibiotics. He remains in intensive care on ventilatory support 30 days after the onset of his illness.
Summary of Clinical Features and Initial Investigations
A summary of the clinical features and initial investigations of the first 10 cases of SARS identified in Canada (8 probable and 2 suspected) is given in Table 1Table 1
Clinical Features of the Canadian Patients with SARS at Presentation.. All of the patients were adults, ranging from 24 to 78 years of age. Six of the 10 were men. Eight of the 10 were of Asian descent. Three had a diagnosis of type 2 diabetes mellitus (Patient 1, Patient 2, and Patient 8); two had underlying pulmonary disease (asthma in Patient 3 and chronic cough of unclear cause in Patient 6); and four had a history of smoking (Patient 2, Patient 6, Patient 8, and Patient 9) although none still smoked. Given the patients who had a defined exposure time (Patient 3, Patient 7, and Patient 8), the incubation period can be estimated to range from 3 to 10 days. However, we are unable to exclude the possibility of a one-day incubation period in Patient 3.The presenting symptoms included fever in all cases and nonspecific symptoms such as malaise (7 of 10 cases) and myalgias (2 of 10 cases). Three of the 10 patients had chest pain, 3 had sore throat, and 3 had headache as part of their initial presentation. Although a nonproductive cough (in all 10 cases) and dyspnea (8 of 10 cases) were common, these respiratory symptoms were not the presenting symptoms in 5 cases. In three patients the fevers had improved by the time respiratory symptoms occurred. Five of the 10 patients had diarrhea, and 1 had vomiting, although 4 of these patients were also taking medications frequently associated with gastrointestinal side effects. No patient had a rash.
On presentation to the hospital, five of nine patients were febrile (temperature, 38.4 to 40°C), one had a low-grade fever (temperature, 37.9°C), and three had hypothermia (temperature, 35.5 to 36.5°C). Tachycardia (in five of nine cases), tachypnea (in seven of nine), and borderline low blood pressure (in five of nine) were common. Oxygen saturation while breathing room air was less than 95 percent in seven of nine patients. Physical examination was normal in all patients outside the respiratory system. Crackles were noted at the bases symmetrically (in three of nine patients) or asymmetrically (in two of nine). Bronchial breath sounds or egophony were noted in three patients. Chest radiographs revealed abnormalities in all of the nine patients who underwent radiography. In all but three patients, changes were bilateral and predominantly in the basal lung zones. Abnormalities were subtle at first in five of the nine patients, primarily involving a reticular interstitial pattern. For two of these patients, subsequent chest radiographs were read as normal. All other patients had progressive symmetric involvement of predominantly air-space disease on subsequent radiographs. Pleural effusions were not seen. A representative series of chest radiographs is shown in Figure 3Figure 3
The Course of Disease in Patient 8..The most common laboratory abnormalities noted included lymphopenia, elevated lactate dehydrogenase levels, elevated aspartate aminotransferase levels, and elevated creatine kinase levels. Other less common abnormalities included mild thrombocytopenia and mild leukopenia.
Case Management
All seven patients who presented to the hospital in Toronto and were recognized as having suspected or probable SARS were treated empirically with recommended doses of oral oseltamivir and broad-spectrum antibiotics, as well as intravenous ribavirin in the dosing schedule recommended for the treatment of viral hemorrhagic fever (a loading dose of 2 g, followed by 1 g every six hours for four days, then 500 mg every eight hours for another four to six days).3 The three other patients were treated with empirical broad-spectrum antibiotics alone. All cases were managed with use of respiratory and contact precautions as soon as the diagnosis of suspected or probable SARS had been considered.
Clinical Course
Five of the patients with SARS required mechanical ventilation for worsening respiratory failure at one point in their illness, and two of these patients have died (Patient 2 and Patient 8). Patient 2 initially received noninvasive ventilation and was then intubated and received mechanical ventilation until his death four days later. Tidal volumes were 500 to 700 ml, and minute ventilation largely ranged between 10 and 15 liters per minute. Peak inspiratory pressures ranged from 17 to 42 cm of water but were generally less than 35 cm of water, with positive end-expiratory pressure levels of 5 to 15 cm of water. The ratio of the partial pressure of oxygen (PaO2) to the fraction of inspired oxygen (FiO2) in the first 96 hours was generally more than 150, but it decreased thereafter to between 100 and 150; the PaO2 never dropped below 71 mm Hg. Patient 8 was intubated and received ventilation with tidal volumes of 500 to 750 ml. The FiO2 ranged from 0.9 to 1.0, with PaO2:FiO2 ratios of 56 to 85 despite positive end-expiratory pressure levels of 14 cm of water. Peak inspiratory pressures generally ranged from 24 to 38 cm of water, and the partial pressure of carbon dioxide increased from about 25 to about 50 mm Hg over a period of four days despite increases in minute ventilation from about 15 to 20 liters per minute. Although both patients had markedly abnormal PaO2:FiO2 ratios, they were never extremely hypoxemic and probably did not die of severe hypoxemia.
Patient 1 also died at home, increasing the total number of deaths to 3 among the 10 patients. All of the deaths occurred in patients who had an underlying immunocompromised state (type 2 diabetes).
Of the three patients who were treated with broad-spectrum antibiotics alone, two died and one remains in intensive care requiring mechanical ventilation. Of the seven patients who were treated with intravenous ribavirin and oral oseltamivir in addition to broad-spectrum antibacterial therapy, one died and one remains in intensive care requiring mechanical ventilation but with signs of clinical improvement. The other five, including one who had required mechanical ventilation, showed improvement within the first five days of treatment. They have all since recovered fully, with the exception of two who remain mildly dypsneic on exertion approximately three weeks after the onset of their illness.
Laboratory Investigations
Histopathological and microbiologic investigations of specimens received were conducted at local, national, and international laboratories. Histopathological testing was completed on autopsy tissue from Patient 2. Routine and specialized microbiologic investigations were completed on all specimens received in 9 of the 10 cases. (No specimens were sent from Patient 1, who died before being recognized as having SARS and in whom an autopsy was not performed.)
Histopathological Investigations
Autopsy tissue from Patient 2 was subjected to immunohistochemical tests for influenzaviruses A and B, respiratory syncytial virus, adenovirus, Hendra and Nipah viruses, hantavirus, measles virus, enterovirus, flaviviruses, Old World arenavirus, typhus and spotted fever rickettsia, coxiella species, Yersinia pestis, Mycoplasma pneumoniae, and Chlamydophila (Chlamydia) pneumoniae. All were negative.
Microbiologic Investigations
Bacterial and Fungal Examination
Routine bacterial and fungal examination was completed on all blood, respiratory, and urine specimens from 9 of the 10 patients, yielding negative results. Specifically, cultures as well as direct examination (where appropriate) were completed on all blood, respiratory, and urine specimens received, yielding negative results. In addition, cultures for legionella species, direct fluorescent antibody testing against legionella species on all respiratory specimens received, and testing for the presence of Legionella pneumophila serogroup 1 antigen in urine specimens received have been negative.
To date, bacterial molecular testing has been completed on all respiratory specimens received from 6 of the 10 patients, yielding negative results. Specifically, DNA was extracted, and polymerase-chain-reaction (PCR) detection for targets specific for L. pneumophila, M. pneumoniae, C. pneumoniae, C. psittaci, Chlamydophila at the genus level, Y. pestis, Bacillus anthracis, and 16S rRNA was negative.
Virologic Examination
Routine direct virologic examination of all respiratory and stool specimens received from 9 of the 10 patients was completed, yielding negative results. This included negative electron-microscopical examination and negative direct fluorescent antibody testing against influenzaviruses A and B, parainfluenzaviruses 1, 2, and 3, adenovirus, and respiratory syncytial virus in all specimens, with the exception of one subsequently unconfirmed positive direct fluorescent antibody result for influenzavirus B in a specimen from Patient 10.
Viral molecular testing has been completed on all respiratory and blood specimens received from 9 of the 10 patients. Specifically, DNA was extracted and PCR was completed for targets specific to various DNA viruses, yielding negative results for adenoviruses, parvoviruses, circoviruses, herpesviruses, and orthopoxviruses. In addition, RNA was extracted and reverse-transcription–PCR (RT-PCR) was completed for targets specific to various RNA viruses, including influenzaviruses A and B, respiratory syncytial virus, parainfluenzavirus subtypes 1, 2, 3, and 4, human metapneumovirus, filoviruses (Ebola and Marburg viruses), arenaviruses, measles virus, mumps virus, Hanta viruses, and Crimean–Congo hemorrhagic fever virus, yielding negative results.
Further virologic studies were completed on all respiratory specimens received from 9 of the 10 patients. These included viral cultures (including inoculation onto cell culture and into embryonated hen eggs and intracerebral inoculation of suckling mice), immune electron microscopy of nasopharyngeal swabs and bronchoalveolar fluids with serum obtained during the convalescent phase from Patient 10, RT-PCR for conserved portions of the polymerase gene of RNA viruses, and nested RT-PCR with genus-specific degenerative primers for paramyxoviruses and bunyaviruses. Results for all of these tests have been negative, with two exceptions. Human metapneumovirus was amplified by nested RT-PCR from bronchoalveolar-lavage fluid and nasopharyngeal swabs from five of nine patients with SARS and from a nasopharyngeal swab from an asymptomatic contact of one of the patients in Toronto (Patient 3) with use of the following primer pair: 5'CTTTGGACTTAATGACAGATG3' and 5'GTCTTCCTGTGCTAACTTTG3'.4 For confirmation of these positive findings, the amplicons were sequenced and found to be unique, ruling out the possibility of cross-contamination in the laboratory.
In addition, a novel coronavirus was isolated from Vero cell cultures inoculated with respiratory specimens from five of nine patients with SARS. Four of these patients had specimens from which metapneumovirus was also identified. A cytopathic effect on the Vero cell cultures was noted on day 6 of incubation. On the basis of collaboration with investigators in Hong Kong and at the Centers for Disease Control and Prevention (CDC) in Atlanta, who reported isolating a novel coronavirus from patients with SARS in other areas of the world, RT-PCR was completed targeting conserved regions of the coronavirus polymerase gene using the following primer pair: 5'CAGAGCCATGCCTAACATG3' and 5'AATGTTTACGCAGGTAAGCG3'. A novel coronavirus identical to that reported by the CDC2 was amplified from all five cultures. In addition, nested RT-PCR using the same primers plus 5'TGTTAAACCAGGTGGAAC3' and 5'CCTGTGTTGTAGATTGCG3' amplified the coronavirus directly from bronchoalveolar-lavage fluid from three of nine patients tested, all of whom also had coronavirus isolated from cell culture as described above.
At a different laboratory, a coronavirus was also identified independently by amplification directly from bronchoalveolar-lavage fluid from three of six patients tested. All three of these patients had coronavirus isolated from cell culture and amplification as described above. Reverse transcription was completed using the primer 5'GCATAGGCAGTAGTTGCATC3', followed by PCR targeting a highly conserved region of the coronavirus polymerase gene with use of the primer pair 5'TGATGGGATGGGACTATCCTAAGTGTGA3' and 5'TTGCATCACCACTAGTTGTGCCACCAGGTT3'. One of the amplicons was sequenced (GenBank accession number AY271716), and although the nucleotide sequence was different from that of any known coronaviruses, the deduced amino acid sequence had a high degree of homology (78 percent) to the polymerase amino acid sequence of several coronaviruses. Phylogenetic analysis suggests that this is a novel virus that is not closely related to any of the known clusters of coronaviruses (groups 1, 2, and 3).
Further studies are currently being completed to help determine whether the human metapneumovirus and a novel coronavirus, either alone or in combination, are the cause of SARS or whether other thus far undetected pathogens are possibly responsible. The possibility that coinfection of either virus with another agent may be responsible for SARS cannot be excluded.
Contact Tracing
As of March 31, 2003, in the Greater Toronto area, contact tracing has identified an additional 100 patients as having probable or suspected SARS. The ethnic background of these patients has varied widely. To date, one additional death has been reported. Transmission has been limited to close contacts of patients (i.e., household members, health care workers, or other patients who were not protected with contact or respiratory precautions). Case-finding measures have also identified additional persons with symptoms suggestive of SARS who have returned from travel to areas outside Canada where there has been documented transmission of SARS.
Discussion
The identification of SARS in Canada only a few weeks after an outbreak on another continent exemplifies the ease with which infectious agents can be transmitted in this era of international travel. It also demonstrates the importance and value of information and alert systems such as the Department of Communicable Disease Surveillance Response of the World Health Organization and the Disease Outbreak News Web site (http://www.who.int/csr/don) and the ProMED-mail (Program for Monitoring Emerging Diseases) reporting network sponsored by the International Society for Infectious Diseases (http://www.promedmail.org).5
Epidemiologic investigations and laboratory studies suggest that most patients with disease meeting the definition of SARS in both Toronto and Vancouver can be linked to a common source and to common potential causative agents. On the basis of preliminary investigations, it appears that this syndrome may be due in part to the newly described respiratory viral pathogen, human metapneumovirus,6 to a novel coronavirus, or both.
