Original Article
A Tyrosine Kinase Created by Fusion of the PDGFRA and FIP1L1 Genes as a Therapeutic Target of Imatinib in Idiopathic Hypereosinophilic Syndrome
N Engl J Med 2003; 348:1201-1214March 27, 2003
- Abstract
Background
Idiopathic hypereosinophilic syndrome involves a prolonged state of eosinophilia associated with organ dysfunction. It is of unknown cause. Recent reports of responses to imatinib in patients with the syndrome suggested that an activated kinase such as ABL, platelet-derived growth factor receptor (PDGFR), or KIT, all of which are inhibited by imatinib, might be the cause.
Methods
We treated 11 patients with the hypereosinophilic syndrome with imatinib and identified the molecular basis for the response.
Results
Nine of the 11 patients treated with imatinib had responses lasting more than three months in which the eosinophil count returned to normal. One such patient had a complex chromosomal abnormality, leading to the identification of a fusion of the Fip1-like 1 (FIP1L1) gene to the PDGFRα (PDGFRA) gene generated by an interstitial deletion on chromosome 4q12. FIP1L1-PDGFRα is a constitutively activated tyrosine kinase that transforms hematopoietic cells and is inhibited by imatinib (50 percent inhibitory concentration, 3.2 nM). The FIP1L1-PDGFRA fusion gene was subsequently detected in 9 of 16 patients with the syndrome and in 5 of the 9 patients with responses to imatinib that lasted more than three months. Relapse in one patient correlated with the appearance of a T674I mutation in PDGFRA that confers resistance to imatinib.
Conclusions
The hypereosinophilic syndrome may result from a novel fusion tyrosine kinase — FIP1L1-PDGFRα — that is a consequence of an interstitial chromosomal deletion. The acquisition of a T674I resistance mutation at the time of relapse demonstrates that FIP1L1-PDGFRα is the target of imatinib. Our data indicate that the deletion of genetic material may result in gain-of-function fusion proteins.
Media in This Article
Figure 1
Detection of the Fusion Gene Formed by the Genes for Fip1-like 1 (FIP1L1) and Platelet-Derived Growth Factor Receptor α (PDGFRA).Figure 2
The Fip1-like 1 (FIP1L1)–Platelet-Derived Growth Factor Receptor α (PDGFRα) Fusion Protein (Panel A) and the Resistance Mutation in Patient 5 (Panels B and C).Article Activity
- Article
The hypereosinophilic syndrome is a rare hematologic disorder with sustained overproduction of eosinophils in the bone marrow, eosinophilia, tissue infiltration, and organ damage. The diagnosis is based on the criteria of Chusid et al.1: sustained eosinophilia (more than 1500 eosinophils per cubic millimeter) for more than six months; the absence of other causes of eosinophilia, including parasitic infections and allergies; and signs and symptoms of organ involvement, most frequently the heart, the central and peripheral nervous system, the lungs, and the skin. The syndrome is more common in men than women (ratio, 9:1) and occurs predominantly between the ages of 20 and 50 years. Total leukocyte counts are usually less than 25,000 per cubic millimeter, with 30 to 70 percent eosinophils. Bone marrow eosinophils are increased (30 to 60 percent), but myeloblasts are usually not.2 It has been difficult to assess the clonality of the hypereosinophilic syndrome, but some cases are clonally derived, as demonstrated by clonal karyotypic abnormalities and X-inactivation assays.3,4
Treatment of the hypereosinophilic syndrome attempts to limit organ damage by controlling the eosinophil count and includes prednisone, hydroxyurea, interferon alfa, and cytotoxic chemotherapy. In most cases, however, the disorder is fatal. Recently, it was reported that four of five cases responded to imatinib mesylate (Gleevec, Novartis).5 Imatinib, a 2-phenylaminopyrimidine–based tyrosine kinase inhibitor,6 has been approved for the treatment of BCR-ABL–positive chronic myeloid leukemia (CML) and acute lymphoblastic leukemia.7,8 Besides the ABL tyrosine kinase, imatinib also inhibits the type III transmembrane receptors KIT and platelet-derived growth factor receptor (PDGFR) β.6,9,10 Hence, imatinib is also a promising new treatment for gastrointestinal stromal tumors, which frequently harbor activating mutations in the KIT gene,11,12 and chronic myeloproliferative diseases with rearrangements of the gene for PDGFRβ (PDGFRB).13 The clinical response to imatinib suggests that the hypereosinophilic syndrome may also be associated with constitutive activation of ABL, KIT, PDGFR, or an as yet unidentified target. Therefore, we evaluated the response to imatinib in patients with the hypereosinophilic syndrome and the molecular basis of the response.
Methods
Patients and Treatment
The study was conducted from June 2001 to October 2002. We studied 16 patients who had received a diagnosis of the hypereosinophilic syndrome and 1 who had acute myelogenous leukemia with marrow fibrosis that developed from a rapidly progressive hypereosinophilic myeloproliferative disorder (Table 1Table 1
Characteristics of 17 Patients with the Hypereosinophilic Syndrome (HES).). Only Patients 1 through 11, who had symptomatic disease, were treated with imatinib, at a dose of 100 to 400 mg per day. Patients 12 through 17 were not treated with imatinib. No patient concurrently received cytotoxic therapy.Written informed consent was obtained for the prospective accrual of clinical data and the collection of biologic specimens for analysis of genes known to be inhibited by imatinib. Complete hematologic remission was defined by a white-cell count of less than 10,000 per cubic millimeter, a platelet count of more than 100,000 per cubic millimeter, the presence of fewer than 5 percent eosinophils in the peripheral blood and bone marrow, the absence of blasts and promyelocytes in the peripheral blood, and the absence of extramedullary involvement.
Fluorescence in Situ Hybridization
Fluorescence in situ hybridization was performed as described previously.14 Probes were obtained from the Roswell Park Cancer Institute libraries RPCI6 and RPCI11 (http://www.chori.org/BACPAC).
Rapid Amplification of Complementary DNA Ends
Trizol (Invitrogen) was used to extract RNA from white cells. DNA was extracted with use of the QIAmp DNA blood Maxi Kit (Qiagen). First-strand complementary DNA (cDNA) was synthesized from 2 μg of total RNA with the use of the Superscript first-strand synthesis system (Invitrogen) with a gene-specific primer or random primers. Rapid amplification of cDNA ends was performed as previously described15 with primers PDGFRA-R1 for cDNA synthesis and PDGFRA-R2 and PDGFRA-R3 for a nested polymerase chain reaction (PCR).
PCR Assay
Fusion of the Fip1-like 1 (FIP1L1) gene to the PDGFRα (PDGFRA) gene was confirmed on cDNA by nested PCR with the use of primer pairs FIP1L1-F4 and PDGFRA-R1 and FIP1L1-F5 and PDGFRA-R2. The reciprocal fusion was detected with the use of primer pairs PDGFRA-F5 and FIP1L1-R1 and PDGFRA-F3 and FIP1L1-R2. Amplification of the fusion gene at the DNA level was performed with use of the Expand Long template PCR system (Roche). For mutation analysis of the FIP1L1-PDGFRA fusion gene in Patient 5, the gene was amplified with primers FIP1L1-F5 and PDGFRA-R12. Exon 15 of PDGFRA was amplified with primers PDGFRA-F14 and PDGFRA-R15. PCR products were cloned in a pGEM-T-easy plasmid (Promega) and sequenced with use of an ABI sequencer (Perkin Elmer). Long-distance inverse PCR was performed as previously described,16 with use of an AseI digest (New England Biolabs) and primer pairs LDI1 and PDGFRA-R2 in the first PCR and LDI2 and PDGFRA-R3 in the nested PCR.
Constructs
The open reading frame of the FIP1L1-PDGFRA fusion gene was amplified by PCR from cDNA from Patient 1 with use of the proofreading enzyme HF-2 (Clontech) and primers FIP1L1-Fc and PDGFRA-Rc. This PCR product was cloned in the retroviral vector MSCV-EGFP (kindly provided by W. Pear, University of Pennsylvania). Constructs with point mutations, constructs with deletion mutations, and epitope-tagged constructs were obtained by PCR from the FIP1L1-PDGFRA clone and cloned into MSCV-EGFP. Similarity searches were performed with use of the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST).
Cell Culture
293T cells were grown in Dulbecco's modified Eagle's medium with 10 percent fetal-calf serum, and Ba/F3 cells were grown in RPMI medium with 10 percent fetal-calf serum and 1 ng of mouse interleukin-3 per milliliter. Production of retroviral supernatant and transduction have been described previously.17 Interleukin-3–independent growth was assessed by plating transduced Ba/F3 cells in interleukin-3–free medium, after the cells were washed three times in phosphate-buffered saline. Imatinib was stored as a 10 mM stock solution in water and diluted in RPMI medium for use. For Western blotting, Ba/F3 cells were incubated in the presence of imatinib for 90 minutes before lysis. For dose–response curves, Ba/F3 cells were incubated for 24 hours in the presence of imatinib, and the number of viable cells at the start and at the end was determined with the Celltiter96AQueousOne solution proliferation assay (Promega). Dose–response curves were fitted with use of OriginPro 6.1 software (OriginLab).
Western Blotting
Immunoprecipitation was performed with use of anti-MYC antibody (Cell Signaling) and protein G agarose (Roche). Each procedure involved 6 million Ba/F3 cells with stable expression of MYC-tagged wild-type FIP1L1-PDGFRα fusion protein or the T674I mutant. Cells were lysed in lysis buffer (Cell Signaling) containing 1 mM sodium orthovanadate, 20 μM phenylarsine oxide (Calbiochem), and protease inhibitors (complete tablets, Roche). For Western blotting, Ba/F3 cells were collected, lysed in loading buffer (Cell Signaling), separated by sodium dodecyl sulfate–polyacrylamide-gel electrophoresis, and transferred to membranes. The following antibodies were used: anti-phospho-ERK1/2, anti-phospho-STAT5 and antiphosphotyrosine (P-Tyr-100/102, Cell Signaling), anti-PDGFRα (Upstate), anti-STAT5b (Santa-Cruz), antimouse peroxidase, and antirabbit peroxidase (Amersham Pharmacia Biotech). Detection was performed with use of the Western Lightning system (Perkin Elmer).
Primers
The following primers were used: PDGFRA-F3, 5'gagcgagaaccgagagctc; PDGFRA-F5, 5'caaagtggaggagaccatcg; PDGFRA-F14, 5'gaacattgtaaacttgctggg; PDGFRA-R1, 5'tgagagcttgtttttcactgga; PDGFRA-R2, 5'gggaccggcttaatccatag; PDGFRA-R3, 5'ggctgttccttcaaccacct; PDGFRA-R12, 5'catagctccgtgctttca; PDGFRA-R15, 5'catagctccgtgtgctttca; PDGFRA-Rc, 5'cgaattcccagttacaggaagctgtct; FIP1L1-Fc, 5'tggatcccggccatgtcggccggcgag; FIP1L1-F4, 5'acctggtgctgatctttctgat; FIP1L1-F5, 5'aaagaggatacgaatgggacttg; FIP1L1-R1, 5'agtgctgacagtcggaggag; FIP1L1-R2, 5'gagctcctggagggaaaaac; LDI1, 5'gaacgtacgatgtttggtttcca; LDI2, 5'gtctctaatcccatccaggttgc; GAPDH-F, 5'tggaaatcccatcaccatct; and GAPDH-R, 5'gtcttctgggtggcagtgat.
Results
Response to Imatinib in Patients with Hypereosinophilic Syndrome
The median age of the 11 patients (9 men and 2 women) who received imatinib was 46 years (range, 28 to 61) (Table 1). Prior therapies included corticosteroids in 9, hydroxyurea in 10, interferon alfa in 5, cytotoxic chemotherapy in 2, cyclosporine in 1, and radiotherapy for extramedullary disease in 2. Patients had one or more of the following: endomyocardial fibrosis or restrictive cardiomyopathy, gastrointestinal involvement, central nervous system or paraspinal disease, pulmonary involvement, skin involvement, hepatosplenomegaly, and thrombosis. The median eosinophil count at presentation was 14,500 per cubic millimeter (range, 4960 to 53,000). Nine patients had a normal karyotype; one patient had t(1;4)(q44;q12), and the patient with leukemia had trisomy 8, trisomy 19, add2q, and del6q. All patients were BCR-ABL–negative on cytogenetic analysis or fluorescence in situ hybridization. Imatinib was initiated at doses ranging from 100 to 400 mg daily. A complete hematologic remission was achieved in 10 of 11 patients after a median of 4 weeks (range, 1 to 12), although 1 of the 10 had only a transient response, which lasted several weeks, and had no response to an increased dose of imatinib. The response lasted more than 3 months in the other nine patients (median duration, 7 months; range, 3 to 15). Analysis of a bone marrow aspirate and biopsy specimen obtained before therapy from Patient 5, who had a response, showed hypereosinophilia, with the large hypolobated eosinophils characteristic of the hypereosinophilic syndrome. After therapy, there was extensive necrosis, Charcot–Leyden crystals, and patchy, normal hematopoiesis. This patient relapsed at five months, with recurrent cytogenetic abnormalities.
Cloning of FIP1L1-PDGFRA
Patient DNA was analyzed for activating mutations in known targets of imatinib: PDGFRA, PDGFRB, and KIT.6,9,10 No mutations were found in exons encoding the activation loops or juxtamembrane domains (data not shown). One patient (Patient 1) had t(1;4) (q44;q12). The combination of this patient's response to imatinib and translocation at 4q12, a region where PDGFRA and KIT are located, prompted investigation of their involvement. Fluorescence in situ hybridization showed that a probe spanning the KIT locus (586A2) was translocated to the der(1) chromosome, indicating that the break point was centromeric to KIT. A probe at the CHIC2 locus (200D9), centromeric to PDGFRA, 18 was deleted (Figure 1BFigure 1
Detection of the Fusion Gene Formed by the Genes for Fip1-like 1 (FIP1L1) and Platelet-Derived Growth Factor Receptor α (PDGFRA).). Taken together, these results indicated the presence of a translocation associated with a deletion on 4q12 with a break point near PDGFRA.To determine whether a chimeric PDGFRA transcript was present, we performed 5' rapid amplification of cDNA ends on the sequence, encoding the kinase domain of PDGFRA.19 Sequence analysis of the resultant products revealed that the kinase domain of PDGFRA was fused to an uncharacterized gene (GenBank accession number NM_030917), encoding a putative 520-amino-acid protein that most closely resembled Fip1, an essential component of the Saccharomyces cerevisiae polyadenylation machinery.20 Therefore, we named the human gene FIP1L1 (Fip1-like 1). According to data from Expressed Sequence Tags (http://www.ncbi.nlm.nih.gov/dbEST) and Ensembl (http://www.ensembl.org), FIP1L1 is widely expressed and undergoes alternative splicing. The FIP1L1-PDGFRA fusion gene was in-frame and fused the first 233 amino acids of FIP1L1 to the last 523 amino acids of PDGFRα (Figure 1 and Figure 2Figure 2
The Fip1-like 1 (FIP1L1)–Platelet-Derived Growth Factor Receptor α (PDGFRα) Fusion Protein (Panel A) and the Resistance Mutation in Patient 5 (Panels B and C).).Surprisingly, FIP1L1 was not located on chromosome 1, as might have been expected owing to a reciprocal translocation, but was approximately 800 kb upstream of PDGFRA on 4q12 (NCBI contig NT_022853) (Figure 3Figure 3
Genomic Structure of the 4q12 Chromosomal Region.). Taken together, this information indicated that the fusion gene was created by either del(4)(q12) or t(4;4)(q12;q12) rather than t(1;4)(q44;q12). The fusion of FIP1L1 and PDGFRA was confirmed by reverse-transcriptase–PCR on RNA and PCR on DNA from Patient 1 (Figure 1D and Figure 4AFigure 4
Genomic Break Points (Panels A and B) and Splicing (Panel C) of the Gene for Fip1-like 1 (FIP1L1) to the Gene for Platelet-Derived Growth Factor Receptor α (PDGFRA).). The reciprocal PDGFRA-FIP1L1 fusion gene was not detected in RNA or DNA, strongly suggesting that the fusion was the consequence of an interstitial deletion (Figure 1D and Figure 4A).Incidence of FIP1L1-PDGFRA in the Hypereosinophilic Syndrome
An additional four of nine patients for whom pretreatment RNA or DNA was available had the FIP1L1-PDGFRA fusion gene. Four of six patients with the hypereosinophilic syndrome who did not receive imatinib were also found to have the gene on the basis of RNA or DNA analysis (Figure 1 and Figure 4). Thus, the FIP1L1-PDGFRA fusion gene occurred in 9 of our 16 patients (56 percent).
Sequence analysis of DNA from peripheral-blood samples from seven of nine patients with the fusion gene confirmed that all break points in PDGFRA occurred in exon 12 and that cryptic splice sites were used within introns of FIP1L1 or within exon 12 of PDGFRA, to allow splicing between exons of FIP1L1 and the interrupted exon 12 of PDGFRA (Figure 4). Attempts to amplify the reciprocal fusion genes on RNA and DNA were unsuccessful, indicating that all fusions were the result of a deletion on 4q12 and not of t(4;4) (Figure 1 and Figure 4).
Relapse during Imatinib Treatment Associated with an Acquired Mutation in PDGFRA
Patient 5, who relapsed during imatinib treatment, harbored the FIP1L1-PDGFRA fusion gene initially and at the time of relapse. We hypothesized that relapse might be attributable to mutations in the PDGFRα moiety that conferred resistance to imatinib. Sequence analysis of the PDGFRα kinase domain at the time of relapse showed that the fusion protein had acquired a T674I mutation (Figure 2B). This mutation occurred in the ATP-binding region of PDGFRα at the same position as the T315I mutation in BCR-ABL21,22 (Figure 2C), which is known to confer resistance to imatinib in that context.21-23
Effect of FIP1L1-PDGFRα
The expression of FIP1L1-PDGFRα transformed the murine hematopoietic cell line Ba/F3 to interleukin-3–independent growth (Figure 5BFigure 5
Transformation, Inhibition, and Signal Transduction Properties of the Fusion Tyrosine Kinase Formed by Fip1-like 1 (FIP1L1) and Platelet-Derived Growth Factor Receptor α (PDGFRα).) and was constitutively tyrosine-phosphorylated in these cells (Figure 5D). Deletion of the FIP1L1 moiety (amino acids 4 to 233) abrogated this type of growth, indicating that this part of the fusion protein was essential for the activation of the chimeric kinase. Further mutational analysis showed that the first 29 amino acids of FIP1L1 (encoded by exon 1) were necessary and sufficient to activate the PDGFRα kinase domain (Figure 5B). Analysis of the phosphorylation status of ERK1 or ERK2 and STAT5 indicated that STAT5, but not ERK, was a downstream target of FIP1L1-PDGFRα (Figure 5E, and data not shown).Inhibition of FIP1L1-PDGFRα Kinase Activity and Resistance to Imatinib
To confirm that FIP1L1-PDGFRα was a target of imatinib, we tested the effect of imatinib on the growth of Ba/F3 cells expressing FIP1L1-PDGFRα or FIP1L1-PDGFRα harboring the T674I mutation (Figure 5C). Ba/F3 cells expressing FIP1L1-PDGFRα were efficiently inhibited by much lower concentrations of imatinib than Ba/F3 cells expressing BCR-ABL. The concentration of imatinib required to inhibit cells transformed by FIP1L1-PDGFRα by 50 percent (IC50) was 3.2 nM, whereas the IC50 for BCR-ABL was 582 nM.23 These data indicate that FIP1L1-PDGFRα is more sensitive to inhibition by imatinib than is BCR-ABL and correlate with the findings that the effective dose of imatinib is lower in patients with the hypereosinophilic syndrome (100 mg per day) than in patients with BCR-ABL–positive CML (300 to 400 mg per day). As compared with Ba/F3 cells expressing wild-type FIP1L1-PDGFRα, Ba/F3 cells expressing the FIP1L1-PDGFRα T674I mutant were more than 1000 times as resistant to imatinib, with a cellular IC50 of 7498 nM (Figure 5C).
Consistent with these findings, imatinib inhibited tyrosine phosphorylation of FIP1L1-PDGFRα and its downstream target STAT5 with an IC50 of approximately 5 nM (Figure 5D and Figure 5E, respectively), whereas inhibition of the T674I mutant required concentrations of imatinib that were at least 1000 times as high (10,000 and 5000 nM, respectively) (Figure 5F and Figure 5G). STAT5 phosphorylation was restored by the addition of interleukin-3 (Figure 5E and Figure 5G), demonstrating the specificity of imatinib in this context. Taken together, these data demonstrate that the PDGFRα kinase domain is a direct target of imatinib in patients with the hypereosinophilic syndrome.
Discussion
Constitutive activation of tyrosine kinases is a key element in the pathogenesis of myeloproliferative diseases. In most cases the mutant kinases have been identified by cloning recurrent chromosomal translocation break points. Examples include the BCR-ABL,24 ETV6-PDGFRβ,25 HIP1-PDGFRβ,26 ETV6-JAK2,27 and H4-PDGFRβ28 fusion proteins. The hypereosinophilic syndrome is a myeloproliferative syndrome, but most patients present with an apparently normal karyotype. We found a gene rearrangement, which is not evident on standard karyotyping, that results in a novel FIP1L1-PDGFRα fusion protein.
The FIP1L1-PDGFRA gene rearrangement is a clonal abnormality that raises several questions about the classification of eosinophilic syndromes. World Health Organization (WHO) criteria indicate that patients with clonally derived eosinophils should be classified as having chronic eosinophilic leukemia rather than the hypereosinophilic syndrome. On the basis of these criteria, at least seven of our patients with the hypereosinophilic syndrome should be reclassified as having chronic eosinophilic leukemia. Furthermore, it is plausible that most patients with the hypereosinophilic syndrome, or at least those with imatinib-sensitive disease, will have clonally derived eosinophils. It may therefore be appropriate to reevaluate the WHO classification in the light of our observations.
Several lines of evidence argue that the FIP1L1-PDGFRα fusion protein is a cause of the hypereosinophilic syndrome. First, it was found in a majority of our patients and has the biologic properties of other tyrosine kinase fusion proteins that are implicated in the pathogenesis of myeloproliferative disease. Second, most patients with the hypereosinophilic syndrome had a response to imatinib, a potent inhibitor of PDGFRα, PDGFRβ, KIT, and ABL.10 Most such patients have a response to lower doses of imatinib than those required for the induction of hematologic and cytogenetic responses in patients with BCR-ABL–positive CML (e.g., 100 mg daily vs. 400 mg daily).8 This difference correlates with the lower IC50 of FIP1L1-PDGFRα than BCR-ABL. Third, clinical relapse and resistance to imatinib in a patient with the hypereosinophilic syndrome were associated with the acquisition of a point mutation in the ATP-binding domain of the FIP1L1-PDGFRα fusion protein that confers resistance to imatinib. The T674I substitution is analogous to the T315I mutation in the ABL kinase that occurs in some patients with BCR-ABL–positive CML in whom resistance to imatinib develops21 and thus demonstrates that FIP1L1-PDGFRα is the therapeutic target of imatinib in the hypereosinophilic syndrome.
