Original Article
Dysfunctional Interaction of C/EBPα and the Glucocorticoid Receptor in Asthmatic Bronchial Smooth-Muscle Cells
N Engl J Med 2004; 351:560-574August 5, 2004
- Abstract
Background
Increased proliferation of bronchial smooth-muscle cells may lead to increased muscle mass in the airways of patients with asthma. The antiproliferative effect of glucocorticoids in bronchial smooth-muscle cells in subjects without asthma is mediated by a complex of the glucocorticoid receptor and the CCAAT/enhancer binding protein α (C/EBPα). We examined the signaling pathway controlling the inhibitory effect of glucocorticoids on cell proliferation and interleukin-6 synthesis in bronchial smooth-muscle cells of subjects with asthma and those without asthma.
Methods
Lines of bronchial smooth-muscle cells were established from cells from 20 subjects with asthma, 8 subjects with emphysema, and 26 control subjects. Cell proliferation was determined by means of cell counts and [3H]thymidine incorporation. Signal transduction was studied by means of an electrophoretic DNA mobility-shift assay, a supershift electrophoretic-mobility assay, immunoblotting, use of C/EBPα antisense oligonucleotides, and use of a human C/EBPα expression vector. Interleukin-6 release was determined by means of an enzyme-linked immunosorbent assay.
Results
Glucocorticoids activated the glucocorticoid receptor and inhibited serum-induced secretion of interleukin-6 in bronchial smooth-muscle cells from both subjects with asthma and those without asthma; however, glucocorticoids inhibited proliferation only in bronchial smooth-muscle cells from subjects without asthma. C/EBPα protein was detected by immunoblotting in all bronchial smooth-muscle cells from subjects without asthma but not in those with asthma, whereas the protein was expressed in lymphocytes from both groups of subjects. C/EBPα antisense oligonucleotides or the glucocorticoid-receptor inhibitor mifepristone reversed the antiproliferative effect of glucocorticoids in bronchial smooth-muscle cells from subjects without asthma. When bronchial smooth-muscle cells from subjects with asthma were transiently transfected with an expression vector for human C/EBPα, two forms of the protein were expressed, and subsequent administration of glucocorticoids inhibited cell proliferation.
Conclusions
We hypothesize that a cell-type–specific absence of C/EBPα is responsible for the enhanced proliferation of bronchial smooth-muscle cells derived from subjects with asthma and that it explains the failure of glucocorticoids to inhibit proliferation in vitro.
Media in This Article
Figure 1
Immunoblotting, Densitometric Analysis, and Electrophoretic Mobility-Shift Assays in Bronchial Smooth-Muscle Cells from Subjects with Asthma and Those without Asthma.Figure 2
Effect of Glucocorticoids on Serum-Induced Secretion of Interleukin-6.Article Activity
- Article
Asthma is characterized pathologically by an increased mass of bronchial smooth muscle,1,2 apparently as a result of the enhanced proliferation of bronchial smooth-muscle cells.3,4 Bronchial smooth-muscle cells are thus considered a major target for antiasthma treatments such as glucocorticoids.5
Glucocorticoids down-regulate the secretion of several inflammatory cytokines by various types of cells resident in the human lung,6-9 and this process is thought to be mediated by the ligand-activated glucocorticoid receptor.9-11 On activation, the glucocorticoid receptor migrates to the nucleus, where it binds to its specific DNA consensus sequence, the glucocorticoid-responsive element,9-11 or interacts with other transcription factors.10,12,13
CCAAT/enhancer-binding proteins (C/EBPs) are involved in cell proliferation. The activation of C/EBPα and C/EBPε, which are antiproliferative transcription factors, leads to cell differentiation.14-17 In contrast, C/EBPβ and C/EBPδ seem to drive cell-cycle progression.16-19 C/EBPγ forms complexes with C/EBPα and C/EBPβ, thereby modulating their function.17 C/EBPζ is a relatively recently identified isoform with various synonyms (e.g., Ig/EBP and Gadd153) and may play a specific role in the function of the endoplasmic reticulum.17,20
Glucocorticoids down-regulate the proliferation of airway smooth-muscle cells21 by decreasing the expression of cyclin D1 and the phosphorylation of retinoblastoma protein22 and by activating p21(Waf1/Cip1).23 In human-lung fibroblasts and pulmonary vascular and bronchial smooth-muscle cells from patients without asthma, glucocorticoid treatment rapidly induces the activation of glucocorticoid receptors and C/EBPα, and subsequently the expression of the p21(Waf1/Cip1) gene is faster than predicted on the basis of animal models.23-28 Furthermore, transcriptional activation of the p21(Waf1/Cip1) gene by glucocorticoids does not require the glucocorticoid-receptor–mediated synthesis of C/EBPα in lung fibroblasts, pulmonary vascular smooth-muscle cells, or bronchial smooth-muscle cells.25,26 Because of the importance of glucocorticoid treatment in asthma, we investigated whether the pathways outlined above are operative in bronchial smooth-muscle cells obtained from subjects with asthma. Furthermore, we assessed whether the modulation of cytokine release by glucocorticoids involves the same signaling cascade in bronchial smooth-muscle cells from subjects with asthma as in those from subjects without asthma.