Evidence of the role of human metapneumovirus includes its amplification from respiratory specimens from five of nine Canadian patients with SARS and one asymptomatic contact and the identification of a metapneumovirus from respiratory specimens from other non-Canadian patients with SARS (Tam J, Department of Microbiology, Chinese University of Hong Kong: personal communication). In addition, the range of clinical findings, from asymptomatic disease to severe pneumonia and death, is similar to that described in human metapneumovirus infection.7 On the other hand, the severity with which the Canadian cases of SARS presented and the high attack rate of SARS among close contacts have not been described in patients with human metapneumovirus infection, suggesting that human metapneumovirus alone may not be responsible for SARS, that a genetic variant of the human metapneumovirus is potentially responsible, or that human metapneumovirus is not related to SARS but is an incidental finding. Indeed, we know little about the prevalence of asymptomatic carriage of human metapneumovirus, and such information would be helpful in interpreting the meaning of our amplification of this virus in patients meeting the criteria for SARS.8,9
The novel coronavirus identified in five of nine Canadian cases may also be a possible causative agent of SARS. Further evidence includes its identification by other investigators around the world from specimens from other patients with SARS and reports of positive immunofluorescence antibody tests in serum from patients from whom the coronavirus was isolated.2 In addition, known human coronaviruses are recognized to cause respiratory infection, albeit typically less severe than that described in the Canadian patients with SARS.10 Finally, coronaviruses are known to infect both animals and humans, and it is logical to consider that the emergence of a new disease may be related to the emergence of a novel coronavirus that originated with a limited range of animal hosts and evolved to involve an altered range that now includes humans.11 Although one can speculate about the possible roles of both coronaviruses and human metapneumovirus in SARS, it is currently not clear what role, if any, either of these viruses has in causing SARS. Further collaborative investigations are needed.
The illnesses described in the Canadian patients with SARS ranged from a febrile respiratory disease not associated with hypoxemia to severe pneumonia with significant respiratory dysfunction requiring intubation and mechanical ventilation and leading to death. Factors that may account for this variation in disease severity include genetic predisposition, age, underlying illness, smoking status, previous immunity, and coinfection with more than one pathogen. Within the Toronto family cluster of SARS cases, all patients who had severe enough disease to require supplemental oxygenation were genetically related; although this fact could represent a possible underlying genetic predisposition to severe disease, contact was most likely closest among these persons. Advanced age and the presence of underlying medical illnesses, which have been reported to be associated with more severe disease in patients infected with other respiratory viruses, including human metapneumovirus and coronaviruses, may also be risk factors for more severe disease in SARS.7,12 Indeed, all of the Canadian patients with SARS who either required intubation or died had underlying medical illnesses or were older than 55 years of age. Tobacco smoking, a known risk factor for other respiratory infections,13 may also be a risk factor for more severe SARS. Of the four Canadian patients who had a history of smoking, all required mechanical ventilation, as compared with only one of the six nonsmokers. Lack of previous immunity to the underlying etiologic agent or agents of SARS may also be a risk factor for more severe manifestations of disease, as may coinfection with more than one pathogen. Coinfection has been associated with increased severity of other respiratory viral illnesses. For example, Greensill et al.14 studied 10 infants with severe respiratory syncytial virus bronchiolitis who had no other risk factors for severe disease and found that 9 (90 percent) were coinfected with human metapneumovirus. Similarly, in SARS, human metapneumovirus or another pathogen may have the role of a copathogen, increasing the underlying severity of disease secondary to a novel coronavirus or another yet-to-be-identified pathogen.
The mechanism of transmission of the agent or agents causing SARS is not yet understood. However, the fact that transmission has been limited to only close contacts of patients, such as household members, health care workers, or other patients who were not protected with contact or respiratory precautions, suggests that either droplet secretions or direct or indirect contact probably has a role. However, the apparent ease of transmission in some cases is of concern. Although both the index patient in Toronto and the patient in Vancouver stayed in the same hotel in Hong Kong during the period when at least one other person with SARS was a guest, they had minimal exposure to other guests. Although airborne transmission is a possibility that cannot be completely ruled out in this example, there were probably many opportunities for indirect contact as well. Supporting droplet secretions or direct or indirect contact as the most likely mode of transmission is the fact that, to date, follow-up of all contacts of patients with SARS has not revealed secondary transmission that cannot be explained by these routes.
Treatment recommendations based on this small case series are obviously limited. However, given the possibility that human metapneumovirus or a coronavirus may be a possible causative agent and given the observed mortality rate, it may be prudent until there is further understanding of the underlying cause of SARS to consider empirical treatment with an antiviral agent, such as ribavirin. Ribavirin is a ribonucleoside analogue that induces lethal mutagenesis of RNA viral genomes and has broad-spectrum activity against RNA viruses15 including respiratory syncytial virus,16 a pneumovirus related to human metapneumovirus, and coronaviruses.11,17,18 Although the condition of five of seven (71 percent) of the Canadian patients with SARS who have been treated with ribavirin has improved with therapy, the patients were treated with an array of therapeutic agents, and it is unclear whether ribavirin affected the clinical outcome. Indeed, the efficacy of ribavirin against SARS has not been established, and it cannot currently be considered the standard of care. The patients who received mechanical ventilation fulfilled the diagnostic criteria for ARDS with diffuse infiltrates on chest radiography and hypoxemia without evidence of left ventricular failure.19 There is no definite therapy for ARDS; therapy is supportive,20 with the use of mechanical ventilation to improve oxygenation and to decrease the work of breathing. Noninvasive ventilation was used in one patient (Patient 2), but he required intubation within 24 hours owing to worsening respiratory failure. The best approach for ventilating patients with SARS is not known, but it seems reasonable to adopt a lung-protective strategy that has been shown to decrease mortality in patients with ARDS,21 perhaps by preventing the development of multiorgan dysfunction syndrome.22,23
Supported in part by grants from the Canadian Bacterial Diseases Network, the Canadian Institutes of Health Research, and the Hospital for Sick Children.
This article was published at www.nejm.org on March 31, 2003.
Source Information
From the Toronto Medical Laboratories and Mount Sinai Hospital Department of Microbiology, Toronto (S.M.P., D.E.L., K.G., A.J.M.); the Department of Laboratory Medicine and Pathobiology (S.M.P., D.E.L., R.T., A.E.S., A.J.M.), Department of Medicine Division of Infectious Diseases (D.E.L., A.K.C., I.S., A.E.S., A.J.M.), and Department of Medicine and Interdepartmental Division of Critical Care (A.S.S.), University of Toronto, Toronto; the City of Toronto Public Health Department (B.H.); Scarborough Hospital, Toronto (S.F., D.R.); the Hospital for Sick Children, Toronto (R.T., R.D., D.A., M.A.); Epidemiology Services (D.M.S.) and Laboratory Services (M.K., M.P.), British Columbia Centre for Disease Control, Vancouver; University Health Network, Toronto (I.S.); Sunnybrook and Women's College Health Sciences Centre, Toronto (A.E.S.); St. Michael's Hospital, Toronto (A.S.S.); the Department of Pathology and Laboratory Medicine, Vancouver Hospital and Health Sciences Centre and University of British Columbia, Vancouver (P.W.D.); and the University of British Columbia Centre for Disease Control, Vancouver (R.C.B.) — all in Canada.
Address reprint requests to Dr. McGeer at the Toronto Medical Laboratories and Mount Sinai Hospital, Department of Microbiology, 600 University Ave., Rm. 1460, Toronto, ON M5G 1X5, Canada.
Members of the National Microbiology Laboratory, Canada, and the Canadian Severe Acute Respiratory Syndrome Study Team groups are listed in the Appendix.
Appendix
Investigators from the National Microbiology Laboratory, Canada, working in collaboration with the Canadian Public Health Laboratory Network, include F. Plummer, Y. Li, N. Bastien, H. Artsob, K. Bernard, T. Booth, D. Bowness, M. Czub, D. Dick, L. Dillon, M. Drebot, R. Flick, M. Garbutt, A. Grolla, L. Fernando, S. Jones, A. Kabani, C. Li, G. McClarty, A. Meyers, Z. Mohammed, C. Munro, S. Normand, E. Ongsansoy, U. Stroeher, G. Tipples, S. Tyler, R. Vogrig, G. Wang, D. Ward, and B. Watson. Additional investigators from the Canadian Severe Acute Respiratory Syndrome Study Team include M. Fearon, Ontario Provincial Laboratory; R. Chow, B. Willey, and S. Pong-Porter, Toronto Medical Laboratories and Mount Sinai Hospital Department of Microbiology; J. Butany, Department of Laboratory Medicine and Pathobiology, University of Toronto and University Health Network, Toronto; S. Zaki, Centers for Disease Control and Prevention, Atlanta; M. Vearncombe, E. Phillips, and A. Rachlis, Sunnybrook and Women's College Health Sciences Centre, Toronto; L. Davies, Scarborough Hospital, Grace Division, Toronto; L. Dresser, Mount Sinai Hospital, Toronto; W.R. Bowie, J. Ronco, E.A. Bryce, F. Ryan, and K. Craig, University of British Columbia and Vancouver Hospital and Health Sciences Centre, Vancouver; M. Naus, British Columbia Centre for Disease Control, Vancouver; L. MacDougall and L.F. Srour, Field Epidemiology Training Program, Population and Public Health Branch, Health Canada; and T. Tam, J. Macey, and A. King, Division of Immunization and Respiratory Diseases, Health Canada.
- References
References
1
Severe acute respiratory syndrome (SARS). Wkly Epidemiol Rec 2003;78:81-83
Medline2
Update: outbreak of severe acute respiratory syndrome -- worldwide, 2003. MMWR Morb Mortal Wkly Rep 2003;52:241-248
Medline3
Borio L ,Inglesby T ,Peters CJ , et al. Hemorrhagic fever viruses as biological weapons: medical and public health management. JAMA 2002;287:2391-2405
CrossRef | Web of Science | Medline4
Peret TC ,Boivin G ,Li Y , et al. Characterization of human metapneumoviruses isolated from patients in North America. J Infect Dis 2002;185:1660-1663
CrossRef | Web of Science | Medline5
Heymann DL ,Rodier GR . Hot spots in a wired world: WHO surveillance of emerging and re-emerging infectious diseases. Lancet Infect Dis 2001;1:345-353
CrossRef | Medline6
van den Hoogen BG ,de Jong JC ,Groen J , et al. A newly discovered human pneumovirus isolated from young children with respiratory tract disease. Nat Med 2001;7:719-724
CrossRef | Web of Science | Medline7
Boivin G ,Abed Y ,Pelletier G , et al. Virological features and clinical manifestations associated with human metapneumovirus: a new paramyxovirus responsible for acute respiratory-tract infections in all age groups. J Infect Dis 2002;186:1330-1334
CrossRef | Web of Science | Medline8
Stockton J ,Stephenson I ,Fleming D ,Zambon M . Human metapneumovirus as a cause of community-acquired respiratory illness. Emerg Infect Dis 2002;8:897-901
Web of Science | Medline9
Nissen MD ,Siebert DJ ,Mackay IM ,Sloots TP ,Withers SJ . Evidence of human metapneumovirus in Australian children. Med J Aust 2002;176:188-188
Web of Science | Medline10
Vabret A ,Brouard J ,Petitjean J ,Eugene-Ruellan G ,Freymuth F . Infections à coronavirus humains: importance et diagnostic. Presse Med 1998;27:1813-1817
Web of Science | Medline11
Truyen U ,Parrish CR ,Harder TC ,Kaaden OR . There is nothing permanent except change: the emergence of new virus diseases. Vet Microbiol 1995;43:103-122
CrossRef | Web of Science | Medline12
Falsey AR ,McCann RM ,Hall WJ , et al. The “common cold“ in frail older persons: impact of rhinovirus and coronavirus in a senior daycare center. J Am Geriatr Soc 1997;45:706-711
Web of Science | Medline13
Farr BM ,Bartlett CL ,Wadsworth J ,Miller DL . Risk factors for community-acquired pneumonia diagnosed upon hospital admission. Respir Med 2000;94:954-963
CrossRef | Web of Science | Medline14
Greensill J ,McNamara PS ,Dove W ,Flanagan B ,Smyth RL ,Hart CA . Human metapneumovirus in severe respiratory syncytial virus bronchiolitis. Emerg Infect Dis 2003;9:372-375
Web of Science | Medline15
Crotty S ,Maag D ,Arnold JJ , et al. The broad-spectrum antiviral ribonucleoside ribavirin is an RNA virus mutagen. Nat Med 2000;6:1375-1379[Erratum, Nat Med 2001;7:255.]