Nine of 11 patients with the hypereosinophilic syndrome had responses to imatinib that lasted more than three months, but only 5 of these 9 had a detectable FIP1L1-PDGFRA fusion. The basis for a response to imatinib in the other four patients is not known, but there are several possibilities. First, break points for the deletion may be widely distributed within the FIP1L1 gene. Our biochemical data indicate that a deletion that incorporated only the first exon of FIP1L1 would be sufficient to activate the PDGFRα kinase domain. However, reverse-transcriptase–PCR screening for such FIP1L1-PDGFRA variants was negative in these patients. Second, another gene near FIP1L1 could form a fusion protein with PDGFRα. Detailed fluorescence in situ hybridization with probes that span the deleted region will resolve this question, but we have not yet identified alternative fusion partners for PDGFRA. Third, in some patients with the hypereosinophilic syndrome, the KIT gene, located approximately 400 kb downstream of PDGFRA, may be fused to FIP1L1. KIT is also sensitive to imatinib10; thus, a FIP1L1-KIT fusion protein in patients with the hypereosinophilic syndrome should also result in a clinical response. However, we have been unable to identify such a FIP1L1-KIT fusion gene in the four patients who had a response to imatinib but who did not have the FIP1L1-PDGFRA fusion gene. Fourth, a similar, cytogenetically silent gene rearrangement may occur, involving either ABL or PDGFRβ in some patients. Finally, an as yet unidentified kinase that is inhibited by imatinib may be constitutively activated by a mutation. Further analysis will be required to evaluate these possibilities.
Cloning of the FIP1L1-PDGFRA gene rearrangement identified chromosomal interstitial deletion as a novel molecular mechanism for a gain-of-function fusion gene. Most investigations of the loss of heterozygosity in human tumors have focused on the loss of function of one or both alleles of a putative tumor-suppressor gene. Our data suggest that a comprehensive analysis of human tumors for small deletions that may result in gain-of-function fusion genes should be undertaken.
Supported in part by grants from the National Institutes of Health (CA66996 and DK50654, to Dr. Gilliland; T32GMO7753-24, to Ms. Stover; and K23HL04409, to Dr. Gotlib); by a grant from the Leukemia and Lymphoma Society (to Dr. Gilliland); by a grant from the Fonds voor Wetenschappelijk Onderzoek-Vlaanderen (G.0121.00, to Dr. Marynen); and by the Belgian American Educational Foundation and the Commission for Educational Exchange between the United States and Belgium. Dr. Cools is a postdoctoral researcher and Dr. Vandenberghe is a senior clinical investigator of the Fonds voor Wetenschappelijk Onderzoek-Vlaanderen. Dr. Gilliland is an Associate Investigator of the Howard Hughes Medical Institute.
Drs. Cools and DeAngelo contributed equally to this article.
We are indebted to Ursula Pluys, Riet Somers, and Alexis Bywater for technical and administrative assistance, and to Marie Maerevoet, M.D., Lucienne Michaux, M.D., and Achiel Vanhoof, M.D. for contribution of patient samples and clinical care.
Source Information
From Brigham and Women's Hospital and Harvard Medical School, Boston (J. Cools, E.H.S., J.K., J. Clark, D.G.G.); the Dana–Farber Cancer Institute, Boston (D.J.D., J. Clark, I.G., J.D.G., R.S., D.G.G.); Stanford University School of Medicine, Stanford, Calif. (J.G., J.M., S.L.S., S.E.C.); Women and Infants Hospital, Brown University School of Medicine, Providence, R.I., and Westerly Hospital, Westerly, R.I. (R.D.L.); M.D. Anderson Cancer Center, Houston (J. Cortes, H.K.); the Wessex Regional Genetics Laboratory, Salisbury, United Kingdom (N.C.P.C.); Mayo Clinic, Rochester, Minn. (A.T.); National Jewish Medical and Research Center, Denver (R.A.); Tulane University School of Medicine, New Orleans (J.S.); Yale University School of Medicine, New Haven, Conn. (M.R.); University Hospital Leuven, Leuven, Belgium (P.V., G.V., M.B.); Flanders Interuniversity Institute for Biotechnology, Leuven, Belgium (J. Cools, P.M.); Center for Human Genetics, Leuven, Belgium (I.W.); and Howard Hughes Medical Institute, Brigham and Women's Hospital, Boston (D.G.G.).
Address reprint requests to Dr. Gilliland at the Harvard Institutes of Medicine, 4 Blackfan Cir., Rm. 418, Boston, MA 02115 (gilliland@hihg.med.harvard.edu) or to Dr. Stone at the Dana–Farber Cancer Institute, 44 Binney St., Boston, MA 02115 (rstone@partners.org).
- References
References
1
Chusid MJ ,Dale DC ,West BC ,Wolff SM . The hypereosinophilic syndrome: analysis of fourteen cases with review of the literature. Medicine (Baltimore) 1975;54:1-27
CrossRef | Web of Science | Medline2
Weller PF ,Bubley GJ . The idiopathic hypereosinophilic syndrome. Blood 1994;83:2759-2779
Web of Science | Medline3
Luppi M ,Marasca R ,Morselli M ,Barozzi P ,Torelli G . Clonal nature of hypereosinophilic syndrome. Blood 1994;84:349-350
Web of Science | Medline4
Chang HW ,Leong KH ,Koh DR ,Lee SH . Clonality of isolated eosinophils in the hypereosinophilic syndrome. Blood 1999;93:1651-1657
Web of Science | Medline5
Gleich GJ ,Leiferman KM ,Pardanani A ,Tefferi A ,Butterfield JH . Treatment of hypereosinophilic syndrome with imatinib mesilate. Lancet 2002;359:1577-1578
CrossRef | Web of Science | Medline6
Buchdunger E ,Zimmermann J ,Mett H , et al. Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a 2-phenylaminopyrimidine derivative. Cancer Res 1996;56:100-104
Web of Science | Medline7
Druker BJ ,Sawyers CL ,Kantarjian H , et al. Activity of a specific inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome. N Engl J Med 2001;344:1038-1042[Erratum, N Engl J Med 2001;345:232.]
Full Text | Web of Science | Medline8
Druker BJ ,Talpaz M ,Resta DJ , et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med 2001;344:1031-1037
Full Text | Web of Science | Medline9
Carroll M ,Ohno-Jones S ,Tamura S , et al. CGP 57148, a tyrosine kinase inhibitor, inhibits the growth of cells expressing BCR-ABL, TEL-ABL, and TEL-PDGFR fusion proteins. Blood 1997;90:4947-4952
Web of Science | Medline10
Buchdunger E ,Cioffi CL ,Law N , et al. Abl protein-tyrosine kinase inhibitor STI571 inhibits in vitro signal transduction mediated by c-kit and platelet-derived growth factor receptors. J Pharmacol Exp Ther 2000;295:139-145
Web of Science | Medline11
Tuveson DA ,Willis NA ,Jacks T , et al. STI571 inactivation of the gastrointestinal stromal tumor c-KIT oncoprotein: biological and clinical implications. Oncogene 2001;20:5054-5058
CrossRef | Web of Science | Medline12
Demetri GD ,von Mehren M ,Blanke CD , et al. Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors. N Engl J Med 2002;347:472-480
Full Text | Web of Science | Medline13
Apperley JF ,Gardembas M ,Melo JV , et al. Response to imatinib mesylate in patients with chronic myeloproliferative diseases with rearrangements of the platelet-derived growth factor receptor beta. N Engl J Med 2002;347:481-487
Full Text | Web of Science | Medline14
Dierlamm J ,Wlodarska I ,Michaux L , et al. Successful use of the same slide for consecutive fluorescence in situ hybridization experiments. Genes Chromosomes Cancer 1996;16:261-264
CrossRef | Web of Science | Medline15
Cools J ,Bilhou-Nabera C ,Wlodarska I , et al. Fusion of a novel gene, BTL, to ETV6 in acute myeloid leukemias with a t(4;12) (q11-q12;p13). Blood 1999;94:1820-1824
Web of Science | Medline16
Willis TG ,Jadayel DM ,Coignet LJ , et al. Rapid molecular cloning of rearrangements of the IGHJ locus using long-distance inverse polymerase chain reaction. Blood 1997;90:2456-2464
Web of Science | Medline17
Schwaller J ,Frantsve J ,Aster J , et al. Transformation of hematopoietic cell lines to growth-factor independence and induction of a fatal myelo- and lymphoproliferative disease in mice by retrovirally transduced TEL/JAK2 fusion gene. EMBO J 1998;17:5321-5333
CrossRef | Web of Science | Medline18
Cools J ,Mentens N ,Odero MD , et al. Evidence for position effects as a variant ETV6-mediated leukemogenic mechanism in myeloid leukemias with a t(4;12) (q11-q12;p13) or t(5;12)(q31;p13). Blood 2002;99:1776-1784
CrossRef | Web of Science | Medline19
Kawagishi J ,Kumabe T ,Yoshimoto T ,Yamamoto T . Structure, organization, and transcription units of the human alpha-platelet-derived growth factor receptor gene, PDGFRA. Genomics 1995;30:224-232
CrossRef | Web of Science | Medline20
Preker PJ ,Lingner J ,Minvielle-Sebastia L ,Keller W . The FIP1 gene encodes a component of a yeast pre-mRNA polyadenylation factor that directly interacts with poly(A) polymerase. Cell 1995;81:379-389
CrossRef | Web of Science | Medline21
Gorre ME ,Mohammed M ,Ellwood K , et al. Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science 2001;293:876-880
CrossRef | Web of Science | Medline22
Shah NP ,Nicoll JM ,Nagar B , et al. Multiple BCR-ABL kinase domain mutations confer polyclonal resistance to the tyrosine kinase inhibitor imatinib (STI571) in chronic phase and blast crisis chronic myeloid leukemia. Cancer Cell 2002;2:117-125
CrossRef | Web of Science | Medline23
Roumiantsev S ,Shah NP ,Gorre ME , et al. Clinical resistance to the kinase inhibitor STI-571 in chronic myeloid leukemia by mutation of Tyr-253 in the Abl kinase domain P-loop. Proc Natl Acad Sci U S A 2002;99:10700-10705
CrossRef | Web of Science | Medline24
de Klein A ,van Kessel AG ,Grosveld G , et al. A cellular oncogene is translocated to the Philadelphia chromosome in chronic myelocytic leukaemia. Nature 1982;300:765-767
CrossRef | Web of Science | Medline25
Golub TR ,Barker GF ,Lovett M ,Gilliland DG . Fusion of PDGF receptor beta to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation. Cell 1994;77:307-316
CrossRef | Web of Science | Medline26
Ross TS ,Bernard OA ,Berger R ,Gilliland DG . Fusion of Huntingtin interacting protein 1 to platelet-derived growth factor beta receptor (PDGFbetaR) in chronic myelomonocytic leukemia with t(5;7) (q33;q11.2). Blood 1998;91:4419-4426
Web of Science | Medline27
Peeters P ,Raynaud SD ,Cools J , et al. Fusion of TEL, the ETS-variant gene 6 (ETV6), to the receptor-associated kinase JAK2 as a result of t(9;12) in a lymphoid and t(9;15;12) in a myeloid leukemia. Blood 1997;90:2535-2540
Web of Science | Medline28
Schwaller J ,Anastasiadou E ,Cain D , et al. H4(D10S170), a gene frequently rearranged in papillary thyroid carcinoma, is fused to the platelet-derived growth factor receptor beta gene in atypical chronic myeloid leukemia with t(5;10)(q33;q22). Blood 2001;97:3910-3918
CrossRef | Web of Science | Medline
- Citing Articles (535)
Citing Articles
1
April Chiu, Attilio Orazi. (2012) Mastocytosis and related disorders. Seminars in Diagnostic Pathology 29:1, 19-30
CrossRef2
E Lierman, S Smits, J Cools, B Dewaele, M Debiec-Rychter, P Vandenberghe. (2012) Ponatinib is active against imatinib resistant mutants of FIP1L1-PDGFRA and KIT, and against FGFR1-derived fusion kinases. Leukemia
CrossRef3
Lisa M McGinnis, Calvin J Kuo. (2012) PDGF-B exploits stromal EPO. Nature Medicine 18:1, 22-24
CrossRef4
Neil O Carragher, Asier Unciti-Broceta, David A Cameron. (2012) Advancing cancer drug discovery towards more agile development of targeted combination therapies. Future Medicinal Chemistry 4:1, 87-105
CrossRef5
Carrie L. Kitko, Eric S. White, Kristin Baird. (2012) Fibrotic and Sclerotic Manifestations of Chronic Graft-versus-Host Disease. Biology of Blood and Marrow Transplantation 18:1, S46-S52
CrossRef6
Arian Laurence, Kamran Ghoreschi, Kiyoshi Hirahara, Xiangping Yang, John J. O'Shea. (2012) Therapeutic inhibition of the Janus kinases. Inflammation and Regeneration 32:1, 016-022
CrossRef7
Nasim Valizadeh. (2011) Chromosomal mosaicism for inversion of chromosome 3(p25, p26) in a case of idiopathic hypereosinophilic syndrome (IHES). Indian Journal of Hematology and Blood Transfusion
CrossRef8
Jocelyn Celestin, Marianne Frieri. (2011) Eosinophilic Disorders in Various Diseases. Current Allergy and Asthma Reports
CrossRef9
Huan-You Wang, John A. Thorson, H. Elizabeth Broome, Hooman H. Rashidi, Peter T. Curtin, Marie L. Dell'Aquila. (2011) t(4;22)(q12;q11.2) involving presumptive platelet-derived growth factor receptor A and break cluster region in a patient with mixed phenotype acute leukemia. Human Pathology 42:12, 2029-2036
CrossRef10
J. Vardiman, E. Hyjek. (2011) World Health Organization Classification, Evaluation, and Genetics of the Myeloproliferative Neoplasm Variants. Hematology 2011:1, 250-256
CrossRef11
A. D. Klion. (2011) Eosinophilic Myeloproliferative Disorders. Hematology 2011:1, 257-263
CrossRef12
John Anastasi. (2011) The myeloproliferative neoplasms including the eosinophilia-related myeloproliferations associated with tyrosine kinase mutations: changes and issues in classification and diagnosis criteria. Seminars in Diagnostic Pathology 28:4, 304-313
CrossRef13
C. Feld, H. Spangenberger, J. Böhm, D. Meuthen, I. Meuthen. (2011) 76-jähriger Patient mit nicht bestätigtem Verdacht auf „idiopathische Myelofibrose“. Der Internist 52:11, 1346-1350
CrossRef14
Evans R. Fernández Pérez, Amy L. Olson, Stephen K. Frankel. (2011) Eosinophilic Lung Diseases. Medical Clinics of North America 95:6, 1163-1187
CrossRef15
Didem Ozdemir, Selcuk Dagdelen, Tomris Erbas. (2011) Systemic Mastocytosis. The American Journal of the Medical Sciences 342:5, 409-415
CrossRef16
Kathryn A. Kolquist, Roger A. Schultz, Aubry Furrow, Theresa C. Brown, Jin-Yeong Han, Lynda J. Campbell, Meaghan Wall, Marilyn L. Slovak, Lisa G. Shaffer, Blake C. Ballif. (2011) Microarray-based comparative genomic hybridization of cancer targets reveals novel, recurrent genetic aberrations in the myelodysplastic syndromes. Cancer Genetics 204:11, 603-628
CrossRef17
Ailsa Holroyd, Nicholas C.P. Cross, Donald H. Macdonald. (2011) The two faces of myeloproliferative neoplasms: Molecular events underlying lymphoid transformation. Leukemia Research 35:10, 1279-1285
CrossRef18
Tracy I. George, Hans-Peter Horny. (2011) Systemic Mastocytosis. Hematology/Oncology Clinics of North America 25:5, 1067-1083
CrossRef19
Qixia Yuan, Jun Pang, Sjouke Mauw, Panuwat Trairatphisan, Monique Wiesinger, Thomas Sauter. (2011) A Study of the PDGF Signaling Pathway with PRISM. Electronic Proceedings in Theoretical Computer Science 67, 65-81
CrossRef20
Y. Sekkach, F. Mekouar, M. Jira, M. Elqatni, N. Elomri, J. Fatihi, M. Badaoui, S. Hammi, J. Smaali, A. El Khattabi, T. Amezyane, A. Abouzahir, D. Ghafir. (2011) Efficacité et rémission durables après traitement par imatinib mésylate pour une cardiomyopathie éosinophilique à transcrit FIP1L1–PDGFRA négatif. Annales Pharmaceutiques Françaises 69:5, 277-281
CrossRef21
E. S. Dellon, J. J. Bower, T. O. Keku, X. Chen, C. R. Miller, J. T. Woosley, R. C. Orlando, N. J. Shaheen. (2011) Markers of tyrosine kinase activity in eosinophilic esophagitis: a pilot study of the FIP1L1-PDGFRα fusion gene, pERK 1/2, and pSTAT5. Diseases of the Esophagusno-no
CrossRef22
G Metzgeroth, P Erben, H Martin, S Mousset, M Teichmann, C Walz, T Klippstein, A Hochhaus, N C P Cross, W-K Hofmann, A Reiter. (2011) Limited clinical activity of nilotinib and sorafenib in FIP1L1-PDGFRA positive chronic eosinophilic leukemia with imatinib-resistant T674I mutation. Leukemia
CrossRef23
Jason Gotlib. (2011) World Health Organization-defined eosinophilic disorders: 2011 update on diagnosis, risk stratification, and management. American Journal of Hematology 86:8, 677-688
CrossRef24
Sandrine Medves, Jean-Baptiste Demoulin. (2011) Tyrosine kinase gene fusions in cancer: translating mechanisms into targeted therapies. Journal of Cellular and Molecular Medicineno-no
CrossRef25
Constantin A. Dasanu, Steven Cohen, Frank Bauer. (2011) A curious case of a ‘burned-out’ hypereosinophilic syndrome. Leukemia Research 35:7, e141-e142
CrossRef26
Amy C. Anderson, Michael P. Pollastri, Celia A. Schiffer, Norton P. Peet. (2011) The challenge of developing robust drugs to overcome resistance. Drug Discovery Today
CrossRef27
Jesús M. Hernández, Isabel Granada, Francesc Solé. (2011) De la citogenética convencional al análisis por micromatrices. Cincuenta años del cromosoma Filadelfia. Medicina Clínica 137:5, 221-229
CrossRef28
F. Vandenbos, M. Figueredo, M.-C. Dumon-Gubeno, I. Nicolle, A. Tarhini, L.-D. Medioni, H. Naman, J. Mouroux. (2011) Hyperéosinophilie clonale révélée par une infection récurrente à Staphylococcus aureus. Revue de Pneumologie Clinique 67:3, 167-169
CrossRef29
Luis M. Schang. 2011. Cellular Protein Kinases as Antiviral Targets. , 305-347.
