Original Article
Brief Report
Growth Hormone Insensitivity Associated with a STAT5b Mutation
N Engl J Med 2003; 349:1139-1147September 18, 2003
- Article
The syndrome of growth hormone insensitivity is characterized by phenotypic features consistent with the presence of a growth hormone deficiency, but with normal-to-elevated circulating concentrations of growth hormone and resistance to exogenous growth hormone therapy.1 Originally described by Laron and colleagues,2 the syndrome, it has become increasingly apparent, involves considerable phenotypic heterogeneity, reflecting, at least in part, the complexity of the growth hormone signaling cascade. The majority of patients described to date have low serum concentrations of growth hormone–binding protein, the extracellular domain of the growth hormone receptor, as a result of mutations or deletions that affect the growth hormone–binding region of the receptor.3-5 A number of patients, however, have been described who have normal or even elevated serum concentrations of growth hormone–binding protein.6,7 These include patients with mutations in the growth hormone receptor that affect dimerization8 or the transmembrane and intracellular regions.9-12
Growth hormone insensitivity in patients who are positive for growth hormone–binding protein might also result from defects in the signaling of growth hormone receptor. Dimerization of the receptor activates Janus kinase 2 (JAK2), a receptor-associated kinase that phosphorylates both itself and the growth hormone receptor. The phosphorylated residues act as docking sites for a variety of molecules, which undergo subsequent phosphorylation by JAK2, resulting in the activation of the signal transducers and activators of transcription (STAT), phosphatidylinositol-3 kinase, and mitogen-activated protein kinase pathways. Collectively, these pathways mediate the growth-promoting and metabolic actions of growth hormone.
Although several patients with a phenotype of growth hormone insensitivity and normal growth hormone receptor (GHR) genes have been described, no specific molecular defects downstream of the receptor have been identified.13-16 We now describe a patient with the clinical and biochemical characteristics of growth hormone insensitivity, a normal GHR gene, and a homozygous missense mutation in the gene for STAT5b.
Case Report
A 1400-g baby girl was born at 33 weeks of gestation to consanguineous Argentine parents. Paternal and maternal heights were 173.6 and 155.8 cm, respectively. There was no family history of growth failure, and the girl's younger sisters were of normal stature. At birth, she required care in a neonatal unit because of respiratory difficulties. Poor weight gain and growth failure were noted during the first three years of life, and evaluations for failure to thrive and malabsorption revealed no abnormalities. The girl was first referred to an endocrine center at seven years of age, when her height was 97 cm and her weight was 14 kg, both far below the 5th percentiles. She also had respiratory difficulties, with increased oxygen requirements; an eventual lung biopsy was interpreted as indicating lymphoid interstitial pneumonia. Studies were negative for human immunodeficiency virus, cytomegalovirus, and Epstein–Barr virus. The patient was treated with corticosteroids, with partial improvement, but she continued to have multiple episodes of bronchial obstruction. At the age of eight years, she presented with severe hemorrhagic varicella and subsequently had several episodes of herpes zoster. A progressive worsening of her pulmonary function resulted in a second lung biopsy at the age of 10 years (diagnosis, lymphoid interstitial pneumonia), and Pneumocystis carinii was isolated from the tissue.
A 12-month trial of growth hormone therapy resulted in no improvement in growth rate (Figure 1AFigure 1
Growth Curve of the Patient between the Ages of 4 and 16 Years (Panel A); Response of Insulin-Like Growth Factor I (IGF-I), Insulin-Like Growth Factor–Binding Protein 3 (IGFBP-3), and Acid-Labile Subunit to Stimulation with Growth Hormone (Panel B); and the Transcriptional Regulation of IGF-I (Panel C) and IGFBP-3 (Panel D) by Growth Hormone.). At the age of 16.5 years, her height was 117.8 cm (7.5 SD below the mean for age), with normal body proportions and delayed secondary sex characteristics (Tanner stage III pubertal development). She had a prominent forehead, a saddle nose, and a high-pitched voice. In an insulin–arginine growth hormone stimulation test, the serum growth hormone concentration was 9.4 ng per milliliter after an overnight fast, with a peak concentration of 53.8 ng per milliliter after stimulation with 0.05 U of insulin per kilogram of body weight (normal value, >10), and the serum growth hormone–binding protein concentration was 1236 pmol per liter (normal range, 431 to 1892). Serum concentrations of insulin-like growth factor I (IGF-I), insulin-like growth factor–binding protein 3 (IGFBP-3), and the acid-labile subunit were all markedly low, with poor responses to seven consecutive daily injections of growth hormone (0.05 mg per kilogram of body weight per day) (Figure 1B). All studies were approved by the institutional review board at Oregon Health and Science University, and written informed consent was obtained from the patient and her parents.Methods
Serum concentrations of IGF-I, IGFBP-3, and acid-labile subunit (Diagnostic Systems Laboratories),17 growth hormone–binding protein (Esoterix Endocrinology), and growth hormone (Nichols Institute Diagnostics) were measured in the patient and control subjects. Primary fibroblast cultures were established from skin-biopsy specimens obtained from the patient and a healthy 30-year-old woman in compliance with ethics guidelines. Additional normal dermal fibroblasts from a 31-year-old woman were purchased from BioWhittaker. Further details concerning cell culture are provided in Supplementary Appendix 1 (available with the full text of this article at http://www.nejm.org). Details of Western immunoblotting, genomic, and complementary DNA (cDNA) analysis, real-time quantitative polymerase chain reaction (PCR) for IGF-I transcripts, and Northern analysis for IGFBP-3 are also provided in Supplementary Appendix 1.
Results
Analysis of the Growth Hormone Receptor Gene and Protein
Sequencing of genomic DNA from the patient's lymphocytes did not show any mutations in the GHR gene. Sequencing of GHR cDNA amplified from fibroblasts by reverse-transcriptase PCR (RT-PCR) confirmed that the GHR coding region was normal. Corroborating the genetic data, normal growth hormone receptor was readily detected in fibroblast-cell lysates by immunoblot analysis (data not shown). These findings were consistent with the patient's normal serum growth hormone–binding protein concentration and suggested that the defect occurs downstream from GHR.
Expression of IGF-I and IGFBP-3 Messenger RNA
Growth hormone–induced regulation of the expression of IGF-I and IGFBP-3 was assessed in primary fibroblasts. IGF-I messenger RNA (mRNA) was monitored by real-time quantitative PCR 0, 10, 60, and 180 minutes after the addition of growth hormone (Figure 1C). Primers for IGF-I were as follows: 5'TGCCCGGCTAATTTTTTGG3' (forward) and 5'CATGCCTGTAATCCCAGCAA3' (reverse) (further details are available in Supplementary Appendix 1). Transcriptional regulation of IGF-I mRNA was reproducibly induced in two independent cultures of normal fibroblasts; elevated mRNA concentrations were evident within 10 minutes after the administration of growth hormone, peaked at 60 minutes (with an 80 percent increase), and were sustained for 180 minutes. In contrast, the fibroblasts from the patient showed no increase in IGF-I transcription in response to growth hormone; there was even a reduction in transcription of 30 to 40 percent 60 minutes after treatment.
