Original Article
Brief Report
Inherited Deficiency of Mannan-Binding Lectin–Associated Serine Protease 2
N Engl J Med 2003; 349:554-560August 7, 2003
- Article
The complement system is part of the innate immune system and contributes to the establishment of adaptive immune responses.1 The mannan-binding lectin pathway of the complement system is activated when mannan-binding lectin binds to carbohydrate structures on microorganisms.2 This happens through autoactivation of the mannan-binding lectin–associated serine protease 2 (MASP-2), which then cleaves complement factors C4 and C2, generating the C3 convertase C4bC2b.3,4 Activation of C3 initiates the alternative pathway and the formation of the membrane-attack complex. Complement fragments deposited on microorganisms facilitate phagocytosis and initiate inflammatory reactions. Like mannan-binding lectin, the recognition molecules L-ficolin and H-ficolin activate complement by a MASP-2–dependent mechanism.5 Three other proteins are associated with mannan-binding lectin and ficolins: mannan-binding lectin–associated proteases 1 and 3 (MASP-1 and MASP-3), serine proteases of unknown function, and MAp19, a fragment of MASP-2, with four additional amino acid residues.6,7 A deficiency of mannan-binding lectin is associated with susceptibility to infections and with the development of immunologic disease.8 We describe a patient with an inherited deficiency of MASP-2.
Case Report
A man who had been born in 1967 was essentially healthy until 1980, when he received a diagnosis of ulcerative colitis. The condition was successfully treated with topical prednisolone. In 1996 erythema multiforme bullosum developed. Systemic lupus erythematosus was suspected because of joint symptoms and myalgia in combination with weakly positive tests for antinuclear antibody. The patient had a favorable response to treatment with prednisolone, and other immunosuppressive drugs were subsequently added to the regimen.
Severe pneumococcal pneumonia was documented at least three times between 1995 and 1997, with one episode of sepsis requiring prolonged intensive care. In 1997, roentgenography and transbronchial biopsy showed progressive lung fibrosis without vasculitis, alveolitis, or granulomas. Hypocomplementemia was found, but a Coomb's test and tests for antibodies against native DNA, cardiolipin, neutrophil cytoplasm, human immunodeficiency virus, and hepatitis A, B, and C virus were negative. Differential leukocyte counts and tests of kidney and liver function were also normal.
The patient's inflammatory disease persisted. Complement analysis in October 2002 showed severe hypocomplementemia with anti-C1q autoantibodies and low C1q levels (see Supplementary Appendix 1, available with the full text of this article at http://www.nejm.org). Immunosuppressive treatment is now limited to 5 to 15 mg of prednisolone daily. Without this treatment, the patient's skin symptoms worsen. The patient's parents, brother, and his two children have no increased susceptibility to infections.
Methods
Reagents and Samples
We used a monoclonal antibody raised against MAp19 and a monoclonal antibody that reacts only against MASP-2 alone, generated with the use of the three C-terminal domains of MASP-2. Antibody against MASP-1 was generated from clone 12F2.9 Rat anti–MASP-3 antiserum was generated with the use of recombinant MASP-3 B-chain. EDTA-treated plasma samples were obtained on three occasions from the patient while his condition was clinically stable and from his parents, brother, and two children. Mannan-binding lectin–deficient serum (<20 ng of mannan-binding lectin per milliliter) was obtained from two healthy volunteers. Serum samples from 17 patients who had hypocomplementemia with low C1q levels (8 with systemic lupus erythematosus, 5 with hypocomplementemic urticarial vasculitis syndrome, and 4 with unexplained hypocomplementemia) were also analyzed. The studies were approved by the appropriate ethics committees, and samples were obtained after each subject or the subject's parent had provided written informed consent.
Recombinant Proteins
MASP-2 complementary DNA was cloned in the pCI eukaryotic expression vector (Promega), and recombinant MASP-2 was produced in a human embryonic-kidney-cell line, HEK293, with use of the Free Style 293-F system (GIBCO). Recombinant mutant MASP-2 was produced after site-directed mutagenesis by an overlapping polymerase chain reaction (PCR). Recombinant mannan-binding lectin was produced as described previously.10
Complement Analysis
C3 and C4 were quantified by turbidometry. C1q, C1 inhibitor, properdin, C3d fragments, terminal component complexes (SC5b–C9), the function of the classic and alternative pathways, and autoantibodies to C1q were determined as described previously.11-15 The function of C1 inhibitor was determined with the use of a commercial kit (Behringwerke), and mannan-binding lectin by means of a time-resolved immunofluorometric assay.14 The function of the mannan-binding lectin pathway was assessed on the basis of the capacity of the mannan-binding lectin–MASP complex to induce the deposition of C4b onto a mannan-coated surface.16 Levels of MASP-2 were measured with the use of a sandwich-type time-resolved immunofluorometric assay on plates coated with antibody against MASP-2 and subsequent incubation with a biotinylated antibody against MAp19–MASP-2 and europium-labeled streptavidin. To identify MASPs bound to mannan-binding lectin with the use of Western blotting, we incubated plasma samples in microtiter wells coated with antibody against mannan-binding lectin. The resulting bound material was eluted with sample buffer for sodium dodecyl sulfate–polyacryl-amide-gel electrophoresis and analyzed by Western blotting through incubation with antibodies against MASP.17
Gene Sequencing
DNA was isolated from EDTA-treated blood. The exons of the gene encoding MAp19 and MASP-2 as well as 1100 bp of the promoter region were amplified by PCR and sequenced (Lark). We subsequently used the primer sets 5'GCGAGTACGACTTCGTCAAGG3' and 5'CTCGGCTGCATAGAAGGCCTC3' to amplify parts of the region encoding the first domain (CUB1) and 5'CCAGACCTTTGGAAAGTTAGC3' and 5'GGCTCAAGTTCCAAGTATTGC3' to amplify part of the region encoding the fifth domain (the complement control protein domain 2) of MASP-2. These PCR products were sequenced. The gene for mannan-binding lectin (MBL) was sequenced after the individual exons had been amplified by PCR.