CrossRef30
J.-J. Kiladjian, R. A. Mesa, R. Hoffman. (2011) The renaissance of interferon therapy for the treatment of myeloid malignancies. Blood 117:18, 4706-4715
CrossRef31
Saskia Gueller, Sina Hehn, Verena Nowak, Sigal Gery, Hubert Serve, Christian H. Brandts, H. Phillip Koeffler. (2011) Adaptor protein Lnk binds to PDGF receptor and inhibits PDGF-dependent signaling. Experimental Hematology 39:5, 591-600
CrossRef32
Philip C. Amrein. (2011) The potential for dasatinib in treating chronic lymphocytic leukemia, acute myeloid leukemia, and myeloproliferative neoplasms. Leukemia & Lymphoma 52:5, 754-763
CrossRef33
Thomas Klag, Ulf Schnetzke, Rudolf Benz, Jürgen Zanow, Anita Glaser, Tudor C. Pörner, Sebastian Scholl, Andreas Reiter, Andreas Hochhaus, Paul Rosée. (2011) Leriche’s syndrome and Löffler endocarditis in a 30-year-old patient presenting with hypereosinophilic syndrome. Annals of Hematology
CrossRef34
Grzegorz Helbig, Andrzej Moskwa, Marek Hus, Jarosław Piszcz, Alina Swiderska, Alina Urbanowicz, Małgorzata Całbecka, Ilona Seferyńska, Małgorzata Raźny, Marek Rodzaj, Ewa Żuk, Sławomira Kyrcz-Krzemień. (2011) Durable remission after treatment with very low doses of imatinib for FIP1L1-PDGFRα-positive chronic eosinophilic leukaemia. Cancer Chemotherapy and Pharmacology 67:4, 967-969
CrossRef35
Jean-Yves Blay, Margaret von Mehren. (2011) Nilotinib: A Novel, Selective Tyrosine Kinase Inhibitor. Seminars in Oncology 38, S3-S9
CrossRef36
Animesh Pardanani. (2011) Systemic mastocytosis in adults: 2011 update on diagnosis, risk stratification, and management. American Journal of Hematology 86:4, 362-371
CrossRef37
Suzita M. Noor, Richard Bell, Alister C. Ward. (2011) Shooting the messenger: Targeting signal transduction pathways in leukemia and related disorders. Critical Reviews in Oncology/Hematology 78:1, 33-44
CrossRef38
S Schnittger, U Bacher, C Haferlach, T Alpermann, F Dicker, J Sundermann, W Kern, T Haferlach. (2011) Characterization of NPM1-mutated AML with a history of myelodysplastic syndromes or myeloproliferative neoplasms. Leukemia 25:4, 615-621
CrossRef39
Marek Hus, Grzegorz Helbig, Maria Cioch, Hanna Szczepanska-Szerej, Paweł Wieczorek, Magdalena Woźniak, Justyna Kozinska, Marta Morawska, Anna Dmoszynska, Slawomira Kyrcz-Krzemien, Dariusz Kata. (2011) Rapid reversal of quadraparesis in chronic eosinophilic leukaemia expressing the FIP1L1-PDGFRA transcript after therapy with imatinib. Leukemia Research 35:3, e15-e17
CrossRef40
J.-E. Kahn, Y. Schoindre, F. Legrand, O. Bletry, F. Ackermann. (2011) Hyperéosinophilies chroniques inexpliquées et syndromes hyperéosinophiliques. Revue des Maladies Respiratoires Actualités 3:2, 108-113
CrossRef41
I. Tillie-Leblond, J.–F. Bervar, A. Cortot. (2011) Poumon à éosinophiles : algorithme diagnostique. Revue des Maladies Respiratoires Actualités 3:2, 114-119
CrossRef42
N von Bubnoff, S P Gorantla, R A Engh, T M Oliveira, S Thöne, E Åberg, C Peschel, J Duyster. (2011) The low frequency of clinical resistance to PDGFR inhibitors in myeloid neoplasms with abnormalities of PDGFRA might be related to the limited repertoire of possible PDGFRA kinase domain mutations in vitro. Oncogene 30:8, 933-943
CrossRef43
Shaoyan Hu, Yaxiang He, Xueming Zhu, Jie Li, Hailong He. (2011) Myeloproliferative Disorders with t(8;9)(p12;q33): A Case Report and Review of the Literature. Pediatric Hematology-Oncology 28:2, 140-146
CrossRef44
Q Huang, D S Snyder, P Chu, K K Gaal, K L Chang, L M Weiss. (2011) PDGFRA rearrangement leading to hyper-eosinophilia, T-lymphoblastic lymphoma, myeloproliferative neoplasm and precursor B-cell acute lymphoblastic leukemia. Leukemia 25:2, 371-375
CrossRef45
Kate Burbury, Lee Ping Chew, David Westerman, Alberto Catalano, John F. Seymour. (2011) Concomitant FIP1L1–PDGFRA fusion gene and T-cell clonality in a case of chronic eosinophilic leukemia with clonal evolution and an incomplete response to imatinib. Leukemia & Lymphoma 52:2, 335-338
CrossRef46
Jennifer L. Poitras, Dolors Costa, Michael J. Kluk, Philip C. Amrein, Richard M. Stone, Charles Lee, Paola Dal Cin, Cynthia C. Morton. (2011) Genomic alterations in myeloid neoplasms with novel, apparently balanced translocations. Cancer Genetics 204:2, 68-76
CrossRef47
Grzegorz Helbig, Marek Hus, Magdalena Hałasz, Marek Dudziński, Agnieszka Więcławek, Małgorzata Stachowicz, Anna Soja, Sławomira Kyrcz-Krzemień. (2011) Imatinib mesylate may induce long-term clinical response in FIP1L1-PDGFRα-negative hypereosinophilic syndrome. Medical Oncology
CrossRef48
Michelle Maccarini Barcelos, Maria Cláudia Santos-Silva. (2011) Molecular approach to diagnose BCR/ABL negative chronic myeloproliferative neoplasms. Revista Brasileira de Hematologia e Hemoterapia 33:4, 290-296
CrossRef49
Yasuhiko Nishioka, Yoshinori Aono, Saburo Sone. (2011) Role of tyrosine kinase inhibitors in tumor immunology. Immunotherapy 3:1, 107-116
CrossRef50
Cristina R Antonescu. (2011) The GIST paradigm: lessons for other kinase-driven cancers. The Journal of Pathology 223:2, 252-262
CrossRef51
Koa Hosoki, Mizuho Nagao, Kosei Iguchi, Toshiaki Ihara, Yoshiyuki Yamada, Masamune Higashigawa, Gail M. Kephart, Hirohito Kita, Takao Fujisawa. (2011) An 8-Year-Old Boy with Hypereosinophilic Syndrome. International Archives of Allergy and Immunology 155:s1, 117-122
CrossRef52
Ryoko AWAZAWA, Yu-ichi YAMAMOTO, Tsuyoshi AWAZAWA, Yutaka ASATO, Kiyohito TAIRA, Kenzo TAKAHASHI, Hiroshi UEZATO. (2011) A Case of Hypereosinophilic Syndrome Successfully Treated with Low Dose Oral Corticosteroids and Cyclosporine Combination Therapy. Nishi Nihon Hifuka 73:4, 345-349
CrossRef53
Soo-Mee Bang, Ho Young Kim, Hyo Jung Kim, Hee-Jin Kim, Jong Ho Won, Bong Seog Kim, Chul-Won Jung, Hyun-Sook Chi, . (2011) Diagnostic and therapeutic guideline for myeloproliferative neoplasm. Journal of the Korean Medical Association 54:1, 112
CrossRef54
Kodjovi Messie, Ahoefa Vovor, Irenee Messanh Kueviakoe, Levi kankoe Sallah, Kossi Agbetiafa, Akuete Yvon Segbena. (2011) Clonal Hypereosinophilic Syndrome: Two Cases Report in Black Men from Sub-Saharan Africa and Literature Reviews. ISRN Hematology 2011, 1-6
CrossRef55
Susannah O’Sullivan, Dorit Naot, Karen E. Callon, Maureen Watson, Greg D. Gamble, Marianne Ladefoged, Morten A. Karsdal, Peter Browett, Jillian Cornish, Andrew Grey. (2011) Imatinib Mesylate Does Not Increase Bone Volume In Vivo. Calcified Tissue International 88:1, 16-22
CrossRef56
Yoshiyuki Yamada, Akira Nishi, Yoshifumi Ebara, Masahiko Kato, Hideki Yamamoto, Hideaki Morita, Ichiro Nomura, Kenji Matsumoto, Junko Hirato, Shin-itsu Hatakeyama, Norio Suzuki, Yasuhide Hayashi. (2011) Eosinophilic Gastrointestinal Disorders in Infants: A Japanese Case Series. International Archives of Allergy and Immunology 155:s1, 40-45
CrossRef57
Nobuyasu Awano, Tomiko Ryu, Naoki Yoshimura, Masakazu Takazoe, Shigehiro Kitamura, Masanori Tanaka. (2011) Successful Treatment of Ulcerative Colitis Associated with Hypereosinophilic Syndrome/Chronic Eosinophilic Leukemia. Internal Medicine 50:16, 1741-1745
CrossRef58
Don L. Gibbons, Sabrina Pricl, Hagop Kantarjian, Jorge Cortes, Alfonso Quintás-Cardama. (2011) The rise and fall of gatekeeper mutations? The BCR-ABL1 T315I paradigm. Cancern/a-n/a
CrossRef59
BJ Bain. 2011. Myeloproliferative neoplasms with eosinophilia. , 371-379.
CrossRef60
Bryan Corrin, Andrew G. Nicholson. 2011. Pulmonary eosinophilia. , 459-470.
CrossRef61
S. Schnittger, C. Haferlach, M. Ulke, T. Alpermann, W. Kern, T. Haferlach. (2010) IDH1 mutations are detected in 6.6% of 1414 AML patients and are associated with intermediate risk karyotype and unfavorable prognosis in adults younger than 60 years and unmutated NPM1 status. Blood 116:25, 5486-5496
CrossRef62
Tracy I. George, Hans-Peter Horny. (2010) Systemic Mastocytosis. Surgical Pathology Clinics 3:4, 1185-1202
CrossRef63
J. R. -Y. Wang, C. -C. Yen, J. -P. Gau, L. -T. Hsiao, C. -Y. Liu, J. -T. Pai, C. -H. Tzeng, H. -W. Teng. (2010) A case of myeloid neoplasm associated with eosinophilia and KIAA1509-PDGFRβ responsive to combination treatment with imatinib mesylate and prednisolone. Journal of Clinical Pharmacy and Therapeutics 35:6, 733-736
CrossRef64
Maria Cristina Rapanotti, Roberta Caruso, Emanuele Ammatuna, Serena Zaza, Laura Trotta, Mariadomenica Divona, Laura Cicconi, Daria Funaro, Giorgio Federici, Sergio Amadori, Giulio De Rossi, Francesco Lo-Coco. (2010) Molecular characterization of paediatric idiopathic hypereosinophilia. British Journal of Haematology 151:5, 440-446
CrossRef65
Maher Albitar. 2010. Diagnosis of Leukemias: New Diagnostic Modalities and Implications for Classification. , 43-55.
CrossRef66
Hartmut Koeppen, Carlos E. Bueso-Ramos, Sergej N. Konoplev. 2010. Traditional Diagnostic Approaches. , 29-42.
CrossRef67
Hendrik J Kuiken, Roderick L Beijersbergen. (2010) Exploration of synthetic lethal interactions as cancer drug targets. Future Oncology 6:11, 1789-1802
CrossRef68
Barbara J Bain, Torsten Haferlach. 2010. Laboratory Diagnosis of Haematological Neoplasms. , 395-414.
CrossRef69
John M Goldman, Tariq I Mughal. 2010. Chronic Myeloid Leukaemia. , 483-502.
CrossRef70
Choi, Young Lim, Soda, Manabu, Yamashita, Yoshihiro, Ueno, Toshihide, Takashima, Junpei, Nakajima, Takahiro, Yatabe, Yasushi, Takeuchi, Kengo, Hamada, Toru, Haruta, Hidenori, Ishikawa, Yuichi, Kimura, Hideki, Mitsudomi, Tetsuya, Tanio, Yoshiro, Mano, Hiroyuki, . (2010) EML4-ALK Mutations in Lung Cancer That Confer Resistance to ALK Inhibitors. New England Journal of Medicine 363:18, 1734-1739
Full Text71
F. Toffalini, J.-B. Demoulin. (2010) New insights into the mechanisms of hematopoietic cell transformation by activated receptor tyrosine kinases. Blood 116:14, 2429-2437
CrossRef72
Lena Reindl, Ulrike Bacher, Frank Dicker, Tamara Alpermann, Wolfgang Kern, Susanne Schnittger, Torsten Haferlach, Claudia Haferlach. (2010) Biological and clinical characterization of recurrent 14q deletions in CLL and other mature B-cell neoplasms. British Journal of Haematology 151:1, 25-36
CrossRef73
Mathias Rathe, Thomas Kielsgaard Kristensen, Michael Boe Møller, Niels L.T. Carlsen. (2010) Myeloid neoplasm with prominent eosinophilia and PDGFRA rearrangement treated with imatinib mesylate. Pediatric Blood & Cancer 55:4, 730-732
CrossRef74
E Weisberg, M Sattler, A Ray, J D Griffin. (2010) Drug resistance in mutant FLT3-positive AML. Oncogene 29:37, 5120-5134
CrossRef75
C Nishioka, T Ikezoe, J Yang, A Yokoyama. (2010) Long-term exposure of leukemia cells to multi-targeted tyrosine kinase inhibitor induces activations of AKT, ERK and STAT5 signaling via epigenetic silencing of the PTEN gene. Leukemia 24:9, 1631-1640
CrossRef76
Ignacio Erquiaga, Cristina Ormazábal, Cristina Hurtado, Paula Aranaz, María J. Calasanz, Marina García-Delgado, Francisco J. Novo, José L. Vizmanos. (2010) Quantification of PDGFRA alternative transcripts improves the screening for X–PDGFRA fusions by reverse transcriptase-polymerase chain reaction. Leukemia & Lymphoma 51:9, 1720-1726
CrossRef77
Lawrence B. Schwartz, Javed Sheikh, Anish Singh. (2010) Current strategies in the management of hypereosinophilic syndrome, including mepolizumab. Current Medical Research and Opinion 26:8, 1933-1946
CrossRef78
Alain Bernheim. (2010) Cytogenomics of cancers: From chromosome to sequence. Molecular Oncology 4:4, 309-322
CrossRef79
Takayuki Ikezoe, Kazuto Togitani, Taizo Tasaka, Chie Nishioka, Akihito Yokoyama. (2010) Successful treatment of imatinib-resistant hypereosinophilic syndrome with nilotinib. Leukemia Research 34:8, e200-e201
CrossRef80
Ankur Lodha, Mehandi Haran, Vijay Shetty, Adnan Sadiq, Gerald Hollander, Jacob Shani. (2010) Hypereosinophilic Syndrome Presenting with Biventricular Cardiac Thrombi. Echocardiography 27:6, E57-E59
CrossRef81
Florence Roufosse, Peter F. Weller. (2010) Practical approach to the patient with hypereosinophilia. Journal of Allergy and Clinical Immunology 126:1, 39-44
CrossRef82
Martin M. Crane, Cindy Ma Chang, Monica G. Kobayashi, Peter F. Weller. (2010) Incidence of myeloproliferative hypereosinophilic syndrome in the United States and an estimate of all hypereosinophilic syndrome incidence. Journal of Allergy and Clinical Immunology 126:1, 179-181
CrossRef83
Dagmar Simon, Andrew Wardlaw, Marc E. Rothenberg. (2010) Organ-specific eosinophilic disorders of the skin, lung, and gastrointestinal tract. Journal of Allergy and Clinical Immunology 126:1, 3-13
CrossRef84
Hans-Uwe Simon, Marc E. Rothenberg, Bruce S. Bochner, Peter F. Weller, Andrew J. Wardlaw, Michael E. Wechsler, Lanny J. Rosenwasser, Florence Roufosse, Gerald J. Gleich, Amy D. Klion. (2010) Refining the definition of hypereosinophilic syndrome. Journal of Allergy and Clinical Immunology 126:1, 45-49
CrossRef85
Ji-Sook Lee, In Sik Kim. (2010) Leukotactin-1/CCL15 induces cell migration and differentiation of human eosinophilic leukemia EoL-1 cells through PKCδ activation. Molecular Biology Reports 37:5, 2149-2156
CrossRef86
E. Weisberg, H. G. Choi, A. Ray, R. Barrett, J. Zhang, T. Sim, W. Zhou, M. Seeliger, M. Cameron, M. Azam, J. A. Fletcher, M. Debiec-Rychter, M. Mayeda, D. Moreno, A. L. Kung, P. A. Janne, R. Khosravi-Far, J. V. Melo, P. W. Manley, S. Adamia, C. Wu, N. Gray, J. D. Griffin. (2010) Discovery of a small-molecule type II inhibitor of wild-type and gatekeeper mutants of BCR-ABL, PDGFR , Kit, and Src kinases: novel type II inhibitor of gatekeeper mutants. Blood 115:21, 4206-4216
CrossRef87
D Ercan, K Zejnullahu, K Yonesaka, Y Xiao, M Capelletti, A Rogers, E Lifshits, A Brown, C Lee, J G Christensen, D J Kwiatkowski, J A Engelman, P A Jänne. (2010) Amplification of EGFR T790M causes resistance to an irreversible EGFR inhibitor. Oncogene 29:16, 2346-2356
CrossRef88
Mark A. Dawson, Jayne E. Curry, Kelly Barber, Philip A. Beer, Brent Graham, John F. Lyons, Caroline J. Richardson, Mike A. Scott, Tomoko Smyth, Matthew S. Squires, Neil T. Thompson, Anthony R. Green, Nicola G. Wallis. (2010) AT9283, a potent inhibitor of the Aurora kinases and Jak2, has therapeutic potential in myeloproliferative disorders. British Journal of Haematologyno-no
CrossRef89
Hong Liu, Samer Z. Al-Quran, Richard Lottenberg. (2010) Thrombotic storm in Kimura disease. Journal of Thrombosis and Thrombolysis 29:3, 354-357
CrossRef90
Jan Václavík, Tomáš Szotkowski, Martin Hutyra, Jiří Kozák, Jan Lukl, Miloš Táborský. (2010) Development of Löffler's endocarditis in FIP1L1-PDGFRalpha-positive hypereosinophilic syndrome despite continuous imatinib mesylate therapy and continuous complete remission. American Journal of Hematology 85:4, 296-299
CrossRef91
Ulrich Keller, Nikolas Von Bubnoff, Christian Peschel, Justus Duyster. (2010) Oncologist’s/haematologist’s view on the roles of pathologists for molecular targeted cancer therapy. Journal of Cellular and Molecular Medicine 14:4, 805-817
CrossRef92
William W. Busse, Johannes Ring, Johannes Huss-Marp, Jean-Emmanuel Kahn. (2010) A review of treatment with mepolizumab, an anti–IL-5 mAb, in hypereosinophilic syndromes and asthma. Journal of Allergy and Clinical Immunology 125:4, 803-813
CrossRef93
2010. Chronic Myeloid Leukaemias. , 261-300.
CrossRef94
Neil Cox, J. L. Jorizzo, J. F. Bourke, C. O. S. Savage. 2010. Vasculitis, Neutrophilic Dermatoses and Related Disorders. , 1-95.
CrossRef95
Peter Vandenberghe, Lucienne Michaux, Anne Hagemeijer. 2010. Chronic Myeloproliferative Neoplasms. , 209-232.
CrossRef96
Michael J. Eck, Cai-Hong Yun. (2010) Structural and mechanistic underpinnings of the differential drug sensitivity of EGFR mutations in non-small cell lung cancer. Biochimica et Biophysica Acta (BBA) - Proteins & Proteomics 1804:3, 559-566
CrossRef97
Jason Gotlib. (2010) Eosinophilic myeloid disorders: new classification and novel therapeutic strategies. Current Opinion in Hematology 17:2, 117-124
CrossRef98
Howard Li, Steven D. Groshong, David Lynch, Kevin K. Brown, Stephen K. Frankel. (2010) Eosinophilic Lung Disease. Clinical Pulmonary Medicine 17:2, 66-74
CrossRef99
Martha Wadleigh, Ayalew Tefferi. (2010) Classification and diagnosis of myeloproliferative neoplasms according to the 2008 World Health Organization criteria. International Journal of Hematology 91:2, 174-179
CrossRef100
Houman Rezaizadeh, Monica Sanchez-Ross, Edo Kaluski, Marc Klapholz, Bunyad Haider, Christine Gerula. (2010) Acute eosinophilic myocarditis: Diagnosis and treatment. Acute Cardiac Care 12:1, 31-36
CrossRef101
Gaurav D. Shah, Nick Loizos, Hagop Youssoufian, Jonathan D. Schwartz, Eric K. Rowinsky. (2010) Rationale for the development of IMC-3G3, a fully human immunoglobulin G subclass 1 monoclonal antibody targeting the platelet-derived growth factor receptor α. Cancer 116:S4, 1018-1026
CrossRef102
C Thuny, C Gaudy-Marqueste, I Nicol, J Gabert, R Costello, JJ Grob, MA Richard. (2010) Chronic eosinophilic leukaemia revealed by lymphomatoid papulosis: the role of the FIP1-like 1-platelet-derived growth factor receptor alpha fusion gene. Journal of the European Academy of Dermatology and Venereology 24:2, 234-234
CrossRef103
Zachary A. Knight, Henry Lin, Kevan M. Shokat. (2010) Targeting the cancer kinome through polypharmacology. Nature Reviews Cancer 10:2, 130-137
CrossRef104
Jeffrey Jie-Lou Liao. 2010. Structure-Based Design of Kinase Inhibitors: Molecular Recognition of Protein Multiple Conformations. .