CrossRef | Web of Science | Medline16
Smith DW ,Frankel LR ,Mathers LH ,Tang ATS ,Ariagno RL ,Prober CG . A controlled trial of aerosolized ribavirin in infants receiving mechanical ventilation for severe respiratory syncytial virus infection. N Engl J Med 1991;325:24-29
Full Text | Web of Science | Medline17
Weiss RC ,Oostrom-Ram T . Inhibitory effects of ribavirin alone or combined with human alfa interferon on feline infectious peritonitis virus replication in vitro. Vet Microbiol 1989;20:255-265
CrossRef | Web of Science | Medline18
Sidwell RW ,Huffman JH ,Call EW ,Warren RP ,Radov LA ,Murray RJ . Inhibition of murine hepatitis virus infections by the immunomodulator 2,3,5,6,7,8-hexahydro-2-phenyl-8,8-dimethoxy-imidazo[1,2a]pyridine (PR-879-317A). Antimicrob Agents Chemother 1987;31:1130-1134
Web of Science | Medline19
Bernard GR ,Artigas A ,Brigham KL , et al. The American-European Consensus Conference on ARDS: definitions, mechanisms, relevant outcomes, and clinical trial coordination. Am J Respir Crit Care Med 1994;149:818-824
Web of Science | Medline20
Ware LB ,Matthay MA . The acute respiratory distress syndrome. N Engl J Med 2000;342:1334-1349
Full Text | Web of Science | Medline21
The Acute Respiratory Distress Syndrome Network
Full Text | Web of Science | Medline22
Slutsky AS ,Tremblay LN . Multiple system organ failure: is mechanical ventilation a contributing factor? Am J Respir Crit Care Med 1998;157:1721-1725
Web of Science | Medline23
Imai Y ,Parodo J ,Kajikawa O , et al. Injurious mechanical ventilation and end-organ epithelial cell apoptosis and organ dysfunction in an experimental model. JAMA 2003;289:2104-2120
CrossRef | Web of Science | Medline
- Citing Articles (264)
Citing Articles
1
Ben X. Wang, Eleanor N. Fish. (2012) The yin and yang of viruses and interferons. Trends in Immunology
CrossRef2
Ulrich Spengler, Hans-Peter Fischer, Wolfgang H. Caselmann. 2012. Liver Disease Associated with Viral Infections. , 629-643.
CrossRef3
Neill K.J. Adhikari, Gordon D. Rubenfeld. (2011) Worldwide demand for critical care. Current Opinion in Critical Care 17:6, 620-625
CrossRef4
Rossella Boldrini, Luca Fasano, Stefano Nava. (2011) Noninvasive mechanical ventilation. Current Opinion in Critical Care1
CrossRef5
Kathryn A. Radigan, Richard G. Wunderink. (2011) Epidemic Viral Pneumonia and Other Emerging Pathogens. Clinics in Chest Medicine 32:3, 451-467
CrossRef6
B.S.U. Mendis, T.D. Gedeon. (2011) Complex Structured Decision Making Model: A hierarchical frame work for complex structured data. Information Sciences
CrossRef7
Prasenjit Mukherjee, Falgun Shah, Prashant Desai, Mitchell Avery. (2011) Inhibitors of SARS-3CL pro : Virtual Screening, Biological Evaluation, and Molecular Dynamics Simulation Studies. Journal of Chemical Information and Modeling 51:6, 1376-1392
CrossRef8
Antonio Craxì, Rosa Di Stefano. 2011. Hepatitis Due to Non-A-E Viruses. , 427-437.
CrossRef9
I Chen Hsing. (2011) Acute lung injury and acute respiratory distress syndrome: experimental and clinical investigations. Journal of Geriatric Cardiology 8:1, 44-54
CrossRef10
J. Scott Weese, Martha B. Fulford. 2011. Viral Diseases. , 241-274.
CrossRef11
Nicole H. Tobin, Angela J.P. Campbell, Danielle M. Zerr, Ann J. Melvin. 2011. Life-Threatening Viral Diseases and Their Treatment. , 1324-1335.
CrossRef12
Bryan Corrin, Andrew G. Nicholson. 2011. Infectious diseases. , 155-262.
CrossRef13
Hongli Xiao, Haiyu Qi, Xingwang Li, Jing Wang, Xiaoli Li, Suxia Ma, Zongli Diao, Yan Wang, Fangfang Sun, Chenghong Yin. (2010) The identification of risk factors for infectious patients with acute fever and formulation of activation criteria to alert outpatient clinic doctors. Journal of Evaluation in Clinical Practice 16:6, 1248-1253
CrossRef14
Ronald N. Kostoff. (2010) The highly cited SARS research literature. Critical Reviews in Microbiology 36:4, 299-317
CrossRef15
Neill KJ Adhikari, Robert A Fowler, Satish Bhagwanjee, Gordon D Rubenfeld. (2010) Critical care and the global burden of critical illness in adults. The Lancet 376:9749, 1339-1346
CrossRef16
Minna Risku, Suvi Lappalainen, Sirpa Räsänen, Timo Vesikari. (2010) Detection of human coronaviruses in children with acute gastroenteritis. Journal of Clinical Virology 48:1, 27-30
CrossRef17
Mark H. Wilcox, Robert C. Spencer. 2010. Healthcare-Associated Infections. .
CrossRef18
Silvana Badaloni, Marco Falda. (2010) Temporal-based medical diagnoses using a Fuzzy Temporal Reasoning System. Journal of Intelligent Manufacturing 21:1, 145-153
CrossRef19
M. Jalali-Heravi, M. Asadollahi-Baboli, A. Mani-Varnosfaderani. (2009) Shuffling multivariate adaptive regression splines and adaptive neuro-fuzzy inference system as tools for QSAR study of SARS inhibitors. Journal of Pharmaceutical and Biomedical Analysis 50:5, 853-860
CrossRef20
Hiroshi Ohara, Nguyen Viet Hung, Truong Anh Thu. (2009) Fact-finding survey of nosocomial infection control in hospitals in Vietnam and application to training programs. Journal of Infection and Chemotherapy 15:6, 384-389
CrossRef21
Dan Feng, Sake J. de Vlas, Li-Qun Fang, Xiao-Na Han, Wen-Juan Zhao, Shen Sheng, Hong Yang, Zhong-Wei Jia, Jan Hendrik Richardus, Wu-Chun Cao. (2009) The SARS epidemic in mainland China: bringing together all epidemiological data. Tropical Medicine & International Health 14, 4-13
CrossRef22
Ben S. Cooper, Li-Qun Fang, Jie-Ping Zhou, Dan Feng, Hui Lv, Mao-Ti Wei, Shi-Xin Wang, Wu-Chun Cao, Sake J. de Vlas. (2009) Transmission of SARS in three Chinese hospitals. Tropical Medicine & International Health 14, 71-78
CrossRef23
Kristin Lyle, Tonya Thompson, James Graham. (2009) Pediatric Mass Casualty: Triage and Planning for the Prehospital Provider. Clinical Pediatric Emergency Medicine 10:3, 173-185
CrossRef24
David R Murdoch, Stephen T Chambers. (2009) Atypical pneumonia—time to breathe new life into a useful term?. The Lancet Infectious Diseases 9:8, 512-519
CrossRef25
Stefano Nava, Nicholas Hill. (2009) Non-invasive ventilation in acute respiratory failure. The Lancet 374:9685, 250-259
CrossRef26
G. Y. Oudit, Z. Kassiri, C. Jiang, P. P. Liu, S. M. Poutanen, J. M. Penninger, J. Butany. (2009) SARS-coronavirus modulation of myocardial ACE2 expression and inflammation in patients with SARS. European Journal of Clinical Investigation 39:7, 618-625
CrossRef27
Justin Lessler, Nicholas G Reich, Ron Brookmeyer, Trish M Perl, Kenrad E Nelson, Derek AT Cummings. (2009) Incubation periods of acute respiratory viral infections: a systematic review. The Lancet Infectious Diseases 9:5, 291-300
CrossRef28
Vanessa Ditt, Oliver Schildgen. (2009) Severe acute respiratory syndrome-coronavirus and human coronavirus-NL63: an updated overview. Reviews in Medical Microbiology 20:2, 19-28
CrossRef29
Kelly R. Bright, Enue E. Sicairos-Ruelas, Patricia M. Gundy, Charles P. Gerba. (2009) Assessment of the Antiviral Properties of Zeolites Containing Metal Ions. Food and Environmental Virology 1:1, 37-41
CrossRef30
Zhongde Ye, Chung Kai Wong, Peng Li, Yong Xie. (2008) A SARS-CoV protein, ORF-6, induces caspase-3 mediated, ER stress and JNK-dependent apoptosis. Biochimica et Biophysica Acta (BBA) - General Subjects 1780:12, 1383-1387
CrossRef31
Staci A. Fischer. (2008) Emerging Viruses in Transplantation: There Is More to Infection After Transplant Than CMV and EBV. Transplantation 86:10, 1327-1339
CrossRef32
S. Broor, P. Bharaj, H. S. Chahar. (2008) Human metapneumovirus: a new respiratory pathogen. Journal of Biosciences 33:4, 483-493
CrossRef33
Kenneth W. TSANG, Thomas M. FILE Jr. (2008) Respiratory infections unique to Asia. Respirology 13:7, 937-949
CrossRef34
Shunxin Wang, Feng Guo, Kangtai Liu, Hongliang Wang, Shuan Rao, Peng Yang, Chengyu Jiang. (2008) Endocytosis of the receptor-binding domain of SARS-CoV spike protein together with virus receptor ACE2. Virus Research 136:1-2, 8-15
CrossRef35
Farideh Rafiefard, ZhiBing Yun, Claes Örvell. (2008) Epidemiologic characteristics and seasonal distribution of human metapneumovirus infections in five epidemic seasons in Stockholm, Sweden, 2002-2006. Journal of Medical Virology 80:9, 1631-1638
CrossRef36
Jianli Dong, Juan P. Olano, Jere W. McBride, David H. Walker. (2008) Emerging Pathogens: Challenges and Successes of Molecular Diagnostics. The Journal of Molecular Diagnostics 10:3, 185-197
CrossRef37
Yasushi Ami, Noriyo Nagata, Kazuya Shirato, Rie Watanabe, Naoko Iwata, Keiko Nakagaki, Shuetsu Fukushi, Masayuki Saijo, Shigeru Morikawa, Fumihiro Taguchi. (2008) Co-infection of respiratory bacterium with severe acute respiratory syndrome coronavirus induces an exacerbated pneumonia in mice. Microbiology and Immunology 52:2, 118-127
CrossRef38
Bingke Bai, Xinya Lu, Jin Meng, Qinxue Hu, Panyong Mao, Baojing Lu, Ze Chen, Zhiming Yuan, Hanzhong Wang. (2008) Vaccination of mice with recombinant baculovirus expressing spike or nucleocapsid protein of SARS-like coronavirus generates humoral and cellular immune responses. Molecular Immunology 45:4, 868-875
CrossRef39
Rima Styra, Laura Hawryluck, Susan Robinson, Sonja Kasapinovic, Calvin Fones, Wayne L. Gold. (2008) Impact on health care workers employed in high-risk areas during the Toronto SARS outbreak. Journal of Psychosomatic Research 64:2, 177-183
CrossRef40
Chung-Hua Hsu, Kung-Chang Hwang, Chung-Liang Chao, Steve G. N. Chang, Mei-Shang Ho, Jaung-Geng Lin, Hen-Hong Chang, Shung-Te Kao, Yi-Ming Chen, Pesus Chou. (2008) An Evaluation of the Additive Effect of Natural Herbal Medicine on SARS or SARS-Like Infectious Diseases in 2003: A Randomized, Double-Blind, and Controlled Pilot Study. Evidence-Based Complementary and Alternative Medicine 5:3, 355-362
CrossRef41
K.-Y. Hwa, W. M. Lin, Y.-I. Hou, T.-M. Yeh. (2008) Peptide Mimicrying Between SARS Coronavirus Spike Protein and Human Proteins Reacts with SARS Patient Serum. Journal of Biomedicine and Biotechnology 2008, 1-9
CrossRef42
Sean P. Elliott, C. George Ray. 2008. Viral Infections of the Lower Respiratory Tract. , 481-489.