To assess the expression of IGFBP-3, total RNA was collected at 24 and 48 hours from untreated cells and from cells that had been incubated with growth hormone. Northern blotting analysis demonstrated that the level of expression of IGFBP-3 tripled in normal primary fibroblasts within 24 hours after growth hormone stimulation, whereas there was no such increase in the patient's cells (Figure 1D). These observations reflected the markedly reduced serum concentrations of IGF-I and IGFBP-3, as well as the minimal increase in these proteins after the administration of growth hormone in vivo (Figure 1B).
GHR Signal-Transduction Patterns
Signal transduction involving the growth hormone receptor occurs by means of at least three well-established pathways: the signaling module involving mitogen-activated protein kinase and extracellular regulated kinase 1 and 2 (ERK1 and 2), STAT, and the phosphatidylinositol-3 kinase–protein kinase B signaling module. A review of these pathways indicated that signal transduction from the growth hormone receptor to ERK1 and 2 was normal in normal fibroblasts and in primary fibroblasts from the patient, with a rapid onset of phosphorylation (within 5 minutes) (data not shown), which peaked within 30 minutes (Figure 2AFigure 2
Immunoblots of Phosphorylation (p) of Signal Transducer and Activator of Transcription 1 (STAT1), STAT3, Extracellular Regulated Kinase 1 (ERK1), and ERK2 (Panel A) and STAT5 (Panel B) Induced by Growth Hormone (GH), Prolactin, and Interferon-γ (IFN-γ).). Growth hormone–induced signaling through the STAT pathways (STAT1, STAT3, STAT5a, and STAT5b) was, however, aberrant in the patient's cells. Induction of STAT1 phosphorylation by growth hormone was poor in normal primary skin fibroblasts, as described previously,13 and in the fibroblasts from the two control subjects (Figure 2A). The patient's fibroblasts, on the contrary, demonstrated growth hormone–induced phosphorylation of STAT1 as early as 15 minutes after the administration of growth hormone, which peaked between 30 and 60 minutes and returned to base line by 120 minutes. The degree of phosphorylation of STAT1 in the patient's fibroblasts was 8 to 10 times as great as in the control cells (Figure 2A). Interestingly, the total STAT1 concentration appeared to be at least twice as high in the patient's cells as in the control cells. As with STAT1, growth hormone–activated phosphorylation of STAT3 was also significantly enhanced in the patient's cells, with a peak increase by a factor of approximately 8 (Figure 2A).The enhanced activation of STAT1 and STAT3 in the patient's cells was also observed when the cells were treated with prolactin, a luteotrophic hormone whose actions, like those of growth hormone, are mediated by class I cytokine receptors. In contrast, when the cells were incubated with interferon-γ, a potent STAT1 activator whose actions are mediated by class II cytokine receptors, the activation of STAT1 and STAT3 was robust, and more important, it was the same as that in the normal cells (Figure 2A).
Identification of a Missense Mutation in the SH2 Domain of STAT5b
Although the signal transduction is mediated in part through STAT1 and STAT3, rodent knockout models (STAT5a–/–, STAT5b–/–, and STAT5a–/–b–/–) have demonstrated the requirement for STAT5b in the generation of IGF-I in response to treatment with growth hormone and for normal postnatal growth.18-20 In normal fibroblasts, both STAT5a and STAT5b were detectable under basal conditions. Activation of STAT5 was evident but transient, with peak activity observed between 5 and 15 minutes after the administration of growth hormone (Figure 2B) and a return to basal concentrations by 60 minutes. In the patient's cells, however (Figure 2B), immunoblotting with antibodies specific to either STAT5a or STAT5b clearly demonstrated that STAT5b was only poorly detectable, whereas STAT5a was normally expressed. Furthermore, on treatment with growth hormone, no phosphorylation of STAT5a or STAT5b was detectable. These results suggested either that STAT5b was absent in the patient or that the epitope recognized by the specific (monoclonal) antibody was affected by a mutation and raised questions concerning the ability of this protein to be activated.
The 2.4-kb STAT5b coding region was amplified by RT-PCR from the patient's cells and from two control cell lines. A comparison of the DNA sequences indicated that the patient was homozygous for a single nucleotide change within the src homology (SH2) domain of STAT5b (Figure 3AFigure 3
Domains of the Wild-Type STAT5b Protein (Panel A), Mutation in the STAT5b Gene from the Patient (Panel B), Differentiation of the Wild-Type Sequence from That of the Mutated Sequence in the src-Homology-2 (SH2) Domain (Panel C), and Stability and Activity of the Mutant STAT5b (Panel D).). The mutation was confirmed at the genomic level (data not shown). The mutation resulted in an amino acid substitution of proline (cct) for alanine (gct) at position 630 (A630P) (Figure 3B). The patient's parents, as expected, were heterozygous for the mutation (Figure 3B). Sequencing of the relevant STAT5b exon (exon 15) from 100 samples of normal genomic DNA (Coriell) revealed neither polymorphisms nor heterozygosity at this site.The change in the DNA sequence introduced a StyI restriction site, which, as shown in Figure 3C, could be used to differentiate the mutated SH2 sequence from that of the wild type. Both the patient's mother and father carried the wild-type as well as the mutant products (Figure 3C), corroborating the sequencing data. Furthermore, immunoblotting of lymphoblast-cell extracts from both parents showed the presence of wild-type STAT5b in concentrations equivalent to those of controls (data not shown).
Stability and Activity of Mutant STAT5b
To evaluate the stability and phosphorylation of the mutant STAT5b (A630P) further, we used a COS-7–cell expression system and interferon-γ, which can activate both STAT5a and STAT5b (data not shown). In COS-7 cells, treatment with interferon-γ results in the activation of endogenous STAT5 (Figure 3D, lanes 7 and 8). Transient transfection with the vector pcDNA3.1 resulted in the same pattern of phosphorylation (Figure 3D, lanes 1 and 4). When wild-type STAT5b was overexpressed, it was constitutively activated but was still clearly responsive to interferon-γ–induced activation (Figure 3D, lanes 3 and 6). In contrast, overexpression of mutant STAT5b (A630P) showed a pattern of STAT5 phosphorylation that was similar to that of untransfected, or vector-transfected, cells (Figure 3D, lanes 2 and 5). This was not due to a lack of expression of mutant STAT5b, since the overexpressed protein was readily detected, albeit less well recognized by the antibody than the wild-type protein (Figure 3D, lanes 2 and 5). These results demonstrate that the mutant STAT5b can be stably expressed but cannot be activated by either growth hormone (Figure 2B) or interferon-γ (Figure 3D).
Discussion
We describe a patient with a homozygous mutation in the gene for STAT5b, resulting in IGF-I deficiency and growth hormone insensitivity. The patient had abnormal postnatal growth, facial dysmorphism, and markedly reduced serum concentrations of IGF-I, IGFBP-3, and acid-labile subunit. Serum concentrations of these three proteins remained abnormally low, despite seven days of treatment with growth hormone, and her growth rate failed to increase in response to one year of growth hormone therapy. Her concentrations of growth hormone–binding protein were normal, as measured by a ligand-mediated binding assay in serum and by immunoblotting of fibroblast lysates, reflecting the fact that her GHR gene and protein were normal. Although there was no family history of growth retardation, the parents were first cousins, a relationship consistent with the occurrence of classic autosomal recessive transmission.