CrossRef105
Hideo Tanaka, Koji Iwato, Hiroya Asou, Akiro Kimura. (2010) Pure Red Cell Aplasia Associated with Imatinib-Treated FIP1L1-PDGFRA Positive Chronic Eosinophilic Leukemia. Internal Medicine 49:12, 1195-1200
CrossRef106
D M Ross, T P Hughes, J V Melo. (2010) Do we have to kill the last CML cell?. Leukemia
CrossRef107
Tadashi Ohtomo, Keisuke Miyazawa, Munekazu Naito, Shota Moriya, Masahiko Kuroda, Masahiro Itoh, Akio Tomoda. (2010) Cytoprotective effect of imatinib mesylate in non-BCR-ABL-expressing cells along with autophagosome formation. Biochemical and Biophysical Research Communications 391:1, 310-315
CrossRef108
Isamu Okamoto. (2010) Epidermal growth factor receptor in relation to tumor development: EGFR-targeted anticancer therapy. FEBS Journal 277:2, 309-315
CrossRef109
H.-U. Schildhaus, R. Büttner, E. Binot, S. Merkelbach-Bruse, E. Wardelmann. (2009) Inflammatorische fibroide Polypen sind echte Neoplasien mit PDGFRA-Mutationen. Der Pathologe 30:S2, 117-120
CrossRef110
Princess U. Ogbogu, Bruce S. Bochner, Joseph H. Butterfield, Gerald J. Gleich, Johannes Huss-Marp, Jean Emmanuel Kahn, Kristin M. Leiferman, Thomas B. Nutman, Florian Pfab, Johannes Ring, Marc E. Rothenberg, Florence Roufosse, Marie-Helene Sajous, Javed Sheikh, Dagmar Simon, Hans-Uwe Simon, Miguel L. Stein, Andrew Wardlaw, Peter F. Weller, Amy D. Klion. (2009) Hypereosinophilic syndrome: A multicenter, retrospective analysis of clinical characteristics and response to therapy. Journal of Allergy and Clinical Immunology 124:6, 1319-1325.e3
CrossRef111
Ji-Sook Lee, Eun Ju Yang, In Sik Kim. (2009) The roles of MCP-1 and protein kinase Cδ activation in human eosinophilic leukemia EoL-1 cells. Cytokine 48:3, 186-195
CrossRef112
Toshirou Nishida, Tsuyoshi Takahashi, Yasuaki Miyazaki. (2009) Gastrointestinal stromal tumor: a bridge between bench and bedside. Gastric Cancer 12:4, 175-188
CrossRef113
Tamara Intermesoli, Federica Delaini, Sara Acerboni, Silvia Salmoiraghi, Orietta Spinelli, Vittoria Guerini, Alessandro M. Vannucchi, Silvia Mappa, Giuseppe Rossi, Valentina Rossi, Eros Di Bona, Simona Paratore, Alessandra Carobbio, Alessandro Rambaldi, Tiziano Barbui, Renato Bassan. (2009) A short low-dose imatinib trial allows rapid identification of responsive patients in hypereosinophilic syndromes. British Journal of Haematology 147:5, 681-685
CrossRef114
Jason Gotlib. (2009) On being metachromatic: Mystique and misunderstanding in mastocytosis. American Journal of Hematology 84:12, 779-781
CrossRef115
Ross L. Levine. (2009) Mechanisms of mutations in myeloproliferative neoplasms. Best Practice & Research Clinical Haematology 22:4, 489-494
CrossRef116
Yanli Jin, Qi Chen, Zhongzheng Lu, Bo Chen, Jingxuan Pan. (2009) Triptolide abrogates oncogene FIP1L1-PDGFRα addiction and induces apoptosis in hypereosinophilic syndrome. Cancer Science 100:11, 2210-2217
CrossRef117
A. D. Klion. (2009) How I treat hypereosinophilic syndromes. Blood 114:18, 3736-3741
CrossRef118
Nicholas Lydon. (2009) Attacking cancer at its foundation. Nature Medicine 15:10, 1153-1157
CrossRef119
Chunaram Choudhary, Jesper V. Olsen, Christian Brandts, Jürgen Cox, Pavankumar N.G. Reddy, Frank D. Böhmer, Volker Gerke, Dirk-E. Schmidt-Arras, Wolfgang E. Berdel, Carsten Müller-Tidow, Matthias Mann, Hubert Serve. (2009) Mislocalized Activation of Oncogenic RTKs Switches Downstream Signaling Outcomes. Molecular Cell 36:2, 326-339
CrossRef120
M. Ravoet, C. Sibille, C. Gu, M. Libin, B. Haibe-Kains, C. Sotiriou, M. Goldman, F. Roufosse, K. Willard-Gallo. (2009) Molecular profiling of CD3-CD4+ T cells from patients with the lymphocytic variant of hypereosinophilic syndrome reveals targeting of growth control pathways. Blood 114:14, 2969-2983
CrossRef121
Wolpin, Brian M., Weller, Peter F., Katz, Joel T., Levy, Bruce D., Loscalzo, Joseph, . (2009) The Writing on the Wall. New England Journal of Medicine 361:14, 1387-1392
Full Text122
Ayalew Tefferi, Juergen Thiele, James W. Vardiman. (2009) The 2008 World Health Organization classification system for myeloproliferative neoplasms. Cancer 115:17, 3842-3847
CrossRef123
Els Lierman, Jan Cools. (2009) Recent breakthroughs in the understanding and management of chronic eosinophilic leukemia. Expert Review of Anticancer Therapy 9:9, 1295-1304
CrossRef124
Craig B. Thompson. (2009) Attacking Cancer at Its Root. Cell 138:6, 1051-1054
CrossRef125
Isabelle Plo, William Vainchenker. (2009) Molecular and Genetic Bases of Myeloproliferative Disorders: Questions and Perspectives. Clinical Lymphoma, Myeloma & Leukemia 9:0, S329-S339
CrossRef126
A Pardanani, T Lasho, G Smith, C J Burns, E Fantino, A Tefferi. (2009) CYT387, a selective JAK1/JAK2 inhibitor: in vitro assessment of kinase selectivity and preclinical studies using cell lines and primary cells from polycythemia vera patients. Leukemia 23:8, 1441-1445
CrossRef127
John Anastasi. (2009) The Myeloproliferative Neoplasms: Insights into Molecular Pathogenesis and Changes in WHO Classification and Criteria for Diagnosis. Hematology/Oncology Clinics of North America 23:4, 693-708
CrossRef128
Dragan Jevremovic, David S. Viswanatha. (2009) Molecular Diagnosis of Hematopoietic and Lymphoid Neoplasms. Hematology/Oncology Clinics of North America 23:4, 903-933
CrossRef129
Joseph H. Butterfield. (2009) Success of short-term, higher-dose imatinib mesylate to induce clinical response in FIP1L1-PDGFRα-negative hypereosinophilic syndrome. Leukemia Research 33:8, 1127-1129
CrossRef130
J. W. Vardiman, J. Thiele, D. A. Arber, R. D. Brunning, M. J. Borowitz, A. Porwit, N. L. Harris, M. M. Le Beau, E. Hellstrom-Lindberg, A. Tefferi, C. D. Bloomfield. (2009) The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes. Blood 114:5, 937-951
CrossRef131
Janna Paulsson, Tobias Sjöblom, Patrick Micke, Fredrik Pontén, Göran Landberg, Carl-Henrik Heldin, Jonas Bergh, Donal J. Brennan, Karin Jirström, Arne Östman. (2009) Prognostic Significance of Stromal Platelet-Derived Growth Factor β-Receptor Expression in Human Breast Cancer. The American Journal of Pathology 175:1, 334-341
CrossRef132
B L Ebert. (2009) Deletion 5q in myelodysplastic syndrome: a paradigm for the study of hemizygous deletions in cancer. Leukemia 23:7, 1252-1256
CrossRef133
Mrinal M Patnaik, Ayalew Tefferi. (2009) Molecular diagnosis of myeloproliferative neoplasms. Expert Review of Molecular Diagnostics 9:5, 481-492
CrossRef134
Youssef Sorour, Christopher D. Dalley, John A. Snowden, Nicholas C. P. Cross, John T. Reilly. (2009) Acute myeloid leukaemia with associated eosinophilia: justification for FIP1L1-PDGFRA screening in cases lacking the CBFB-MYH11 fusion gene. British Journal of Haematology 146:2, 225-227
CrossRef135
Michael Darmon, Elie Azoulay. (2009) Critical care management of cancer patients: cause for optimism and need for objectivity. Current Opinion in Oncology 21:4, 318-326
CrossRef136
C Kumar, A V Purandare, F Y Lee, M V Lorenzi. (2009) Kinase drug discovery approaches in chronic myeloproliferative disorders. Oncogene 28:24, 2305-2313
CrossRef137
Stephanie R. Fink, Kimberly J. Belongie, Sarah F. Paternoster, Stephanie A. Smoley, Animesh D. Pardanani, Ayalew Tefferi, Daniel L. Van Dyke, Rhett P. Ketterling. (2009) Validation of a new three-color fluorescence in situ hybridization (FISH) method to detect CHIC2 deletion, FIP1L1/PDGFRA fusion and PDGFRA translocations. Leukemia Research 33:6, 843-846
CrossRef138
Lori A. Wagner, Stephen Speckart, Bruce Cutter, Gerald J. Gleich. (2009) Treatment of FIP1L1/PDGFRA-negative hypereosinophilic syndrome with alemtuzumab, an anti-CD52 antibody. Journal of Allergy and Clinical Immunology 123:6, 1407-1408
CrossRef139
Nitin Jain, Jorge Cortes, Alfonso Quintás-Cardama, Taghi Manshouri, Raja Luthra, Guillermo Garcia-Manero, Hagop Kantarjian, Srdan Verstovsek. (2009) Imatinib has limited therapeutic activity for hypereosinophilic syndrome patients with unknown or negative PDGFRα mutation status. Leukemia Research 33:6, 837-839
CrossRef140
S. Salemi, S. Yousefi, D. Simon, I. Schmid, L. Moretti, L. Scapozza, H.-U. Simon. (2009) A novel FIP1L1-PDGFRA mutant destabilizing the inactive conformation of the kinase domain in chronic eosinophilic leukemia/hypereosinophilic syndrome. Allergy 64:6, 913-918
CrossRef141
Ellen Weisberg, Rosemary Barrett, Qingsong Liu, Richard Stone, Nathanael Gray, James D. Griffin. (2009) FLT3 inhibition and mechanisms of drug resistance in mutant FLT3-positive AML. Drug Resistance Updates 12:3, 81-89
CrossRef142
A. Roldán Montaud, M.J. Citores Sánchez, I. Perales Fraile, V. Masip Marzá, C. Bellas Menéndez, J.A. Vargas Núñez. (2009) Variante linfoide del síndrome hipereosinófilo. Revista Clínica Española 209:6, 303-308
CrossRef143
Andrey S. Ivanov, Sergey V. Shishkov. (2009) Synthesis of imatinib: a convergent approach revisited. Monatshefte für Chemie - Chemical Monthly 140:6, 619-623
CrossRef144
Massimo Breccia, Daniela Cilloni, Laura Cannella, Caterina Stefanizzi, Agostino Tafuri, Angelo Fama, Michelina Santopietro, Giuseppe Saglio, Giuliana Alimena. (2009) Isolated molecular relapse in FIP1L1-PDGFRα hypereosinophilic syndrome after discontinuation and single weekly dose of imatinib: need of quantitative molecular procedures to modulate imatinib dose. Cancer Chemotherapy and Pharmacology 63:6, 1161-1163
CrossRef145
Gerald J. Gleich, Kristin M. Leiferman. (2009) The hypereosinophilic syndromes: current concepts and treatments. British Journal of Haematology 145:3, 271-285
CrossRef146
E Lierman, L Michaux, E Beullens, P Pierre, P Marynen, J Cools, P Vandenberghe. (2009) FIP1L1-PDGFRα D842V, a novel panresistant mutant, emerging after treatment of FIP1L1-PDGFRα T674I eosinophilic leukemia with single agent sorafenib. Leukemia 23:5, 845-851
CrossRef147
Srdan Verstovsek. (2009) Preclinical and clinical experience with dasatinib in philadelphia chromosome-negative leukemias and myeloid disorders. Leukemia Research 33:5, 617-623
CrossRef148
A Tefferi, R L Levine, K-H Lim, O Abdel-Wahab, T L Lasho, J Patel, C M Finke, A Mullally, C-Y Li, A Pardanani, D G Gilliland. (2009) Frequent TET2 mutations in systemic mastocytosis: clinical, KITD816V and FIP1L1-PDGFRA correlates. Leukemia 23:5, 900-904
CrossRef149
Kamran Ghoreschi, Arian Laurence, John J O'Shea. (2009) Selectivity and therapeutic inhibition of kinases: to be or not to be?. Nature Immunology 10:4, 356-360
CrossRef150
Darrin Stuart, William R Sellers. (2009) Linking somatic genetic alterations in cancer to therapeutics. Current Opinion in Cell Biology 21:2, 304-310
CrossRef151
J.-V. Malfuson, T. Fagot, J. Konopacki, L. Mangouka, B. Souleau, T. de Revel. (2009) Hyperéosinophilies et affections hématologiques. La Revue de Médecine Interne 30:4, 322-330
CrossRef152
, Toshirou Nishida, Tsuyoshi Takahashi, Akiko Nishitani, Toshihiko Doi, Kuniaki Shirao, Yoshito Komatsu, Kiyokazu Nakajima, Seiichi Hirota. (2009) Sunitinib-resistant gastrointestinal stromal tumors harbor cis-mutations in the activation loop of the KIT gene. International Journal of Clinical Oncology 14:2, 143-149
CrossRef153
Makoto KOBAYASHI, Tetsuya KUBOTA, Yoshiki UEMURA, Hirokuni TAGUCHI. (2009) A case of hypereosinophilic syndrome presenting with chronic cough successfully treated with imatinib. Respirology 14:2, 302-304
CrossRef154
Ayalew Tefferi. (2009) Molecular drug targets in myeloproliferative neoplasms: mutant ABL1, JAK2, MPL, KIT, PDGFRA, PDGFRB and FGFR1. Journal of Cellular and Molecular Medicine 13:2, 215-237
CrossRef155
C Walz, J Score, J Mix, D Cilloni, C Roche-Lestienne, R-F Yeh, J L Wiemels, E Ottaviani, P Erben, A Hochhaus, M Baccarani, D Grimwade, C Preudhomme, J Apperley, G Martinelli, G Saglio, N C P Cross, A Reiter. (2009) The molecular anatomy of the FIP1L1-PDGFRA fusion gene. Leukemia 23:2, 271-278
CrossRef156
Antonio B Fernandez, Shafeeq Ahmed, Brett Duncan, Stephen Firshein, Jeffrey Kluger. (2009) Cardiac tamponade: a rare complication of idiopathic hypereosinophilic syndrome. Journal of Cardiovascular Medicine 10:2, 188-191
CrossRef157
Amy Klion. (2009) Hypereosinophilic Syndrome: Current Approach to Diagnosis and Treatment *. Annual Review of Medicine 60:1, 293-306
CrossRef158
David H. Broide. (2009) Immunomodulation of Allergic Disease. Annual Review of Medicine 60:1, 279-291
CrossRef159
J Score, C Walz, J V Jovanovic, A V Jones, K Waghorn, C Hidalgo-Curtis, F Lin, D Grimwade, F Grand, A Reiter, N C P Cross. (2009) Detection and molecular monitoring of FIP1L1-PDGFRA-positive disease by analysis of patient-specific genomic DNA fusion junctions. Leukemia 23:2, 332-339
CrossRef160
T. Negri, G. M. Pavan, E. Virdis, A. Greco, M. Fermeglia, M. Sandri, S. Pricl, M. A. Pierotti, S. Pilotti, E. Tamborini. (2009) T670X KIT Mutations in Gastrointestinal Stromal Tumors: Making Sense of Missense. JNCI Journal of the National Cancer Institute 101:3, 194-204
CrossRef161
M. G. Cornejo, M. G. Kharas, M. B. Werneck, S. L. Bras, S. A. Moore, B. Ball, M. Beylot-Barry, S. J. Rodig, J. C. Aster, B. H. Lee, H. Cantor, J.-P. Merlio, D. G. Gilliland, T. Mercher. (2009) Constitutive JAK3 activation induces lymphoproliferative syndromes in murine bone marrow transplantation models. Blood 113:12, 2746-2754
CrossRef162
Y. Mori, H. Iwasaki, K. Kohno, G. Yoshimoto, Y. Kikushige, A. Okeda, N. Uike, H. Niiro, K. Takenaka, K. Nagafuji, T. Miyamoto, M. Harada, K. Takatsu, K. Akashi. (2009) Identification of the human eosinophil lineage-committed progenitor: revision of phenotypic definition of the human common myeloid progenitor. Journal of Experimental Medicine 206:1, 183-193
CrossRef163
Grzegorz Helbig, Andrzej Moskwa, Marek Hus, Jarosław Piszcz, Alina Swiderska, Alina Urbanowicz, Małgorzata Całbecka, Justyna Gajkowska, Ilona Seferyńska, Magdalena Hałasz, Dariusz Woszczyk, Miroslaw Markiewicz, Sławomira Krzemień. (2009) Clinical characteristics of patients with chronic eosinophilic leukaemia (CEL) harbouring FIP1L1-PDGFRA fusion transcript-results of Polish multicentre study. Hematological Oncologyn/a-n/a
CrossRef164
Da-Woon Kim, Myung-Geun Shin, Hyeong-Kee Yun, Soo-Hyun Kim, Jong-Hee Shin, Soon-Pal Suh, Dong-Wook Ryang. (2009) Incidence and Causes of Hyperosinophilia in the Patients of a University Hospital. The Korean Journal of Laboratory Medicine 29:3, 185
CrossRef165
Jorge Cortes, Kim De Keersmaecker. (2009) T-Cell acute lymphoblastic leukemia with a “pinch” of BCR-ABL1. Leukemia & Lymphoma 50:3, 321-322
CrossRef166
DANIEL A. ARBER. 2009. Bone Marrow. , 1536-1593.
CrossRef167
Wajeeha Razaq, Elizabeth Beautyman. (2009) Successful Treatment of Refractory Idiopathic Hypereosinophilic Syndrome With Etoposide. American Journal of Therapeutics 16:1, 68-70
CrossRef168
Hiroto Ohguchi, Tomohiro Sugawara, Hideo Harigae. (2009) Thrombotic Thrombocytopenic Purpura Complicated with Hypereosinophilic Syndrome. Internal Medicine 48:18, 1687-1690
CrossRef169
Cindy M. Salm, Nicole E. St. Clair, James V. Lustig, Margaret M. Samyn. (2009) Cardiac Manifestations from Non-FIP1L1-PDGFRα-Associated Hypereosinophilic Syndrome in a 13-Year-Old African American Boy. Journal of Allergy 2009, 1-5
CrossRef170
James R. Cook. 2009. Molecular Hematopathology. , 305-324.
CrossRef171
Javed Sheikh, Peter F Weller. (2009) Advances in diagnosis and treatment of eosinophilia. Current Opinion in Hematology 16:1, 3-8
CrossRef172
Ayalew Tefferi, Ross L. Levine, Hagop Kantarjian. (2009) Oncogenic Signals as Treatment Targets in Classic Myeloproliferative Neoplasms. Biology of Blood and Marrow Transplantation 15:1, 114-119
CrossRef173
Chun-Yan Sun, Yu Hu, Zhang-Bo Chu, Tao Guo, Jing He. (2009) Successful treatment of myeloid neoplasms associated with PDGFRA rearrangement with imatinib mesylate. International Journal of Hematology 89:1, 66-70
CrossRef174
Luke Y.C. Chen, Emily J. Lai, David R. Collins, David N. Ostrow, Gayatri M. Sreenivasan. (2009) A young woman with episodic angioedema, papilledema, and eosinophilia. American Journal of HematologyNA-NA
CrossRef175
O. Blétry, J.-E. Kahn. 2009. Hyperéosinophilie. , 727-729.
CrossRef176
B. J. Druker. (2008) Translation of the Philadelphia chromosome into therapy for CML. Blood 112:13, 4808-4817
CrossRef177
Rakhee Kar, Seema Rao, Hara Prasad Pati. (2008) Systemic mastocytosis with acute myelomonocytic leukemia: a case report. Indian Journal of Hematology and Blood Transfusion 24:4, 182-185
CrossRef178
Georgia Metzgeroth, Christoph Walz, Philipp Erben, Helena Popp, Annette Schmitt-Graeff, Claudia Haferlach, Alice Fabarius, Susanne Schnittger, David Grimwade, Nicholas C. P. Cross, Rüdiger Hehlmann, Andreas Hochhaus, Andreas Reiter. (2008) Safety and efficacy of imatinib in chronic eosinophilic leukaemia and hypereosinophilic syndrome - a phase-II study. British Journal of Haematology 143:5, 707-715
CrossRef179
Khaled el-Shami, Richard M Stone, B Douglas Smith. (2008) FLT3 inhibitors in acute myeloid leukemia. Expert Review of Hematology 1:2, 153-160
CrossRef180
L. Cristina Gavrilescu, Richard A. Van Etten. 2008. Murine Retroviral Bone Marrow Transplantation Models for the Study of Human Myeloproliferative Disorders. .
CrossRef181
T Pene-Dumitrescu, L F Peterson, N J Donato, T E Smithgall. (2008) An inhibitor-resistant mutant of Hck protects CML cells against the antiproliferative and apoptotic effects of the broad-spectrum Src family kinase inhibitor A-419259. Oncogene 27:56, 7055-7069
CrossRef182
Ouafae Karimi, J. Bart A. Crusius, Constantina Coucoutsi, Roel Heijmans, Alicia M. Sambuelli, A. Salvador Peña, Ioannis E. Koutroubakis. (2008) JAK2 V617F mutation is not involved in thromboembolism in IBD. Inflammatory Bowel Diseases 14:11, 1606-1607
CrossRef183
Maria-Theresa Krauth, Thomas Binder, Leopold Öhler, Ulrich Jäger, Peter Valent. (2008) Improvement of cardiac function, mitral regurgitation and pulmonary hypertension in a patient with chronic eosinophilic leukemia (CEL) after low dose imatinib therapy. Leukemia Research 32:11, 1779-1783
CrossRef184