Results
Analyses of the functional activity of the mannan-binding lectin–MASP complex in the patient revealed severe deficiency, with less than 10 mU of mannan-binding lectin activity per microgram. The 5th to 95th percentile is 300 to 950 mU of mannan-binding lectin per microgram.18 The patient was heterozygous for the mannan-binding lectin B allotype, and his mannan-binding lectin level (0.7 μg per milliliter) was within the range reported for blood donors with this allotype.19 In other persons with this allotype, the specific activity of the pathway is within the normal range.18
The mannan-binding lectin–MASP complexes from the patient contained MASP-1 (Figure 1BFigure 1
Analyses of the Mannan-Binding Lectin (MBL) Pathway for Complexes of MAp19 and MBL-Associated Serine Protease 2 (MASP-2) (Panel A), MASP-1 (Panel B), MASP-3 (Panel C), C4b Deposition (Panel D), and C4 Deposition (Panel E), and the Plasma Volume of MASP-2 and MAp19 (Panel F).) and MASP-3 (Figure 1C) but no MAp19 or MASP-2 (Figure 1A). This result was confirmed by Western blot analysis of complexes eluted from wells coated with antibody against mannan-binding lectin, whereas the same analyses showed all four components in mannan-binding lectin–MASP complexes in plasma from control subjects (see Supplementary Appendix 1, available with the full text of this article at http://www.nejm.org).Analysis for MASP-2 and MAp19 that were not bound to mannan-binding lectin in plasma was carried out with the use of affinity purification on beads coated with antibody against MAp19–MASP-2 and Western blotting. The results showed the presence of trace amounts of MASP-2 (less than 10 percent of that in normal serum), whereas the amount of MAp19 was about 50 percent of the normal level (Figure 1F). The mannan-binding lectin pathway in the patient was restored by reconstitution with recombinant MASP-2 (Figure 1D) or mannan-binding lectin–deficient plasma (data not shown). This demonstrated that mannan-binding lectin from the patient was fully active. Accordingly, the addition of recombinant mannan-binding lectin to plasma from a subject with mannan-binding lectin deficiency restored the mannan-binding lectin pathway, whereas it had no effect when added to the patient's plasma (Figure 1E). The activity of the mannan-binding lectin pathway in plasma from the patient's mother (300 mU of mannan-binding lectin per microgram), his two children (200 and 220 mU per microgram), and a brother (233 mU per microgram) was at or below the 5th percentile. The activity could not be directly evaluated in plasma from the patient's father owing to the low level of mannan-binding lectin. However, on the addition of recombinant mannan-binding lectin, the activity was increased to one third of the activity in two reference samples of mannan-binding lectin–deficient serum.
The patient had low levels of C1q, C4, and C3; increased levels of C3dg; and anti-C1q antibodies (see Supplementary Appendix 1). These findings prompted studies in other patients with evidence of pronounced activation of the classic pathway. Eleven of the 17 patients studied had anti-C1q autoantibodies. No patient had reduced activity of the mannan-binding lectin pathway. Autoantibody against MASP-2 did not appear to be the cause of the MASP-2 deficiency in our patient, since antibodies against MASP-2 could not be detected on Western blotting of mannan-binding lectin–MASP preparations, in microtiter wells coated with mannan-binding lectin–MASP complex, or bound to mannan-binding lectin–MASP complex in plasma.
The promoter region and all the exons encoding MASP-2–MAp19 were sequenced and compared with known sequences. GenBank presents two different codons for the amino acid at position 371 in the first part of complement control protein 2: a GAT encoding aspartic acid and a TAT encoding tyrosine. The patient and all his family members were homozygous for TAT. Of 15 unrelated control subjects, 10 were homozygous for TAT, 3 were heterozygous (TAT/GAT), and 2 were homozygous for GAT. Hence, these variants represent common allotypes of no discernible consequence with respect to the function of MASP-2.
Another difference in the patient's sequence was in exon 3 in the codon for the amino acid at position 120 (position 105 in the mature protein) — that is, in the CUB1 domain — where codon GGC was found instead of GAC. The patient was homozygous for this variant, which resulted in the substitution of glycine for aspartic acid (Figure 2Figure 2
The Structure of Mannan-Binding Lectin–Associated Serine Protease 2 (MASP-2) and MAp19 (Panel A), and the Location of the Mutation in MASP-2 (Panels B and C).). Amplification by PCR and sequencing of the region around the mutation in CUB1 demonstrated that the patient's parents, brother, and two children were heterozygous (GAC/GGC). Of 100 control subjects, 89 were homozygous for GAC and 11 were heterozygous (GAC/GGC), yielding a gene frequency of 0.055 for the mutant allotype. Heterozygotes had significantly lower MASP-2 levels (by 45 percent) than those who were homozygous for the wild-type MASP-2 (Figure 3Figure 3
Mannan-Binding Lectin–Associated Serine Protease 2 (MASP-2) Levels in Plasma from 86 Control Subjects Who Were Homozygous for the Wild Type (D120/D120), 11 Heterozygous (D120/G120) Control Subjects and the 5 Heterozygous Members of the Patient's Family, and the Patient, Who Was Homozygous for the Mutant Sequence (G120/G120).). The patient's MASP-2 level was about 5 percent of the levels in these homozygous subjects.To determine the importance of the substitution in the CUB1 domain, we examined recombinant wild-type and mutant MASP-2 in functional assays. Mutant MASP-2 could not associate with mannan-binding lectin (Figure 4AFigure 4
Functional Analysis of Recombinant Wild-Type and Mutant Mannan-Binding Lectin–Associated Serine Protease 2 (MASP-2) with Respect to Their Binding to Mannan-Binding Lectin (MBL) (Panel A), C4-Cleaving Capacity (Panel B), and Size (Panel C).) and thus could not form an active mannan-binding lectin–MASP complex (Figure 4B). Western blotting showed that the size of the mutated recombinant MASP-2 was identical to that of the wild type, and no degradation fragments were observed (Figure 4C).Discussion
In our patient with a history of infections and chronic inflammatory disease, the mannan-binding lectin pathway was nonfunctional despite the presence of a normal level of immunoreactive mannan-binding lectin. This malfunction was caused by the absence of MASP-2 in the mannan-binding lectin–MASP complex. The activity of the mannan-binding lectin–MASP complex was restored by the addition of recombinant MASP-2. The mannan-binding lectin–MASP complex contained no MASP-2 but a normal level of MASP-1 and an elevated level of MASP-3, results that are consistent with our previous finding that MASP-3 competes with MASP-2 for binding to mannan-binding lectin.6 The mannan-binding lectin–MASP complex also contained no MAp19. MASP-2 and MAp19 could be detected in plasma at low levels.