Most reported cases of growth hormone insensitivity involve mutations or deletions of the GHR gene.2-5,8-12 Several cases of putative defects downstream of the GHR gene have now been reported in patients with phenotypes of growth hormone insensitivity.13-16 In two of these studies,15,16 growth hormone failed to induce tyrosine phosphorylation of the STAT proteins, although no specific molecular abnormalities were identified. Indeed, the STAT5b gene from each of the 14 children with idiopathic short stature described by Salerno et al.16 was sequenced and found to be normal.21 Rodent models of STAT knockouts, on the other hand, have indicated that of the STAT proteins, STAT5b is essential for growth hormone–induced activation of IGF-I and for normal postnatal growth.19,20 Interestingly, female mice with STAT5b knockouts were largely unaffected, whereas males, which are usually approximately 30 percent larger than female mice, resembled females in size. This loss of sexually dimorphic growth patterns in mice contrasts with the dramatic growth failure observed in our patient. Furthermore, STAT5a and STAT5b do not appear to be fully redundant in humans, since normal concentrations of STAT5a did not prevent the insensitivity to growth hormone in our patient.
The missense mutation in our patient is in exon 15 of the STAT5b gene, which encodes half of the SH2 domain. No polymorphism or heterozygosity was detected in this exon in control subjects. The SH2 domain of the STAT genes is highly conserved and is necessary for the docking of these latent proteins to ligand-activated phosphorylated receptors22,23 and for their subsequent dimerization.24 The amino acid affected, alanine at position 630, is deep within the SH2 domain, in a β-sheet, βC, that is part of an antiparallel β-sheet structure essential for the binding of phosphate groups.25 Prolines are incompatible with a functional β-sheet structure. A change from alanine to proline is therefore predicted to be disruptive, affecting the functionality of the SH2 domain, distorting the epitopes recognized by antibodies, and changing the overall stability of the protein. When the mutant STAT5b was overexpressed, it was detectable in COS-7 cells, suggesting that its expression can be stable. Epitope recognition and functionality, however, were clearly affected by the mutation, since the mutant protein was poorly recognized by commercially available antibodies against STAT5b. Most important, despite being stably expressed, the mutant protein could not be activated by either growth hormone or interferon-γ.
One consequence of the mutant STAT5b is the failure to activate genes transcriptionally, as demonstrated by the dysregulation of IGF-I and IGFBP-3 both in vitro and in vivo. Aberrant regulation of other proteins is also to be expected, including the negative regulators of STAT signaling, which could potentially account for the enhanced phosphorylation of STAT1 and STAT3 that we observed. The increase in total STAT1 concentrations in our patient is consistent with that observed in the STAT5b–/– rodent model.19
In addition to mediating the actions of growth hormone, STAT5b is also important for the actions of many other growth factors and cytokines (interleukins26 and interferons20). The signal transduction of prolactin was abnormal in our patient's fibroblasts, and in the COS-7–cell model, interferon-γ activated wild-type STAT5b but failed to activate the mutant STAT5b. STAT5b has an important role in the proliferation and differentiation of T cells,26-29 and a nonfunctional STAT5b is likely to decrease cell-mediated immunity, as has been demonstrated in STAT5b–/– mice18-20,28 and as suggested by the results in our patient's cells when they were exposed to interferon-γ. Hence, we hypothesize that the immunologic problems in our patient are probably a direct manifestation of the mutated STAT5b. Further studies of immunodeficiencies in this and similar patients are clearly warranted.
In summary, the STAT5b mutation represents a clearly defined postreceptor molecular abnormality in the human growth hormone signaling cascade. It is likely that other defects in the JAK-STAT system will be identified in patients with various degrees of IGF deficiency and growth hormone insensitivity. The combined phenotype of growth hormone insensitivity and immunodeficiency is consistent with the presence of such signaling defects.
Supported by grants (CA58110 and DMD17-00-1-0042, to Dr. Rosenfeld) from the National Institutes of Health, and by a grant from Pharmacia.
Mr. Kofoed and Dr. Hwa contributed equally to the article.
We are indebted to Dr. Ellen Magenis (Department of Genetics, Oregon Health and Science University) for performing a skin biopsy to obtain the fibroblast cultures used in this study.
Source Information
From the Department of Pediatrics, Oregon Health and Science University, Portland (E.M.K., V.H., B.L., K.A.W., C.K.B., J.T., K.L.P., R.G.R.); the Departments of Endocrinology (L.B., H.J., J.J.H.) and Pulmonology (A.T.), Hospital General de Niños Ricardo Gutiérrez de Buenos Aires, Buenos Aires, Argentina; and the Lucile Packard Foundation for Children's Health, Palo Alto, Calif. (R.G.R.).
Address reprint requests to Dr. Rosenfeld at the Lucile Packard Foundation for Children's Health, 770 Welch Rd., Suite 350, Palo Alto, CA 94304, or at ron.rosenfeld@lpfch.org.
- References
References
1
Savage MO ,Rosenfeld RG . Growth hormone insensitivity: a proposed revised classification. Acta Paediatr Suppl 1999;428:147-147
CrossRef2
Laron Z ,Pertzelan A ,Mannheimer S . Genetic pituitary dwarfism with high serum concentration of growth hormone -- a new inborn error of metabolism? Isr J Med Sci 1966;2:152-155
Medline3
Rosenfeld RG ,Rosenbloom AL ,Guevara-Aguirre J . Growth hormone (GH) insensitivity due to primary GH receptor deficiency. Endocr Rev 1994;15:369-390