CrossRef43
Betty Shuc Han Wills, Janice M. Morse. (2008) Responses of Chinese Elderly to the Threat of Severe Acute Respiratory Syndrome (SARS) in a Canadian Community. Public Health Nursing 25:1, 57-68
CrossRef44
N. Lee, P.K.S. Chan, I.T. Yu, K.K. Tsoi, G. Lui, J.J.Y. Sung, C.S. Cockram. (2007) Co-circulation of human metapneumovirus and SARS-associated coronavirus during a major nosocomial SARS outbreak in Hong Kong. Journal of Clinical Virology 40:4, 333-337
CrossRef45
A. Shigayeva, K. Green, J. M. Raboud, B. Henry, A. E. Simor, M. Vearncombe, D. Zoutman, M. Loeb, A. McGeer, . (2007) Factors Associated With Critical‐Care Healthcare Workers’ Adherence to Recommended Barrier Precautions During the Toronto Severe Acute Respiratory Syndrome Outbreak • . Infection Control and Hospital Epidemiology 28:11, 1275-1283
CrossRef46
S. Bansal, B. T Grenfell, L. A. Meyers. (2007) When individual behaviour matters: homogeneous and network models in epidemiology. Journal of The Royal Society Interface 4:16, 879-891
CrossRef47
William F. Carman, James B. Mahony. (2007) The pathogens. Journal of Clinical Virology 40, S5-S10
CrossRef48
G.-p. Zhao. (2007) SARS molecular epidemiology: a Chinese fairy tale of controlling an emerging zoonotic disease in the genomics era. Philosophical Transactions of the Royal Society B: Biological Sciences 362:1482, 1063-1081
CrossRef49
Hui-Min Wang, Po-Huang Liang. (2007) Pharmacophores and biological activities of severe acute respiratory syndrome viral protease inhibitors. Expert Opinion on Therapeutic Patents 17:5, 533-546
CrossRef50
Sergio Scrimini, Andrea Junemann, Carlos M Luna. (2007) Community acquired pneumonia in the tropics. Current Opinion in Pulmonary Medicine 13:3, 170-176
CrossRef51
T.-H. Wang, K.-C. Wei, C. A. Hsiung, S. A. Maloney, R. B. Eidex, D. L. Posey, W.-H. Chou, W.-Y. Shih, H.-S. Kuo. (2007) Optimizing Severe Acute Respiratory Syndrome Response Strategies: Lessons Learned From Quarantine. American Journal of Public Health 97:Supplement 1, S98-S100
CrossRef52
RANGARAJAN SAMPATH, THOMAS A. HALL, CHRISTIAN MASSIRE, FENG LI, LAWRENCE B. BLYN, MARK W. ESHOO, STEVEN A. HOFSTADLER, DAVID J. ECKER. (2007) Rapid Identification of Emerging Infectious Agents Using PCR and Electrospray Ionization Mass Spectrometry. Annals of the New York Academy of Sciences 1102:1, 109-120
CrossRef53
Jun Chen, Kanta Subbarao. (2007) The Immunobiology of SARS *. Annual Review of Immunology 25:1, 443-472
CrossRef54
Matthew P Muller, Linda Dresser, Janet Raboud, Allison McGeer, Elizabeth Rea, Susan E Richardson, Tony Mazzulli, Mark Loeb, Marie Louie. (2007) Adverse Events Associated with High-Dose Ribavirin: Evidence from the Toronto Outbreak of Severe Acute Respiratory Syndrome. Pharmacotherapy 27:4, 494-503
CrossRef55
Ryan E Longman, Timothy RB Johnson. (2007) Viral respiratory disease in pregnancy. Current Opinion in Obstetrics and Gynecology 19:2, 120-125
CrossRef56
Hua Yu, Li-Fang Jiang, Dan-Yun Fang, Hui-Jun Yan, Jing-Jiao Zhou, Jun-Mei Zhou, Yu Liang, Yang Gao, Wei Zhao, Bei-Guo Long. (2007) Selection of SARS-Coronavirus-specific B cell epitopes by phage peptide library screening and evaluation of the immunological effect of epitope-based peptides on mice. Virology 359:2, 264-274
CrossRef57
Feng Ge, Yonghu Luo, Pei Xiong Liew, Eugene Hung. (2007) Derivation of a novel SARS–coronavirus replicon cell line and its application for anti-SARS drug screening. Virology 360:1, 150-158
CrossRef58
William C.W. Wong, Samuel Y.S. Wong, Albert Lee, William B. Goggins. (2007) How to provide an effective primary health care in fighting against severe acute respiratory syndrome: The experiences of two cities. American Journal of Infection Control 35:1, 50-55
CrossRef59
Yung-Liang Wan, Pei-Kwei Tsay, Yun-Chung Cheung, Ping-Cherng Chiang, Chun-Hua Wang, Ying-Huang Tsai, Han-Ping Kuo, Kuo-Chien Tsao, Tzou-Yien Lin. (2007) A Correlation between the Severity of Lung Lesions on Radiographs and Clinical Findings in Patients with Severe Acute Respiratory Syndrome. Korean Journal of Radiology 8:6, 466
CrossRef60
Hiroshi Ohara, Nguyen Viet Hung, Truong Anh Thu, Tran Quy. (2007) Report on Japan-Vietnam collaboration in nosocomial infection control at Bach Mai Hospital, Hanoi from 2000 to 2006. Tropical Medicine and Health 35:3, 253-259
CrossRef61
Yasushi Shimada, Kayo Nemoto, Minoru Kubota, Norifumi Ninomiya, Yasuhiro Yamamoto. (2007) Neuraminidase Inhibitors Prevent Lipopolysaccharide-Induced Intestinal Paralysis in Conscious Guinea Pigs. Nihon Kyukyu Igakukai Zasshi 18:4, 127-134
CrossRef62
Daniel F. Garcia, Peter W. Hiatt, Alan Jewell, Shauna L. Schoonover, Stanley G. Cron, Mark Riggs, Susan Grace, Christopher M. Oermann, Pedro A. Piedra. (2007) Human metapneumovirus and respiratory syncytial virus infections in older children with cystic fibrosis. Pediatric Pulmonology 42:1, 66-74
CrossRef63
Jeffrey C. Kwong, Thérèse A. Stukel, Allison J. McGeer, Douglas G. Manuel. (2007) Appropriate measures of influenza immunization program effectiveness. Vaccine 25:6, 967-969
CrossRef64
Lili Chen, Jian Li, Cheng Luo, Hong Liu, Weijun Xu, Gang Chen, Oi Wah Liew, Weiliang Zhu, Chum Mok Puah, Xu Shen, Hualiang Jiang. (2006) Binding interaction of quercetin-3-β-galactoside and its synthetic derivatives with SARS-CoV 3CLpro: Structure–activity relationship studies reveal salient pharmacophore features. Bioorganic & Medicinal Chemistry 14:24, 8295-8306
CrossRef65
Z. Khattari, E. Arbely, I. T. Arkin, T. Salditt. (2006) Viral ion channel proteins in model membranes: a comparative study by X-ray reflectivity. European Biophysics Journal 36:1, 45-55
CrossRef66
A. Timen, G. J. J. van Doornum, M. Schutten, M. A. E. Conyn-van Spaendonck, J. W. M. van der Meer, A. D. M. E. Osterhaus, J. E. van Steenbergen. (2006) Public health implications of using various case definitions in The Netherlands during the worldwide SARS outbreak. Clinical Microbiology and Infection 12:12, 1214-1220
CrossRef67
Richard A. Martinello, Frank Esper, Carla Weibel, David Ferguson, Marie L. Landry, Jeffrey S. Kahn. (2006) Human metapneumovirus and exacerbations of chronic obstructive pulmonary disease. Journal of Infection 53:4, 248-254
CrossRef68
Grace O. M. Lee, Malcolm Warner. (2006) Human Resources, Labour Markets and Unemployment: The Impact of the SARS Epidemic on the Service Sector in Singapore. Asia Pacific Business Review 12:4, 507-527
CrossRef69
Keiji Kuba, Yumiko Imai, Shuan Rao, Chengyu Jiang, Josef M. Penninger. (2006) Lessons from SARS: control of acute lung failure by the SARS receptor ACE2. Journal of Molecular Medicine 84:10, 814-820
CrossRef70
Tara M. Vogt, Marta A. Guerra, Elaine W. Flagg, Thomas G. Ksiazek, Sara A. Lowther, Paul M. Arguin. (2006) Risk of Severe Acute Respiratory Syndrome?Associated Coronavirus Transmission Aboard Commercial Aircraft. Journal of Travel Medicine 13:5, 268-272
CrossRef71
Cai Qi, Jin-Zhu Duan, Zhan-Hui Wang, Yan-Yan Chen, Pan-He Zhang, Lin Zhan, Xi-Yun Yan, Wu-Chun Cao, Gang Jin. (2006) Investigation of interaction between two neutralizing monoclonal antibodies and SARS virus using biosensor based on imaging ellipsometry. Biomedical Microdevices 8:3, 247-253
CrossRef72
Richard Berry, Mary Marian, Jennifer Doley. 2006. Respiratory Health. .
CrossRef73
Jian Ping Liu, Jing Zhang, Hao Lu, Sally EM Bell-Syer, Jian Ping Liu. 2006. Chinese herbal medicines for treating diabetic foot ulcers. .
CrossRef74
Chao Liu, Junmin Chen, Chao Liu. 2006. Endothelin receptor antagonists for pulmonary arterial hypertension. .
CrossRef75
Evelyn Wong, Khoy Kheng Ho. (2006) The effect of severe acute respiratory syndrome (SARS) on emergency airway management. Resuscitation 70:1, 26-30
CrossRef76
Giuseppe Gerna, Giulia Campanini, Francesca Rovida, Elena Percivalle, Antonella Sarasini, Antonietta Marchi, Fausto Baldanti. (2006) Genetic variability of human coronavirus OC43-, 229E-, and NL63-like strains and their association with lower respiratory tract infections of hospitalized infants and immunocompromised patients. Journal of Medical Virology 78:7, 938-949
CrossRef77
Ian Brierley, Francisco J. Dos Ramos. (2006) Programmed ribosomal frameshifting in HIV-1 and the SARS–CoV. Virus Research 119:1, 29-42
CrossRef78
Denise J. Jamieson, Jane E. Ellis, Daniel B. Jernigan, Tracee A. Treadwell. (2006) Emerging infectious disease outbreaks: Old lessons and new challenges for obstetrician-gynecologists. American Journal of Obstetrics and Gynecology 194:6, 1546-1555
CrossRef79
Lauren Ancel Meyers, M.E.J. Newman, Babak Pourbohloul. (2006) Predicting epidemics on directed contact networks. Journal of Theoretical Biology 240:3, 400-418
CrossRef80
E. S. McBryde, G. Gibson, A. N. Pettitt, Y. Zhang, B. Zhao, D. L. S. McElwain. (2006) Bayesian modelling of an epidemic of severe acute respiratory syndrome. Bulletin of Mathematical Biology 68:4, 889-917
CrossRef81
Junling Ma, David J. D. Earn. (2006) Generality of the Final Size Formula for an Epidemic of a Newly Invading Infectious Disease. Bulletin of Mathematical Biology 68:3, 679-702
CrossRef82
Stanley Perlman, Ajai A. Dandekar. (2006) Glucocorticoid contribution to lymphopaenia and immunpathology in patients with SARS. Nature Reviews Immunology 6:4, 334-334
CrossRef83
M. P. Muller, S. E. Richardson, A. McGeer, L. Dresser, J. Raboud, T. Mazzulli, M. Loeb, M. Louie, . (2006) Early diagnosis of SARS: lessons from the Toronto SARS outbreak. European Journal of Clinical Microbiology & Infectious Diseases 25:4, 230-237
CrossRef84
Xie Xudong, Chen Junzhu, Wang Xingxiang, Zhang Furong, Liu Yanrong. (2006) Age- and gender-related difference of ACE2 expression in rat lung. Life Sciences 78:19, 2166-2171
CrossRef85
Jiahai Shi, Jianxing Song. (2006) The catalysis of the SARS 3C-like protease is under extensive regulation by its extra domain. FEBS Journal 273:5, 1035-1045
CrossRef86
E. C. H. Lim, R. C. S. Seet, K.-H. Lee, E. P. V. Wilder-Smith, B. Y. S. Chuah, B. K. C. Ong. (2006) Headaches and the N95 face-mask amongst healthcare providers. Acta Neurologica Scandinavica 113:3, 199-202
CrossRef87
Giuseppe Gerna, Patrizio Vitulo, Francesca Rovida, Daniele Lilleri, Carlo Pellegrini, Tiberio Oggionni, Giulia Campanini, Fausto Baldanti, M. Grazia Revello. (2006) Impact of human metapneumovirus and human cytomegalovirus versus other respiratory viruses on the lower respiratory tract infections of lung transplant recipients. Journal of Medical Virology 78:3, 408-416
CrossRef88
Musheng Bao, Yi Zhang, Min Wan, Li Dai, Xiaoping Hu, Xiuli Wu, Li Wang, Ping Deng, Junzhi Wang, Jianzhu Chen, Yongjun Liu, Yongli Yu, Liying Wang. (2006) Anti-SARS-CoV immunity induced by a novel CpG oligodeoxynucleotide. Clinical Immunology 118:2-3, 180-187
CrossRef89
Joanna Zorzitto, Carole L Galligan, Joanna JM Ueng, Eleanor N Fish. (2006) Characterization of the antiviral effects of interferon-α against a SARS-like coronoavirus infection in vitro. Cell Research 16:2, 220-229
CrossRef90
Xuemei Liu, Mingming Zhang, Lin He, Youping Li, Youping Li. 2006. Chinese herbs combined with Western medicine for severe acute respiratory syndrome (SARS). .