The gene encoding MASP-2 had a mutation in the CUB1 domain, causing substitution of glycine for aspartic acid in the loop connecting beta strands 8 and 9 (i.e., D120G) (Figure 2).20 The change from an acidic to a neutral amino acid may have profound effects on the function of the domain. The aspartic acid at this position is conserved in all MASPs as well as in the similar serine proteases C1r and C1s of the classic complement pathway. The CUB1–epidermal growth factor domains are essential for the association of MAp19 and MASP-2 with mannan-binding lectin.21,22 Analysis of the recombinant wild-type and mutated MASP-2 showed that the mutation prevents the formation of functional mannan-binding lectin–MASP-2 complexes.
The patient's parents, brother, and two children had a low level of activity of the mannan-binding lectin pathway, and they were all heterozygous for the CUB1 mutation. Likewise, the level of MASP-2 in control subjects who were heterozygous for the CUB1 mutation was about half of that in subjects with the wild type, suggesting a dominant effect of an autosomally inherited mutant allotype. Recombinant wild-type and mutant MASP-2 were secreted at similar levels by transfected cells, indicating that the mutation had no effect on intracellular processing. The failure of the mutant MASP-2 to bind to mannan-binding lectin may enhance its catabolism. MASP-2 forms dimers,21,22 which in heterozygous persons may be a mixture of wild-type and mutated MASP-2 and therefore may be more susceptible to degradation. It is not clear why the level of MAp19 was less strongly affected than the level of MASP-2.
The frequency of the gene containing the CUB1 mutation was determined to be 0.055. One would expect about 0.3 percent of the population to be homozygous for the mutation, making MASP-2 deficiency a fairly common complement deficiency. Complement deficiencies are usually associated with susceptibility to invasive infections caused by encapsulated bacteria or with the development of immunologic diseases such as systemic lupus erythematosus.1 Mannan-binding lectin deficiency has been described as a factor in susceptibility to infections and may also contribute to the development of immunologic disease.8 The consequences of MASP-2 deficiency might be more severe, since MASP-2 also mediates the activation of complement through the ficolins.5
It seems likely that the MASP-2 deficiency was at least partly responsible for the manifestations of disease in our patient, even though the clinical findings in a single patient must be interpreted with caution. The absence of serious infections during childhood is consistent with the findings in some patients who have a deficiency of C4 or C2.23 An impairment in the function of the mannan-binding lectin pathway predisposes patients to invasive pneumococcal disease,24 supporting the assumption that our patient's severe pneumococcal infections were due to a MASP-2 deficiency. The patient's hypocomplementemia may also have contributed to his impaired immune defense. Low C1q levels and the presence of anti-C1q autoantibodies are characteristics of hypocomplementemic urticarial vasculitis syndrome15,25 and severe systemic lupus erythematosus.26 These diagnoses were not justified in our patient, and we found normal MASP-2 levels in patients with hypocomplementemic urticarial vasculitis syndrome and systemic lupus erythematosus. Identification of the prevalence of the CUB1 mutation should facilitate the determination of its clinical effect on immune defense and the development of inflammatory disease.
Supported by grants from the Danish Medical Research Council, the Karen Elise Jensens Foundation, King Gustaf V's 80th Birthday Fund, and the Novo Nordisk Foundation.
Drs. Fugger and Jensenius contributed equally to this article.
We are indebted to Drs. Gerard Arlaud and Nicole Thielens, Grenoble, France, for donating the recombinant MAp19, MASP-3 B chain, and MASP-2 C-terminal fragment.
Source Information
From the Departments of Rheumatology (K.S.-P.) and Clinical Immunology (L.T.J., L.F.), Aarhus University Hospital; and the Department of Medical Microbiology and Immunology, University of Aarhus (S.T., M.G., M.M.-K., R.S., J.C.J.) — both in Aarhus, Denmark; Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, United Kingdom (L.F.); and the Institute of Laboratory Medicine, Section of Microbiology, Immunology, and Glycobiology, University of Lund, Lund, Sweden (A.G.S.).
Address reprint requests to Dr. Thiel at the Department of Medical Microbiology and Immunology, University of Aarhus, 8000 Aarhus, Denmark, or at st@microbiology.au.dk.