Web of Science | Medline4
Woods KA ,Dastot F ,Preece MA , et al. Phenotype: genotype relationships in growth hormone insensitivity syndrome. J Clin Endocrinol Metab 1997;82:3529-3535
CrossRef | Web of Science | Medline5
Wojcik J ,Berg MA ,Esposito N , et al. Four contiguous amino acid substitutions, identified in patients with Laron syndrome, differently affect the binding affinity and intracellular trafficking of the growth hormone receptor. J Clin Endocrinol Metab 1998;83:4481-4489
CrossRef | Web of Science | Medline6
Burren CP ,Woods KA ,Rose SJ , et al. Clinical and endocrine characteristics in atypical and classical growth hormone insensitivity syndrome. Horm Res 2001;55:125-130
CrossRef | Web of Science | Medline7
Amit T ,Youdim MB ,Hochberg Z . Does serum growth hormone (GH) binding protein reflect human GH receptor function? J Clin Endocrinol Metab 2000;85:927-932
CrossRef | Web of Science | Medline8
Duquesnoy P ,Sobrier ML ,Duriez B , et al. A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH) receptor confers familial GH resistance (Laron syndrome) with positive GH-binding activity by abolishing receptor homodimerization. EMBO J 1994;13:1386-1395
Web of Science | Medline9
Sobrier ML ,Dastot F ,Duquesnoy P , et al. Nine novel growth hormone receptor gene mutations in patients with Laron syndrome. J Clin Endocrinol Metab 1997;82:435-437
CrossRef | Web of Science | Medline10
Woods KA ,Fraser NC ,Postel-Vinay MC ,Savage MO ,Clark AJ . A homozygous splice site mutation affecting the intracellular domain of the growth hormone (GH) receptor resulting in Laron syndrome with elevated GH-binding protein. J Clin Endocrinol Metab 1996;81:1686-1690
CrossRef | Web of Science | Medline11
Iida K ,Takahashi Y ,Kaji H , et al. Functional characterization of truncated growth hormone (GH) receptor-(1-277) causing partial GH insensitivity syndrome with high GH-binding protein. J Clin Endocrinol Metab 1999;84:1011-1016
CrossRef | Web of Science | Medline12
Ayling RM ,Ross R ,Towner P , et al. A dominant-negative mutation of the growth hormone receptor causes familial short stature. Nat Genet 1997;16:13-14
CrossRef | Web of Science | Medline13
Freeth JS ,Silva CM ,Whatmore AJ ,Clayton PE . Activation of the signal transducers and activators of transcription signaling pathway by growth hormone (GH) in skin fibroblasts from normal and GH binding protein-positive Laron Syndrome children. Endocrinology 1998;139:20-28
CrossRef | Web of Science | Medline14
Laron Z ,Klinger B ,Eshet R ,Kaneti H ,Karasik A ,Silbergeld A . Laron syndrome due to a post-receptor defect: response to IGF-I treatment. Isr J Med Sci 1993;29:757-763
Medline15
Silva CM ,Kloth MT ,Whatmore AJ , et al. GH and epidermal growth factor signaling in normal and Laron syndrome fibroblasts. Endocrinology 2002;143:2610-2617
CrossRef | Web of Science | Medline16
Salerno M ,Balestrieri B ,Matrecano E , et al. Abnormal GH receptor signaling in children with idiopathic short stature. J Clin Endocrinol Metab 2001;86:3882-3888
CrossRef | Web of Science | Medline17
Buckway CK ,Guevara-Aguirre J ,Pratt KL ,Burren CP ,Rosenfeld RG . The IGF-I generation test revisited: a marker of GH sensitivity. J Clin Endocrinol Metab 2001;86:5176-5183
CrossRef | Web of Science | Medline18
Liu X ,Robinson GW ,Wagner KU ,Garrett L ,Wynshaw-Boris A ,Hennighausen L . Stat5a is mandatory for adult mammary gland development and lactogenesis. Genes Dev 1997;11:179-186
CrossRef | Web of Science | Medline19
Udy GB ,Towers RP ,Snell RG , et al. Requirement of STAT5b for sexual dimorphism of body growth rates and liver gene expression. Proc Natl Acad Sci U S A 1997;94:7239-7244
CrossRef | Web of Science | Medline20
Teglund S ,McKay C ,Schuetz E , et al. Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell 1998;93:841-850
CrossRef | Web of Science | Medline21
Ambrosio R ,Fimiani G ,Monfregola J , et al. The structure of human STAT5A and B genes reveals two regions of nearly identical sequence and an alternative tissue specific STAT5B promoter. Gene 2002;285:311-318
CrossRef | Web of Science | Medline22
Li X ,Leung S ,Kerr IM ,Stark GR . Functional subdomains of STAT2 required for preassociation with the alpha interferon receptor and for signaling. Mol Cell Biol 1997;17:2048-2056
Web of Science | Medline23
Krishnan K ,Singh B ,Krolewski JJ . Identification of amino acid residues critical for the Src-homology 2 domain-dependent docking of Stat2 to the interferon alpha receptor. J Biol Chem 1998;273:19495-19501
CrossRef | Web of Science | Medline24
Shuai K ,Horvath CM ,Huang LH ,Qureshi SA ,Cowburn D ,Darnell JE Jr . Interferon activation of the transcription factor Stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions. Cell 1994;76:821-828
CrossRef | Web of Science | Medline25
Chen X ,Vinkemeier U ,Zhao Y ,Jeruzalmi D ,Darnell JE Jr ,Kuriyan J . Crystal structure of a tyrosine phosphorylated STAT-1 dimer bound to DNA. Cell 1998;93:827-839
CrossRef | Web of Science | Medline26
Moriggl R ,Sexl V ,Piekorz R ,Topham D ,Ihle JN . Stat5 activation is uniquely associated with cytokine signaling in peripheral T cells. Immunity 1999;11:225-230
CrossRef | Web of Science | Medline27
Welte T ,Leitenberg D ,Dittel BN , et al. STAT5 interaction with the T cell receptor complex and stimulation of T cell proliferation. Science 1999;283:222-225
CrossRef | Web of Science | Medline28
Imada K ,Bloom ET ,Nakajima H , et al. Stat5b is essential for natural killer cell-mediated proliferation and cytolytic activity. J Exp Med 1998;188:2067-2074
CrossRef | Web of Science | Medline29
Moriggl R ,Topham DJ ,Teglund S , et al. Stat5 is required for IL-2-induced cell cycle progression of peripheral T cells. Immunity 1999;10:249-259
CrossRef | Web of Science | Medline
- Citing Articles (88)
Citing Articles
1
A.l.i. Mohamadi, Roberto Salvatori. 2012. Neuroendocrine Growth Disorders – Dwarfism, Gigantism. , 707-721.