CrossRef91
Els Keyaerts, Leen Vijgen, Piet Maes, Griet Duson, Johan Neyts, Marc Van Ranst. (2006) Viral load quantitation of SARS-coronavirus RNA using a one-step real-time RT-PCR. International Journal of Infectious Diseases 10:1, 32-37
CrossRef92
Ryan Draker, Rachel L. Roper, Martin Petric, Raymond Tellier. (2006) The complete sequence of the bovine torovirus genome. Virus Research 115:1, 56-68
CrossRef93
Xiaohong Yan, Qian Hao, Yongxin Mu, Khalid Amine Timani, Linbai Ye, Ying Zhu, Jianguo Wu. (2006) Nucleocapsid protein of SARS-CoV activates the expression of cyclooxygenase-2 by binding directly to regulatory elements for nuclear factor-kappa B and CCAAT/enhancer binding protein. The International Journal of Biochemistry & Cell Biology 38:8, 1417-1428
CrossRef94
Linqi Zhang, Fengwen Zhang, Wenjie Yu, Tian He, Jian Yu, Christopher E. Yi, Lei Ba, Wenhui Li, Michael Farzan, Zhiwei Chen, Kwok-Yung Yuen, David Ho. (2006) Antibody responses against SARS coronavirus are correlated with disease outcome of infected individuals. Journal of Medical Virology 78:1, 1-8
CrossRef95
John M. Nicholls, Jagdish Butany, Leo L. M. Poon, Kwok H. Chan, Swan Lip Beh, Susan Poutanen, J. S. Malik Peiris, Maria Wong. (2006) Time Course and Cellular Localization of SARS-CoV Nucleoprotein and RNA in Lungs from Fatal Cases of SARS. PLoS Medicine 3:2, e27
CrossRef96
Massoud Rezvani, Gideon Koren. (2006) Pregnancy outcome after exposure to injectable ribavirin during embryogenesis. Reproductive Toxicology 21:1, 113-115
CrossRef97
Hee-Hyun Yeom, Joon-Soo Park, Dong-Jun Jeong, Chang-Jin Kim, Yong-Bae Kim, Dea-Hoon Lee, Kyung-Joong Kim, Jong-Yoon Chun, Chun Kang, Yoon-Seok Chung, Hyang-Min Cheong. (2006) Human metapneumovirus infection in Korean children. Korean Journal of Pediatrics 49:4, 401
CrossRef98
Hiroaki Kariwa, Nobuhiro Fujii, Ikuo Takashima. (2006) Inactivation of SARS Coronavirus by Means of Povidone-Iodine, Physical Conditions and Chemical Reagents. Dermatology 212:1, 119-123
CrossRef99
Russell D. MacDonald, Bonnie Henry, Rebecca Stuart. (2006) Performance Analysis of a Medical Decision Algorithm to Mitigate Spread of SARS Due to Interfacility Patient Transfers. Prehospital Emergency Care 10:3, 383-389
CrossRef100
Rong-Fu Chen, Jen-Chieh Chang, Wen-Tien Yeh, Chen-Hsiang Lee, Jien-Wei Liu, Hock-Liew Eng, Kuender D. Yang. (2006) Role of vascular cell adhesion molecules and leukocyte apoptosis in the lymphopenia and thrombocytopenia of patients with severe acute respiratory syndrome (SARS). Microbes and Infection 8:1, 122-127
CrossRef101
Danuta M. Skowronski, Martin Petric, Patricia Daly, Robert A. Parker, Elizabeth Bryce, Patrick W. Doyle, Michael A. Noble, Diane L. Roscoe, Joan Tomblin, Tung C. Yang, Mel Krajden, David M. Patrick, Babak Pourbohloul, Swee Han Goh, William R. Bowie, Tim F. Booth, S. Aleina Tweed, Thomas L. Perry, Allison McGeer, Robert C. Brunham. (2006) Coordinated Response to SARS, Vancouver, Canada. Emerging Infectious Diseases 12:1, 155-158
CrossRef102
Guy Boivin, Mariana Baz, St??phanie C??t??, Rodica Gilca, C??line Deffrasnes, ??ric Leblanc, Michel G. Bergeron, Pierre D??ry, Gaston De Serres. (2005) Infections by Human Coronavirus-NL in Hospitalized Children. The Pediatric Infectious Disease Journal 24:12, 1045-1048
CrossRef103
G. Gerna, G. Campanini, F. Rovida, A. Sarasini, D. Lilleri, S. Paolucci, A. Marchi, F. Baldanti, M. G. Revello. (2005) Changing circulation rate of human metapneumovirus strains and types among hospitalized pediatric patients during three consecutive winter-spring seasons. Archives of Virology 150:11, 2365-2375
CrossRef104
Kuo-Chien Tsao, Guang-Wu Chen, Chung-Guei Huang, Ya-Ling Huang, Jing-Yi Lin, Mok-Chee Keng, Chien-Fen Sun, Shin-Ru Shih. (2005) False positive antibody results against human T-cell lymphotropic virus in patients with severe acute respiratory syndrome. Journal of Medical Virology 77:3, 331-336
CrossRef105
Maria Cristina Keightley, Peter Sillekens, Wim Schippers, Charles Rinaldo, Kirsten St. George. (2005) Real-time NASBA detection of SARS-associated coronavirus and comparison with real-time reverse transcription-PCR. Journal of Medical Virology 77:4, 602-608
CrossRef106
Zhongping He, Chunhui Zhao, Qingming Dong, Hui Zhuang, Shujing Song, Guoai Peng, Dominic E. Dwyer. (2005) Effects of severe acute respiratory syndrome (SARS) coronavirus infection on peripheral blood lymphocytes and their subsets. International Journal of Infectious Diseases 9:6, 323-330
CrossRef107
Marie-??ve Hamelin, Guy Boivin. (2005) Human Metapneumovirus. The Pediatric Infectious Disease Journal 24:Supplement, S203-S207
CrossRef108
James B. Mahony, Susan Richardson. (2005) Molecular Diagnosis of Severe Acute Respiratory Syndrome. The Journal of Molecular Diagnostics 7:5, 551-559
CrossRef109
N PETROSILLO, V PURO, A DICARO, G IPPOLITO. (2005) The Initial Hospital Response to an Epidemic. Archives of Medical Research 36:6, 706-712
CrossRef110
Richard P. Wenzel, Gonzalo Bearman, Michael B. Edmond. (2005) Lessons from Severe Acute Respiratory Syndrome (SARS): Implications for Infection Control. Archives of Medical Research 36:6, 610-616
CrossRef111
Cheng-Wen Lin, Fuu-Jen Tsai, Chang-Hai Tsai, Chien-Chen Lai, Lei Wan, Tin-Yun Ho, Chang-Chi Hsieh, Pei-Dawn Lee Chao. (2005) Anti-SARS coronavirus 3C-like protease effects of Isatis indigotica root and plant-derived phenolic compounds. Antiviral Research 68:1, 36-42
CrossRef112
Asami Sasaki, Hiroshi Suzuki, Reiko Saito, Mizuho Sato, Isamu Sato, Yasuko Sano, Makoto Uchiyama. (2005) Prevalence of Human Metapneumovirus and Influenza Virus Infections Among Japanese Children During Two Successive Winters. The Pediatric Infectious Disease Journal 24:10, 905-908
CrossRef113
Jau-Ling Huang, Hui-Tsu Lin, Yu-Ming Wang, Yi-Chien Yeh, Konan Peck, Bai-Ling Lin, Huan-Wun Liu, Ann Chen, Chang-Shen Lin. (2005) Rapid and sensitive detection of multiple genes from the SARS-Coronavirus using quantitative RT-PCR with dual systems. Journal of Medical Virology 77:2, 151-158
CrossRef114
Ary L. Goldberger, C.-K. Peng. (2005) Genomic Classification Using an Information-Based Similarity Index: Application to the SARS Coronavirus. Journal of Computational Biology 12:8, 1103-1116
CrossRef115
S. L. Grace. (2005) The Occupational and Psychosocial Impact of SARS on Academic Physicians in Three Affected Hospitals. Psychosomatics 46:5, 385-391
CrossRef116
S. T. Lai. (2005) Treatment of severe acute respiratory syndrome. European Journal of Clinical Microbiology & Infectious Diseases 24:9, 583-591
CrossRef117
Ralph A. Tripp, Lia M. Haynes, Deborah Moore, Barbara Anderson, Azaibi Tamin, Brian H. Harcourt, Les P. Jones, Mamadi Yilla, Gregory J. Babcock, Thomas Greenough, Donna M. Ambrosino, Rene Alvarez, Justin Callaway, Sheana Cavitt, Kurt Kamrud, Harold Alterson, Jonathan Smith, Jennifer L. Harcourt, Congrong Miao, Raj Razdan, James A. Comer, Pierre E. Rollin, Thomas G. Ksiazek, Anthony Sanchez, Paul A. Rota, William J. Bellini, Larry J. Anderson. (2005) Monoclonal antibodies to SARS-associated coronavirus (SARS-CoV): Identification of neutralizing and antibodies reactive to S, N, M and E viral proteins. Journal of Virological Methods 128:1-2, 21-28
CrossRef118
Y. S. Lin, C. F. Lin, Y. T. Fang, Y. M. Kuo, P. C. Liao, T. M. Yeh, K. Y. Hwa, C. C. K. Shieh, J. H. Yen, H. J. Wang, I. J. Su, H. Y. Lei. (2005) Antibody to severe acute respiratory syndrome (SARS)-associated coronavirus spike protein domain 2 cross-reacts with lung epithelial cells and causes cytotoxicity. Clinical and Experimental Immunology 141:3, 500-508
CrossRef119
Linda Chui, Michael Drebot, Anton Andonov, Astrid Petrich, Martin Glushek, James Mahony. (2005) Comparison of 9 different PCR primers for the rapid detection of severe acute respiratory syndrome coronavirus using 2 RNA extraction methods. Diagnostic Microbiology and Infectious Disease 53:1, 47-55
CrossRef120
Dave Davis, David Ryan, Gary Sibbald, Anita Rachlis, Sharon Davies, Lee Manchul, Sagar Parikh. (2005) Severe acute respiratory syndrome and the delivery of continuing medical education: Case study from Toronto. Journal of Continuing Education in the Health Professions 24:2, 76-81
CrossRef121
Xin-Wei Wang, Jin-Song Li, Ting-Kai Guo, Bei Zhen, Qing-Xin Kong, Bin Yi, Zhong Li, Nong Song, Min Jin, Wen-Jun Xiao, Xiu-Mei Zhu, Chang-Qing Gu, Jing Yin, Wei Wei, Wei Yao, Chao Liu, Jian-Feng Li, Guo-Rong Ou, Min-Nian Wang, Tong-Yu Fang, Gui-Jie Wang, Yao-Hui Qiu, Huai-Huan Wu, Fu-Huan Chao, Jun-Wen Li. (2005) Concentration and detection of SARS coronavirus in sewage from Xiao Tang Shan Hospital and the 309th Hospital. Journal of Virological Methods 128:1-2, 156-161
CrossRef122
Keiji Kuba, Yumiko Imai, Shuan Rao, Hong Gao, Feng Guo, Bin Guan, Yi Huan, Peng Yang, Yanli Zhang, Wei Deng, Linlin Bao, Binlin Zhang, Guang Liu, Zhong Wang, Mark Chappell, Yanxin Liu, Dexian Zheng, Andreas Leibbrandt, Teiji Wada, Arthur S Slutsky, Depei Liu, Chuan Qin, Chengyu Jiang, Josef M Penninger. (2005) A crucial role of angiotensin converting enzyme 2 (ACE2) in SARS coronavirus–induced lung injury. Nature Medicine 11:8, 875-879
CrossRef123
Chuan Qin, Jianwei Wang, Qiang Wei, Mingpeng She, Wayne A Marasco, Hong Jiang, Xinming Tu, Hua Zhu, Lili Ren, Hong Gao, Li Guo, Lan Huang, Renquan Yang, Zhe Cong, Lan Guo, Yanbin Wang, Yali Liu, Yili Sun, Shumin Duan, Jianguo Qu, Liangbiao Chen, Wei Tong, Li Ruan, Peimao Liu, Hua Zhang, Jianmin Zhang, Huiyuan Zhang, Depei Liu, Qian Liu, Tao Hong, Wei He. (2005) An animal model of SARS produced by infection ofMacaca mulatta with SARS coronavirus. The Journal of Pathology 206:3, 251-259
CrossRef124
Shixia Wang, Pavlo Sakhatskyy, Te-Hui W. Chou, Shan Lu. (2005) Assays for the assessment of neutralizing antibody activities against Severe Acute Respiratory Syndrome (SARS) associated coronavirus (SCV). Journal of Immunological Methods 301:1-2, 21-30
CrossRef125
R.H. Rubin. (2005) Transplant infectious disease: a work in progress. Transplant Infectious Disease 7:2, 49-50
CrossRef126
Masayuki Saijo, Toshio Ogino, Fumihiro Taguchi, Shuetsu Fukushi, Tetsuya Mizutani, Tsugunori Notomi, Hidetoshi Kanda, Harumi Minekawa, Shutoku Matsuyama, Hoang Thuy Long, Nguyen Thi Hong Hanh, Ichiro Kurane, Masato Tashiro, Shigeru Morikawa. (2005) Recombinant nucleocapsid protein-based IgG enzyme-linked immunosorbent assay for the serological diagnosis of SARS. Journal of Virological Methods 125:2, 181-186
CrossRef127
Matthew P. Muller, George Tomlinson, Thomas J. Marrie, Patrick Tang, Allison McGeer, Donald E. Low, Allan S. Detsky, Wayne L. Gold. (2005) Can Routine Laboratory Tests Discriminate between Severe Acute Respiratory Syndrome and Other Causes of Community‐Acquired Pneumonia?. Clinical Infectious Diseases 40:8, 1079-1086
CrossRef128
Yat Wah Kwan, Chi Wai Leung, Man Chun Chiu. (2005) Diarrhoea as the presenting sign in an adolescent suffering from severe acute respiratory syndrome. European Journal of Pediatrics 164:4, 227-230
CrossRef129
Thomas M Mack. (2005) The ghost of pandemics past. The Lancet 365:9468, 1370-1372
CrossRef130
George S. Tolomiczenko, Meldon Kahan, Maria Ricci, Lynne Strathern, Christa Jeney, Karen Patterson, Lynn Wilson. (2005) SARS: coping with the impact at a community hospital. Journal of Advanced Nursing 50:1, 101-110
CrossRef131
Ling Ni, Jieqing Zhu, Junjie Zhang, Meng Yan, George F. Gao, Po Tien. (2005) Design of recombinant protein-based SARS-CoV entry inhibitors targeting the heptad-repeat regions of the spike protein S2 domain. Biochemical and Biophysical Research Communications 330:1, 39-45
CrossRef132
Kow-Tong Chen, Shiing-Jer Twu, Hsiao-Ling Chang, Yi-Chun Wu, Chu-Tzu Chen, Ting-Hsiang Lin, Sonja J. Olsen, Scott F. Dowell, Ih-Jen Su. (2005) SARS in Taiwan: an overview and lessons learned. International Journal of Infectious Diseases 9:2, 77-85
CrossRef133
Danuta M. Skowronski, Caroline Astell, Robert C. Brunham, Donald E. Low, Martin Petric, Rachel L. Roper, Pierre J. Talbot, Theresa Tam, Lorne Babiuk. (2005) Severe Acute Respiratory Syndrome (SARS): A Year in Review. Annual Review of Medicine 56:1, 357-381
CrossRef134
Martha Fulford, Jay S. Keystone. (2005) Health risks associated with visiting friends and relatives in developing countries. Current Infectious Disease Reports 7:1, 48-53
CrossRef135
Francesca Rovida, Elena Percivalle, Maurizio Zavattoni, Maria Torsellini, Antonella Sarasini, Giulia Campanini, Stefania Paolucci, Fausto Baldanti, M. Grazia Revello, Giuseppe Gerna. (2005) Monoclonal antibodies versus reverse transcription-PCR for detection of respiratory viruses in a patient population with respiratory tract infections admitted to hospital. Journal of Medical Virology 75:2, 336-347
CrossRef136
Mu-Chin Shih, Konan Peck, Wen-Ling Chan, Yen-Ping Chu, Jui-Chang Chen, Chang-Hai Tsai, Jan-Gowth Chang. (2005) SARS-CoV Infection Was from at Least Two Origins in the Taiwan Area. Intervirology 48:2-3, 124-132
CrossRef137
David M Hwang, Dean W Chamberlain, Susan M Poutanen, Donald E Low, Sylvia L Asa, Jagdish Butany. (2005) Pulmonary pathology of severe acute respiratory syndrome in Toronto. Modern Pathology 18:1, 1-10
CrossRef138
Umesh D Parashar, Angela Merianos, Cathy Roth, Larry J Anderson. 2005. Preparing for a Possible Resurgence of SARS. , 231-238.