- References
References
1
Walport MJ . Complement. N Engl J Med 2001;344:1058-66, 1140
Full Text | Web of Science | Medline2
Gadjeva M ,Thiel S ,Jensenius JC . The mannan-binding-lectin pathway of the innate immune response. Curr Opin Immunol 2001;13:74-78
CrossRef | Web of Science | Medline3
Thiel S ,Vorup-Jensen T ,Stover CM , et al. A second serine protease associated with mannan-binding lectin that activates complement. Nature 1997;386:506-510
CrossRef | Web of Science | Medline4
Vorup-Jensen T ,Petersen SV ,Hansen AG , et al. Distinct pathways of mannan-binding lectin (MBL)- and C1-complex autoactivation revealed by reconstitution of MBL with recombinant MBL-associated serine protease-2. J Immunol 2000;165:2093-2100
Web of Science | Medline5
Matsushita M ,Fujita T . Ficolins and the lectin complement pathway. Immunol Rev 2001;180:78-85
CrossRef | Web of Science | Medline6
Dahl MR ,Thiel S ,Matsushita M , et al. MASP-3 and its association with distinct complexes of the mannan-binding lectin complement activation pathway. Immunity 2001;15:127-135
CrossRef | Web of Science | Medline7
Stover CM ,Thiel S ,Thelen M , et al. Two constituents of the initiation complex of the mannan-binding lectin activation pathway of complement are encoded by a single structural gene. J Immunol 1999;162:3481-3490
Web of Science | Medline8
Jack DL ,Klein NJ ,Turner MW . Mannose-binding lectin: targeting the microbial world for complement attack and opsonophagocytosis. Immunol Rev 2001;180:86-99
CrossRef | Web of Science | Medline9
Petersen SV. Purification and characterization of mannan-binding lectin (MBL) associated serine protease-1. (Ph.D. thesis. Aarhus, Denmark: University of Aarhus, 2001.)
10
Vorup-Jensen T ,Sorensen ES ,Jensen UB , et al. Recombinant expression of human mannan-binding lectin. Int Immunopharmacol 2001;1:677-687
CrossRef | Web of Science | Medline11
Johnson U ,Truedsson L ,Gustavii B . Complement components in 100 newborns and their mothers determined by electroimmunoassay. Acta Pathol Microbiol Immunol Scand (C) 1983;91:147-150
Medline12
Brandslund I ,Siersted HC ,Svehag S-E ,Teisner B . Double-decker rocket immunoelectrophoresis for direct quantitation of complement C3 split products with C3d specificities in plasma. J Immunol Methods 1981;44:63-71
CrossRef | Web of Science | Medline13
Mollnes TE. Analysis of in vivo complement activation. In: Weir DM, Herzenberg LA, Blackwell C, eds. Weir's handbook of experimental immunology. 5th ed. Boston: Blackwell Science, 1996:71-8.
14
Sjöholm AG, Truedsson L, Jensenius JC. Complement pathways and meningococcal disease: diagnostic aspects. In: Pollard AJ, Maiden MCJ, eds. Meningococcal disease: methods and protocols. Totowa, N.J.: Humana Press, 2001:529-47.
15
Martensson U ,Sjoholm AG ,Sturfelt G ,Truedsson L ,Laurell AB . Western blot analysis of human IgG reactive with the collagenous portion of C1q: evidence of distinct binding specificities. Scand J Immunol 1992;35:735-744
CrossRef | Web of Science | Medline16
Petersen SV ,Thiel S ,Jensen L ,Steffensen R ,Jensenius JC . An assay for the mannan-binding lectin pathway of complement activation. J Immunol Methods 2001;257:107-116
CrossRef | Web of Science | Medline17
Thiel S ,Petersen SV ,Vorup-Jensen T , et al. Interaction of C1q and mannan-binding lectin (MBL) with C1r, C1s, MBL-associated serine proteases 1 and 2, and the MBL-associated protein MAp19. J Immunol 2000;165:878-887
Web of Science | Medline18
Thiel S ,Moller-Kristensen M ,Jensen L ,Jensenius JC . Assays for the functional activity of the mannan-binding lectin pathway of complement activation. Immunobiology 2002;205:446-454
CrossRef | Web of Science | Medline19
Steffensen R ,Thiel S ,Varming K ,Jersild C ,Jensenius JC . Detection of structural gene mutations and promoter polymorphisms in the mannan-binding lectin (MBL) gene by polymerase chain reaction with sequence-specific primers. J Immunol Methods 2000;241:33-42
CrossRef | Web of Science | Medline20
Romao MJ ,Kolln I ,Dias JM , et al. Crystal structure of acidic seminal fluid protein (aSFP) at 1.9 A resolution: a bovine polypeptide of the spermadhesin family. J Mol Biol 1997;274:650-660
CrossRef | Web of Science | Medline21
Thielens NM ,Cseh S ,Thiel S , et al. Interaction properties of human mannan-binding lectin (MBL)-associated serine proteases-1 and -2, MBL-associated protein 19, and MBL. J Immunol 2001;166:5068-5077
Web of Science | Medline22
Chen CB ,Wallis R . Stoichiometry of complexes between mannose-binding protein and its associated serine proteases: defining functional units for complement activation. J Biol Chem 2001;276:25894-25902
CrossRef | Web of Science | Medline23
Figueroa JE ,Densen P . Infectious diseases associated with complement deficiencies. Clin Microbiol Rev 1991;4:359-395
Web of Science | Medline24
Roy S ,Knox K ,Segal S , et al. MBL genotype and risk of invasive pneumococcal disease: a case-control study. Lancet 2002;359:1569-1573
CrossRef | Web of Science | Medline25
Wisnieski JJ ,Baer AN ,Christensen J , et al. Hypocomplementemic urticarial vasculitis syndrome: clinical and serologic findings in 18 patients. Medicine (Baltimore) 1995;74:24-41
CrossRef | Web of Science | Medline26
Sjoholm AG ,Martensson U ,Sturfelt G . Serial analysis of autoantibody responses to the collagen-like region of C1q, collagen type II, and double-stranded DNA in patients with systemic lupus erythematosus. J Rheumatol 1997;24:871-878
Web of Science | Medline
- Citing Articles (74)
Citing Articles
1
Angelica B.W. Boldt, Isabela Goeldner, Iara J.T. de Messias-Reason. 2012. Relevance of the lectin pathway of complement in rheumatic diseases. , 105-153.