Methods
Cell Culture
Primary cultures of bronchial smooth-muscle cells were established from airway-muscle bundles obtained from 26 control subjects (14 who were undergoing lung resection for a tumor, 4 who were undergoing transplantation for cystic fibrosis, and 8 who were healthy), 8 subjects with emphysema, and 20 subjects with asthma. Cells were grown as described previously in Dulbecco's minimal essential medium containing 10 percent fetal-calf serum, a 1 percent minimal essential medium–vitamin mix, and 20 mM HEPES.3 The characteristics of the subjects are summarized in Table 1Table 1
Characteristics of the 20 Subjects with Asthma, the 8 Subjects with Emphysema, and the 26 Controls.. All experiments were performed between passages 3 and 6. In addition, peripheral-blood lymphocytes were isolated from 10 ml of blood from four subjects with asthma and four controls according to standard procedures with the use of a Ficoll gradient.25 Approval for the experiments was provided by the human ethics committee of the University of Sydney and by the Central Sydney Area Health Service. All patients provided written informed consent.
Cell Counting and DNA Synthesis
Cells were seeded at a density of 104 cells per square centimeter in 24-well cell-culture plates in growth medium (Dulbecco's minimal essential medium containing 5 percent fetal-calf serum) for 24 hours to allow adherence. The medium was replaced by low-serum medium (Dulbecco's minimal essential medium containing 0.1 percent fetal-calf serum) for one day and then exchanged with growth medium, with or without a single or repeated doses of budesonide, dexamethasone, prednisolone, or hydrocortisone (10–12 to 10–8 M). Cell proliferation was assessed after three and five days of treatment with 5 percent fetal-calf serum; cells were washed twice with ice-cold phosphate-buffered saline and then treated with trypsin and EDTA (1 mM and 0.05 percent, respectively) for one minute. The trypsin solution was removed, and the cells were resuspended in 0.5 ml of phosphate-buffered saline. Cells contained in 0.01 ml of phosphate-buffered saline were counted in duplicate for each well with the use of a Neubauer improved hemocytometer.3,25
The incorporation of [3H]thymidine was measured according to standard protocols. Cells were prepared as they were for cell counts but were cultured for 24 hours only after stimulation and the addition of 5 μCi of [3H]thymidine per milliliter during the last 6 hours of culture. Thymidine incorporation was determined by liquid scintillation, with counting performed in triplicate.25,26,28
Treatment
Mifepristone (10–7 or 10–6 M) was used to inhibit glucocorticoid-receptor–dependent cell responses. Sulfonated antisense C/EBPα oligonucleotide (5'G-AAGGCCGCGGCGCTGCTGGGCGCGT3', MWG Biotech) was used to down-regulate C/EBPα protein,17,18,25 and a scrambled sulfonated oligonucleotide (5'AGCTCGGATGCATGGAGGAG3', MWG Biotech) was used as a negative control.
C/EBPα Expression Vector
The C/EBPα expression vector was constructed from the total RNA of human peripheral-blood lymphocytes with the use of RNeasy (Qiagen). One microgram of total RNA was reverse-transcribed by means of SuperScript II (Invitrogen), and the entire coding sequence of C/EBPα was amplified with Pfx polymerase enzyme (Invitrogen) by means of the polymerase chain reaction (PCR) under the following conditions: primary denaturation at 98°C for 2 minutes was followed by 55 cycles of denaturation at 98°C for 30 seconds, annealing at 61°C for 30 seconds, elongation at 68°C for 100 seconds, and elongation at 68°C for 7 minutes. The C/EBPα primers were 5'CACCATGGAGTCGGCCGACTTCT3' and 3'TCACGCGCAGTTGCCCATG5'. After electrophoresis on a 5 percent agarose gel, the C/EBPα DNA band was isolated with the use of NucleoSpin extract (Macherey-Nagel) and was cloned into a pvDNA3.1D/V5-His6–TOPO vector (Invitrogen) by mixing 4 μl of CEBPα DNA extract with 1 μl of salt solution (1.2 M sodium chloride and 0.06 M magnesium chloride) and 1 μl of the TOPO vector. The mixture was incubated for five minutes at room temperature, and 2 μl of C/EBPα vector was transfected into Escherichia coli. The success of transfection was confirmed on the basis of the response to ampicillin. Transfected cells were assessed for C/EBPα DNA, which was sequenced with the use of an automated sequencer (MWG Biotech).