J Gotlib, J Cools. (2008) Five years since the discovery of FIP1L1–PDGFRA: what we have learned about the fusion and other molecularly defined eosinophilias. Leukemia 22:11, 1999-2010
CrossRef185
E Taniguchi, K Nishijo, A T McCleish, J E Michalek, M H Grayson, A J Infante, H E Abboud, R D Legallo, S J Qualman, B P Rubin, C Keller. (2008) PDGFR-A is a therapeutic target in alveolar rhabdomyosarcoma. Oncogene 27:51, 6550-6560
CrossRef186
Yuval Bibi, Alice B. Gottlieb. (2008) A potential role for imatinib and other small molecule tyrosine kinase inhibitors in the treatment of systemic and localized sclerosis. Journal of the American Academy of Dermatology 59:4, 654-658
CrossRef187
Mohammad Azam, Markus A Seeliger, Nathanael S Gray, John Kuriyan, George Q Daley. (2008) Activation of tyrosine kinases by mutation of the gatekeeper threonine. Nature Structural & Molecular Biology 15:10, 1109-1118
CrossRef188
Christian Baumgartner, Karoline V. Gleixner, Barbara Peter, Veronika Ferenc, Alexander Gruze, Lily L. Remsing Rix, Keiryn L. Bennett, Puchit Samorapoompichit, Francis Y. Lee, Winfried F. Pickl, Harald Esterbauer, Christian Sillaber, Giulio Superti-Furga, Peter Valent. (2008) Dasatinib inhibits the growth and survival of neoplastic human eosinophils (EOL-1) through targeting of FIP1L1-PDGFRα. Experimental Hematology 36:10, 1244-1253
CrossRef189
Alfonso Quintás-Cardama, Jorge Cortes. (2008) Nilotinib: a phenylamino-pyrimidine derivative with activity against BCR-ABL, KIT and PDGFR kinases. Future Oncology 4:5, 611-621
CrossRef190
J T Reilly. (2008) Pathogenetic insight and prognostic information from standard and molecular cytogenetic studies in the BCR-ABL-negative myeloproliferative neoplasms (MPNs). Leukemia 22:10, 1818-1827
CrossRef191
O Kilpivaara, R L Levine. (2008) JAK2 and MPL mutations in myeloproliferative neoplasms: discovery and science. Leukemia 22:10, 1813-1817
CrossRef192
Jean-Emmanuel Kahn, Olivier Blétry, Loïc Guillevin. (2008) Hypereosinophilic syndromes. Best Practice & Research Clinical Rheumatology 22:5, 863-882
CrossRef193
H-U Schildhaus, T Cavlar, E Binot, R Büttner, E Wardelmann, S Merkelbach-Bruse. (2008) Inflammatory fibroid polyps harbour mutations in the platelet-derived growth factor receptor alpha ( PDGFRA) gene. The Journal of Pathology 216:2, 176-182
CrossRef194
Y. Yamada, A. Sanchez-Aguilera, E. B. Brandt, M. McBride, N. J. H. Al-Moamen, F. D. Finkelman, D. A. Williams, J. A. Cancelas, M. E. Rothenberg. (2008) FIP1L1/PDGFR synergizes with SCF to induce systemic mastocytosis in a murine model of chronic eosinophilic leukemia/hypereosinophilic syndrome. Blood 112:6, 2500-2507
CrossRef195
N. Zimmermann, M. L. McBride, Y. Yamada, S. A. Hudson, C. Jones, K. D. Cromie, P. R. Crocker, M. E. Rothenberg, B. S. Bochner. (2008) Siglec-F antibody administration to mice selectively reduces blood and tissue eosinophils. Allergy 63:9, 1156-1163
CrossRef196
Issa J. Dahabreh, Stavroula Giannouli, Cristine Zoi, Katerina Zoi, Dimitrios Loukopoulos, Michael Voulgarelis. (2008) Hypereosinophilic syndrome: Another face of janus?. Leukemia Research 32:9, 1483-1485
CrossRef197
Fröhling, Stefan, Döhner, Hartmut, . (2008) Chromosomal Abnormalities in Cancer. New England Journal of Medicine 359:7, 722-734
Full Text198
Dennis B. Cornfield, Shereen M.F. Gheith, Eliot L. Friedman. (2008) A third case of chronic eosinophilic leukemia with the (8;9)(p23;p24) translocation. Cancer Genetics and Cytogenetics 185:1, 60-61
CrossRef199
Gudrun Reiterer, Rodica P. Bunaciu, James L. Smith, Andrew Yen. (2008) Inhibiting the platelet derived growth factor receptor increases signs of retinoic acid syndrome in myeloid differentiated HL-60 cells. FEBS Letters 582:17, 2508-2514
CrossRef200
Alfonso Quintás-Cardama, Jorge Cortes. (2008) Therapeutic options for patients with clonal and idiopathic hypereosinophia. Expert Opinion on Investigational Drugs 17:7, 1039-1050
CrossRef201
E. O. Hexner, C. Serdikoff, M. Jan, C. R. Swider, C. Robinson, S. Yang, T. Angeles, S. G. Emerson, M. Carroll, B. Ruggeri, P. Dobrzanski. (2008) Lestaurtinib (CEP701) is a JAK2 inhibitor that suppresses JAK2/STAT5 signaling and the proliferation of primary erythroid cells from patients with myeloproliferative disorders. Blood 111:12, 5663-5671
CrossRef202
Kwok-Kin Wong. (2008) Searching for a magic bullet in NSCLC: the role of epidermal growth factor receptor mutations and tyrosine kinase inhibitors. Lung Cancer 60, S10-S18
CrossRef203
F. Wimazal, C. Baumgartner, K. Sonneck, C. Zauner, P. Geissler, S. Schur, P. Samorapoompichit, L. Müllauer, M. Födinger, H. Agis, W. R. Sperr, P. Valent. (2008) Mixed-lineage eosinophil/basophil crisis in MDS: a rare form of progression. European Journal of Clinical Investigation 38:6, 447-455
CrossRef204
N. Martin Silva, L. Geffray, G. Gras, C. Auzary, C. Jeanjean, J.P. Poynard, C. Paris. (2008) Un cas de variant myéloïde de syndrome hyperéosinophilique à transcrit de fusion FIP1L1-PDGFRα ; efficacité de l’imatinib. La Revue de Médecine Interne 29, S132-S133
CrossRef205
Miguel L. Stein, Joyce M. Villanueva, Bridget K. Buckmeier, Yoshiyuki Yamada, Alexandra H. Filipovich, Amal H. Assa'ad, Marc E. Rothenberg. (2008) Anti–IL-5 (mepolizumab) therapy reduces eosinophil activation ex vivo and increases IL-5 and IL-5 receptor levels. Journal of Allergy and Clinical Immunology 121:6, 1473-1483.e4
CrossRef206
Sébastien Conus, Hans-Uwe Simon. (2008) General laboratory diagnostics of eosinophilic GI diseases. Best Practice & Research Clinical Gastroenterology 22:3, 441-453
CrossRef207
Alex Straumann. (2008) Idiopathic eosinophilic gastrointestinal diseases in adults. Best Practice & Research Clinical Gastroenterology 22:3, 481-496
CrossRef208
S. D. Nimer. (2008) Myelodysplastic syndromes. Blood 111:10, 4841-4851
CrossRef209
C. Nishioka, T. Ikezoe, J. Yang, A. Miwa, T. Tasaka, Y. Kuwayama, K. Togitani, H. P. Koeffler, A. Yokoyama. (2008) Ki11502, a novel multitargeted receptor tyrosine kinase inhibitor, induces growth arrest and apoptosis of human leukemia cells in vitro and in vivo. Blood 111:10, 5086-5092
CrossRef210
Claire Hidalgo-Curtis, Andrew Chase, Milton Drachenberg, Mark W. Roberts, Jerry Z. Finkelstein, Sarah Mould, David Oscier, Nicholas C. P. Cross, Francis H. Grand. (2008) The t(1;9)(p34;q34) and t(8;12)(p11;q15) fuse pre-mRNA processing proteinsSFPQ (PSF) andCPSF6 toABL andFGFR1. Genes, Chromosomes and Cancer 47:5, 379-385
CrossRef211
Keisuke Kataoka, Koji Izutsu, Sumimasa Nagai, Akira Hangaishi, Toru Motokura, Tsuyoshi Takahashi, Mineo Kurokawa. (2008) Elevated serum levels of soluble interleukin-2 receptor in chronic eosinophilic leukemia/hypereosinophilic syndrome with FIP1L1-PDGFRα fusion gene. International Journal of Hematology 87:4, 440-441
CrossRef212
SIMON P. HOGAN, HELENE F. ROSENBERG, REDWAN MOQBEL, SIMON PHIPPS, PAUL S. FOSTER, PAIGE LACY, A. BARRY KAY, MARC E. ROTHENBERG. (2008) Eosinophils: Biological Properties and Role in Health and Disease. Clinical & Experimental Allergy 38:5, 709-750
CrossRef213
M. M. Loriaux, R. L. Levine, J. W. Tyner, S. Frohling, C. Scholl, E. P. Stoffregen, G. Wernig, H. Erickson, C. A. Eide, R. Berger, O. A. Bernard, J. D. Griffin, R. M. Stone, B. Lee, M. Meyerson, M. C. Heinrich, M. W. Deininger, D. G. Gilliland, B. J. Druker. (2008) High-throughput sequence analysis of the tyrosine kinome in acute myeloid leukemia. Blood 111:9, 4788-4796
CrossRef214
Dagmar Simon, Souzan Salemi, Shida Yousefi, Hans-Uwe Simon. (2008) Primary resistance to imatinib in Fip1-like 1–platelet-derived growth factor receptor α—positive eosinophilic leukemia. Journal of Allergy and Clinical Immunology 121:4, 1054-1056
CrossRef215
Ernesto Vigna, Eugenio Lucia, Massimo Gentile, Carla Mazzone, Maria Grazia Bisconte, Carlo Gentile, Antonio Armentano, Emanuela Ottaviani, Michela Rondoni, Giovanni Martinelli, Fortunato Morabito. (2008) PDGFRalpha/FIP1L1-positive chronic eosinophilic leukemia presenting with retro-orbital localization: efficacy of imatinib treatment. Cancer Chemotherapy and Pharmacology 61:4, 713-716
CrossRef216
Gerlinde Wernig, Michael G. Kharas, Rachel Okabe, Sandra A. Moore, Dena S. Leeman, Dana E. Cullen, Maricel Gozo, Elizabeth P. McDowell, Ross L. Levine, John Doukas, Chi Ching Mak, Glenn Noronha, Michael Martin, Yon D. Ko, Benjamin H. Lee, Richard M. Soll, Ayalew Tefferi, John D. Hood, D. Gary Gilliland. (2008) Efficacy of TG101348, a Selective JAK2 Inhibitor, in Treatment of a Murine Model of JAK2V617F-Induced Polycythemia Vera. Cancer Cell 13:4, 311-320
CrossRef217
Noushin Heidary, Haley Naik, Susan Burgin. (2008) Chemotherapeutic agents and the skin: An update. Journal of the American Academy of Dermatology 58:4, 545-570
CrossRef218
Grzegorz Helbig, Beata Stella-Hołowiecka, Mirosław Majewski, Małgorzata Całbecka, Jolanta Gajkowska, Ryszard Klimkiewicz, Andrzej Moskwa, Janina Grzegorczyk, Monika Lewandowska, Jerzy Hołowiecki. (2008) A single weekly dose of imatinib is sufficient to induce and maintain remission of chronic eosinophilic leukaemia in FIP1L1-PDGFRA-expressing patients. British Journal of Haematology 141:2, 200-204
CrossRef219
Wechsler, Michael E., . (2008) Combating the Eosinophil with Anti–Interleukin-5 Therapy. New England Journal of Medicine 358:12, 1293-1294
Full Text220
J. Zwerina. (2008) Das Churg-Strauss-Syndrom. Zeitschrift für Rheumatologie 67:2, 137-144
CrossRef221
B. Hellmich, K. Holl-Ulrich, H. Merz, W.L. Gross. (2008) Hypereosinophiles Syndrom und Churg-Strauss-Syndrom. Der Internist 49:3, 286-296
CrossRef222
MA Ionescu, H Murata, A Janin. (2008) Oral mucosa lesions in hypereosinophilic syndrome – an update. Oral Diseases 14:2, 115-122
CrossRef223
Itaru Matsumura, Masao Mizuki, Yuzuru Kanakura. (2008) Roles for deregulated receptor tyrosine kinases and their downstream signaling molecules in hematologic malignancies. Cancer Science 99:3, 479-485
CrossRef224
A. Zabernigg, M. Erdel, R. Schranzhofer, K. Berek, K. Gattringer. (2008) Complete cytogenetic remission in a patient with FIP1L1-PDGFRA fusion negative chronic eosinophilic leukemia associated with atypical thrombotic events. memo - Magazine of European Medical Oncology 1:1, 39-41
CrossRef225
Ayalew Tefferi, Hagop Kantarjian. (2008) Long-term experience with imatinib therapy in chronic phase chronic myelogenous leukemia—Remarkable activity with room for improvement. American Journal of Hematology 83:3, 175-177
CrossRef226
Sven Danckwardt, Matthias W Hentze, Andreas E Kulozik. (2008) 3′ end mRNA processing: molecular mechanisms and implications for health and disease. The EMBO Journal 27:3, 482-498
CrossRef227
Helene François, Paul Coppo, Jean-Philippe Hayman, Bruno Fouqueray, Béatrice Mougenot, Pierre Ronco. (2008) Partial Fanconi Syndrome Induced by Imatinib Therapy: A Novel Cause of Urinary Phosphate Loss. American Journal of Kidney Diseases 51:2, 298-301
CrossRef228
Carine Robert, Àgota Apàti, Christine Chomienne, Béla Papp. (2008) All-trans-retinoic acid enhances apoptosis induction by tyrosine kinase inhibitors in the eosinophilic leukemia-derived EoL-1 cell line. Leukemia Research 32:2, 343-346
CrossRef229
Kenji Ishihara, Hajime Kitamura, Kenji Hiraizumi, Motoko Kaneko, Aki Takahashi, OkPyo Zee, Toshio Seyama, JangJa Hong, Kazuo Ohuchi, Noriyasu Hirasawa. (2008) Mechanisms for the proliferation of eosinophilic leukemia cells by FIP1L1-PDGFRα. Biochemical and Biophysical Research Communications 366:4, 1007-1011
CrossRef230
Stephen E. Scranton, Carolyn A. Wild, Ronald W. England. (2008) EPISODIC ANGIOEDEMA WITH EOSINOPHILIA: SUCCESSFUL TREATMENT WITH IMATINIB. Annals of Allergy, Asthma & Immunology 100:2, 172-174
CrossRef231
Hyuck-Jun Yoon, Hyungseop Kim, Hyoung-Seob Park, Yun-Kyeong Cho, Chang-Wook Nam, Seong-Wook Han, Seung-Ho Hur, Yoon-Nyun Kim, Kwon-Bae Kim. (2008) Loeffler's Endocarditis due to Idiopathic Hypereosinophilic Syndrome. Journal of Cardiovascular Ultrasound 16:4, 136
CrossRef232
John O'shea, Cristina M. Tato, Richard Siegel. 2008. Cytokines and cytokine receptors. , 139-171.
CrossRef233
Yoshinori TAKEUCHI, Shinobu MATSUURA, Yasuhito FUJINO, Mayumi NAKAJIMA, Masashi TAKAHASHI, Ko NAKASHIMA, Yusuke SAKAI, Koji UETSUKA, Koichi OHNO, Hiroyuki NAKAYAMA, Hajime TSUJIMOTO. (2008) Hypereosinophilic Syndrome in Two Cats. Journal of Veterinary Medical Science 70:10, 1085-1089
CrossRef234
Ayalew Tefferi. (2008) Is chronic myelomonocytic leukemia more akin to myelodysplastic or myeloproliferative neoplasms and does it matter?. Leukemia & Lymphoma 49:7, 1225-1227
CrossRef235
A Tefferi, J W Vardiman. (2008) Classification and diagnosis of myeloproliferative neoplasms: The 2008 World Health Organization criteria and point-of-care diagnostic algorithms. Leukemia 22:1, 14-22
CrossRef236
Elie Azoulay, Djamel Mokart, Antoine Rabbat, Frédéric Pene, Achille Kouatchet, Fabrice Bruneel, François Vincent, Rebecca Hamidfar, Delphine Moreau, Ismaël Mohammedi, Geraldine Epinette, Gaëtan Beduneau, Vincent Castelain, Arnaud de Lassence, Didier Gruson, Virginie Lemiale, Benoît Renard, Sylvie Chevret, Benoît Schlemmer. (2008) Diagnostic bronchoscopy in hematology and oncology patients with acute respiratory failure: Prospective multicenter data*. Critical Care Medicine 36:1, 100-107
CrossRef237
S. Menif, N. Ben Romdhane, R. Hafsia. (2008) Efficacité de l’imatinib dans les syndromes hyperéosinophiliques associés au transcrit FIP1L1–PDGFRA. La Revue de Médecine Interne 29:1, 65-67
CrossRef238
Priya Koppikar, Ross L. Levine. (2008) JAK2 and MPL Mutations in Myeloproliferative Neoplasms. Acta Haematologica 119:4, 218-225
CrossRef239
Rowena S Lewis, Alister C Ward. (2008) Stat5 as a diagnostic marker for leukemia. Expert Review of Molecular Diagnostics 8:1, 73-82
CrossRef240
Torsten Haferlach, Ulrike Bacher, Wolfgang Kern, Susanne Schnittger, Claudia Haferlach. (2008) The diagnosis of BCR/ABL-negative chronic myeloproliferative diseases (CMPD): a comprehensive approach based on morphology, cytogenetics, and molecular markers. Annals of Hematology 87:1, 1-10
CrossRef241
Animesh Pardanani, Ayalew Tefferi. (2008) Primary eosinophilic disorders: A concise review. Current Hematologic Malignancy Reports 3:1, 37-43
CrossRef242
Choonhee Son. (2008) Eosinophilic Pneumonia. Tuberculosis and Respiratory Diseases 64:3, 177
CrossRef243
Heng Joo Ng, Daryl C.L. Tan, Richard C. Yiu, Gee Fung How. (2008) Maintenance therapy with imatinib appears necessary despite molecular remission in FIP1L1-PDGFRA fusion gene positive hypereosinophilic disorder. Leukemia Research 32:1, 169-171
CrossRef244
Arian Laurence, Seth L. Masters, John O'Shea. 2008. Protein kinase antagonists as therapeutic agents for immunological and inflammatory disorders. , 1341-1351.
CrossRef245
A Tefferi. (2008) The history of myeloproliferative disorders: before and after Dameshek. Leukemia 22:1, 3-13
CrossRef246
Hiroka Iwata, Nobuo Tsuboi, Takeo Ishii, Yoichiro Hara, Ichiro Okido, Hajime Takahashi, Tetsuya Kawamura, Tatsuo Hosoya. (2008) Hypereosinophilia Associated with Increased Serum Levels of Carcinoembryonic Antigen. Internal Medicine 47:10, 963-967
CrossRef247
Kenji Ishihara, Motoko Kaneko, Hajime Kitamura, Aki Takahashi, Jang Ja Hong, Toshio Seyama, Koji Iida, Hiroshi Wada, Noriyasu Hirasawa, Kazuo Ohuchi. (2008) Mechanism for the Decrease in the FIP1L1-PDGFRα Protein Level in EoL-1 Cells by Histone Deacetylase Inhibitors. International Archives of Allergy and Immunology 146:1, 7-10
CrossRef248
Hideaki Yamasawa, Yukihiko Sugiyama, Masashi Bando, Shoji Ohno. (2008) Drug-Induced Pneumonitis Associated with Imatinib Mesylate in a Patient with Idiopathic Pulmonary Fibrosis. Respiration 75:3, 350-354
CrossRef249
Nicholas C.P. Cross, Andreas Reiter. (2008) Fibroblast Growth Factor Receptor and Platelet-Derived Growth Factor Receptor Abnormalities in Eosinophilic Myeloproliferative Disorders. Acta Haematologica 119:4, 199-206
CrossRef250
Ole Haagen Nielsen, Ben Vainer, Jørgen Rask-Madsen. (2008) Non-IBD and noninfectious colitis. Nature Clinical Practice Gastroenterology & Hepatology 5:1, 28-39
CrossRef251
Patrick Brown, Franklin O Smith. (2008) Molecularly Targeted Therapies for Pediatric Acute Myeloid Leukemia. Pediatric Drugs 10:2, 85-92
CrossRef252
Ariel Berlinski, John L. Carroll. 2008. Eosinophilic Lung Diseases and Hypersensitivity Pneumonitis. , 671-680.
CrossRef253
S Burgstaller, S Kreil, K Waghorn, G Metzgeroth, C Preudhomme, K Zoi, H White, D Cilloni, C Zoi, F Brito-Babapulle, C Walz, A Reiter, N C P Cross. (2007) The severity of FIP1L1–PDGFRA-positive chronic eosinophilic leukaemia is associated with polymorphic variation at the IL5RA locus. Leukemia 21:12, 2428-2432
CrossRef254
Robert O'Connor, Martin Clynes, Paul Dowling, Norma O'Donovan, Lorraine O'Driscoll. (2007) Drug resistance in cancer – searching for mechanisms, markers and therapeutic agents. Expert Opinion on Drug Metabolism & Toxicology 3:6, 805-817
CrossRef255
H. Yahara, T. Satoh, T. Hashimoto, H. Yokozeki. (2007) Transient macular erythema with eosinophilia in a patient carrying the FIP1L1-PDGFRA fusion gene. British Journal of Dermatology 157:6, 1284-1287
CrossRef256
E. Cogan, F. Roufosse. (2007) Éosinophilie, syndrome de Churg-Strauss et syndrome hyperéosinophilique. La Revue de Médecine Interne 28, S256-S258
CrossRef257
Marie-Christine Aubry, Michael C. Heinrich, Julian Molina, Jean E. Lewis, Ping Yang, Stephen D. Cassivi, Christopher L. Corless. (2007) Primary adenoid cystic carcinoma of the lung. Cancer 110:11, 2507-2510
CrossRef258
Ashutosh Kumar, Swasti Sinha, Anil Kumar Tripathi. (2007) Chronic eosinophilic leukemia: a case report and review of literature. Indian Journal of Hematology and Blood Transfusion 23:3-4, 112-115
CrossRef259
Mathieu Capovilla, Jean-Michel Cayuela, Chrystèle Bilhou-Nabera, Claude Gardin, Remi Letestu, Fanny Baran-Marzak, Pierre Fenaux, Antoine Martin. (2007) Synchronous FIP1L1–PDGFRA-positive chronic eosinophilic leukemia and T-cell lymphoblastic lymphoma: a bilineal clonal malignancy. European Journal of Haematology 0:0, 071119184130003-???