CrossRef2
Jeffrey Damman, Julian L. Kok, Harold Snieder, Henri G. Leuvenink, Harry van Goor, Jan-Luuk Hillebrands, Marcory C. van Dijk, Bouke G. Hepkema, Anna Reznichenko, Jaap van den Born, Martin H. de Borst, Stephan J Bakker, Gerjan J. Navis, Rutger J. Ploeg, Marc A. Seelen. (2011) Lectin complement pathway gene profile of the donor and recipient does not influence graft outcome after kidney transplantation. Molecular Immunology
CrossRef3
Li Ping Chung, Grant W. Waterer. (2011) Genetic predisposition to respiratory infection and sepsis. Critical Reviews in Clinical Laboratory Sciences 48:5-6, 250-268
CrossRef4
Tomasz Olszowski, Grażyna Adler, Joanna Janiszewska-Olszowska, Krzysztof Safranow, Mariusz Kaczmarczyk. (2011) MBL2, MASP2, AMELX and ENAM gene polymorphisms and dental caries in Polish children. Oral Diseasesno-no
CrossRef5
Christine Gaboriaud, Lynn Gregory
Pauron, Florence Teillet, Nicole M. Thielens, Isabelle Bally, Gérard J. Arlaud. (2011) Structure and properties of the Ca 2+ -binding CUB domain, a widespread ligand-recognition unit involved in major biological functions. Biochemical Journal 439:2, 185-193
CrossRef6
Siumara Tulio, Fabio R. Faucz, Renata I. Werneck, Márcia Olandoski, Rodrigo B. Alexandre, Angélica B.W. Boldt, Maria Lucia Pedroso, Iara J. de Messias-Reason. (2011) MASP2 gene polymorphism is associated with susceptibility to hepatitis C virus infection. Human Immunology 72:10, 912-915
CrossRef7
N. R. Ferraroni, L. Segat, R. L. Guimarães, L. A. C. Brandão, S. Crovella, R. N. Constantino-Silva, C. Loja, A. J. da Silva Duarte, A. S. Grumach. (2011) Mannose-binding lectin and MBL-associated serine protease-2 gene polymorphisms in a Brazilian population from Rio de Janeiro. International Journal of Immunogeneticsno-no
CrossRef8
Lillemor Skattum, Marcel van Deuren, Tom van der Poll, Lennart Truedsson. (2011) Complement deficiency states and associated infections. Molecular Immunology 48:14, 1643-1655
CrossRef9
Angelica B.W. Boldt, Paola R. Luz, Iara J.T. Messias-Reason. (2011) MASP2 haplotypes are associated with high risk of cardiomyopathy in chronic Chagas disease. Clinical Immunology 140:1, 63-70
CrossRef10
Alexandre Belot, Pierre Cochat. (2011) Les syndromes lupiques monogéniques. Néphrologie & Thérapeutique
CrossRef11
A.B.W. Boldt, C. Grisbach, R. Steffensen, S. Thiel, J.F.J. Kun, J.C. Jensenius, I.J.T. Messias-Reason. (2011) Multiplex sequence-specific polymerase chain reaction reveals new MASP2 haplotypes associated with MASP-2 and MAp19 serum levels. Human Immunology
CrossRef12
Søren E. Degn, Jens C. Jensenius, Steffen Thiel. (2011) Disease-Causing Mutations in Genes of the Complement System. The American Journal of Human Genetics 88:6, 689-705
CrossRef13
Seraina Sallenbach, Steffen Thiel, Christoph Aebi, Margrith Otth, Susanna Bigler, Jens C. Jensenius, Luregn J. Schlapbach, Roland A. Ammann. (2011) Serum concentrations of lectin-pathway components in healthy neonates, children and adults: mannan-binding lectin (MBL), M-, L-, and H-ficolin, and MBL-associated serine protease-2 (MASP-2). Pediatric Allergy and Immunology 22:4, 424-430
CrossRef14
Tang Yongqing, Nicole Drentin, Renee C. Duncan, Lakshmi C. Wijeyewickrema, Robert N. Pike. (2011) Mannose-binding lectin serine proteases and associated proteins of the lectin pathway of complement: Two genes, five proteins and many functions?. Biochimica et Biophysica Acta (BBA) - Proteins & Proteomics
CrossRef15
H. Ytting, I. J. Christensen, R. Steffensen, J. Alsner, S. Thiel, J. C. Jensenius, U. Hansen, H. J. Nielsen. (2011) Mannan-Binding Lectin (MBL) and MBL-Associated Serine Protease 2 (MASP-2) Genotypes in Colorectal Cancer. Scandinavian Journal of Immunology 73:2, 122-127
CrossRef16
Nico M. Wulffraat, Joris van Montfrans, Wietse Kuis. 2011. IMMUNODEFICIENCIES AND THE RHEUMATIC DISEASES. , 627-641.
CrossRef17
J. Vidya Sarma, Peter A. Ward. (2011) The complement system. Cell and Tissue Research 343:1, 227-235
CrossRef18
Jonathan North. 2010. Complement: Measurement. .
CrossRef19
Gérard J Arlaud, Nicole M Thielens. 2010. Complement: Classical and Lectin Pathways. .