Cells were transiently transfected with the C/EBPα expression vector or a green fluorescent protein vector for one hour in serum-free medium containing 1.0 ng of either vector per microliter in Tfx50 reagent (Promega) (ratio of Tfx50 to DNA, 3:1). Transfected cells were then incubated in growth medium for 24 hours in the presence or absence of drugs. The transfection rate was measured in transiently transfected bronchial smooth-muscle cells with the use of a green fluorescent protein vector — that is, a cytomegalovirus-epidermal growth factor promoter–driven vector (p-d2EGFP-N1, Clontech). Transfection was carried out with the use of 1 μg of DNA per milliliter and Tfx50 (ratio, 1:2 to 1:4) for one hour in serum-free medium. Five percent fetal-calf serum was then added to the medium for 24 hours before confocal microscopy of the living cells was performed (model LSM 510, Zeiss). The laser excitation wavelength was 488 nm; fluorescence was detected between 505 and 550 nm with the use of a pinhole aperture of 106 μm. Autofluorescence was not detected between 560 and 615 nm with the use of a wavelength of 543 nm.
Nuclear and Cytosolic Extracts and Electrophoretic Mobility-Shift Assay
Nuclear and cytosolic extracts were prepared from cultures that were 80 percent confluent, as described previously.25 Bronchial smooth-muscle cells were scraped off 175-cm2 flasks and centrifuged at 5000×g for 2 minutes at 4°C, and the pellet was resuspended in 80 μl of low-salt buffer (20 mM HEPES [pH 7.9], 10 mM potassium chloride, 0.1 mM sodium vanadate, 1 mM EDTA, 1 mM EGTA, 0.2 percent NP-40, 10 percent glycerol, and complete protease inhibitor [Roche Diagnostics]) and incubated for 10 minutes at 4°C. After centrifugation at 13,000×g for one minute at 4°C, the supernatant (the cytosolic fraction) was collected. The remaining pellet was dissolved in 50 μl of high-salt buffer (420 mM sodium chloride, 20 mM HEPES at pH 7.9, 10 mM potassium chloride, 0.1 mM sodium vanadate, 1 mM EDTA, 1 mM EGTA, 20 percent glycerol, and complete protease inhibitor), kept on ice for 30 minutes, and centrifuged at 13,000×g for 5 minutes at 4°C. The supernatant collected was considered the nuclear fraction.25,26,28 The protein level was determined with the use of the Bradford assay.
Immunoblotting
Proteins were fractionated according to size, as follows: 5 μg of total protein was applied to a polyacrylamide–sodium dodecyl sulfate gel with a gradient of 4 to 15 percent and transferred to polyvinyledine fluoride membranes (Millipore) according to standard protocols; transfer was confirmed by Ponceau's staining.17,25 Membranes were blocked by the addition of 5 percent skim milk in 10 mM TRIS, 150 mM sodium chloride, and 0.05 percent Tween 20 for 1 hour; incubated for 12 hours at 4°C with a primary monoclonal antibody specific for the glucocorticoid receptor (sc-100X), C/EBPα (sc-61X), or c-Fos/activator protein-1 (AP-1) (sc-253X) (all Santa Cruz Biotechnology); washed three times in blocking solution; and then incubated with a secondary antirabbit antibody conjugated with horseradish peroxidase (sc-2054, Santa Cruz Biotechnology) for 1 hour. Membranes were washed three times with blocking buffer and once with phosphate-buffered saline, and protein bands were visualized by means of chemiluminescence (ECL, Pierce).