CrossRef139
Angela Merianos, Robert Condon, Hitoshi Oshitani, Denise Werker, Roberta Andraghetti. 2005. Epidemiology and Transmission of SARS. , 100-110.
CrossRef140
Lauren Ancel Meyers, Babak Pourbohloul, M.E.J. Newman, Danuta M. Skowronski, Robert C. Brunham. (2005) Network theory and SARS: predicting outbreak diversity. Journal of Theoretical Biology 232:1, 71-81
CrossRef141
Felicia Li Sher Tan, Wee Lim Loo, Seck Guan Tan, Chow Yin Wong, Yu-Meng Tan. (2005) Severe acute respiratory syndrome in surgical patients: a diagnostic dilemma. ANZ Journal of Surgery 75:1-2, 21-26
CrossRef142
Malik Peiris, Albert DME Osterhaus. 2005. Aetiology of SARS. , 50-57.
CrossRef143
Dan-Dan Lu, Su-Hong Chen, Shi-Meng Zhang, Min-Li Zhang, Wei Zhang, Xiao-Chen Bo, Sheng-Qi Wang. (2005) Screening of specific antigens for SARS clinical diagnosis using a protein microarray. The Analyst 130:4, 474
CrossRef144
Kanta Subbarao. 2005. Vaccines. , 203-212.
CrossRef145
Xueying Shi, Encong Gong, Dongxia Gao, Bo Zhang, Jie Zheng, Zifen Gao, Yanfeng Zhong, Wanzhong Zou, Bingquan Wu, Weigang Fang, Songlin Liao, Shenglan Wang, Zhigang Xie, Min Lu, Lin Hou, Haohao Zhong, Hongquan Shao, Ning Li, Congrong Liu, Fei Pei, Jingping Yang, Yuping Wang, Zhihui Han, Xiaohong Shi, Qianying Zhang, Jiangfeng You, Xiang Zhu, Jiang Gu. (2005) Severe Acute Respiratory Syndrome Associated Coronavirus Is Detected in Intestinal Tissues of Fatal Cases. The American Journal of Gastroenterology 100:1, 169-176
CrossRef146
Mark H. Yudin, Donna M. Steele, Michael D. Sgro, Stanley E. Read, Peter Kopplin, Kevin A. Gough. (2005) Severe Acute Respiratory Syndrome in Pregnancy. Obstetrics & Gynecology 105:1, 124-127
CrossRef147
, . (2005) Strategies adopted and lessons learnt during the severe acute respiratory syndrome crisis in Singapore. Reviews in Medical Virology 15:1, 57-70
CrossRef148
H. F. Rabenau, J. Cinatl, B. Morgenstern, G. Bauer, W. Preiser, H. W. Doerr. (2005) Stability and inactivation of SARS coronavirus. Medical Microbiology and Immunology 194:1-2, 1-6
CrossRef149
Nada Kuljic-Kapulica, Biljana Srdic, Ljilja Mijatov-Ukropina, Ljubica Stojsic-Dzunja. (2005) SARS corona virus: A new dilemma. Medicinski pregled 58:1-2, 43-46
CrossRef150
A. Wilder-Smith, A. Earnest, N. I. Paton. (2004) Use of Simple Laboratory Features to Distinguish the Early Stage of Severe Acute Respiratory Syndrome from Dengue Fever. Clinical Infectious Diseases 39:12, 1818-1823
CrossRef151
Nan-Shan Zhong, Gary W.K. Wong. (2004) Epidemiology of severe acute respiratory syndrome (SARS): adults and children. Paediatric Respiratory Reviews 5:4, 270-274
CrossRef152
Michael J. Rieder, Marina Salvadori, Susan Bannister, Cynthia Kenyon. (2004) Collateral damage: the effect of SARS on medical education. The Clinical Teacher 1:2, 85-89
CrossRef153
D. Adachi, G. Johnson, R. Draker, M. Ayers, T. Mazzulli, P.J. Talbot, R. Tellier. (2004) Comprehensive detection and identification of human coronaviruses, including the SARS-associated coronavirus, with a single RT-PCR assay. Journal of Virological Methods 122:1, 29-36
CrossRef154
Paul K.S. Chan, W.K. To, Esther Y.M. Liu, T.K. Ng, John S. Tam, Joseph J.Y. Sung, Jean-Michel Lacroix, Michel Houde. (2004) Evaluation of a peptide-based enzyme immunoassay for anti-SARS coronavirus IgG antibody. Journal of Medical Virology 74:4, 517-520
CrossRef155
J S M Peiris, Y Guan, K Y Yuen. (2004) Severe acute respiratory syndrome. Nature Medicine 10:12s, S88-S97
CrossRef156
Chang‐Phone Fung, Tsorng‐Liu Hsieh, Kuang‐Huan Tan, Chin‐Hui Loh, Jiunn‐Sheng Wu, Chien‐Chung Li, Feng‐Yee Chang, L. K. Siu, Moh‐Yun Yen, Lih‐Shinn Wang, Wing‐Wai Wong, Wei‐Fong Kao, Jia‐Hui Hsu, Ting‐Hsiang Lin, Fu‐Yuan Huang, Chen‐Hsen Lee. (2004) Rapid Creation of a Temporary Isolation Ward for Patients With Severe Acute Respiratory Syndrome in Taiwan • . Infection Control and Hospital Epidemiology 25:12, 1026-1032
CrossRef157
Mark B. Loeb. (2004) Severe Acute Respiratory Syndrome: Preparedness, Management, and Impact • . Infection Control and Hospital Epidemiology 25:12, 1017-1019
CrossRef158
Yan Li, Chunqing Luo, Wei Li, Zhao Xu, Changqing Zeng, Shenli Bi, Jun Yu, Jun Wu, Huanming Yang. (2004) Structure-Based Preliminary Analysis of Immunity and Virulence of SARS Coronavirus. Viral Immunology 17:4, 528-534
CrossRef159
Clete DiGiovanni, Jerome Conley, Daniel Chiu, Jason Zaborski. (2004) Factors Influencing Compliance with Quarantine in Toronto During the 2003 SARS Outbreak. Biosecurity and Bioterrorism: Biodefense Strategy, Practice, and Science 2:4, 265-272
CrossRef160
James. D. Cherry. (2004) The chronology of the 2002–2003 SARS mini pandemic. Paediatric Respiratory Reviews 5:4, 262-269
CrossRef161
P.-R. Hsueh, L.-M. Huang, P.-J. Chen, C.-L. Kao, P.-C. Yang. (2004) Chronological evolution of IgM, IgA, IgG and neutralisation antibodies after infection with SARS-associated coronavirus. Clinical Microbiology and Infection 10:12, 1062-1066
CrossRef162
C.W. Leung, W.K. Chiu. (2004) Clinical picture, diagnosis, treatment and outcome of severe acute respiratory syndrome (SARS) in children. Paediatric Respiratory Reviews 5:4, 275-288
CrossRef163
Xueqing Han, Mark Bartlam, Ying-hua Jin, Xiangtao Liu, Xiaojing He, Xuepeng Cai, Qingqe Xie, Zihe Rao. (2004) The expression of SARS–CoV M gene in P. Pastoris and the diagnostic utility of the expression product. Journal of Virological Methods 122:1, 105-111
CrossRef164
L. Chen, P. Liu, H. Gao, B. Sun, D. Chao, F. Wang, Y. Zhu, G. Hedenstierna, C. G. Wang. (2004) Inhalation of Nitric Oxide in the Treatment of Severe Acute Respiratory Syndrome: A Rescue Trial in Beijing. Clinical Infectious Diseases 39:10, 1531-1535
CrossRef165
Christl A Donnelly, Matthew C Fisher, Christophe Fraser, Azra C Ghani, Steven Riley, Neil M Ferguson, Roy M Anderson. (2004) Epidemiological and genetic analysis of severe acute respiratory syndrome. The Lancet Infectious Diseases 4:11, 672-683
CrossRef166
Paul A Tambyah. (2004) Severe acute respiratory syndrome from the trenches, at a Singapore university hospital. The Lancet Infectious Diseases 4:11, 690-696
CrossRef167
G. Magiorkinis, E. Magiorkinis, D. Paraskevis, A.M. Vandamme, M. Van Ranst, V. Moulton, A. Hatzakis. (2004) Phylogenetic analysis of the full-length SARS-CoV sequences: Evidence for phylogenetic discordance in three genomic regions. Journal of Medical Virology 74:3, 369-372
CrossRef168
LLM Poon, Y Guan, JM Nicholls, KY Yuen, JSM Peiris. (2004) The aetiology, origins, and diagnosis of severe acute respiratory syndrome. The Lancet Infectious Diseases 4:11, 663-671
CrossRef169
C.-H. Chiang, J.-F. Shih, W.-J. Su, R.-P. Perng. (2004) Eight-Month Prospective Study of 14 Patients With Hospital-Acquired Severe Acute Respiratory Syndrome. Mayo Clinic Proceedings 79:11, 1372-1379
CrossRef170
Rene Alvarez, Les P. Jones, Bruce S. Seal, Darrell R. Kapczynski, Ralph A. Tripp. (2004) Serological cross-reactivity of members of the Metapneumovirus genus. Virus Research 105:1, 67-73
CrossRef171
P. Richard Verbeek, Ian W. McClelland, Alexis C. Silverman, Robert J. Burgess. (2004) Loss of Paramedic Availability in an Urban Emergency Medical Services System during a Severe Acute Respiratory Syndrome Outbreak. Academic Emergency Medicine 11:9, 973-978
CrossRef172
Paul K.S. Chan, Ka-Fai To, Anthony W.I. Lo, Jo L.K. Cheung, Ida Chu, Florence W.L. Au, Joanna H.M. Tong, John S. Tam, Joseph J.Y. Sung, Ho-Keung Ng. (2004) Persistent infection of SARS coronavirus in colonic cells in vitro. Journal of Medical Virology 74:1, 1-7
CrossRef173
R W K Li, K W C Leung, F C S Sun, L P Samaranayake. (2004) Severe Acute Respiratory Syndrome (SARS) and the GDP. Part II: Implications for GDPs. British Dental Journal 197:3, 130-134
CrossRef174
Elisabetta Traggiai, Stephan Becker, Kanta Subbarao, Larissa Kolesnikova, Yasushi Uematsu, Maria Rita Gismondo, Brian R Murphy, Rino Rappuoli, Antonio Lanzavecchia. (2004) An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nature Medicine 10:8, 871-875
CrossRef175
Susan M Poutanen, Donald E Low. (2004) Severe acute respiratory syndrome: an update. Current Opinion in Infectious Diseases 17:4, 287-294
CrossRef176
Damon C Scales, William J Sibbald. (2004) Medical technology in the intensive care unit. Current Opinion in Critical Care 10:4, 238-245
CrossRef177
Cheng Luo, Haibin Luo, Suxin Zheng, Chunshan Gui, Liduo Yue, Changying Yu, Tao Sun, Peilan He, Jing Chen, Jianhua Shen, Xiaomin Luo, Yixue Li, Hong Liu, Donglu Bai, Jingkang Shen, Yiming Yang, Fangqiu Li, Jianping Zuo, Rolf Hilgenfeld, Gang Pei, Kaixian Chen, Xu Shen, Hualiang Jiang. (2004) Nucleocapsid protein of SARS coronavirus tightly binds to human cyclophilin A. Biochemical and Biophysical Research Communications 321:3, 557-565
CrossRef178
Tracy Hussell, Robert Snelgrove, Ian R. Humphreys, Andrew E. Williams. (2004) Co-stimulation: novel methods for preventing viral-induced lung inflammation. Trends in Molecular Medicine 10:8, 379-386
CrossRef179
R W K Li, K W C Leung, F C S Sun, L P Samaranayake. (2004) Severe Acute Respiratory Syndrome (SARS) and the GDP. Part I: Epidemiology, virology, pathology and general health issues. British Dental Journal 197:2, 77-80
CrossRef180
X Liu, M Zhang, L He, Y Li, Xuemei Liu. 2004. Chinese herbs combined with western medicine for severe acute respiratory syndrome (SARS). .