CrossRef20
Stephen J Chapman. (2010) Can your genes make you more prone to pneumococcal disease?. Expert Review of Anti-infective Therapy 8:9, 967-972
CrossRef21
Bert-Jan F. de Rooij, Bart van Hoek, W. Rogier ten Hove, Anja Roos, Lee H. Bouwman, Alexander F. Schaapherder, Robert J. Porte, Mohamed R. Daha, Johan J. van der Reijden, Minneke J. Coenraad, Jan Ringers, Andrzej G. Baranski, Bouke G. Hepkema, Daniel W. Hommes, Hein W. Verspaget. (2010) Lectin complement pathway gene profile of donor and recipient determine the risk of bacterial infections after orthotopic liver transplantation. Hepatology 52:3, 1100-1110
CrossRef22
G. J. Arason, G. H. Jorgensen, B. R. Ludviksson. (2010) Primary Immunodeficiency and Autoimmunity: Lessons From Human Diseases. Scandinavian Journal of Immunology 71:5, 317-328
CrossRef23
X. Vallès, M.-R. Sarrias, F. Casals, M. Farnós, R. Piñer, B. Suárez, L. Morais, I. Mandomando, B. Sigaúque, A. Roca, P. L. Alonso, A. Torres, N. M. Thielens, F. Lozano. (2009) Genetic and structural analysis of MBL2 and MASP2 polymorphisms in south-eastern African children. Tissue Antigens 74:4, 298-307
CrossRef24
Francesco Crea, Elisa Giovannetti, Pier Luigi Zinzani, Romano Danesi. (2009) Pharmacologic rationale for early G-CSF prophylaxis in cancer patients and role of pharmacogenetics in treatment optimization. Critical Reviews in Oncology/Hematology 72:1, 21-44
CrossRef25
H. David Pettigrew, Suzanne S. Teuber, M. Eric Gershwin. (2009) Clinical Significance of Complement Deficiencies. Annals of the New York Academy of Sciences 1173:1, 108-123
CrossRef26
Munthe-Fog, Lea, Hummelshøj, Tina, Honoré, Christian, Madsen, Hans O., Permin, Henrik, Garred, Peter, . (2009) Immunodeficiency Associated with FCN3 Mutation and Ficolin-3 Deficiency. New England Journal of Medicine 360:25, 2637-2644
Full Text27
Anna St. Swierzko, Maciej Cedzynski, Iwona Domzalska-Popadiuk, Shirley L. MacDonald, Monika Borkowska-Klos, Anne P.M. Atkinson, Agnieszka Szala, Aleksandra Jopek, Jens C. Jensenius, Masaya Kawakami, Jerzy Szczapa, Misao Matsushita, Janusz Szemraj, Marc L. Turner, David C. Kilpatrick. (2009) Mannan-binding lectin-associated serine protease-2 (MASP-2) in a large cohort of neonates and its clinical associations. Molecular Immunology 46:8-9, 1696-1701
CrossRef28
Liesbet Henckaerts, Kaspar R. Nielsen, Rudi Steffensen, Kristel Van Steen, Chantal Mathieu, Annapaula Giulietti, Pieter J. Wouters, Ilse Milants, Ilse Vanhorebeek, Lies Langouche, Séverine Vermeire, Paul Rutgeerts, Steffen Thiel, Alexander Wilmer, Troels Krarup Hansen, Greet Van den Berghe. (2009) Polymorphisms in innate immunity genes predispose to bacteremia and death in the medical intensive care unit*. Critical Care Medicine 37:1, 192-e3
CrossRef29
E. A. Nicu, U. van der Velden, V. Everts, B. G. Loos. (2008) Expression of FcγRs and mCD14 on polymorphonuclear neutrophils and monocytes may determine periodontal infection. Clinical & Experimental Immunology 154:2, 177-186
CrossRef30
LUREGN J. SCHLAPBACH, CHRISTOPH AEBI, URS FISCH, ROLAND A. AMMANN, MARGRITH OTTH, SUSANNE BIGLER, MATHIAS NELLE, STEFFEN BERGER, ULF KESSLER. (2008) Higher Cord Blood Levels of Mannose-Binding Lectin-Associated Serine Protease-2 in Infants With Necrotising Enterocolitis. Pediatric Research 64:5, 562-566
CrossRef31
M. Isabel Garcia-Laorden, Jordi Sole-Violan, Felipe Rodriguez de Castro, Javier Aspa, M. Luisa Briones, Ayoze Garcia-Saavedra, Olga Rajas, Jose Blanquer, Araceli Caballero-Hidalgo, J. Alberto Marcos-Ramos, Javier Hernandez-Lopez, Carlos Rodriguez-Gallego. (2008) Mannose-binding lectin and mannose-binding lectin–associated serine protease 2 in susceptibility, severity, and outcome of pneumonia in adults. Journal of Allergy and Clinical Immunology 122:2, 368-374.e2
CrossRef32
S. Sagedal, S. Thiel, T. K. Hansen, T. E. Mollnes, H. Rollag, A. Hartmann. (2008) Impact of the complement lectin pathway on cytomegalovirus disease early after kidney transplantation. Nephrology Dialysis Transplantation 23:12, 4054-4060
CrossRef33
I. Messias-Reason, D. G. Bosco, R. M. Nisihara, L. H Jakobsen, M. L. Petzl-Erler, J. C. Jensenius. (2008) Circulating levels of mannan-binding lectin (MBL) and MBL-associated serine protease 2 in endemic pemphigus foliaceus. Clinical and Experimental Dermatology 33:4, 495-497
CrossRef34
L. Varga, G. Szplaki, J. Laki, A. Kocsis, K. Kristf, P. Gl, Z. Bajtay, J. Wieslander, M. R. Daha, P. Garred, H. O. Madsen, G. Fst, H. Farkas. (2008) Depressed activation of the lectin pathway of complement in hereditary angioedema. Clinical & Experimental Immunology 153:1, 68-74
CrossRef35
Miguel Relloso, Tan-Yun Cheng, Jin S. Im, Emilio Parisini, Carme Roura-Mir, Charles DeBono, Dirk M. Zajonc, Leonel F. Murga, Mary Jo Ondrechen, Ian A. Wilson, Steven A. Porcelli, D. Branch Moody. (2008) pH-Dependent Interdomain Tethers of CD1b Regulate Its Antigen Capture. Immunity 28:6, 774-786
CrossRef36
L. Segat, A. Fabris, L. Padovan, M. Milanese, D. Pirulli, F. Lupo, M. Salizzoni, A. Amoroso, S. Crovella. (2008) MBL2 and MASP2 gene polymorphisms in patients with hepatocellular carcinoma. Journal of Viral Hepatitis 15:5, 387-391
CrossRef37
Rasmus Pagh, Karen Duus, Inga Laursen, Paul R. Hansen, Julie Mangor, Nicole Thielens, Gérard J. Arlaud, Leif Kongerslev, Peter Højrup, Gunnar Houen. (2008) The chaperone and potential mannan-binding lectin (MBL) co-receptor calreticulin interacts with MBL through the binding site for MBL-associated serine proteases. FEBS Journal 275:3, 515-526
CrossRef38
Marcelo Derbli Schafranski, Lílian Pereira Ferrari, Daniela Scherner, Renato Torres, Iara José de Messias-Reason. (2008) Functional MASP2 gene polymorphism in patients with history of rheumatic fever. Human Immunology 69:1, 41-44
CrossRef39
L. Segat, A. Fabris, L. Padovan, M. Milanese, D. Pirulli, F. Lupo, M. Salizzoni, A. Amoroso, S. Crovella. (2008) MBL2 and MASP2 gene polymorphisms in patients with hepatocellular carcinoma. Journal of Viral Hepatitisno-no
CrossRef40
W. C. van der Zwet, A. Catsburg, R. M. van Elburg, P. H. M. Savelkoul, C. M. J. E. Vandenbroucke-Grauls. (2007) Mannose-binding lectin (MBL) genotype in relation to risk of nosocomial infection in pre-term neonates in the neonatal intensive care unit. Clinical Microbiology and Infection 0:0, 071121044635001-???