CrossRef2
F. Barzaghi, L. Passerini, E. Gambineri, S. Ciullini Mannurita, T. Cornu, E.S. Kang, Y.H. Choe, C. Cancrini, S. Corrente, R. Ciccocioppo, M. Cecconi, G. Zuin, V. Discepolo, C. Sartirana, J. Schmidtko, A. Ikinciogullari, A. Ambrosi, M.G. Roncarolo, S. Olek, R. Bacchetta. (2012) Demethylation analysis of the FOXP3 locus shows quantitative defects of regulatory T cells in IPEX-like syndrome. Journal of Autoimmunity
CrossRef3
Stephanie M. Wood, Hans-Gustaf Ljunggren, Yenan T. Bryceson. (2011) Insights into NK cell biology from human genetics and disease associations. Cellular and Molecular Life Sciences 68:21, 3479-3493
CrossRef4
Eleonora Gambineri, Troy R. Torgerson. (2011) Genetic disorders with immune dysregulation. Cellular and Molecular Life Sciences
CrossRef5
Myunggi Baik, Ji Hoon Yu, Lothar Hennighausen. (2011) Growth hormone-STAT5 regulation of growth, hepatocellular carcinoma, and liver metabolism. Annals of the New York Academy of Sciences 1229:1, 29-37
CrossRef6
MELISSA WESTWOOD, SHAHIN H. TAJBAKHSH, KIRK W. SIDDALS, ANDREW J. WHATMORE, PETER E. CLAYTON. (2011) Reduced Pericellular Sensitivity to IGF-I in Fibroblasts From Girls With Turner Syndrome: A Mechanism to Impair Clinical Responses to GH. Pediatric Research 70:1, 25-30
CrossRef7
Kari Nadeau, Vivian Hwa, Ron G. Rosenfeld. (2011) STAT5b Deficiency: An Unsuspected Cause of Growth Failure, Immunodeficiency, and Severe Pulmonary Disease. The Journal of Pediatrics 158:5, 701-708
CrossRef8
Sebastián Susperreguy, Liliana Muñoz, Natalia Y. Tkalenko, Ivan D. Mascanfroni, Vanina A. Alamino, María M. Montesinos, Ana M. Masini-Repiso, Mirta B. Miras, Claudia G. Pellizas. (2011) Growth hormone treatment in children with idiopathic short stature: correlation of growth response with peripheral thyroid hormone action. Clinical Endocrinology 74:3, 346-353
CrossRef9
J.M. Wit, W. Kiess, P. Mullis. (2011) Genetic evaluation of short stature. Best Practice & Research Clinical Endocrinology & Metabolism 25:1, 1-17
CrossRef10
Horacio M. Domené, Vivian Hwa, Héctor G. Jasper, Ron G. Rosenfeld. (2011) Acid-labile subunit (ALS) deficiency. Best Practice & Research Clinical Endocrinology & Metabolism 25:1, 101-113
CrossRef11
Vivian Hwa, Kari Nadeau, Jan M. Wit, Ron G. Rosenfeld. (2011) STAT5b deficiency: Lessons from STAT5b gene mutations. Best Practice & Research Clinical Endocrinology & Metabolism 25:1, 61-75
CrossRef12
Olga Ermakova, Lukasz Piszczek, Luisa Luciani, Florence M. G. Cavalli, Tiago Ferreira, Dominika Farley, Stefania Rizzo, Rosa Chiara Paolicelli, Mumna Al-Banchaabouchi, Claus Nerlov, Richard Moriggl, Nicholas M. Luscombe, Cornelius Gross. (2011) Sensitized phenotypic screening identifies gene dosage sensitive region on chromosome 11 that predisposes to disease in mice. EMBO Molecular Medicine 3:1, 50-66
CrossRef13
Ilaria Vigliano, Anna Fusco, Loredana Palamaro, Giuseppina Aloj, Emilia Cirillo, Maria Carolina Salerno, Claudio Pignata. (2011) γ Chain transducing element: A shared pathway between endocrine and immune system. Cellular Immunology 269:1, 10-15
CrossRef14
Rushani W. Saltzman, Stephanie Albin, Pierre Russo, Kathleen E. Sullivan. (2011) Clinical conditions associated with PCP in children. Pediatric Pulmonologyn/a-n/a
CrossRef15
Vivien S. Herman-Bonert, Shlomo Melmed. 2011. Growth Hormone. , 83-117.
CrossRef16
Shoshana Yakar, Hayden-William Courtland, David Clemmons. (2010) IGF-1 and bone: New discoveries from mouse models. Journal of Bone and Mineral Research 25:12, 2543-2552
CrossRef17
Hana Lango Allen, Karol Estrada, Guillaume Lettre, Sonja I. Berndt, Michael N. Weedon, Fernando Rivadeneira, Cristen J. Willer, Anne U. Jackson, Sailaja Vedantam, Soumya Raychaudhuri, Teresa Ferreira, Andrew R. Wood, Robert J. Weyant, Ayellet V. Segrè, Elizabeth K. Speliotes, Eleanor Wheeler, Nicole Soranzo, Ju-Hyun Park, Jian Yang, Daniel Gudbjartsson, Nancy L. Heard-Costa, Joshua C. Randall, Lu Qi, Albert Vernon Smith, Reedik Mägi, Tomi Pastinen, Liming Liang, Iris M. Heid, Jian’an Luan, Gudmar Thorleifsson, Thomas W. Winkler, Michael E. Goddard, Ken Sin Lo, Cameron Palmer, Tsegaselassie Workalemahu, Yurii S. Aulchenko, Åsa Johansson, M. Carola Zillikens, Mary F. Feitosa, Tõnu Esko, Toby Johnson, Shamika Ketkar, Peter Kraft, Massimo Mangino, Inga Prokopenko, Devin Absher, Eva Albrecht, Florian Ernst, Nicole L. Glazer, Caroline Hayward, Jouke-Jan Hottenga, Kevin B. Jacobs, Joshua W. Knowles, Zoltán Kutalik, Keri L. Monda, Ozren Polasek, Michael Preuss, Nigel W. Rayner, Neil R. Robertson, Valgerdur Steinthorsdottir, Jonathan P. Tyrer, Benjamin F. Voight, Fredrik Wiklund, Jianfeng Xu, Jing Hua Zhao, Dale R. Nyholt, Niina Pellikka, Markus Perola, John R. B. Perry, Ida Surakka, Mari-Liis Tammesoo, Elizabeth L. Altmaier, Najaf Amin, Thor Aspelund, Tushar Bhangale, Gabrielle Boucher, Daniel I. Chasman, Constance Chen, Lachlan Coin, Matthew N. Cooper, Anna L. Dixon, Quince Gibson, Elin Grundberg, Ke Hao, M. Juhani Junttila, Lee M. Kaplan, Johannes Kettunen, Inke R. König, Tony Kwan, Robert W. Lawrence, Douglas F. Levinson, Mattias Lorentzon, Barbara McKnight, Andrew P. Morris, Martina Müller, Julius Suh Ngwa, Shaun Purcell, Suzanne Rafelt, Rany M. Salem, Erika Salvi, Serena Sanna, Jianxin Shi, Ulla Sovio, John R. Thompson, Michael