CrossRef181
V. L. Yu, L. C. Madoff. (2004) ProMED-mail: An Early Warning System for Emerging Diseases. Clinical Infectious Diseases 39:2, 227-232
CrossRef182
A. Srinivasan, D. B. Jernign, L. Liedtke, L. Strausbaugh. (2004) Hospital Preparedness for Severe Acute Respiratory Syndrome in the United States: Views from a National Survey of Infectious Diseases Consultants. Clinical Infectious Diseases 39:2, 272-274
CrossRef183
B. Brett Finlay, Raymond H. See, Robert C. Brunham. (2004) Science and society: Rapid response research to emerging infectious diseases: lessons from SARS. Nature Reviews Microbiology 2:7, 602-607
CrossRef184
T. HUSSELL, A. WILLIAMS. (2004) Ménage à trois of bacterial and viral pulmonary pathogens delivers coup de grace to the lung. Clinical & Experimental Immunology 137:1, 8-11
CrossRef185
Kehu Yuan, Ling Yi, Jian Chen, Xiuxia Qu, Tingting Qing, Xi Rao, Pengfei Jiang, Jianhe Hu, Zikai Xiong, Yuchun Nie, Xuanling Shi, Wei Wang, Chen Ling, Xiaolei Yin, Keqiang Fan, Luhua Lai, Mingxiao Ding, Hongkui Deng. (2004) Suppression of SARS-CoV entry by peptides corresponding to heptad regions on spike glycoprotein. Biochemical and Biophysical Research Communications 319:3, 746-752
CrossRef186
Svoboda, Tomislav, Henry, Bonnie, Shulman, Leslie, Kennedy, Erin, Rea, Elizabeth, Ng, Wil, Wallington, Tamara, Yaffe, Barbara, Gournis, Effie, Vicencio, Elisa, Basrur, Sheela, Glazier, Richard H., . (2004) Public Health Measures to Control the Spread of the Severe Acute Respiratory Syndrome during the Outbreak in Toronto. New England Journal of Medicine 350:23, 2352-2361
Full Text187
Kar Neng Lai, Kenneth W. Tsang, Wing Hong Seto, Clara G. C. Ooi. (2004) Clinical, laboratory, and radiologic manifestation of SARS. Current Infectious Disease Reports 6:3, 213-219
CrossRef188
Jindrich Cinatl Jr, Martin Michaelis, Martin Scholz, Hans Wilhelm Doerr. (2004) Role of interferons in the treatment of severe acute respiratory syndrome. Expert Opinion on Biological Therapy 4:6, 827-836
CrossRef189
Alexander Bukreyev, Elaine W Lamirande, Ursula J Buchholz, Leatrice N Vogel, William R Elkins, Marisa St Claire, Brian R Murphy, Kanta Subbarao, Peter L Collins. (2004) Mucosal immunisation of African green monkeys (Cercopithecus aethiops) with an attenuated parainfluenza virus expressing the SARS coronavirus spike protein for the prevention of SARS. The Lancet 363:9427, 2122-2127
CrossRef190
Thomas W. F. Chin, Clarence Chant, Rosemary Tanzini, Janice Wells. (2004) Severe Acute Respiratory Syndrome (SARS): The Pharmacist’s Role. Pharmacotherapy 24:6, 705-712
CrossRef191
M. D. Christian, S. M. Poutanen, M. R. Loutfy, M. P. Muller, D. E. Low. (2004) Severe Acute Respiratory Syndrome. Clinical Infectious Diseases 38:10, 1420-1427
CrossRef192
Timothy H Rainer. (2004) Severe acute respiratory syndrome. Current Opinion in Pulmonary Medicine 10:3, 159-165
CrossRef193
Megan J Brooks, Joseph J Sasadeusz, Gregory A Tannock. (2004) Antiviral chemotherapeutic agents against respiratory viruses. Current Opinion in Pulmonary Medicine 10:3, 197-203
CrossRef194
C. K. WONG, C. W. K. LAM, A. K. L. WU, W. K. IP, N. L. S. LEE, I. H. S. CHAN, L. C. W. LIT, D. S. C. HUI, M. H. M. CHAN, S. S. C. CHUNG, J. J. Y. SUNG. (2004) Plasma inflammatory cytokines and chemokines in severe acute respiratory syndrome. Clinical & Experimental Immunology 136:1, 95-103
CrossRef195
Marie‐Ève Hamelin, Yacine Abed, Guy Boivin. (2004) Human Metapneumovirus: A New Player among Respiratory Viruses. Clinical Infectious Diseases 38:7, 983-990
CrossRef196
Wendi Wang, Shigui Ruan. (2004) Simulating the SARS outbreak in Beijing with limited data. Journal of Theoretical Biology 227:3, 369-379
CrossRef197
G. Simmons, J. D. Reeves, A. J. Rennekamp, S. M. Amberg, A. J. Piefer, P. Bates. (2004) Characterization of severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike glycoprotein-mediated viral entry. Proceedings of the National Academy of Sciences 101:12, 4240-4245
CrossRef198
Ziad A. Memish, Annelies Wilder-Smith. (2004) Global Impact of Severe Acute Respiratory Syndrome: Measures to Prevent Importation into Saudi Arabia. Journal of Travel Medicine 11:2, 127-129
CrossRef199
B. M. JONES, E. S. K. MA, J. S. M. PEIRIS, P. C. WONG, J. C. M. HO, B. LAM, K. N. LAI, K. W. T. TSANG. (2004) Prolonged disturbances of in vitro cytokine production in patients with severe acute respiratory syndrome (SARS) treated with ribavirin and steroids. Clinical and Experimental Immunology 135:3, 467-473
CrossRef200
Patrick CY Woo, Susanna KP Lau, Hoi-wah Tsoi, Kwok-hung Chan, Beatrice HL Wong, Xiao-yan Che, Victoria KP Tam, Sidney CF Tam, Vincent CC Cheng, Ivan FN Hung, Samson SY Wong, Bo-jian Zheng, Yi Guan, Kwok-yung Yuen. (2004) Relative rates of non-pneumonic SARS coronavirus infection and SARS coronavirus pneumonia. The Lancet 363:9412, 841-845
CrossRef201
Kamaljit Singh, Ooi Eng Eong, Bijon Kumarsil, Sharon Saw, Sunil Sethi. (2004) Severe Acute Respiratory Syndrome without Respiratory Symptoms or Abnormal Chest Radiograph Findings. Clinical Infectious Diseases 38:4, 585-586
CrossRef202
Zhengsheng Zou, Yongping Yang, Jumei Chen, Shaojie Xin, Wei Zhang, Xianzhi Zhou, Yuanli Mao, Liangping Hu, Daojian Liu, Binxia Chang, Weihua Chang, Yanping Liu, Xuemei Ma, Yedong Wang, Xiqing Liu. (2004) Prognostic Factors for Severe Acute Respiratory Syndrome: A Clinical Analysis of 165 Cases. Clinical Infectious Diseases 38:4, 483-489
CrossRef203
Natalie Keeler, Jairam Lingappa. (2004) Severe acute respiratory syndrome: public health response and clinical practice update for an emerging disease. Current Opinion in Pediatrics 16:1, 61-69
CrossRef204
Atul Humar, Ian McGilvray, Murray J. Phillips, Gary A. Levy. (2004) Severe acute respiratory syndrome and the liver. Hepatology 39:2, 291-294
CrossRef205
Tai-Nin Chau, Kam-Cheong Lee, Hung Yao, Tak-Yin Tsang, Tat-Chong Chow, Yiu-Cheong Yeung, Kin-Wing Choi, Yuk-Keung Tso, Terence Lau, Sik-To Lai, Ching-Lung Lai. (2004) SARS-associated viral hepatitis caused by a novel coronavirus: Report of three cases. Hepatology 39:2, 302-310
CrossRef206
Sameer Syed, Abdus Saleem. (2004) Severe Acute Respiratory Syndrome Epidemiology and Control. Laboratory Medicine 35:2, 112-116
CrossRef207
Stephen E Lapinsky, John T Granton. (2004) Critical care lessons from severe acute respiratory syndrome. Current Opinion in Critical Care 10:1, 53-58
CrossRef208
Gary WK Wong, Tai F Fok. (2004) Severe acute respiratory syndrome (sars) in children. Pediatric Pulmonology 37:S26, 69-71
CrossRef209
Jian Ping Liu, Lise Lotte Gluud, Bodil Als-Nielsen, Christian Gluud, Jian Ping Liu. 2004. Artificial and bioartificial support systems for liver failure. .