CrossRef41
Luregn J. Schlapbach, Christoph Aebi, Margrith Otth, Kurt Leibundgut, Andreas Hirt, Roland A. Ammann. (2007) Deficiency of Mannose-Binding Lectin-Associated Serine Protease-2 Associated With Increased Risk of Fever and Neutropenia in Pediatric Cancer Patients. The Pediatric Infectious Disease Journal 26:11, 989-994
CrossRef42
O. Manuel, P.E. Tarr, J.-P. Venetz, M. Trendelenburg, P.R. Meylan, M. Pascual. (2007) Meningococcal disease in a kidney transplant recipient with mannose-binding lectin deficiency. Transplant Infectious Disease 9:3, 214-218
CrossRef43
Steffen Thiel. (2007) Complement activating soluble pattern recognition molecules with collagen-like regions, mannan-binding lectin, ficolins and associated proteins. Molecular Immunology 44:16, 3875-3888
CrossRef44
Patricia M L Ng, Agnès Le Saux, Chia M Lee, Nguan S Tan, Jinhua Lu, Steffen Thiel, Bow Ho, Jeak L Ding. (2007) C-reactive protein collaborates with plasma lectins to boost immune response against bacteria. The EMBO Journal 26:14, 3431-3440
CrossRef45
D. P. Eisen, J. Stubbs, D. Spilsbury, J. Carnie, J. Leydon, B. P. Howden. (2007) Low mannose-binding lectin complement activation function is associated with predisposition to Legionnaires' disease. Clinical & Experimental Immunology 149:1, 97-102
CrossRef46
Russell Wallis. (2007) Interactions between mannose-binding lectin and MASPs during complement activation by the lectin pathway. Immunobiology 212:4-5, 289-299
CrossRef47
Péter Gál, László Barna, Andrea Kocsis, Péter Závodszky. (2007) Serine proteases of the classical and lectin pathways: Similarities and differences. Immunobiology 212:4-5, 267-277
CrossRef48
Carlos Cervera, Francisco Lozano, Nuria Saval, Idoia Gimferrer, Ana Iba??ez, Belen Su??rez, Laura Linares, Federico Cof??n, Maria Jose Ricart, Nuria Esforzado, Mar??a Angeles Marcos, Tom??s Pumarola, Federico Oppenheimer, Josep M. Campistol, Asunci??n Moreno. (2007) The Influence of Innate Immunity Gene Receptors Polymorphisms in Renal Transplant Infections. Transplantation 83:11, 1493-1500
CrossRef49
G. Weiss, H. O. Madsen, P. Garred. (2007) A Novel Mannose-binding Lectin-associated Serine Protease 1/3 Gene Variant. Scandinavian Journal of Immunology 65:5, 430-434
CrossRef50
S Thiel, R Steffensen, I J Christensen, W K Ip, Y L Lau, I J M Reason, H Eiberg, M Gadjeva, M Ruseva, J C Jensenius. (2007) Deficiency of mannan-binding lectin associated serine protease-2 due to missense polymorphisms. Genes and Immunity 8:2, 154-163
CrossRef51
Tove Christensen, Thor Petersen, Steffen Thiel, Tomasz Brudek, Svend Ellermann-Eriksen, Anné Møller-Larsen. (2007) Gene–environment interactions in multiple sclerosis: Innate and adaptive immune responses to human endogenous retrovirus and herpesvirus antigens and the lectin complement activation pathway. Journal of Neuroimmunology 183:1-2, 175-188
CrossRef52
Grith L. Sorensen, Inge Petersen, Steffen Thiel, Mogens Fenger, Kaare Christensen, Kirsten O. Kyvik, Thorkild I. A. Sørensen, Uffe Holmskov, Jens Christian Jensenius. (2007) Genetic influences on mannan-binding lectin (MBL) and mannan-binding lectin associated serine protease-2 (MASP-2) activity. Genetic Epidemiology 31:1, 31-41
CrossRef53
H.V. Olesen, J.C. Jensenius, R. Steffensen, S. Thiel, P.O. Schiøtz. (2006) The mannan-binding lectin pathway and lung disease in cystic fibrosis—dysfunction of mannan-binding lectin-associated serine protease 2 (MASP-2) may be a major modifier. Clinical Immunology 121:3, 324-331
CrossRef54
Miquel Granell, Alvaro Urbano-Ispizua, Belén Suarez, Montserrat Rovira, Francesc Fernández-Avilés, Carmen Martínez, Mar Ortega, Carla Uriburu, Anna Gaya, Josep M. Roncero, Alfons Navarro, Enric Carreras, Josep Mensa, Jordi Vives, Ciril Rozman, Emili Montserrat, Francisco Lozano. (2006) Mannan-binding lectin pathway deficiencies and invasive fungal infections following allogeneic stem cell transplantation. Experimental Hematology 34:10, 1435-1441
CrossRef55
R. M. Dommett, N Klein, M. W. Turner. (2006) Mannose-binding lectin in innate immunity: past, present and future. Tissue Antigens 68:3, 193-209
CrossRef56