CrossRef260
A. D. Klion, J. Robyn, I. Maric, W. Fu, L. Schmid, S. Lemery, P. Noel, M. A. Law, M. Hartsell, C. Talar-Williams, M. P. Fay, C. E. Dunbar, T. B. Nutman. (2007) Relapse following discontinuation of imatinib mesylate therapy for FIP1L1/PDGFRA-positive chronic eosinophilic leukemia: implications for optimal dosing. Blood 110:10, 3552-3556
CrossRef261
A. Chase, F. H. Grand, N. C. P. Cross. (2007) Activity of TKI258 against primary cells and cell lines with FGFR1 fusion genes associated with the 8p11 myeloproliferative syndrome. Blood 110:10, 3729-3734
CrossRef262
Yana Pikman, Ross L Levine. (2007) Advances in the molecular characterization of Philadelphia-negative chronic myeloproliferative disorders. Current Opinion in Oncology 19:6, 628-634
CrossRef263
Issa J. Dahabreh, Stavroula Giannouli, Christine Zoi, Katerina Zoi, Michael Voulgarelis, Haralampos M. Moutsopoulos. (2007) Management of Hypereosinophilic Syndrome. Medicine 86:6, 344-354
CrossRef264
Susannah O'Sullivan, Dorit Naot, Karen Callon, Fran Porteous, Anne Horne, Diana Wattie, Maureen Watson, Jill Cornish, Peter Browett, Andrew Grey. (2007) Imatinib Promotes Osteoblast Differentiation by Inhibiting PDGFR Signaling and Inhibits Osteoclastogenesis by Both Direct and Stromal Cell-Dependent Mechanisms. Journal of Bone and Mineral Research 22:11, 1679-1689
CrossRef265
Chiang-Wei Chou, Sanford P.C. Hsu, Ming-Teh Chen, Min-Hsiung Chen, Yang-Hsin Shih, Liang-Shong Lee, Chun-Fu Lin. (2007) Idiopathic hypereosinophilic syndrome with infiltration of cerebrospinal fluid by immature eosinophils: a case report and literature review. Surgical Neurology 68, S52-S55
CrossRef266
Akiko Sada, Yoshio Katayama, Katsuya Yamamoto, Shin Okuyama, Hideshi Nakata, Hirotoshi Shimada, Kazuo Oshimi, Mayumi Mori, Toshimitsu Matsui, . (2007) A multicenter analysis of the FIP1L1-αPDGFR fusion gene in Japanese idiopathic hypereosinophilic syndrome: an aberrant splicing skipping the αPDGFR exon 12. Annals of Hematology 86:12, 855-863
CrossRef267
Taira Maekawa, Eishi Ashihara, Shinya Kimura. (2007) The Bcr-Abl tyrosine kinase inhibitor imatinib and promising new agents against Philadelphia chromosome-positive leukemias. International Journal of Clinical Oncology 12:5, 327-340
CrossRef268
R A Van Etten. (2007) Aberrant cytokine signaling in leukemia. Oncogene 26:47, 6738-6749
CrossRef269
Naomi Galili, Jan Cerny, Azra Raza. (2007) Current Treatment Options: Impact of Cytogenetics on the Course of Myelodysplasia. Current Treatment Options in Oncology 8:2, 117-128
CrossRef270
Alfonso Quintás-Cardama, Hagop Kantarjian, Jorge Cortes. (2007) Flying under the radar: the new wave of BCR–ABL inhibitors. Nature Reviews Drug Discovery 6:10, 834-848
CrossRef271
Pier Paolo Piccaluga, Michela Rondoni, Stefania Paolini, Gianantonio Rosti, Giovanni Martinelli, Michele Baccarani. (2007) Imatinib mesylate in the treatment of hematologic malignancies. Expert Opinion on Biological Therapy 7:10, 1597-1611
CrossRef272
Bo H. Chao, Karen Cline-Parhamovich, John D. Grizzard, Thomas J. Smith. (2007) Fatal Loeffler's endocarditis due to hypereosinophilic syndrome. American Journal of Hematology 82:10, 920-923
CrossRef273
Juan Benezet-Mazuecos, Adolfo de la Fuente, Pedro Marcos-Alberca, Jeronimo Farre. (2007) Loeffler endocarditis: What have we learned?. American Journal of Hematology 82:10, 861-862
CrossRef274
Charles L Sawyers. (2007) Where lies the blame for resistance—tumor or host?. Nature Medicine 13:10, 1144-1145
CrossRef275
Irina Maric, Jamie Robyn, Dean D. Metcalfe, Michael P. Fay, Melody Carter, Todd Wilson, Weiming Fu, Jennifer Stoddard, Linda Scott, Marilyn Hartsell, Arnold Kirshenbaum, Cem Akin, Thomas B. Nutman, Pierre Noel, Amy D. Klion. (2007) KIT D816V–associated systemic mastocytosis with eosinophilia and FIP1L1/PDGFRA-associated chronic eosinophilic leukemia are distinct entities. Journal of Allergy and Clinical Immunology 120:3, 680-687
CrossRef276
Brijesh Arora, Ayalew Tefferi. (2007) Advances in molecular diagnostics of myeloproliferative disorders. Expert Opinion on Medical Diagnostics 1:1, 65-80
CrossRef277
Anna D. Panani. (2007) Cytogenetic and molecular aspects of Philadelphia negative chronic myeloproliferative disorders: Clinical implications. Cancer Letters 255:1, 12-25
CrossRef278
Ross L. Levine, Animesh Pardanani, Ayalew Tefferi, D. Gary Gilliland. (2007) Role of JAK2 in the pathogenesis and therapy of myeloproliferative disorders. Nature Reviews Cancer 7:9, 673-683
CrossRef279
Matko Kalac, Alfonso Quintás-Cardama, Radovan Vrhovac, Hagop Kantarjian, Srdan Verstovsek. (2007) A critical appraisal of conventional and investigational drug therapy in patients with hypereosinophilic syndrome and clonal eosinophilia. Cancer 110:5, 955-964
CrossRef280
John A Curtin, Daniel Pinkel, Boris C Bastian. (2007) Absence of PDGFRA Mutations in Primary Melanoma. Journal of Investigative Dermatology
CrossRef281
Kotaro Shide, Kazuya Shimoda, Kenjirou Kamezaki, Haruko Kakumitsu, Takashi Kumano, Akihiko Numata, Fumihiko Ishikawa, Katsuto Takenaka, Ken Yamamoto, Tadashi Matsuda, Mine Harada. (2007) Tyk2 mutation homologous to V617F Jak2 is not found in essential thrombocythaemia, although it induces constitutive signaling and growth factor independence. Leukemia Research 31:8, 1077-1084
CrossRef282
C E Curtis, F H Grand, K Waghorn, T P Sahoo, J George, N C P Cross. (2007) A novel ETV6-PDGFRB fusion transcript missed by standard screening in a patient with an imatinib responsive chronic myeloproliferative disease. Leukemia 21:8, 1839-1841
CrossRef283
Kristin M. Leiferman, Gerald J. Gleich, Margot S. Peters. (2007) Dermatologic Manifestations of the Hypereosinophilic Syndromes. Immunology and Allergy Clinics of North America 27:3, 415-441
CrossRef284
Barbara J. Bain, Sarah H. Fletcher. (2007) Chronic Eosinophilic Leukemias and the Myeloproliferative Variant of the Hypereosinophilic Syndrome. Immunology and Allergy Clinics of North America 27:3, 377-388
CrossRef285
Steven J. Ackerman, Bruce S. Bochner. (2007) Mechanisms of Eosinophilia in the Pathogenesis of Hypereosinophilic Disorders. Immunology and Allergy Clinics of North America 27:3, 357-375
CrossRef286
Amy D. Klion. (2007) Approach to the Therapy of Hypereosinophilic Syndromes. Immunology and Allergy Clinics of North America 27:3, 551-560
CrossRef287
Hans-Uwe Simon, Jan Cools. (2007) Novel Approaches to Therapy of Hypereosinophilic Syndromes. Immunology and Allergy Clinics of North America 27:3, 519-527
CrossRef288
Li Zuo, Marc E. Rothenberg. (2007) Gastrointestinal Eosinophilia. Immunology and Allergy Clinics of North America 27:3, 443-455
CrossRef289
Hassane Izzedine, Olivier Rixe, Bertrand Billemont, Alain Baumelou, Gilbert Deray. (2007) Angiogenesis Inhibitor Therapies: Focus on Kidney Toxicity and Hypertension. American Journal of Kidney Diseases 50:2, 203-218
CrossRef290
Florence Roufosse, Elie Cogan, Michel Goldman. (2007) Lymphocytic Variant Hypereosinophilic Syndromes. Immunology and Allergy Clinics of North America 27:3, 389-413
CrossRef291
Javed Sheikh, Peter F. Weller. (2007) Clinical Overview of Hypereosinophilic Syndromes. Immunology and Allergy Clinics of North America 27:3, 333-355
CrossRef292
Princess U. Ogbogu, Douglas R. Rosing, McDonald K. Horne. (2007) Cardiovascular Manifestations of Hypereosinophilic Syndromes. Immunology and Allergy Clinics of North America 27:3, 457-475
CrossRef293
Frédéric Lambert, Pierre Heimann, Christian Herens, Alain Chariot, Vincent Bours. (2007) A Case of FIP1L1-PDGFRA-Positive Chronic Eosinophilic Leukemia with a Rare FIP1L1 Breakpoint. The Journal of Molecular Diagnostics 9:3, 414-419
CrossRef294
J Pan, A Quintás-Cardama, T Manshouri, F J Giles, P Lamb, A Tefferi, J Cortes, H Kantarjian, S Verstovsek. (2007) The novel tyrosine kinase inhibitor EXEL-0862 induces apoptosis in human FIP1L1-PDGFR-α-expressing cells through caspase-3-mediated cleavage of Mcl-1. Leukemia 21:7, 1395-1404
CrossRef295
Alexandra Böhm, Manuela Födinger, Friedrich Wimazal, Oskar A. Haas, Matthias Mayerhofer, Wolfgang R. Sperr, Harald Esterbauer, Peter Valent. (2007) Eosinophilia in systemic mastocytosis: Clinical and molecular correlates and prognostic significance. Journal of Allergy and Clinical Immunology 120:1, 192-199
CrossRef296
T.-l. Gu, T. Mercher, J. W. Tyner, V. L. Goss, D. K. Walters, M. G. Cornejo, C. Reeves, L. Popova, K. Lee, M. C. Heinrich, J. Rush, M. Daibata, I. Miyoshi, D. G. Gilliland, B. J. Druker, R. D. Polakiewicz. (2007) A novel fusion of RBM6 to CSF1R in acute megakaryoblastic leukemia. Blood 110:1, 323-333
CrossRef297
D Cilloni, F Messa, G Martinelli, E Gottardi, F Arruga, I Defilippi, S Carturan, E Messa, M Fava, E Giugliano, V Rosso, R Catalano, S Merante, P Nicoli, M Rondoni, E Ottaviani, S Soverini, M Tiribelli, F Pane, M Baccarani, G Saglio. (2007) WT1 transcript amount discriminates secondary or reactive eosinophilia from idiopathic hypereosinophilic syndrome or chronic eosinophilic leukemia. Leukemia 21:7, 1442-1450
CrossRef298
Claire E. Curtis, Francis H. Grand, Pellegrino Musto, Andrew Clark, John Murphy, Gianni Perla, Maria M. Minervini, Janet Stewart, Andreas Reiter, Nicholas C. P. Cross. (2007) Two novel imatinib-responsive PDGFRA fusion genes in chronic eosinophilic leukaemia. British Journal of Haematology 138:1, 77-81
CrossRef299
A. Pellagatti, M. Jadersten, A.-M. Forsblom, H. Cattan, B. Christensson, E. K. Emanuelsson, M. Merup, L. Nilsson, J. Samuelsson, B. Sander, J. S. Wainscoat, J. Boultwood, E. Hellstrom-Lindberg. (2007) Lenalidomide inhibits the malignant clone and up-regulates the SPARC gene mapping to the commonly deleted region in 5q- syndrome patients. Proceedings of the National Academy of Sciences 104:27, 11406-11411
CrossRef300
Dagmar Simon, Hans-Uwe Simon. (2007) Eosinophilic disorders. Journal of Allergy and Clinical Immunology 119:6, 1291-1300
CrossRef301
Marta Mauri, Marta García, Esteban Reynaga, Elena Ramila. (2007) Síndrome hipereosinofílico y endocarditis de Löffler con reordenamiento FIP1L1-PDGFRA: efectividad del tratamiento con imatinib mesilato. Medicina Clínica 129:4, 159
CrossRef302
E. Messa, D. Cilloni, G. Saglio. (2007) A young man with persistent eosinophilia. Internal and Emergency Medicine 2:2, 107-112
CrossRef303
G Metzgeroth, C Walz, J Score, R Siebert, S Schnittger, C Haferlach, H Popp, T Haferlach, P Erben, J Mix, M C Müller, H Beneke, L Müller, F Del Valle, W E Aulitzky, G Wittkowsky, N Schmitz, C Schulte, K Müller-Hermelink, E Hodges, S J Whittaker, F Diecker, H Döhner, P Schuld, R Hehlmann, A Hochhaus, N C P Cross, A Reiter. (2007) Recurrent finding of the FIP1L1-PDGFRA fusion gene in eosinophilia-associated acute myeloid leukemia and lymphoblastic T-cell lymphoma. Leukemia 21:6, 1183-1188
CrossRef304
J. V. Jovanovic, J. Score, K. Waghorn, D. Cilloni, E. Gottardi, G. Metzgeroth, P. Erben, H. Popp, C. Walz, A. Hochhaus, C. Roche-Lestienne, C. Preudhomme, E. Solomon, J. Apperley, M. Rondoni, E. Ottaviani, G. Martinelli, F. Brito-Babapulle, G. Saglio, R. Hehlmann, N. C. P. Cross, A. Reiter, D. Grimwade, . (2007) Low-dose imatinib mesylate leads to rapid induction of major molecular responses and achievement of complete molecular remission in FIP1L1-PDGFRA positive chronic eosinophilic leukemia. Blood 109:11, 4635-4640
CrossRef305
Ayako Arai, Weihua Yan, Shihoko Wakabayashi, Shin Hayashi, Johji Inazawa, Osamu Miura. (2007) Successful imatinib treatment of cardiac involvement of FIP1L1-PDGFRA-positive chronic eosinophilic leukemia followed by severe Hepatotoxicity. International Journal of Hematology 86:3, 233-237
CrossRef306
Sonja Burgstaller, Andreas Reiter, Nicholas C. P. Cross. (2007) BCR-ABL-negative chronic myeloid leukemia. Current Hematologic Malignancy Reports 2:2, 75-82
CrossRef307
Thomas Force, Daniela S. Krause, Richard A. Van Etten. (2007) Molecular mechanisms of cardiotoxicity of tyrosine kinase inhibition. Nature Reviews Cancer 7:5, 332-344
CrossRef308
Silke C. Hofmann, Kristin Technau, Antonia M.S. Müller, Michael Lübbert, Leena Bruckner-Tuderman. (2007) Bullous pemphigoid associated with hypereosinophilic syndrome: Simultaneous response to imatinib. Journal of the American Academy of Dermatology 56:5, S68-S72
CrossRef309
Vincenzo Pitini, Carmela Arrigo, Giuseppe Altavilla, Claudia Naro, Maria Righi. (2007) Imatinib-induced apoptosis in the eosinophils of patients with a hypereosinophilic syndrome: A surrogate marker of response?. Leukemia Research 31:5, 725-726
CrossRef310
Daniel J. DeAngelo. (2007) Role of Imatinib-Sensitive Tyrosine Kinases in the Pathogenesis of Chronic Myeloproliferative Disorders. Seminars in Hematology 44, S17-S30
CrossRef311
Giovanni Martinelli, Michela Rondoni, Emanuela Ottaviani, Stefania Paolini, Michele Baccarani. (2007) Hypereosinophilic Syndrome and Molecularly Targeted Therapy. Seminars in Hematology 44, S4-S16
CrossRef312
G. Wozel. (2007) Eosinophile Dermatosen. Der Hautarzt 58:4, 347-360
CrossRef313
Ryoichi Sakuta, Yuzo Tomita, Makiko Ohashi, Toshiro Nagai, Nobuyuki Murakami. (2007) Idiopathic hypereosinophilic syndrome complicated by central sinovenous thrombosis. Brain and Development 29:3, 182-184
CrossRef314
Ayalew Tefferi, James W Vardiman. (2007) The diagnostic interface between histology and molecular tests in myeloproliferative disorders. Current Opinion in Hematology 14:2, 115-122
CrossRef315
K Yalamanchili, D Liu, K Seiter. (2007) Myelofibrosis with a novel translocation, t(1;3)(q31;q23), and response to imatinib mesylate. Leukemia 21:3, 577-578
CrossRef316
B Crescenzi, A Chase, R La Starza, D Beacci, V Rosti, A Gallì, G Specchia, M F Martelli, P Vandenberghe, J Cools, A V Jones, N C P Cross, P Marynen, C Mecucci. (2007) FIP1L1-PDGFRA in chronic eosinophilic leukemia and BCR-ABL1 in chronic myeloid leukemia affect different leukemic cells. Leukemia 21:3, 397-402
CrossRef317
F. Weissinger, D. Fabbro, H. Einsele. (2007) Signalübermittlungsinhibitoren. Der Onkologe 13:3, 213-226
CrossRef318
Kenji Ishihara, Aki Takahashi, Motoko Kaneko, Hiroki Sugeno, Noriyasu Hirasawa, JangJa Hong, OkPyo Zee, Kazuo Ohuchi. (2007) Differentiation of eosinophilic leukemia EoL-1 cells into eosinophils induced by histone deacetylase inhibitors. Life Sciences 80:13, 1213-1220
CrossRef319
A Buijs, M Bruin. (2007) Fusion of FIP1L1 and RARA as a result of a novel t(4;17)(q12;q21) in a case of juvenile myelomonocytic leukemia. Leukemia
CrossRef320
Hajnalka Andrikovics, Anikó Szilvási, Nóra Meggyesi, Viktória Király, Gabriella Halm, Sándor Lueff, Sarolta Nahajevszky, Gábor Mikala, Andrea Sipos, Nóra Lovas, Zoltán Csukly, Zoltán Mátrai, Júlia Tamáska, Attila Tordai, Tamás Masszi. (2007) A 2-es típusú Janus tirozin kináz Val617Phe aktiváló pontmutáció szerepe és kimutatásának jelentősége myeloproliferatív szindrómában. Orvosi Hetilap 148:5, 203-210
CrossRef321
F Neumann, A Poelitz, B Hildebrandt, R Fenk, R Haas, B Royer-Pokora, U Germing. (2007) The tyrosine-kinase inhibitor imatinib induces long-term remission in a patient with chronic myelogenous leukemia with translocation t(4;22). Leukemia
CrossRef322
E T P Penserga, T Skorski. (2007) Fusion tyrosine kinases: a result and cause of genomic instability. Oncogene 26:1, 11-20
CrossRef323
Ai Inoue, Kojiro Michitaka, Shuichiro Shigematsu, Ichiro Konishi, Masashi Hirooka, Yoichi Hiasa, Hidetaka Matsui, Bunzo Matsuura, Norio Horiike, Takaaki Hato, Hiroaki Miyaoka, Morikazu Onji. (2007) Budd-Chiari Syndrome Associated with Hypereosinophilic Syndrome; A Case Report. Internal Medicine 46:14, 1095-1100
CrossRef324
Donald Macdonald, Nicholas C. Cross. (2007) Chronic Myeloproliferative Disorders: The Role of Tyrosine Kinases in Pathogenesis, Diagnosis and Therapy. Pathobiology 74:2, 81-88
CrossRef325
K Tokita, K Maki, J Tadokoro, Y Nakamura, Y Arai, K Sasaki, M Eguchi-Ishimae, M Eguchi, K Mitani. (2007) Chronic idiopathic myelofibrosis expressing a novel type of TEL-PDGFRB chimaera responded to imatinib mesylate therapy. Leukemia 21:1, 190-192
CrossRef326
Motoko Kaneko, Kenji Ishihara, Aki Takahashi, JangJa Hong, Noriyasu Hirasawa, OkPyo Zee, Kazuo Ohuchi. (2007) Mechanism for the Differentiation of EoL-1 Cells into Eosinophils by Histone Deacetylase Inhibitors. International Archives of Allergy and Immunology 143:1, 28-32
CrossRef327
S. Barete. (2007) Mastocitosis. EMC - Dermatolog??a 41:2, 1-17
CrossRef328
Simon P. Hogan. (2007) Recent Advances in Eosinophil Biology. International Archives of Allergy and Immunology 143:1, 3-14
CrossRef329
Sarah Fletcher, Saad Abdalla, Matthew Edwards, Barbara J Bain. (2007) Case 32. Eosinophilia: Reactive or neoplastic?. Leukemia & Lymphoma 48:1, 174-176
CrossRef330
Sarah Fletcher, Barbara Bain. (2007) Diagnosis and treatment of hypereosinophilic syndromes. Current Opinion in Hematology 14:1, 37-42
CrossRef331
Makoto Kobayashi, Naoki Komatsu, Yoshio Kuwayama, Kentaro Bandobashi, Tetsuya Kubota, Yoshiki Uemura, Hirokuni Taguchi. (2007) Idiopathic Hypereosinophilic Syndrome Presenting Acute Abdomen. Internal Medicine 46:10, 675-678
CrossRef332
Ross L Levine, D Gary Gilliland. (2007) JAK-2 mutations and their relevance to myeloproliferative disease. Current Opinion in Hematology 14:1, 43-47
CrossRef333
Markus Warmuth, Sungjoon Kim, Xiang-ju Gu, Gang Xia, Francisco Adrián. (2007) Ba/F3 cells and their use in kinase drug discovery. Current Opinion in Oncology 19:1, 55-60
CrossRef334
Campbell, Peter J., Green, Anthony R., . (2006) The Myeloproliferative Disorders. New England Journal of Medicine 355:23, 2452-2466
Full Text335
Thomas de Raedt, Jan Cools, Maria Debiec–Rychter, Hilde Brems, Nicole Mentens, Raf Sciot, Jacques Himpens, Ivo de Wever, Patrick Schöffski, Peter Marynen, Eric Legius. (2006) Intestinal Neurofibromatosis Is a Subtype of Familial GIST and Results From a Dominant Activating Mutation in PDGFRA. Gastroenterology 131:6, 1907-1912
CrossRef336
Nicholas W Choong, Ezra EW Cohen. (2006) Forthcoming receptor tyrosine kinase inhibitors. Expert Opinion on Therapeutic Targets 10:6, 793-797
CrossRef337
Luis M Schang. (2006) First demonstration of the effectiveness of inhibitors of cellular protein kinases in antiviral therapy. Expert Review of Anti-infective Therapy 4:6, 953-956
CrossRef338
Srdan Verstovsek, Francis J. Giles, Alfonso Quintás-Cardama, Taghi Manshouri, Ly Huynh, Paul Manley, Jorge Cortes, Ayalew Tefferi, Hagop Kantarjian. (2006) Activity of AMN107, a novel aminopyrimidine tyrosine kinase inhibitor, against human FIP1L1-PDGFR-α-expressing cells. Leukemia Research 30:12, 1499-1505
CrossRef339
Michael Davies, Bryan Hennessy, Gordon B Mills. (2006) Point mutations of protein kinases and individualised cancer therapy. Expert Opinion on Pharmacotherapy 7:16, 2243-2261
CrossRef340
C. S. Zürn, B. R. Brehm, N. Rüb, H. Langer, K. Klingel, S. Kröber, R. Kandolf, B. Klumpp, S. Miller, M. Gawaz. (2006) Rezidivierende transitorische ischämische Attacken bei einer Patientin mit Pansinusitis. Der Internist 47:11, 1165-1172
CrossRef341
R.F. Davis, P. Dusanjh, A. Majid, A. Fletcher, A. Wardlaw, R. Siebert, M.J.S. Dyer, K.E. Harman. (2006) Eosinophilic cellulitis as a presenting feature of chronic eosinophilic leukaemia, secondary to a deletion on chromosome 4q12 creating the FIP1L1?PDGFRA fusion gene. British Journal of Dermatology 155:5, 1087-1089
CrossRef342
Amy Wagelie-Steffen, Seema S. Aceves. (2006) Eosinophilic disorders in children. Current Allergy and Asthma Reports 6:6, 475-482
CrossRef343
Akos Czibere, Franck Grall, Manuel Aivado. (2006) Perspectives of proteomics in acute myeloid leukemia. Expert Review of Anticancer Therapy 6:11, 1663-1675
CrossRef344
Christopher L. Corless, Patina Harrell, Mario Lacouture, Troy Bainbridge, Claudia Le, Ken Gatter, Clifton White, Scott Granter, Michael C. Heinrich. (2006) Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia. The Journal of Molecular Diagnostics 8:5, 604-612
CrossRef345
T. McPherson, E.W. Cowen, E. McBurney, A.D. Klion. (2006) Platelet-derived growth factor receptor-?-associated hypereosinophilic syndrome and lymphomatoid papulosis. British Journal of Dermatology 155:4, 824-826
CrossRef346
Alfonso Quintas-Cardama, Ahmed Aribi, Jorge Cortes, Francis J. Giles, Hagop Kantarjian, Srdan Verstovsek. (2006) Novel approaches in the treatment of systemic mastocytosis. Cancer 107:7, 1429-1439
CrossRef347
Christoph Walz, Claire Curtis, Susanne Schnittger, Beate Schultheis, Georgia Metzgeroth, Claudia Schoch, Eva Lengfelder, Philipp Erben, Martin C. Müller, Torsten Haferlach, Andreas Hochhaus, Rüdiger Hehlmann, Nicholas C. P. Cross, Andreas Reiter. (2006) Transient response to imatinib in a chronic eosinophilic leukemia associated with ins(9;4)(q33;q12q25) and aCDK5RAP2-PDGFRA fusion gene. Genes, Chromosomes and Cancer 45:10, 950-956
CrossRef348
Hiroaki Ohnishi, Koji Kandabashi, Yoshiharu Maeda, Machiko Kawamura, Takashi Watanabe. (2006) Chronic eosinophilic leukaemia with FIP1L1–PDGFRA fusion and T674I mutation that evolved from Langerhans cell histiocytosis with eosinophilia after chemotherapy. British Journal of Haematology 134:5, 547-549
CrossRef349
Stefan Florian, Harald Esterbauer, Thomas Binder, Leonhard Müllauer, Oskar A. Haas, Wolfgang R. Sperr, Christian Sillaber, Peter Valent. (2006) Systemic mastocytosis (SM) associated with chronic eosinophilic leukemia (SM-CEL): Detection of FIP1L1/PDGFRα, classification by WHO criteria, and response to therapy with imatinib. Leukemia Research 30:9, 1201-1205
CrossRef350
Jason Gotlib, N.C.P. Cross, D. Gary Gilliland. (2006) Eosinophilic disorders: Molecular pathogenesis, new classification, and modern therapy. Best Practice & Research Clinical Haematology 19:3, 535-569
CrossRef351
David P. Steensma. (2006) JAK2 V617F in Myeloid Disorders: Molecular Diagnostic Techniques and Their Clinical Utility. The Journal of Molecular Diagnostics 8:4, 397-411
CrossRef352
Ayalew Tefferi. (2006) Classic and atypical myeloproliferative disorders. Best Practice & Research Clinical Haematology 19:3, 361-364
CrossRef353
Ayalew Tefferi, Gary Gilliland. (2006) Classification of chronic myeloid disorders: From Dameshek towards a semi-molecular system. Best Practice & Research Clinical Haematology 19:3, 365-385
CrossRef354
A. Pardanani, C. Akin, P. Valent. (2006) Pathogenesis, clinical features, and treatment advances in mastocytosis. Best Practice & Research Clinical Haematology 19:3, 595-615
CrossRef355
Cem Akin. (2006) Molecular Diagnosis of Mast Cell Disorders. The Journal of Molecular Diagnostics 8:4, 412-419
CrossRef356
R. H. Alvarez, H. M. Kantarjian, J. E. Cortes. (2006) Biology of Platelet-Derived Growth Factor and Its Involvement in Disease. Mayo Clinic Proceedings 81:9, 1241-1257
CrossRef357
Jamie Robyn. (2006) Imatinib-responsive hypereosinophilic syndrome. Leukemia Research 30:8, 915-916
CrossRef358
H A Vu, P T Xinh, M Masuda, T Motoji, A Toyoda, Y Sakaki, K Tokunaga, Y Sato. (2006) FLT3 is fused to ETV6 in a myeloproliferative disorder with hypereosinophilia and a t(12;13)(p13;q12) translocation. Leukemia 20:8, 1414-1421
CrossRef359
Asim Khwaja. (2006) The role of Janus kinases in haemopoiesis and haematological malignancy. British Journal of Haematology 134:4, 366-384
CrossRef360
A. Willson, P. Cannell, D. Joske, B. Augustson. (2006) Imatinib-induced cytogenetic remission in chronic eosinophilic leukaemia. Internal Medicine Journal 36:8, 537-538
CrossRef361
A. Pardanani, R.P. Ketterling, C.-Y. Li, M.M. Patnaik, A.P. Wolanskyj, M.A. Elliott, J.K. Camoriano, J.H. Butterfield, G.W. Dewald, A. Tefferi. (2006) FIP1L1-PDGFRA in eosinophilic disorders: Prevalence in routine clinical practice, long-term experience with imatinib therapy, and a critical review of the literature. Leukemia Research 30:8, 965-970
CrossRef362
Thomas A. Abrams, Scott M. Schuetze. (2006) Targeted therapy for dermatofibrosarcoma protuberans. Current Oncology Reports 8:4, 291-296
CrossRef363
N. Widmer, L. A. Decosterd, C. Csajka, S. Leyvraz, M. A. Duchosal, A. Rosselet, B. Rochat, C. B. Eap, H. Henry, J. Biollaz, T. Buclin. (2006) Population pharmacokinetics of imatinib and the role of alpha1-acid glycoprotein. British Journal of Clinical Pharmacology 62:1, 97-112
CrossRef364
Talpaz, Moshe, Shah, Neil P., Kantarjian, Hagop, Donato, Nicholas, Nicoll, John, Paquette, Ron, Cortes, Jorge, O'Brien, Susan, Nicaise, Claude, Bleickardt, Eric, Blackwood-Chirchir, M. Anne, Iyer, Vishwanath, Chen, Tai-Tsang, Huang, Fei, Decillis, Arthur P., Sawyers, Charles L., . (2006) Dasatinib in Imatinib-Resistant Philadelphia Chromosome–Positive Leukemias. New England Journal of Medicine 354:24, 2531-2541
Full Text365
Patrick C Ma, Xiaodong Zhang, Zhenghe J Wang. (2006) High-throughput mutational analysis of the human cancer genome. Pharmacogenomics 7:4, 597-612
CrossRef366
Grzegorz Helbig, Beata Stella-Holowiecka, Sebastian Grosicki, Grazyna Bober, Magorzata Krawczyk, Jerzy Wojnar, Andreas Reiter, Andreas Hochhaus, Jerzy Holowiecki. (2006) The results of imatinib therapy for patients with primary eosinophilic disorders. European Journal of Haematology 76:6, 535-536
CrossRef367
J.S. Kuk, J.A. MacEachern, P. Soamboonsrup, A. McFarlane, A. Benger, W. Patterson, L. Yang, M.R. Trus. (2006) Chronic eosinophilic leukemia presenting with autoimmune hemolytic anemia and erythrophagocytosis by eosinophils. American Journal of Hematology 81:6, 458-461
CrossRef368
Ayalew Tefferi, Mrinal M. Patnaik, Animesh Pardanani. (2006) Eosinophilia: secondary, clonal and idiopathic. British Journal of Haematology 133:5, 468-492
CrossRef369
Martha Wadleigh, D. Gary Gilliland. (2006) The JAK2V617F tyrosine kinase mutation in myeloproliferative disorders: Summary of published literature and a perspective. Current Hematologic Malignancy Reports 1:2, 75-80
CrossRef370
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Ebeling, Sally H.Peters, Christine C., Chung, Raymond T., Iafrate, A. John, Amrein, Philip C., Sahani, Dushyant V., Misdraji, Joseph, . (2006) Case 15-2006. New England Journal of Medicine 354:20, 2166-2175
Full Text371
J Score, C Curtis, K Waghorn, M Stalder, M Jotterand, F H Grand, N C P Cross. (2006) Identification of a novel imatinib responsive KIF5B-PDGFRA fusion gene following screening for PDGFRA overexpression in patients with hypereosinophilia. Leukemia 20:5, 827-832
CrossRef372
F. Ballanger, S. Barbarot, M. Hamidou. (2006) Syndromes hyperéosinophiliques primitifs : actualités. Annales de Dermatologie et de Vénéréologie 133:5, 487-494
CrossRef373
Jochen Rössler, Izabella Zambrzycka, Jeanette Lagodny, Udo Kontny, Charlotte Marie Niemeyer. (2006) Effect of STI-571 (imatinib mesylate) in combination with retinoic acid and γ-irradiation on viability of neuroblastoma cells. Biochemical and Biophysical Research Communications 342:4, 1405-1412
CrossRef374
Marc E. Rothenberg, Simon P. Hogan. (2006) THE EOSINOPHIL. Annual Review of Immunology 24:1, 147-174
CrossRef375
A. Tefferi, M. A. Elliott, A. Pardanani. (2006) Atypical Myeloproliferative Disorders: Diagnosis and Management. Mayo Clinic Proceedings 81:4, 553-563
CrossRef376
F. Carlomagno, S. Anaganti, T. Guida, G. Salvatore, G. Troncone, S. M. Wilhelm, M. Santoro. (2006) BAY 43-9006 Inhibition of Oncogenic RET Mutants. JNCI Journal of the National Cancer Institute 98:5, 326-334
CrossRef377
Michael A. Morgan, Christoph W. M. Reuter. (2006) Molecularly targeted therapies in myelodysplastic syndromes and acute myeloid leukemias. Annals of Hematology 85:3, 139-163
CrossRef378
Shadmehr Demehri, Amie Corbin, Marc Loriaux, Brian J. Druker, Michael W. Deininger. (2006) Establishment of a murine model of aggressive systemic mastocytosis/mast cell leukemia. Experimental Hematology 34:3, 284-288
CrossRef379
Jamie Robyn, Steven Lemery, J. Philip McCoy, Joseph Kubofcik, Yae-Jean Kim, Svetlana Pack, Thomas B. Nutman, Cynthia Dunbar, Amy D. Klion. (2006) Multilineage involvement of the fusion gene in patients with FIP1L1/PDGFRA-positive hypereosinophilic syndrome. British Journal of Haematology 132:3, 286-292
CrossRef380
Christoph Walz, Martin Sattler. (2006) Novel targeted therapies to overcome imatinib mesylate resistance in chronic myeloid leukemia (CML). Critical Reviews in Oncology/Hematology 57:2, 145-164
CrossRef381
K De Keersmaecker, J Cools. (2006) Chronic myeloproliferative disorders: a tyrosine kinase tale. Leukemia 20:2, 200-205
CrossRef382
R Nakamura, S Chakrabarti, C Akin, J Robyn, E Bahceci, A Greene, R Childs, C E Dunbar, D D Metcalfe, A J Barrett. (2006) A pilot study of nonmyeloablative allogeneic hematopoietic stem cell transplant for advanced systemic mastocytosis. Bone Marrow Transplantation 37:4, 353-358
CrossRef383
Per Venge. 2006. Eosinophilia and the Hypereosinophil Syndromes. .