C. Turchin, Liesbeth Vandenput, Dominique J. Verlaan, Veronique Vitart, Charles C. White, Andreas Ziegler, Peter Almgren, Anthony J. Balmforth, Harry Campbell, Lorena Citterio, Alessandro De Grandi, Anna Dominiczak, Jubao Duan, Paul Elliott, Roberto Elosua, Johan G. Eriksson, Nelson B. Freimer, Eco J. C. Geus, Nicola Glorioso, Shen Haiqing, Anna-Liisa Hartikainen, Aki S. Havulinna, Andrew A. Hicks, Jennie Hui, Wilmar Igl, Thomas Illig, Antti Jula, Eero Kajantie, Tuomas O. Kilpeläinen, Markku Koiranen, Ivana Kolcic, Seppo Koskinen, Peter Kovacs, Jaana Laitinen, Jianjun Liu, Marja-Liisa Lokki, Ana Marusic, Andrea Maschio, Thomas Meitinger, Antonella Mulas, Guillaume Paré, Alex N. Parker, John F. Peden, Astrid Petersmann, Irene Pichler, Kirsi H. Pietiläinen, Anneli Pouta, Martin Ridderstråle, Jerome I. Rotter, Jennifer G. Sambrook, Alan R. Sanders, Carsten Oliver Schmidt, Juha Sinisalo, Jan H. Smit, Heather M. Stringham, G. Bragi Walters, Elisabeth Widen, Sarah H. Wild, Gonneke Willemsen, Laura Zagato, Lina Zgaga, Paavo Zitting, Helene Alavere, Martin Farrall, Wendy L. McArdle, Mari Nelis, Marjolein J. Peters, Samuli Ripatti, Joyce B. J. van Meurs, Katja K. Aben, Kristin G. Ardlie, Jacques S. Beckmann, John P. Beilby, Richard N. Bergman, Sven Bergmann, Francis S. Collins, Daniele Cusi, Martin den Heijer, Gudny Eiriksdottir, Pablo V. Gejman, Alistair S. Hall, Anders Hamsten, Heikki V. Huikuri, Carlos Iribarren, Mika Kähönen, Jaakko Kaprio, Sekar Kathiresan, Lambertus Kiemeney, Thomas Kocher, Lenore J. Launer, Terho Lehtimäki, Olle Melander, Tom H. Mosley Jr, Arthur W. Musk, Markku S. Nieminen, Christopher J. O’Donnell, Claes Ohlsson, Ben Oostra, Lyle J. Palmer, Olli Raitakari, Paul M. Ridker, John D. Rioux, Aila Rissanen, Carlo Rivolta, Heribert Schunkert, Alan R. Shuldiner, David S. Siscovick, Michael Stumvoll, Anke Tönjes, Jaakko Tuomilehto, Gert-Jan van Ommen, Jorma Viikari, Andrew C. Heath, Nicholas G. Martin, Grant W. Montgomery, Michael A. Province, Manfred Kayser, Alice M. Arnold, Larry D. Atwood, Eric Boerwinkle, Stephen J. Chanock, Panos Deloukas, Christian Gieger, Henrik Grönberg, Per Hall, Andrew T. Hattersley, Christian Hengstenberg, Wolfgang Hoffman, G. Mark Lathrop, Veikko Salomaa, Stefan Schreiber, Manuela Uda, Dawn Waterworth, Alan F. Wright, Themistocles L. Assimes, Inês Barroso, Albert Hofman, Karen L. Mohlke, Dorret I. Boomsma, Mark J. Caulfield, L. Adrienne Cupples, Jeanette Erdmann, Caroline S. Fox, Vilmundur Gudnason, Ulf Gyllensten, Tamara B. Harris, Richard B. Hayes, Marjo-Riitta Jarvelin, Vincent Mooser, Patricia B. Munroe, Willem H. Ouwehand, Brenda W. Penninx, Peter P. Pramstaller, Thomas Quertermous, Igor Rudan, Nilesh J. Samani, Timothy D. Spector, Henry Völzke, Hugh Watkins, James F. Wilson, Leif C. Groop, Talin Haritunians, Frank B. Hu, Robert C. Kaplan, Andres Metspalu, Kari E. North, David Schlessinger, Nicholas J. Wareham, David J. Hunter, Jeffrey R. O’Connell, David P. Strachan, H.-Erich Wichmann, Ingrid B. Borecki, Cornelia M. van Duijn, Eric E. Schadt, Unnur Thorsteinsdottir, Leena Peltonen, André G. Uitterlinden, Peter M. Visscher, Nilanjan Chatterjee, Ruth J. F. Loos, Michael Boehnke, Mark I. McCarthy, Erik Ingelsson, Cecilia M. Lindgren, Gonçalo R. Abecasis, Kari Stefansson, Timothy M. Frayling, Joel N. Hirschhorn. (2010) Hundreds of variants clustered in genomic loci and biological pathways affect human height. Nature 467:7317, 832-838
CrossRef18
Andrew J. Brooks, Michael J. Waters. (2010) The growth hormone receptor: mechanism of activation and clinical implications. Nature Reviews Endocrinology 6:9, 515-525
CrossRef19
Martin O. Savage, Christine P. Burren, Ron G. Rosenfeld. (2010) The continuum of growth hormone-IGF-I axis defects causing short stature: diagnostic and therapeutic challenges. Clinical Endocrinology 72:6, 721-728
CrossRef20
Peter Rotwein, Dennis J. Chia. (2010) Gene regulation by growth hormone. Pediatric Nephrology 25:4, 651-658
CrossRef21
Ron G. Rosenfeld, Vivian Hwa. 2010. Genetic Diagnosis of Growth Failure. , 283-335.
CrossRef22
Thierry Touvier, Françoise Conte-Auriol, Olivier Briand, Céline Cudejko, Réjane Paumelle, Sandrine Caron, Eric Baugé, Yves Rouillé, Jean-Pierre Salles, Bart Staels, Bernard Bailleul. (2009) LEPROT and LEPROTL1 cooperatively decrease hepatic growth hormone action in mice. Journal of Clinical Investigation 119:12, 3830-3838
CrossRef23
Shlomo Melmed. (2009) Acromegaly pathogenesis and treatment. Journal of Clinical Investigation 119:11, 3189-3202
CrossRef24
Yoshihisa Watanabe, Masaya Ikegawa, Yoshihisa Naruse, Masaki Tanaka. (2009) A novel splicing variant form suppresses the activity of full-length signal transducer and activator of transcription 5A. FEBS Journal 276:21, 6312-6323
CrossRef25
George M. Bright, Jessica R. Mendoza, Ron G. Rosenfeld. (2009) Recombinant Human Insulin-Like Growth Factor-1 Treatment: Ready for Primetime. Endocrinology & Metabolism Clinics of North America 38:3, 625-638
CrossRef26
Jerry K. Wales. 2009. Evaluation of Growth Disorders. , 124-154.
CrossRef27
Melissa Westwood. 2009. Principles of Hormone Action. , 24-39.
CrossRef28
Ameeta Mehta, Evelien F. Gevers, Mehul T. Dattani. 2009. Congenital Disorders of the Hypothalamo-Pituitary-Somatotrope Axis. , 60-105.