Leen Moens, Erna Van Hoeyveld, Willy E. Peetermans, Christiane De Boeck, Jan Verhaegen, Xavier Bossuyt. (2006) Mannose-Binding Lectin Genotype and Invasive Pneumococcal Infection. Human Immunology 67:8, 605-611
CrossRef57
Ingolf Molle, Rudi Steffensen, Steffen Thiel, Niels A. Peterslund. (2006) Chemotherapy-related infections in patients with multiple myeloma: associations with mannan-binding lectin genotypes. European Journal of Haematology 77:1, 19-26
CrossRef58
A.G. Sjöholm, G. Jönsson, J.H. Braconier, G. Sturfelt, L. Truedsson. (2006) Complement deficiency and disease: An update. Molecular Immunology 43:1-2, 78-85
CrossRef59
S. Thiel, P.D. Frederiksen, J.C. Jensenius. (2006) Clinical manifestations of mannan-binding lectin deficiency. Molecular Immunology 43:1-2, 86-96
CrossRef60
P. D. Frederiksen, S. Thiel, C. B. Larsen, J. C. Jensenius. (2005) M-ficolin, an Innate Immune Defence Molecule, Binds Patterns of Acetyl Groups and Activates Complement. Scandinavian Journal of Immunology 62:5, 462-473
CrossRef61
Rikke Sørensen, Steffen Thiel, Jens C. Jensenius. (2005) Mannan-binding-lectin-associated serine proteases, characteristics and disease associations. Springer Seminars in Immunopathology 27:3, 299-319
CrossRef62
Gérard J Arlaud, Maurice G Colomb. 2005. Complement: Classical Pathway. .
CrossRef63
Jonathan North, K Whaley. 2005. Complement: Measurement. .
CrossRef64
F. Lozano, B. Suarez, A. Munoz, J.C. Jensenius, J. Mensa, J. Vives, J.-P. Horcajada. (2005) Novel MASP2 variants detected among North African and Sub-Saharan individuals. Tissue Antigens 66:2, 131-135
CrossRef65
C. Stover, S. Barrett, N.J. Lynch, J.N.W.N. Barker, D. Burden, R. Trembath, W. Schwaeble, C. Veal. (2005) Functional MASP2 single nucleotide polymorphism plays no role in psoriasis. British Journal of Dermatology 152:6, 1313-1315
CrossRef66
M. Carlsson, A. G. Sjoholm, L. Eriksson, S. Thiel, J. C. Jensenius, M. Segelmark, L. Truedsson. (2005) Deficiency of the mannan-binding lectin pathway of complement and poor outcome in cystic fibrosis: bacterial colonization may be decisive for a relationship. Clinical and Experimental Immunology 139:2, 306-313
CrossRef67
M.A. Seelen, A. Roos, J. Wieslander, T.E. Mollnes, A.G. Sjöholm, R. Wurzner, M. Loos, F. Tedesco, R.B. Sim, P. Garred, E. Alexopoulos, M.W. Turner, M.R. Daha. (2005) Functional analysis of the classical, alternative, and MBL pathways of the complement system: standardization and validation of a simple ELISA. Journal of Immunological Methods 296:1-2, 187-198
CrossRef68
G??ran J??nsson, Lennart Truedsson, Gunnar Sturfelt, Vivi-Anne Oxelius, Jean Henrik Braconier, Anders G. Sj??holm. (2005) Hereditary C2 Deficiency in Sweden. Medicine 84:1, 23-34
CrossRef69
(2004) Congress of Clinical Chemistry and Laboratory Medicine Annual meeting of the German United Society for Clinical Chemistry and Laboratory Medicine (DGKL), Düsseldorf, Germany, November 22-24, 2004. Clinical Chemistry and Laboratory Medicine 42:10, A101-A161
CrossRef70
S. Saevarsdottir, T. Vikingsdottir, H. Valdimarsson. (2004) The Potential Role of Mannan-Binding Lectin in the Clearance of Self-Components Including Immune Complexes. Scandinavian Journal of Immunology 60:1-2, 23-29
CrossRef71
M. CEDZYNSKI, J. SZEMRAJ, A. ST. SWIERZKO, L. BAK-ROMANISZYN, M. BANASIK, K. ZEMAN, D. C. KILPATRICK. (2004) Mannan-binding lectin insufficiency in children with recurrent infections of the respiratory system. Clinical and Experimental Immunology 136:2, 304-311
CrossRef72
Teizo Fujita, Misao Matsushita, Yuichi Endo. (2004) The lectin-complement pathway - its role in innate immunity and evolution. Immunological Reviews 198:1, 185-202
CrossRef73
Capucine Picard, Anne Puel, Jacinta Bustamante, Cheng-Lung Ku, Jean-Laurent Casanova. (2003) Primary immunodeficiencies associated with pneumococcal disease. Current Opinion in Allergy and Clinical Immunology 3:6, 451-459
CrossRef74
Mette Møller-Kristensen, Jens Chr. Jensenius, Lisbeth Jensen, Nicole Thielens, Véronique Rossi, Gerard Arlaud, Steffen Thiel. (2003) Levels of mannan-binding lectin-associated serine protease-2 in healthy individuals. Journal of Immunological Methods 282:1-2, 159-167
CrossRef