CrossRef384
Fumihiko Monma, Kazuhiro Nishii, Felipe Lorenzo, Eiji Usui, Yuichiro Ueda, Yasuyuki Watanabe, Keiki Kawakami, Koji Oka, Hidetsugu Mitani, Takao Sekine, Shigehisa Tamaki, Minoru Mizutani, Fumiharu Yagasaki, Noriko Doki, Syuichi Miyawaki, Naoyuki Katayama, Hiroshi Shiku. (2006) Molecular analysis of PDGFRalpha/beta genes in core binding factor leukemia with eosinophilia. European Journal of Haematology 76:1, 18-22
CrossRef385
Edward M. Scolnick, Tracey Petryshen, Pamela Sklar. (2006) Schizophrenia: Do the Genetics and Neurobiology of Neuregulin Provide a Pathogenesis Model?. Harvard Review of Psychiatry 14:2, 64-77
CrossRef386
ITARU MATSUMURA. (2006) Nihon Naika Gakkai Zasshi 95:7, 1375-1381
CrossRef387
Yana Pikman, Benjamin H. Lee, Thomas Mercher, Elizabeth McDowell, Benjamin L. Ebert, Maricel Gozo, Adam Cuker, Gerlinde Wernig, Sandra Moore, Ilene Galinsky, Daniel J. DeAngelo, Jennifer J. Clark, Stephanie J. Lee, Todd R. Golub, Martha Wadleigh, D. Gary Gilliland, Ross L. Levine. (2006) MPLW515L Is a Novel Somatic Activating Mutation in Myelofibrosis with Myeloid Metaplasia. PLoS Medicine 3:7, e270
CrossRef388
Tetsuya Adachi, Satoko Hanaka, Tomoko Yano, Koichi Yamamura, Hisanao Yoshihara, Hiroyuki Nagase, Junichi Chihara, Ken Ohta. (2006) The Role of Platelet-Derived Growth Factor Receptor in Eotaxin Signaling of Eosinophils. International Archives of Allergy and Immunology 140:1, 28-34
CrossRef389
Antonia M. S. Müller, Uwe M. Martens, Silke C. Hofmann, Leena Bruckner-Tuderman, Roland Mertelsmann, Michael Lübbert. (2006) Imatinib mesylate as a novel treatment option for hypereosinophilic syndrome: two case reports and a comprehensive review of the literature. Annals of Hematology 85:1, 1-16
CrossRef390
Takeshi Kawasaki, Naoki Sano, Hideyuki Murakoshi, Satoru Shibukawa, Tokuo Saito, Kuniaki Matsui. (2006) Idiopathic hypereosinophilic syndrome with systemic and localized edema.. Nihon Naika Gakkai Zasshi 95:4, 745-747
CrossRef391
Nicholas M. Levinson, Olga Kuchment, Kui Shen, Matthew A. Young, Michael Koldobskiy, Martin Karplus, Philip A. Cole, John Kuriyan. (2006) A Src-Like Inactive Conformation in the Abl Tyrosine Kinase Domain. PLoS Biology 4:5, e144
CrossRef392
Maria E. Nelson, David P. Steensma. (2006) JAK2 V617F in myeloid disorders: What do we know now, and where are we headed?. Leukemia & Lymphoma 47:2, 177-194
CrossRef393
Atsushi Sadanaga, Hitoshi Nakashima, Kohsuke Masutani, Katsuhisa Miyake, Sakiko Shimizu, Takashi Igawa, Naonobu Sugiyama, Hiroaki Niiro, Hideki Hirakata, Mine Harada. (2005) Amelioration of autoimmune nephritis by imatinib in MRL/lpr mice. Arthritis & Rheumatism 52:12, 3987-3996
CrossRef394
Susana Rives, I??aki Alcorta, Teresa Toll, Esperanza Tuset, Jes??s Estella, Nicholas C. P Cross. (2005) Idiopathic Hypereosinophilic Syndrome in Children. Journal of Pediatric Hematology/Oncology 27:12, 663-665
CrossRef395
Gerald J Gleich, Kristin M Leiferman. (2005) The hypereosinophilic syndromes: still more heterogeneity. Current Opinion in Immunology 17:6, 679-684
CrossRef396
Elizabeth O Hexner, Alan M Gewirtz. (2005) RNA interference for treating haematological malignancies. Expert Opinion on Biological Therapy 5:12, 1585-1592
CrossRef397
Thomas M. Leath, Manav Singla, Stephen P. Peters. (2005) Novel and emerging therapies for asthma. Drug Discovery Today 10:23-24, 1647-1655
CrossRef398
Paul William Manley, Sandra W. Cowan-Jacob, Jürgen Mestan. (2005) Advances in the structural biology, design and clinical development of Bcr-Abl kinase inhibitors for the treatment of chronic myeloid leukaemia. Biochimica et Biophysica Acta (BBA) - Proteins & Proteomics 1754:1-2, 3-13
CrossRef399
Marina Bousquet, Cathy Quelen, Véronique De Mas, Eliane Duchayne, Blandine Roquefeuil, Georges Delsol, Guy Laurent, Nicole Dastugue, Pierre Brousset. (2005) The t(8;9)(p22;p24) translocation in atypical chronic myeloid leukaemia yields a new PCM1-JAK2 fusion gene. Oncogene 24:48, 7248-7252
CrossRef400
M. Huntgeburth, M. Lindner, J. W. U. Fries, U. C. Hoppe. (2005) Hypereosinophilic syndrome associated with acute necrotizing myocarditis and cardiomyopathy. Zeitschrift für Kardiologie 94:11, 761-766
CrossRef401
N. Kemmler, W. K. Peitsch, E. Glorer, S. Goerdt. (2005) Hypereosinophile Dermatitis. Der Hautarzt 56:11, 1060-1067
CrossRef402
Miguel L Stein, Marc E Rothenberg. (2005) Hypereosinophilic syndromes and new therapeutic approaches including anti-IL-5. Expert Review of Clinical Immunology 1:4, 633-644
CrossRef403
Seth J. Corey. (2005) Targeted therapy: For kids, too. Pediatric Blood & Cancer 45:5, 623-634
CrossRef404
H. Jeffrey Wilkins, Martin M. Crane, Kelly Copeland, William V. Williams. (2005) Hypereosinophilic syndrome: An update. American Journal of Hematology 80:2, 148-157
CrossRef405
Zhizhuang Joe Zhao, William Vainchenker, Sanford B. Krantz, Nicole Casadevall, Stefan N. Constantinescu. (2005) Role of Tyrosine Kinases and Phosphatases in Polycythemia Vera. Seminars in Hematology 42:4, 221-229
CrossRef406
Anthony J. Bench, Heike L. Pahl. (2005) Chromosomal Abnormalities and Molecular Markers in Myeloproliferative Disorders. Seminars in Hematology 42:4, 196-205
CrossRef407
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Ebeling, Sally H.Ellender, Stacey M.Peters, Christine C., Wolf, Myles, Rose, Henry, Smith, R. Neal, . (2005) Case 28-2005. New England Journal of Medicine 353:11, 1148-1157
Full Text408
Jose Antonio L??pez-Guerrero, Samuel Navarro, Rosa Noguera, Carmen Carda, Silvia Calabuig Fari??as, Antonio Pell??n, Antonio Llombart-Bosch. (2005) Mutational Analysis of the c-KIT AND PDGFR?? in a Series of Molecularly Well-Characterized Synovial Sarcomas. Diagnostic Molecular Pathology 14:3, 134-139
CrossRef409
Giulia Cervetti, Sara Galimberti, Giovanni Carulli, Mario Petrini. (2005) Imatinib therapy in Hypereosinophilic Syndrome: A case of molecular remission. Leukemia Research 29:9, 1097-1098
CrossRef410
Chyh-Woei Lee, Richard N. Mitchell, Richard F. Horan, Mariana C. Castells. (2005) Cardiogenic shock and peripheral eosinophilia in a young woman. Annals of Allergy, Asthma & Immunology 95:3, 229-233
CrossRef411
Elias Jabbour, Srdan Verstovsek, Francis Giles, Varsha Gandhi, Jorge Cortes, Susan O'Brien, William Plunkett, Guillermo Garcia-Manero, C. Ellen Jackson, Hagop Kantarjian, Michael Andreeff. (2005) 2-Chlorodeoxyadenosine and cytarabine combination therapy for idiopathic hypereosinophilic syndrome. Cancer 104:3, 541-546
CrossRef412
K. Spiekermann, W. Hiddemann. (2005) Molekulare Zielstrukturen in der Onkologie. Der Internist 46:8, 847-860
CrossRef413
Maria Cristina Rapanotti, Roberta Caruso, Sergio Bernardini, Valentina Coletti, Francesco Lo-Coco, Giulio De Rossi. (2005) Idiopathic hypereosinophilic syndrome: a case evolving in B-lymphoblastic lymphoma. Leukemia Research 29:8, 975-979
CrossRef414
A. Tefferi, S. V. Rajkumar, A. A. Adjei. (2005) Introduction to a Cancer Symposium for the Practitioner. Mayo Clinic Proceedings 80:8, 1085-1086
CrossRef415
Krause, Daniela S., Van Etten, Richard A., . (2005) Tyrosine Kinases as Targets for Cancer Therapy. New England Journal of Medicine 353:2, 172-187
Full Text416
V. Cottin, J.-F. Cordier. (2005) Eosinophilic pneumonias. Allergy 60:7, 841-857
CrossRef417
Magdalena M Gorska, Rafeul Alam. (2005) The signaling mechanism of eosinophil activation. Expert Review of Clinical Immunology 1:2, 247-256
CrossRef418
Jacek Musial, Beata Brzezinska-Kolarz, Marek Sanak, Andrzej Szczeklik. (2005) Improved cardiac function in a patient with hypereosinophilic syndrome treated with imatinib. European Journal of Haematology 75:1, 87-88
CrossRef419
Guixin Li, Zhanjun Guo, Keiichi Higuchi, Masatomo Kawakubo, Kiyoshi Matsumoto, Masayuki Mori. (2005) A locus for eosinophilia in the MES rat is on Chromosome 19. Mammalian Genome 16:7, 516-523
CrossRef420
A. Tefferi, D. G. Gilliland. (2005) The JAK2V617F Tyrosine Kinase Mutation in Myeloproliferative Disorders: Status Report and Immediate Implications for Disease Classification and Diagnosis. Mayo Clinic Proceedings 80:7, 947-958
CrossRef421
Jill A. Poole, Anil Nanda, Ponpan Matangkasombut, Rohit K. Katial. (2005) Food intolerance, flushing, and diarrhea in a 44-year-old woman. Annals of Allergy, Asthma & Immunology 94:6, 621-626
CrossRef422
C Walz, A Chase, C Schoch, A Weisser, F Schlegel, A Hochhaus, R Fuchs, A Schmitt-Gräff, R Hehlmann, N C P Cross, A Reiter. (2005) The t(8;17)(p11;q23) in the 8p11 myeloproliferative syndrome fuses MYO18A to FGFR1. Leukemia 19:6, 1005-1009
CrossRef423
Rafael Rosell, Enriqueta Felip, Noemí Reguart, Teresa Moran. (2005) Crossing the rubicon in lung adenocarcinoma: the conundrum of EGFR tyrosine kinase mutations. Future Oncology 1:3, 319-322
CrossRef424
Jan Cools, Chantal Maertens, Peter Marynen. (2005) Resistance to tyrosine kinase inhibitors: Calling on extra forces. Drug Resistance Updates 8:3, 119-129
CrossRef425
A. J. BENCH, W. N. ERBER, M. A. SCOTT. (2005) Molecular genetic analysis of haematological malignancies: I. Acute leukaemias and myeloproliferative disorders. Clinical and Laboratory Haematology 27:3, 148-171
CrossRef426
B. HELLMICH, E. CSERNOK, W. L. GROSS. (2005) Proinflammatory Cytokines and Autoimmunity in Churg-Strauss Syndrome. Annals of the New York Academy of Sciences 1051:1, 121-131
CrossRef427
P. Åman. (2005) Fusion oncogenes. Seminars in Cancer Biology 15:3, 159-161
CrossRef428
Hiroyuki Kanno, Naohisa Ouchi, Masatoshi Sato, Tsukasa Wada, Takashi Sawai. (2005) Hypereosinophilia with systemic thrombophlebitis. Human Pathology 36:5, 585-589
CrossRef429
Shinsaku Imashuku, Naoki Kakazu, Ikuyo Ueda, Akira Morimoto, Hironori Harada, Tomoko Teramura, Shinichi Tamura, Yoko Fukushima-Nakase, Hiroshi Kuroda. (2005) Response to Imatinib Mesylate in a Patient with Idiopathic Hypereosinophilic Syndrome Associated with Cyclic Eosinophil Oscillations. International Journal of Hematology 81:4, 310-314
CrossRef430
T. Harzy, F. Allali, B. Amine, R. Rahmouni, N. Hajjaj-Hassouni. (2005) Manifestations cardiaques du syndrome hyperéosinophilique essentiel. La Revue de Médecine Interne 26:5, 386-392
CrossRef431
C Roche-Lestienne, S Lepers, V Soenen-Cornu, J-E Kahn, J-L Laï, E Hachulla, F Drupt, A-L Demarty, A-S Roumier, M Gardembas, M Dib, N Philippe, N Cambier, S Barete, C Libersa, O Bletry, P-Y Hatron, B Quesnel, C Rose, K Maloum, O Blanchet, P Fenaux, L Prin, C Preudhomme. (2005) Molecular characterization of the idiopathic hypereosinophilic syndrome (HES) in 35 French patients with normal conventional cytogenetics. Leukemia 19:5, 792-798
CrossRef432
Raffaella Poggioli, Tatiana Froud, David A. Baidal, Jacqueline V. Ferreira, Muhammad M. Hafiz, Camillo Ricordi, Gerald J. Gleich, Rodolfo Alejandro. (2005) Hypereosinophilia in an Islet Transplant Recipient. Transplantation 79:7, 853-854
CrossRef433
Ulrike Bacher, Torsten Haferlach, Wolfgang Kern, Wolfgang Hiddemann, Susanne Schnittger, Claudia Schoch. (2005) Conventional cytogenetics of myeloproliferative diseases other than CML contribute valid information. Annals of Hematology 84:4, 250-257
CrossRef434
Shane C McAllister, Klaus Fruh, Ashlee V Moses. (2005) Functional genomics and the development of pathogenesis-targeted therapies for Kaposis sarcoma. Pharmacogenomics 6:3, 235-244
CrossRef435
Ziyad Al Aly, Jennifer M. Philoctête Ashley, Mary E. Gellens, Esther A. González. (2005) Thrombotic thrombocytopenic purpura in a patient treated with imatinib mesylate: True association or mere coincidence?. American Journal of Kidney Diseases 45:4, 762-768
CrossRef436
Ross L. Levine, Martha Wadleigh, Jan Cools, Benjamin L. Ebert, Gerlinde Wernig, Brian J.P. Huntly, Titus J. Boggon, Iwona Wlodarska, Jennifer J. Clark, Sandra Moore, Jennifer Adelsperger, Sumin Koo, Jeffrey C. Lee, Stacey Gabriel, Thomas Mercher, Alan D’Andrea, Stefan Fröhling, Konstanze Döhner, Peter Marynen, Peter Vandenberghe, Ruben A. Mesa, Ayalew Tefferi, James D. Griffin, Michael J. Eck, William R. Sellers, Matthew Meyerson, Todd R. Golub, Stephanie J. Lee, D. Gary Gilliland. (2005) Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell 7:4, 387-397
CrossRef437
James D Griffin. (2005) Interaction maps for kinase inhibitors. Nature Biotechnology 23:3, 308-309
CrossRef438
Didier Decaudin, Patricia de Cremoux, Xavier Sastre, Jean-Gabriel Judde, Fariba Nemati, Carine Tran-Perennou, Paul Fréneaux, Alain Livartowski, Pierre Pouillart, Marie-France Poupon. (2005) In vivo efficacy of STI571 in xenografted human small cell lung cancer alone or combined with chemotherapy. International Journal of Cancer 113:5, 849-856
CrossRef439
Cazzola, Mario, Malcovati, Luca, . (2005) Myelodysplastic Syndromes — Coping with Ineffective Hematopoiesis. New England Journal of Medicine 352:6, 536-538
Full Text440
Raoul Tibes, Jonathan Trent, Razelle Kurzrock. (2005) TYROSINE KINASE INHIBITORS AND THE DAWN OF MOLECULAR CANCER THERAPEUTICS*. Annual Review of Pharmacology and Toxicology 45:1, 357-384
CrossRef441
Maria Debiec-Rychter, Jan Cools, Herlinde Dumez, Raf Sciot, Michel Stul, Nicole Mentens, Hilde Vranckx, Bartosz Wasag, Hans Prenen, Johannes Roesel, Anne Hagemeijer, Allan Van Oosterom, Peter Marynen. (2005) Mechanisms of resistance to imatinib mesylate in gastrointestinal stromal tumors and activity of the PKC412 inhibitor against imatinib-resistant mutants. Gastroenterology 128:2, 270-279
CrossRef442
LB Simon. (2005) A novel reciprocal translocation associated with chronic eosinophilic leukemia. Leukemia & Lymphoma 46:2, 299-302
CrossRef443
Cem Akin. (2005) Clonality and Molecular Pathogenesis of Mastocytosis. Acta Haematologica 114:1, 61-69
CrossRef444
A. Pardanani. (2005) Systemic Mastocytosis: Bone Marrow Pathology, Classification, and Current Therapies. Acta Haematologica 114:1, 41-51
CrossRef445
Kenji Ishihara, JangJa Hong, OkPyo Zee, Kazuo Ohuchi. (2005) Folia Pharmacologica Japonica 125:5, 265-270
CrossRef446
William Pao, Vincent A. Miller, Katerina A. Politi, Gregory J. Riely, Romel Somwar, Maureen F. Zakowski, Mark G. Kris, Harold Varmus. (2005) Acquired Resistance of Lung Adenocarcinomas to Gefitinib or Erlotinib Is Associated with a Second Mutation in the EGFR Kinase Domain. PLoS Medicine 2:3, e73
CrossRef447
Adedayo A. Onitilo, Ebenezer A. Kio, Avtar K. Singh, John Lazarchick. (2005) Cytogenetic remission with imatinib therapy in hypereosinophilic syndrome with trisomy 8 and resolution of severe cardiac dysfunction. Leukemia & Lymphoma 46:11, 1667-1670
CrossRef448
Dagmar Simon, Lasse R. Braathen, Hans-Uwe Simon. (2005) Anti-Interleukin-5 Antibody Therapy in Eosinophilic Diseases. Pathobiology 72:6, 287-292
CrossRef449
Bin Peng, Peter Lloyd, Horst Schran. (2005) Clinical Pharmacokinetics of Imatinib. Clinical Pharmacokinetics 44:9, 879-894
CrossRef450
Klaus Eisendle, Dominik Wolf, Guenther Gastl, Brigitte Kircher-Eibl. (2005) Dendritic cells from patients with chronic myeloid leukemia: Functional and phenotypic features. Leukemia & Lymphoma 46:5, 663-670
CrossRef451
Yoshinori TANAKA, Kumiko MATSUI, Shizu SAKURAGI, Noriyuki MITANI, Kazuhiro MATSUDA, Kenji SHINOHARA. (2005) Three Cases of Philadelphia Chromosome Negative Myelodysplastic/Myeloproliferative Diseases. Yamaguchi Medical Journal 54:5, 139-145
CrossRef452
T.F. WESTBROOK, F. STEGMEIER, S.J. ELLEDGE. (2005) Dissecting Cancer Pathways and Vulnerabilities with RNAi. Cold Spring Harbor Symposia on Quantitative Biology 70:1, 435-444
CrossRef453
Jason Gotlib. (2005) Molecular Classification and Pathogenesis of Eosinophilic Disorders: 2005 Update. Acta Haematologica 114:1, 7-25
CrossRef454
J.H. Butterfield. (2005) Interferon Treatment for Hypereosinophilic Syndromes and Systemic Mastocytosis. Acta Haematologica 114:1, 26-40
CrossRef455
Jennifer Clark, Jan Cools, D. Gary Gilliland. (2005) EGFR Inhibition in Non-Small Cell Lung Cancer: Resistance, Once Again, Rears Its Ugly Head. PLoS Medicine 2:3, e75