CrossRef29
Hiroaki Ohnishi, Ken-ichirou Hosoi, Hiroshi Yoshino, Masatoshi Sugiura, Satsuki Matsushima, Takashi Watanabe, Fumio Bessho. (2009) A novel JAK2 splicing mutation in neonatal myeloproliferative disorder accompanying congenital anomalies. British Journal of Haematology 145:5, 676-678
CrossRef30
Stephen F. Kemp. (2009) Insulin-Like Growth Factor-I Deficiency in Children with Growth Hormone Insensitivity. BioDrugs 23:3, 155-163
CrossRef31
A. Hosui, A. Kimura, D. Yamaji, B.-m. Zhu, R. Na, L. Hennighausen. (2009) Loss of STAT5 causes liver fibrosis and cancer development through increased TGF- and STAT3 activation. Journal of Experimental Medicine 206:4, 819-831
CrossRef32
C. Pass, V. E. MacRae, S. F. Ahmed, C. Farquharson. (2009) Inflammatory cytokines and the GH/IGF-I axis: novel actions on bone growth. Cell Biochemistry and Function 27:3, 119-127
CrossRef33
Stuart J. Frank, Serge Y. Fuchs. (2008) Modulation of growth hormone receptor abundance and function: roles for the ubiquitin–proteasome system. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1782:12, 785-794
CrossRef34
Ilkka Lappalainen, Janita Thusberg, Bairong Shen, Mauno Vihinen. (2008) Genome wide analysis of pathogenic SH2 domain mutations. Proteins: Structure, Function, and Bioinformatics 72:2, 779-792
CrossRef35
Adrian Liston, Anselm Enders, Owen M. Siggs. (2008) Unravelling the association of partial T-cell immunodeficiency and immune dysregulation. Nature Reviews Immunology 8:7, 545-558
CrossRef36
A Lakshmikuttyamma, E Pastural, N Takahashi, K Sawada, D P Sheridan, J F DeCoteau, C R Geyer. (2008) Bcr-Abl induces autocrine IGF-1 signaling. Oncogene 27:27, 3831-3844
CrossRef37
Anna Villa, Veronica Marrella, Francesca Rucci, Luigi D Notarangelo. (2008) Genetically determined lymphopenia and autoimmune manifestations. Current Opinion in Immunology 20:3, 318-324
CrossRef38
Troy R. Torgerson. (2008) Immune Dysregulation in Primary Immunodeficiency Disorders. Immunology and Allergy Clinics of North America 28:2, 315-327
CrossRef39
J.M. Wit, P.E. Clayton, A.D. Rogol, M.O. Savage, P.H. Saenger, P. Cohen. (2008) Idiopathic short stature: Definition, epidemiology, and diagnostic evaluation. Growth Hormone & IGF Research 18:2, 89-110
CrossRef40
N Byts, A Samoylenko, T Fasshauer, M Ivanisevic, L Hennighausen, H Ehrenreich, A-L Sirén. (2008) Essential role for Stat5 in the neurotrophic but not in the neuroprotective effect of erythropoietin. Cell Death and Differentiation 15:4, 783-792
CrossRef41
Kay-Uwe Wagner, Hallgeir Rui. (2008) Jak2/Stat5 Signaling in Mammogenesis, Breast Cancer Initiation and Progression. Journal of Mammary Gland Biology and Neoplasia 13:1, 93-103
CrossRef42
Agnieszka M. Lichanska, Michael J. Waters. (2008) How growth hormone controls growth, obesity and sexual dimorphism. Trends in Genetics 24:1, 41-47
CrossRef43
Karen Lin-Su, Maria I. New. (2008) Inactivation of the acid labile subunit gene resulting in insulin-like growth factor deficiency. Mount Sinai Journal of Medicine: A Journal of Translational and Personalized Medicine 75:1, 57-58
CrossRef44
A.M. Lichanska, M.J. Waters. (2008) New Insights into Growth Hormone Receptor Function and Clinical Implications. Hormone Research 69:3, 138-145
CrossRef45
Troy R Torgerson, Hans D Ochs. (2007) Regulatory T cells in primary immunodeficiency diseases. Current Opinion in Allergy and Clinical Immunology 7:6, 515-521
CrossRef46
Weiguo Yao, Kathleen Bethin, Xianlin Yang, Jin Zhong, Wei-Hua Lee. (2007) Role of the GH/IGF-I axis in the growth retardation of weaver mice. Endocrine 32:2, 227-234
CrossRef47
Guillaume Lettre, Johannah L. Butler, Kristin G. Ardlie, Joel N. Hirschhorn. (2007) Common genetic variation in eight genes of the GH/IGF1 axis does not contribute to adult height variation. Human Genetics 122:2, 129-139
CrossRef48
Yongzhi Cui, Atsushi Hosui, Rui Sun, Kezhen Shen, Oksana Gavrilova, Weiping Chen, Margaret C. Cam, Bin Gao, Gertraud W. Robinson, Lothar Hennighausen. (2007) Loss of signal transducer and activator of transcription 5 leads to hepatosteatosis and impaired liver regeneration. Hepatology 46:2, 504-513
CrossRef49
Ron G. Rosenfeld, Alicia Belgorosky, Cecelia Camacho-Hubner, M.O. Savage, J.M. Wit, Vivian Hwa. (2007) Defects in growth hormone receptor signaling. Trends in Endocrinology & Metabolism 18:4, 134-141
CrossRef50
Charmian A. Quigley. (2007) Growth Hormone Treatment of Non–Growth Hormone-Deficient Growth Disorders. Endocrinology & Metabolism Clinics of North America 36:1, 131-186
CrossRef51
Weiguo Chen, Gurjit K. Khurana Hershey. (2007) Signal transducer and activator of transcription signals in allergic disease. Journal of Allergy and Clinical Immunology 119:3, 529-541
CrossRef52
Pierre Bougnères, Vincent Goffin. (2007) The Growth Hormone Receptor in Growth. Endocrinology & Metabolism Clinics of North America 36:1, 1-16
CrossRef53
Vivian Hwa, Cecilia Camacho-Hübner, Brian M. Little, Alessia David, Lou A. Metherell, Nesrin El-Khatib, Martin O. Savage, Ron G. Rosenfeld. (2007) Growth Hormone Insensitivity and Severe Short Stature in Siblings: A Novel Mutation at the Exon 13-Intron 13 Junction of the <i>STAT5b</i> Gene. Hormone Research 68:5, 218-224
CrossRef54
Carlos Eduardo Martinelli, Soraya Sader Milani, Joana Karin Previato, Marcos Figueira, Ana Paula Rangel Montenegro, Farideh Miraki-Moud, Sandra Betancourth, Ayrton Custódio Moreira, Martin O. Savage, Cecilia Camacho-Hübner. (2007) Final Height in Patients with Idiopathic Short Stature and High Growth Hormone Responses to Stimulation Tests. Hormone Research 67:5, 224-230
CrossRef55
Arlan L. Rosenbloom. (2007) Recombinant Human Insulin-Like Growth Factor I (rhIGF-I) and rhIGF-I/rhIGF-Binding-Protein-3: New Growth Treatment Options?. The Journal of Pediatrics 150:1, 7-11
CrossRef56
Edward O. Reiter. (2007) Hormonal Treatment of Idiopathic Short Stature. Hormone Research 67:1, 58-63
CrossRef57
Iwona Pilecka, Andrew Whatmore, Rob Hooft van Huijsduijnen, Benoit Destenaves, Peter Clayton. (2007) Growth hormone signalling: sprouting links between pathways, human genetics and therapeutic options. Trends in Endocrinology & Metabolism 18:1, 12-18
CrossRef58
Horacio M. Domené, Alicia S. Martínez, Jan Frystyk, Sonia V. Bengolea, María G. Ropelato, Paula A. Scaglia, Jian-Wen Chen, Carsten Heuck, Ole D. Wolthers, Juan J. Heinrich, Héctor G. Jasper. (2007) Normal Growth Spurt and Final Height despite Low Levels of All Forms of Circulating Insulin-Like Growth Factor-I in a Patient with Acid-Labile Subunit Deficiency. Hormone Research 67:5, 243-249