CrossRef210
HIROSHI OHARA. (2004) EXPERIENCE AND REVIEW OF SARS CONTROL IN VIETNAM AND CHINA. Tropical Medicine and Health 32:3, 235-240
CrossRef211
A. Berger, Ch. Drosten, H.W. Doerr, M. Stürmer, W. Preiser. (2004) Severe acute respiratory syndrome (SARS)—paradigm of an emerging viral infection. Journal of Clinical Virology 29:1, 13-22
CrossRef212
BERNADETTE G. VAN DEN HOOGEN, D. M. E. OSTERHAUS, RON A. M. FOUCHIER. (2004) Clinical impact and diagnosis of human metapneumovirus infection. The Pediatric Infectious Disease Journal 23:Supplement, S25-S32
CrossRef213
Joyce Yee-Hing Hui, Timothy Yu-Wai Hon, Michael Kwok-Wai Yang, Danny Hing-Yan Cho, Wing-Hang Luk, Ronee Yun-Yee Chan, Kin-Sang Chan, Tony Kwok-Loon Loke, James Chi-Sang Chan. (2004) High-Resolution Computed Tomography Is Useful for Early Diagnosis of Severe Acute Respiratory Syndrome–Associated Coronavirus Pneumonia in Patients with Normal Chest Radiographs. Journal of Computer Assisted Tomography 28:1, 1-9
CrossRef214
Alexander C. Vlantis, Raymond K. Y. Tsang, Duncan K. K. Wong, John K. S. Woo, C. Andrew van Hasselt. (2004) The Impact of Severe Acute Respiratory Syndrome on Otorhinolaryngological Services at The Prince of Wales Hospital in Hong Kong. The Laryngoscope 114:1, 171-174
CrossRef215
Russell D. MacDonald, Bruce Farr, Michael Neill, John Loch, Bruce Sawadsky, Chris Mazza, Karim Daya, Chris Olynyk, Sandra Chad. (2004) A
N EMERGENCY MEDICAL SERVICES TRANSFER AUTHORIZATION CENTER IN RESPONSE TO THE TORONTO SEVERE ACUTE RESPIRATORY SYNDROME OUTBREAK . Prehospital Emergency Care 8:2, 223-231
CrossRef216
T.-N Jang, D.Y Yeh, S.-H Shen, C.-H Huang, J.-S Jiang, S.-J Kao. (2004) Severe acute respiratory syndrome in Taiwan: analysis of epidemiological characteristics in 29 cases. Journal of Infection 48:1, 23-31
CrossRef217
Maher M. El-Masri, Karen M. Williamson, Susan M. Fox-Wasylyshyn. (2004) Severe Acute Respiratory Syndrome. AACN Clinical Issues: Advanced Practice in Acute and Critical Care 15:1, 150-159
CrossRef218
ASUNCI??N MEJ??AS, SUSANA CH??VEZ-BUENO, OCTAVIO RAMILO. (2004) Human metapneumovirus: a not so new virus. The Pediatric Infectious Disease Journal 23:1, 1-7
CrossRef219
Peiris, Joseph S.M., Yuen, Kwok Y., Osterhaus, Albert D.M.E., Stöhr, Klaus, . (2003) The Severe Acute Respiratory Syndrome. New England Journal of Medicine 349:25, 2431-2441
Full Text220
Amar Safdar, Roy F. Chemaly, Cheryl A. Perego, Virginia R. Gonzalez B.S., Kenneth V. Rolston, Issam I. Raad, Jeffrey J. Tarrand, David L. Callender. (2003) Hospitalization of an oncology patient suspected of having severe acute respiratory syndrome. Cancer 98:12, 2738-2739
CrossRef221
J.S.M Peiris. (2003) Severe Acute Respiratory Syndrome (SARS). Journal of Clinical Virology 28:3, 245-247
CrossRef222
T.F Leung, G.W.K Wong, K.L.E Hon, T.F Fok. (2003) Severe acute respiratory syndrome (SARS) in children: epidemiology, presentation and management. Paediatric Respiratory Reviews 4:4, 334-339
CrossRef223
Philip W. H. Peng, David T. Wong, David Bevan, Michael Gardam. (2003) Infection control and anesthesia: Lessons learned from the Toronto SARS outbreak. Canadian Journal of Anesthesia/Journal canadien d'anesthésie 50:10, 989-997
CrossRef224
Lanjuan Li, Jianer Wo, Junbing Shao, Haihong Zhu, Nanping Wu, Minwei Li, Hangpin Yao, Minjun Hu, Reinhard H. Dennin. (2003) SARS-coronavirus replicates in mononuclear cells of peripheral blood (PBMCs) from SARS patients. Journal of Clinical Virology 28:3, 239-244
CrossRef225
Leo L.M. Poon, Kwok Hung Chan, On Kei Wong, Wing Cheong Yam, Kwok Yung Yuen, Yi Guan, Y.M.Dennis Lo, Joseph S.M. Peiris. (2003) Early diagnosis of SARS Coronavirus infection by real time RT-PCR. Journal of Clinical Virology 28:3, 233-238
CrossRef226
L. A. Mandell, J. G. Bartlett, S. F. Dowell, T. M. File, D. M. Musher, C. Whitney. (2003) Update of Practice Guidelines for the Management of Community-Acquired Pneumonia in Immunocompetent Adults. Clinical Infectious Diseases 37:11, 1405-1433
CrossRef227
F C Smales, L P Samaranyake. (2003) Maintaining dental education and specialist dental care during an outbreak of a new coronavirus infection. Part 1: A deadly viral epidemic begins. British Dental Journal 195:10, 557-561
CrossRef228
Adrea Savarino, John R Boelaert, Antonio Cassone, Giancario Majori, Roberto Cauda. (2003) Effects of chloroquine on viral infections: an old drug against today's diseases. The Lancet Infectious Diseases 3:11, 722-727
CrossRef229
WK LAM, NS ZHONG, WC TAN. (2003) Overview on SARS in Asia and the World. Respirology 8:s1, S2-S5
CrossRef230
John NICHOLLS, Xiao-Ping DONG, Gu JIANG, Malik PEIRIS. (2003) SARS: clinical virology and pathogenesis. Respirology 8:s1, S6-S8
CrossRef231
Bonnie Ching-Ha Kwan, Chi-Bon Leung, Cheuk-Chun Szeto, Angela Yee-Moon Wang, Philip Kam-Tao Li. (2003) Severe acute respiratory syndrome in a hemodialysis patient. American Journal of Kidney Diseases 42:5, 1069-1074
CrossRef232
Runtao He, Andrew Leeson, Anton Andonov, Yan Li, Nathalie Bastien, Jingxin Cao, Carla Osiowy, Frederick Dobie, Todd Cutts, Melissa Ballantine, Xuguang Li. (2003) Activation of AP-1 signal transduction pathway by SARS coronavirus nucleocapsid protein. Biochemical and Biophysical Research Communications 311:4, 870-876
CrossRef233
Sanjay Manocha, Keith R. Walley, James A. Russell. (2003) Severe acute respiratory distress syndrome (SARS): A critical care perspective. Critical Care Medicine 31:11, 2684-2692
CrossRef234
D.A. Groneberg. (2003) Severe acute respiratory syndrome: global initiatives for disease diagnosis. QJM 96:11, 845-852
CrossRef235
Christopher M.B. Fernandes. (2003) Emergency Department Overcrowding: What Is Our Response to the "New Normal"?. Academic Emergency Medicine 10:10, 1096-1097
CrossRef236
Annelies Wilder-Smith, Tai Goh Kee, Nicholas I Paton. (2003) Experience of Severe Acute Respiratory Syndrome in Singapore: Importation of Cases, and Defense Strategies at the Airport. Journal of Travel Medicine 10:5, 259-262
CrossRef237
Annelies Wilder-Smith, Hoe Nam Leong, Jorge S. Villacian. (2003) In-flight transmission of Severe Acute Respiratory Syndrome (SARS): A Case Report. Journal of Travel Medicine 10:5, 299-300
CrossRef238
Gary W.K. Wong, Albert M. Li, P.C. Ng, Tai F. Fok. (2003) Severe acute respiratory syndrome in children. Pediatric Pulmonology 36:4, 261-266
CrossRef239
NS Zhong, BJ Zheng, YM Li, LLM Poon, ZH Xie, KH Chan, PH Li, SY Tan, Q Chang, JP Xie, XQ Liu, J Xu, DX Li, KY Yuen, JSM Peiris, Y Guan. (2003) Epidemiology and cause of severe acute respiratory syndrome (SARS) in Guangdong, People's Republic of China, in February, 2003. The Lancet 362:9393, 1353-1358
CrossRef240
(2003) The potential impact of SARS on organ transplantation: Exercise caution. Pediatric Transplantation 7:5, 345-347
CrossRef241
Hsing I. Chen, Shang Jyh Kao, David Wang, Ru Ping Lee, Chain Fa Su. (2003) Acute respiratory distress syndrome. Journal of Biomedical Science 10:6, 588-592
CrossRef242
Xiao Ping Chen, Guan Han Li, Xiao Ping Tang, Yuan Xiong, Xie Jie Chen, Yunzhen Cao. (2003) Lack of Severe Acute Respiratory Syndrome in 19 AIDS Patients Hospitalized Together. JAIDS Journal of Acquired Immune Deficiency Syndromes 34:2, 242-243
CrossRef243
Jeffrey S. Kahn. (2003) Human metapneumovirus, a newly emerging respiratory virus. The Pediatric Infectious Disease Journal 22:10, 923-924
CrossRef244
P Bossi, A Guihot, S Ansart, F Bricaire. (2003) Actualités sur le syndrome respiratoire aigu sévère. La Revue de Médecine Interne 24:10, 672-680
CrossRef245
T. B. Knudsen, T. N. Kledal, O. Andersen, J. Eugen-Olsen, T. B. Kristiansen. (2003) Severe Acute Respiratory Syndrome - a New Coronavirus from the Chinese Dragon's Lair*. Scandinavian Journal of Immunology 58:3, 277-284
CrossRef246
Kenneth W. TSANG, Thomas Y. MOK, Poon C. WONG, Gaik C. OOI. (2003) Severe acute respiratory syndrome (SARS) in Hong Kong. Respirology 8:3, 259-265
CrossRef247
(2003) Pseudo-SARS. New England Journal of Medicine 349:7, 709-711
Full Text248
Christian Drosten, Wolfgang Preiser, Stephan Günther, Herbert Schmitz, Hans Wilhelm Doerr. (2003) Severe acute respiratory syndrome: identification of the etiological agent. Trends in Molecular Medicine 9:8, 325-327
CrossRef249
Li, Gang, Chen, XuejuanXu, Anlong, . (2003) Profile of Specific Antibodies to the SARS-Associated Coronavirus. New England Journal of Medicine 349:5, 508-509
Full Text250
Thijs Kuiken, Ron AM Fouchier, Martin Schutten, Guus F Rimmelzwaan, Geert van Amerongen, Debby van Riel, Jon D Laman, Ton de Jong, Gerard van Doornum, Wilina Lim, Ai Ee Ling, Paul KS Chan, John S Tam, Maria C Zambon, Robin Gopal, Christian Drosten, Sylvie van der Werf, Nicolas Escriou, Jean-Claude Manuguerra, Klaus Stöhr, J S Malik Peiris, Albert DME Osterhaus. (2003) Newly discovered coronavirus as the primary cause of severe acute respiratory syndrome. The Lancet 362:9380, 263-270
CrossRef251
Ling-Ling Chen, Hong-Yu Ou, Ren Zhang, Chun-Ting Zhang. (2003) ZCURVE_CoV: a new system to recognize protein coding genes in coronavirus genomes, and its applications in analyzing SARS-CoV genomes. Biochemical and Biophysical Research Communications 307:2, 382-388
CrossRef252
Yanqing Ding, Huijun Wang, Hong Shen, Zhuguo Li, Jian Geng, Huixia Han, Junjie Cai, Xin Li, Wei Kang, Desheng Weng, Yaodan Lu, Dehua Wu, Li He, Kaitai Yao. (2003) The clinical pathology of severe acute respiratory syndrome (SARS): a report from China. The Journal of Pathology 200:3, 282-289
CrossRef253
Philip A. Marsden, Qin Ning, Laisum S. Fung, Xioping Luo, Yue Chen, Michael Mendicino, Anand Ghanekar, Jeremy A. Scott, Teresa Miller, Camie W.Y. Chan, Mathew W.C. Chan, Wei He, Reginald M. Gorczynski, David R. Grant, David A. Clark, M. James Phillips, Gary A. Levy. (2003) The Fgl2/fibroleukin prothrombinase contributes to immunologically mediated thrombosis in experimental and human viral hepatitis. Journal of Clinical Investigation 112:1, 58-66
CrossRef254
W NGANKEE. (2003) Severe acute respiratory syndrome (SARS). International Journal of Obstetric Anesthesia 12:3, 151-152
CrossRef255
P. Sampathkumar, Z. Temesgen, T. F. Smith, R. L. Thompson. (2003) SARS: Epidemiology, Clinical Presentation, Management, and Infection Control Measures. Mayo Clinic Proceedings 78:7, 882-890
CrossRef256
Ksiazek, Thomas G., Erdman, Dean, Goldsmith, Cynthia S., Zaki, Sherif R., Peret, Teresa, Emery, Shannon, Tong, Suxiang, Urbani, Carlo, Comer, James A., Lim, Wilina, Rollin, Pierre E., Dowell, Scott F., Ling, Ai-Ee, Humphrey, Charles D., Shieh, Wun-Ju, Guarner, Jeannette, Paddock, Christopher D., Rota, Paul, Fields, Barry, DeRisi, Joseph, Yang, Jyh-Yuan, Cox, Nancy, Hughes, James M., LeDuc, James W., Bellini, William J., Anderson, Larry J., the SARS Working Group. (2003) A Novel Coronavirus Associated with Severe Acute Respiratory Syndrome. New England Journal of Medicine 348:20, 1953-1966
Full Text257
Drazen, Jeffrey M., . (2003) Case Clusters of the Severe Acute Respiratory Syndrome. New England Journal of Medicine 348:20,
Full Text258
Drosten, Christian, Günther, Stephan, Preiser, Wolfgang, van der Werf, Sylvie, Brodt, Hans-Reinhard, Becker, Stephan, Rabenau, Holger, Panning, Marcus, Kolesnikova, Larissa, Fouchier, Ron A.M., Berger, Annemarie, Burguière, Ana-Maria, Cinatl, Jindrich, Eickmann, Markus, Escriou, Nicolas, Grywna, Klaus, Kramme, Stefanie, Manuguerra, Jean-Claude, Müller, Stefanie, Rickerts, Volker, Stürmer, Martin, Vieth, SimonKlenk, Hans-Dieter, Osterhaus, Albert D.M.E., Schmitz, Herbert, Doerr, Hans Wilhelm, . (2003) Identification of a Novel Coronavirus in Patients with Severe Acute Respiratory Syndrome. New England Journal of Medicine 348:20, 1967-1976
Full Text259
Wenzel, Richard P., Edmond, Michael B., . (2003) Managing SARS amidst Uncertainty. New England Journal of Medicine 348:20, 1947-1948
Full Text260
Holmes, Kathryn V., . (2003) SARS-Associated Coronavirus. New England Journal of Medicine 348:20, 1948-1951
Full Text261
(2003) The Use of Corticosteroids in SARS. New England Journal of Medicine 348:20, 2034-2035
Full Text262
Drazen, Jeffrey M., Campion, Edward W., . (2003) SARS, the Internet, and the Journal. New England Journal of Medicine 348:20, 2029-2029
Full Text263
Brian Tomlinson, Clive Cockram. (2003) SARS: experience at Prince of Wales Hospital, Hong Kong. The Lancet 361:9368, 1486-1487
CrossRef264
Ann R Falsey, Edward E Walsh. (2003) Novel coronavirus and severe acute respiratory syndrome. The Lancet 361:9366, 1312-1313
CrossRef
- Letters