CrossRef456
Susan Burgin. (2005) New Drugs, New Rashes: Update on Cutaneous Drug Reactions. Advances in Dermatology 21, 279-302
CrossRef457
A. Tefferi. (2005) Modern Diagnosis and Treatment of Primary Eosinophilia. Acta Haematologica 114:1, 52-60
CrossRef458
R.K. THOMAS, H. GREULICH, Y. YUZA, J.C. LEE, T. TENGS, W. FENG, T.-H. CHEN, E. NICKERSON, J. SIMONS, M. EGHOLM, J.M. ROTHBERG, W.R. SELLERS, M.L. MEYERSON. (2005) Detection of Oncogenic Mutations in the EGFR Gene in Lung Adenocarcinoma with Differential Sensitivity to EGFR Tyrosine Kinase Inhibitors. Cold Spring Harbor Symposia on Quantitative Biology 70:1, 73-81
CrossRef459
H. VARMUS, W. PAO, K. POLITI, K. PODSYPANINA, Y.-C.N. DU. (2005) Oncogenes Come of Age. Cold Spring Harbor Symposia on Quantitative Biology 70:1, 1-9
CrossRef460
Ayalew Tefferi. (2005) Blood Eosinophilia: A New Paradigm in Disease Classification, Diagnosis, and Treatment. Mayo Clinic Proceedings 80:1, 75-83
CrossRef461
Enrico Selvi, Pietro Rubegni, Stefania Manganelli, Renato De Stefano, Elena Frati, Sauro Lorenzini, Paolo Sbano, Roberto Marcolongo. (2004) Combination Therapy With Montelukast and Ketotifen for Arthritis and Rash Resulting From Idiopathic Hypereosinophilic Syndrome. JCR: Journal of Clinical Rheumatology 10:6, 344-346
CrossRef462
S. P. Hogan, M. E. Rothenberg. (2004) Review article: the eosinophil as a therapeutic target in gastrointestinal disease. Alimentary Pharmacology and Therapeutics 20:11-12, 1231-1240
CrossRef463
Henrik Daub, Katja Specht, Axel Ullrich. (2004) Strategies to overcome resistance to targeted protein kinase inhibitors. Nature Reviews Drug Discovery 3:12, 1001-1010
CrossRef464
Mark A Pearson, Doriano Fabbro. (2004) Targeting protein kinases in cancer therapy: a success?. Expert Review of Anticancer Therapy 4:6, 1113-1124
CrossRef465
Charles Sawyers. (2004) Targeted cancer therapy. Nature 432:7015, 294-297
CrossRef466
Seshadri, Tara, Seymour, John F., McArthur, Grant A., . (2004) Oligospermia in a Patient Receiving Imatinib Therapy for the Hypereosinophilic Syndrome. New England Journal of Medicine 351:20, 2134-2135
Full Text467
J. Gracia Colldeforns, D. Hernández Maraver, R. de Paz Arias, F. Hernández Navarro. (2004) Síndromes mieloproliferativos crónicos. Medicine - Programa de Formación Médica Continuada Acreditado 9:21, 1332-1346
CrossRef468
Christopher L. Corless, Laura McGreevey, Ajia Town, Arin Schroeder, Troy Bainbridge, Patina Harrell, Jonathan A. Fletcher, Michael C. Heinrich. (2004) KIT Gene Deletions at the Intron 10−Exon 11 Boundary in GI Stromal Tumors. The Journal of Molecular Diagnostics 6:4, 366-370
CrossRef469
Brian Weiss, Kevin Shannon. 2004. Preclinical Trials in Mouse Cancer Models. .
CrossRef470
C. Graux, J. Cools, C. Melotte, H. Quentmeier, A. Ferrando, R. Levine, J.R. Vermeesch, M. Stul, B. Dutta, N. Boeckx, A. Bosly, P. Heimann, A. Uyttebroeck, N. Mentens, R. Somers, R.A.F. MacLeod, H.G. Drexler, A.T. Look, D.G. Gilliland, L. Michaux, P. Vandenberghe, I. Wlodarska, Peter Marynen, Anne Hagemeijer. (2004) Fusion of NUP214 to ABL1 on amplified episomes in T-cell acute lymphoblastic leukemia. Nature Genetics 36:10, 1084-1089
CrossRef471
Barbara J. Bain. (2004) Relationship between idiopathic hypereosinophilic syndrome, eosinophilic leukemia, and systemic mastocytosis. American Journal of Hematology 77:1, 82-85
CrossRef472
W Michael Alberts. (2004) Eosinophilic interstitial lung disease. Current Opinion in Pulmonary Medicine 10:5, 419-424
CrossRef473
Arne Östman. (2004) PDGF receptors-mediators of autocrine tumor growth and regulators of tumor vasculature and stroma. Cytokine & Growth Factor Reviews 15:4, 275-286
CrossRef474
Mani Mohindru, Amit Verma. (2004) Kinase inhibitors translate lab discoveries into exciting new cures for cancers. The Indian Journal of Pediatrics 71:8, 713-718
CrossRef475
José Baselga, Joaquín Arribas. (2004) Treating cancer's kinase 'addiction'. Nature Medicine 10:8, 786-787
CrossRef476
F. Roufosse, E. Cogan, M. Goldman. (2004) Recent advances in pathogenesis and management of hypereosinophilic syndromes. Allergy 59:7, 673-689
CrossRef477
Akihiro Abe, Nobuhiko Emi, Tadaharu Kanie, Shizuka Imagama, Yoshie Kuno, Masahide Takahashi, Hidehiko Saito, Tomoki Naoe. (2004) Expression cloning of oligomerization-activated genes with cell-proliferating potency by pseudotype retrovirus vector. Biochemical and Biophysical Research Communications 320:3, 920-926
CrossRef478
Srinivasan Madhusudan, Trivadi S. Ganesan. (2004) Tyrosine kinase inhibitors in cancer therapy. Clinical Biochemistry 37:7, 618-635
CrossRef479
Cem Akin, Dean D Metcalfe. (2004) The biology of Kit in disease and the application of pharmacogenetics. Journal of Allergy and Clinical Immunology 114:1, 13-19
CrossRef480
D. Tan, W. Hwang, H. J. Ng, Y. T. Goh, P. Tan. (2004) Successful Treatment of Idiopathic Hypereosinophilic Syndrome with Imatinib Mesylate: A Case Report. International Journal of Hematology 80:1, 75-77
CrossRef481
John J. O'Shea, Marko Pesu, Dominic C. Borie, Paul S. Changelian. (2004) A new modality for immunosuppression: targeting the JAK/STAT pathway. Nature Reviews Drug Discovery 3:7, 555-564
CrossRef482
Pellegrino Musto, Gianni Perla, Maria Marta Minervini, Francesco Lo Coco, Gianfranco Catalano, Angelo Michele Carella. (2004) Imatinib-mesylate for all patients with hypereosinophilic syndrome?. Leukemia Research 28:7, 773-774
CrossRef483
Elena Tamborini, Lorena Bonadiman, Angela Greco, Veronica Albertini, Tiziana Negri, Alessandro Gronchi, Rossella Bertulli, Maurizio Colecchia, Paolo G. Casali, Marco A. Pierotti, Silvana Pilotti. (2004) A new mutation in the KIT ATP pocket causes acquired resistance to imatinib in a gastrointestinal stromal tumor patient. Gastroenterology 127:1, 294-299
CrossRef484
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Ebeling, Sally H.Ellender, Stacey M.Peters, Christine C., Huang, Mary S., Hasserjian, Robert P., . (2004) Case 19-2004. New England Journal of Medicine 350:25, 2604-2612
Full Text485
Jing Chen, Nathan R. Wall, Kerry Kocher, Nicole Duclos, Doriano Fabbro, Donna Neuberg, James D. Griffin, Yang Shi, D. Gary Gilliland. (2004) Stable expression of small interfering RNA sensitizes TEL-PDGFβR to inhibition with imatinib or rapamycin. Journal of Clinical Investigation 113:12, 1784-1791
CrossRef486
Francis J Giles, Jorge E Cortes, Hagop M Kantarjian, Susan M O'Brien. (2004) Accelerated and blastic phases of chronic myelogenous leukemia. Hematology/Oncology Clinics of North America 18:3, 753-774
CrossRef487
Lolita Banerji, Martin Sattler. (2004) Targeting mutated tyrosine kinases in the therapy of myeloid leukaemias. Expert Opinion on Therapeutic Targets 8:3, 221-239
CrossRef488
Ayalew Tefferi, Animesh Pardanani. (2004) Imatinib Therapy in Clonal Eosinophilic Disorders, Including Systemic Mastocytosis. International Journal of Hematology 79:5, 441-447
CrossRef489
Carlos L. Arteaga, Jose Baselga. (2004) Tyrosine kinase inhibitors. Cancer Cell 5:6, 525-531
CrossRef490
Jorge Cortes, Hagop Kantarjian. (2004) Beyond chronic myelogenous leukemia. Cancer 100:10, 2064-2078
CrossRef491
Yuko Ishii, Yoshikazu Ito, Yuzuru Kuriyama, Tetsuzo Tauchi, Kazuma Ohyashiki. (2004) Successful treatment with imatinib mesylate of hypereosinophilic syndrome (chronic eosinophilic leukemia) with myelofibrosis. Leukemia Research 28, 79-80
CrossRef492
Nicholas B Lydon, Brian J Druker. (2004) Lessons learned from the development of imatinib. Leukemia Research 28, 29-38
CrossRef493
Stephanie Blencke, Birgit Zech, Ola Engkvist, Zoltán Greff, László Őrfi, Zoltán Horváth, György Kéri, Axel Ullrich, Henrik Daub. (2004) Characterization of a Conserved Structural Determinant Controlling Protein Kinase Sensitivity to Selective Inhibitors. Chemistry & Biology 11:5, 691-701
CrossRef494
Animesh Pardanani, Ayalew Tefferi. (2004) Imatinib therapy for hypereosinophilic syndrome and eosinophilia-associated myeloproliferative disorders. Leukemia Research 28, 47-52
CrossRef495
E. Nadal, E. Olavarria. (2004) Imatinib mesylate (Gleevec/Glivec) a molecular-targeted therapy for chronic myeloid leukaemia and other malignancies. International Journal of Clinical Practice 58:5, 511-516
CrossRef496
Geoffrey W Krystal. (2004) Imatinib mesylate (STI571) for myeloid malignancies other than CML. Leukemia Research 28, 53-59
CrossRef497
Anne Michele Safley, Siby Sebastian, Timothy S. Collins, Carlos A. Tirado, Timothy T. Stenzel, Jerald Z. Gong, Barbara K. Goodman. (2004) Molecular and cytogenetic characterization of a novel translocation t(4;22) involving the breakpoint cluster region and platelet-derived growth factor receptor-alpha genes in a patient with atypical chronic myeloid leukemia. Genes, Chromosomes and Cancer 40:1, 44-50
CrossRef498
N Widmer, A Béguin, B Rochat, T Buclin, T Kovacsovics, M.A Duchosal, S Leyvraz, A Rosselet, J Biollaz, L.A Decosterd. (2004) Determination of imatinib (Gleevec®) in human plasma by solid-phase extraction–liquid chromatography–ultraviolet absorbance detection. Journal of Chromatography B 803:2, 285-292
CrossRef499
B. J. Bain, J. M. Goldman, N. P. Lucie, F. Brito-Babapulle, M. Bhavnani, A. Kubie, R. Jan-Mohamed, M. Pocock, M. Layton. (2004) Report on slide session, British Society for Haematology, 43rd Annual Scientific Meeting, Glasgow, 2003. Clinical and Laboratory Haematology 26:2, 87-93
CrossRef500
Stephane Wong, Owen N. Witte. (2004) The BCR-ABL Story: Bench to Bedside and Back. Annual Review of Immunology 22:1, 247-306
CrossRef501
Jonathan A Fletcher. (2004) Role of KIT and platelet-derived growth factor receptors as oncoproteins. Seminars in Oncology 31, 4-11
CrossRef502
Grant McArthur. (2004) Molecularly targeted treatment for dermatofibrosarcoma protuberans. Seminars in Oncology 31, 30-36
CrossRef503
Richard M Stone, D.Gary Gilliland, Amy D Klion. (2004) Platelet-derived growth factor receptor inhibition to treat idiopathic hypereosinophilic syndrome. Seminars in Oncology 31, 12-17
CrossRef504
Benjamin S Braun, Kevin Shannon. (2004) The sum is greater than the FGFR1 partner. Cancer Cell 5:3, 203-204
CrossRef505
Ayalew Tefferi. (2004) Treatment of systemic mast cell disease: beyond interferon. Leukemia Research 28:3, 223-224
CrossRef506
Steven Coutré, Jason Gotlib. (2004) Targeted treatment of hypereosinophilic syndromes and chronic eosinophilic leukemias with imatinib mesylate. Seminars in Cancer Biology 14:1, 23-31
CrossRef507
A. Sefcick, D. Sowter, E. DasGupta, N. H. Russell, J. L. Byrne. (2004) Alemtuzumab therapy for refractory idiopathic hypereosinophilic syndrome. British Journal of Haematology 124:4, 558-559
CrossRef508
William Pao, Vincent A. Miller, Mark G. Kris. (2004) ‘Targeting’ the epidermal growth factor receptor tyrosine kinase with gefitinib (Iressa®) in non-small cell lung cancer (NSCLC). Seminars in Cancer Biology 14:1, 33-40
CrossRef509
Farhad Ravandi, Hagop Kantarjian, Francis Giles, Jorge Cortes. (2004) New agents in acute myeloid leukemia and other myeloid disorders. Cancer 100:3, 441-454
CrossRef510
Carl-Henrik Heldin. (2004) Development and possible clinical use of antagonists for PDGF and TGF-β. Upsala Journal of Medical Sciences 109:3, 165-178
CrossRef511
Jamie Robyn, Pierre Noel, Iwona Wlodarska, Mamta Choksi, Patricia O'Neal, Diane Arthur, Cynthia Dunbar, Thomas Nutman, Amy Klion. (2004) Imatinib-Responsive Hypereosinophilia in a Patient with B Cell ALL. Leukemia & Lymphoma 45:12, 2497-2501
CrossRef512
Jan Cools, Elizabeth H. Stover, Iwona Wlodarska, Peter Marynen, D. Gary Gilliland. (2004) The FIP1L1-PDGFR?? kinase in hypereosinophilic syndrome and chronic eosinophilic leukemia. Current Opinion in Hematology 11:1, 51-57
CrossRef513
Ayalew Tefferi, Animesh Pardanani. (2004) Clinical, genetic, and therapeutic insights into systemic mast cell disease. Current Opinion in Hematology 11:1, 58-64
CrossRef514
Pellegrino Musto, Antonietta Falcone, Grazia Sanpaolo, Carlo Bodenizza, Gianni Perla, Maria Marta Minervini, Nicola Cascavilla, Matteo Dell'olio, Antonio La Sala, Saverio Mantuano, Lorella Melillo, Michele Nobile, Potito Rosario Scalzulli, Michele Bisceglia, Angelo Michele Carella. (2004) Heterogeneity of Response to Imatinib-Mesylate (Glivec) in Patients with Hypereosinophilic Syndrome: Implications for Dosing and Pathogenesis. Leukemia & Lymphoma 45:6, 1219-1222
CrossRef515
A. Straumann, H.-U. Simon. (2004) The physiological and pathophysiological roles of eosinophils in the gastrointestinal tract. Allergy 59:1, 15-25
CrossRef516
Tetsuya MINE. (2004) Hypereosinophilic Syndrome vs Eosinophilic Gastroenteritis. Internal Medicine 43:4, 277-278
CrossRef517
John M Goldman. (2004) Chronic myeloid leukemia—still a few questions. Experimental Hematology 32:1, 2-10
CrossRef518
Bruno Rotoli, Lucio Catalano, Maurizio Galderisi, Luigia Luciano, Giuditta Pollio, Anna Guerriero, Arcangelo D'Errico, Cristina Mecucci, Roberta La Starza, Ferdinando Frigeri, Raffaele Di Francia, Antonio Pinto. (2004) Rapid Reversion of Loeffler's Endocarditis by Imatinib in Early Stage Clonal Hypereosinophilic Syndrome. Leukemia & Lymphoma 45:12, 2503-2507
CrossRef519
M MUERS. (2004) Eosinophilic lung diseases. Medicine 32:1, 121-123
CrossRef520
Plötz, Sabine-Gisela, Simon, Hans-Uwe, Darsow, Ulf, Simon, Dagmar, Vassina, Ekatherina, Yousefi, Shida, Hein, Rüdiger, Smith, Tim, Behrendt, Heidrun, Ring, Johannes, . (2003) Use of an Anti–Interleukin-5 Antibody in the Hypereosinophilic Syndrome with Eosinophilic Dermatitis. New England Journal of Medicine 349:24, 2334-2339
Full Text521
Mark Levis, Donald Small. (2003) Novel FLT3 tyrosine kinase inhibitors. Expert Opinion on Investigational Drugs 12:12, 1951-1962
CrossRef522
Adewale Adeyinka, Gordon W Dewald. (2003) Cytogenetics of chronic myeloproliferative disorders and related myelodysplastic syndromes. Hematology/Oncology Clinics of North America 17:5, 1129-1149
CrossRef523
Tracy I George, Daniel A Arber. (2003) Pathology of the myeloproliferative diseases. Hematology/Oncology Clinics of North America 17:5, 1101-1127
CrossRef524
Noah Scheinfeld. (2003) Fatal Fulminant Hypereosinophilic Syndrome With a Petechial Rash in a 16-Year-Old Girl. Journal of Pediatric Hematology/Oncology 25:10, 827-830
CrossRef525
Guttmacher, Alan E., Collins, Francis S., . (2003) Welcome to the Genomic Era. New England Journal of Medicine 349:10, 996-998
Full Text526
(2003) Recent Articles on HES. JNCI Journal of the National Cancer Institute 95:15, 1103-1103
CrossRef527
Rony Abou-Jawde, Toni Choueiri, Carlos Alemany, Tarek Mekhail. (2003) An overview of targeted treatments in cancer. Clinical Therapeutics 25:8, 2121-2137
CrossRef528
P Pottier, B Planchon, O Grossi. (2003) Rémission complète sous imatinib mésylate (Glivec®) d’un syndrome hyperéosinophilique myéloprolifératif associé à une mastocytose cutanée résistant à l’interféron alpha. La Revue de Médecine Interne 24:8, 542-546
CrossRef529
Barbara J. Bain. (2003) Cytogenetic and molecular genetic aspects of eosinophilic leukaemias. British Journal of Haematology 122:2, 173-179
CrossRef530
(2003) Hypereosinophilic Syndrome. New England Journal of Medicine 348:26, 2687-2687
Full Text531
Brian J Druker. (2003) Imatinib mesylate in the treatment of chronic myeloid leukaemia. Expert Opinion on Pharmacotherapy 4:6, 963-971
CrossRef532
Finella Brito-Babapulle. (2003) The eosinophilias, including the idiopathic hypereosinophilic syndrome. British Journal of Haematology 121:2, 203-223
CrossRef533
Edward A Sausville. (2003) Imatinib for chronic myelogenous leukaemia: a 9 or 24 carat gold standard?. The Lancet 361:9367, 1400-1401
CrossRef534
Schwartz, Robert S., . (2003) The Hypereosinophilic Syndrome and the Biology of Cancer. New England Journal of Medicine 348:13, 1199-1200
Full Text535
Tariq I Mughal, John M Goldman. (2003) Chronic Myeloid Leukemia. American Journal of Cancer 2:5, 305-311
CrossRef
- Letters