CrossRef59
Jang Hyun Choi, Hyeon Soo Kim, Sun-Hee Kim, Yong Ryoul Yang, Yun Soo Bae, Jong-Soo Chang, H. Moo Kwon, Sung Ho Ryu, Pann-Ghill Suh. (2006) Phospholipase Cγ1 negatively regulates growth hormone signalling by forming a ternary complex with Jak2 and protein tyrosine phosphatase-1B. Nature Cell Biology 8:12, 1389-1397
CrossRef60
Andrea P. Rojas-Gil, Panos G. Ziros, Leonor Diaz, Dimitris Kletsas, Efthimia K. Basdra, Theodore K. Alexandrides, Zvi Zadik, Stuart J. Frank, Vassiliki Papathanassopoulou, Nicholas G. Beratis, Athanasios G. Papavassiliou, Bessie E. Spiliotis. (2006) Growth hormone/JAK-STAT axis signal-transduction defect.. FEBS Journal 273:15, 3454-3466
CrossRef61
Martin O Savage, Kenneth M Attie, Alessia David, Louise A Metherell, Adrian JL Clark, Cecilia Camacho-Hübner. (2006) Endocrine assessment, molecular characterization and treatment of growth hormone insensitivity disorders. Nature Clinical Practice Endocrinology & Metabolism 2:7, 395-407
CrossRef62
Zvi Laron, Shira Ginsberg, Pearl Lilos, Mira Arbiv, Nahum Vaisman. (2006) Body composition in untreated adult patients with Laron syndrome (primary GH insensitivity). Clinical Endocrinology 65:1, 114-117
CrossRef63
Bernard A. Liu, Karl Jablonowski, Monica Raina, Michael Arcé, Tony Pawson, Piers D. Nash. (2006) The Human and Mouse Complement of SH2 Domain Proteins—Establishing the Boundaries of Phosphotyrosine Signaling. Molecular Cell 22:6, 851-868
CrossRef64
Abdullah Alangari, Abdullah Abobaker, Hirokazu Kanegane, Toshio Miyawaki. (2006) X-linked lymphoproliferative disease associated with hypogammaglobulinemia and growth-hormone deficiency. European Journal of Pediatrics 165:3, 165-167
CrossRef65
Rebecca A Pelekanos, Michael J Waters. (2006) Activation of the growth hormone receptor. Expert Review of Endocrinology & Metabolism 1:2, 189-198
CrossRef66
Erick J Richmond, Alan D Rogol. (2006) Individualized therapy for growth hormone deficiency. Expert Review of Endocrinology & Metabolism 1:1, 83-90
CrossRef67
Iain C.A.F. Robinson, Evelien F. Gevers. (2006) Visualizing and Manipulating Growth Hormone (GH) Responses in Muscle and Other GH Target Tissues. Hormone Research 66:1, 35-41
CrossRef68
Myung Jin Ko, Tae Gyu Hwang, Jeong Nye Lee, Woo Yeong Chung. (2006) Analysis of cytosine adenine(CA) repeat polymorphism of the IGF-I gene and influence on serum IGF-I levels in healthy children and adolescents. Korean Journal of Pediatrics 49:12, 1340
CrossRef69
Yasir Hujeirat, Ora Hess, Stavit Shalev, Yardena Tenenbaum-Rakover. (2006) Growth Hormone Receptor Sequence Changes Do Not Play a Role in Determining Height in Children with Idiopathic Short Stature. Hormone Research 65:4, 210-216
CrossRef70
David B. Dunger, Ken K. Ong. (2005) Endocrine and Metabolic Consequences of Intrauterine Growth Retardation. Endocrinology & Metabolism Clinics of North America 34:3, 597-615
CrossRef71
Alessia David, Louise A. Metherell, Adrian J.L. Clark, Cecilia Camacho-Hübner, Martin O. Savage. (2005) Diagnostic and Therapeutic Advances in Growth Hormone Insensitivity. Endocrinology & Metabolism Clinics of North America 34:3, 581-595
CrossRef72
Rose A. Gubitosi-Klug, Leona Cuttler. (2005) Idiopathic Short Stature. Endocrinology & Metabolism Clinics of North America 34:3, 565-580
CrossRef73
Patricia Park, Pinchas Cohen. (2005) Insulin-like growth factor I (IGF-I) measurements in growth hormone (GH) therapy of idiopathic short stature (ISS). Growth Hormone & IGF Research 15, 13-20
CrossRef74
Ron G. Rosenfeld. (2005) The molecular basis of idiopathic short stature. Growth Hormone & IGF Research 15, 3-5
CrossRef75
Lisa M. Difedele, Jiman He, Erin L. Bonkowski, Xiaonan Han, Matthew A. Held, Alan Bohan, Ram K. Menon, Lee A. Denson. (2005) Tumor Necrosis Factor α Blockade Restores Growth Hormone Signaling in Murine Colitis. Gastroenterology 128:5, 1278-1291
CrossRef76
Helene Nørrelund. (2005) The metabolic role of growth hormone in humans with particular reference to fasting. Growth Hormone & IGF Research 15:2, 95-122
CrossRef77
Ron G. Rosenfeld, Eric Kofoed, Caroline Buckway, Brian Little, Katie A. Woods, Junko Tsubaki, Katherine A. Pratt, Liliana Bezrodnik, Hector Jasper, Alejandro Tepper, Juan J. Heinrich, Vivian Hwa. (2005) Identification of the first patient with a confirmed mutation of the JAK-STAT system. Pediatric Nephrology 20:3, 303-305
CrossRef78
Joachim Woelfle, Dennis J. Chia, Mylynda B. Massart-Schlesinger, Paula Moyano, Peter Rotwein. (2005) Molecular physiology, pathology, and regulation of the growth hormone/insulin-like growth factor-I system. Pediatric Nephrology 20:3, 295-302
CrossRef79
Charles H. Lang, Ly Hong-Brown, Robert A. Frost. (2005) Cytokine inhibition of JAK-STAT signaling: a new mechanism of growth hormone resistance. Pediatric Nephrology 20:3, 306-312
CrossRef80
Marko Pesu, Fabio Candotti, Matthew Husa, Sigrun R. Hofmann, Luigi D. Notarangelo, John J. O'Shea. (2005) Jak3, severe combined immunodeficiency, and a new class of immunosuppressive drugs. Immunological Reviews 203:1, 127-142
CrossRef81
Joyce Lee, Ram K. Menon. (2005) Molecular defects in the growth hormone-IGF axis. The Indian Journal of Pediatrics 72:2, 145-148
CrossRef82
David B. Dunger, Ken K. Ong. (2005) Babies Born Small for Gestational Age: Insulin Sensitivity and Growth Hormone Treatment. Hormone Research 64:3, 58-65
CrossRef83
Brandon M. Nathan, Joel N. Hirschhorn, Mark R. Palmert. (2004) Strategies for Studying Complex Genetic Traits. The Endocrinologist 14:6, 346-352
CrossRef84
Martin O Savage, Cecilia Camacho-Hübner, David B Dunger. (2004) Therapeutic applications of the insulin-like growth factors. Growth Hormone & IGF Research 14:4, 301-308
CrossRef85
Mehul Dattani, Michael Preece. (2004) Growth hormone deficiency and related disorders: insights into causation, diagnosis, and treatment. The Lancet 363:9425, 1977-1987
CrossRef86
Ron G. Rosenfeld, Eric Kofoed, Brian Little, Katie Woods, Caroline Buckway, Katherine Pratt, Vivian Hwa. (2004) Growth hormone insensitivity resulting from post-GH receptor defects. Growth Hormone & IGF Research 14, 35-38
CrossRef87
Ron G. Rosenfeld, Caroline Buckway, Karin Selva, Kathie L. Pratt, Jaime Guevara-Aguirre. (2004) Insulin-Like Growth Factor (IGF) Parameters and Tools for Efficacy: The IGF-I Generation Test in Children. Hormone Research 62:1, 37-43
CrossRef88
Eugster, Erica A., Pescovitz, Ora Hirsch, . (2003) New Revelations about the Role of STATs in Stature. New England Journal of Medicine 349:12, 1110-1112
Full Text