DNA-binding proteins were characterized by means of an electrophoretic mobility-shift assay with the use of a 32P-labeled glucocorticoid-responsive element or CCAAT-binding oligonucleotide (sc-2545 and sc-2525, respectively; Santa Cruz Biotechnology) as described previously.25 We also used a 32P-labeled p21(Waf1/Cip1) promoter fragment containing the C/EBP-binding sites (a gift from Dr. B. Vogelstein, Johns Hopkins University, Baltimore),29 which has been used by others to characterize the glucocorticoid receptor–C/EBPα DNA consensus sequence of the p21(Waf1/Cip1) promoter,23,24,27 and which we have previously used to show the formation of the glucocorticoid receptor–C/EBPα complex.25 Supershift assays (defined by a mobility shift of the p21 promoter fragment) were performed by incubating nuclear extracts with one of the above antibodies (1 mg per milliliter) specific for the glucocorticoid receptor, C/EBPα, or the transcription factor AP-1 overnight at 4°C; DNA–protein complexes and supershifts were analyzed on a nondenaturing 4 percent polyacrylamide gel exposed to x-ray films. The specificity of the observed DNA–protein complexes was characterized by preincubating the extracts with 10 times the normal amount of competitive, unlabeled glucocorticoid-responsive element or CCAAT oligonucleotides.25,26,28
Coimmunoprecipitation of the Glucocorticoid Receptor or C/EBP-α
Coimmunoprecipitations were performed as described previously.25 Extracts of nuclear protein (20 μl) were incubated overnight at 4°C with antibody against C/EBPα (1 μg per milliliter) or against glucocorticoid receptor (1 μg per milliliter, Santa Cruz) and then incubated for one hour with protein A Sepharose (1 mg per milliliter) in phosphate-buffered saline at 37°C. After centrifugation at 5000×g for five minutes, the precipitate was washed twice with 2 ml of phosphate-buffered saline and then resuspended in Laemmli buffer and analyzed by means of immunoblotting.25
Interleukin-6 Enzyme-Linked Immunosorbent Assay
Cell-culture medium was collected 0, 6, 12, and 24 hours after stimulation of cells with 5 percent fetal-calf serum in the presence or absence of drugs or antisense oligonucleotides. The release of interleukin-6 was detected by means of an enzyme-linked immunosorbent assay (Quantikine, R&D Systems).
Statistical Analysis
Analysis of variance and an unpaired Student's t-test were used to assess the data for cell counts and [3H]thymidine incorporation. Results were considered significant if the two-sided P value was less than 0.05.
Results
The clinical characteristics of all 54 study subjects from whom we obtained cells for bronchial smooth-muscle cell cultures are shown in Table 1. There were 35 males and 19 females. Owing to the wide range of ages among subjects with asthma, the mean age of this group did not differ significantly from that of the other two groups (Table 1).
Figure 1AFigure 1
Immunoblotting, Densitometric Analysis, and Electrophoretic Mobility-Shift Assays in Bronchial Smooth-Muscle Cells from Subjects with Asthma and Those without Asthma. shows a representative time course of budesonide-induced (10–8 M) translocation of glucocorticoid receptor from the cytosol to the nucleus in bronchial smooth-muscle cell lines from subjects with asthma and those with emphysema. Budesonide activated the glucocorticoid receptor within 30 minutes, with levels peaking at 1 hour and declining thereafter. Similar time courses were observed for dexamethasone, prednisolone, and hydrocortisone at concentrations ranging from 10–9 to 10–6 M. As summarized in Figure 1B, the time course of the activation of the glucocorticoid receptor by budesonide was similar among bronchial smooth-muscle cell lines from 10 controls, 8 subjects with emphysema, and 12 subjects with asthma, and the time course of the accumulation of glucocorticoid receptors in the nucleus was similar for all four glucocorticoids, with no significant differences in efficacy (data not shown). A second, minor band appeared soon after glucocorticoid treatment (Figure 1A). This band may represent the β isoform of the glucocorticoid receptor but represents only a small proportion of the total.The activation of the glucocorticoid receptor by glucocorticoids and its binding to a glucocorticoid-responsive element oligonucleotide were confirmed by electrophoretic mobility-shift assays in bronchial smooth-muscle cells from subjects with asthma (Figure 1C) and those without asthma (Figure 1D). Similar results were obtained in all other lines of bronchial smooth-muscle cells (six asthma cell lines and six nonasthma cell lines).
To determine the antiinflammatory effect of glucocorticoids, we analyzed the cell-culture medium of the above experiments for the presence of interleukin-6. After adjustment for the cell numbers, the level of secretion of interleukin-6 induced by the addition of 5 percent fetal-calf serum after 24 and 48 hours was similar between bronchial smooth-muscle cells from 10 subjects with asthma and bronchial smooth-muscle cells from 10 subjects without asthma (Figure 2AFigure 2
Effect of Glucocorticoids on Serum-Induced Secretion of Interleukin-6.). All glucocorticoids significantly inhibited the serum-induced secretion of interleukin-6 (P<0.001).To characterize the effect of the inhibitory signaling pathway of glucocorticoids on the secretion of interleukin-6, we treated cells with either the glucocorticoid-receptor inhibitor mifepristone (10–7 M) or a C/EBPα antisense or sense oligonucleotide. The addition of 1.0 μM C/EBPα antisense oligonucleotide resulted within 24 hours in the down-regulation of serum-induced C/EBPα protein expression in total cell-protein extracts in bronchial smooth-muscle cells from subjects without asthma (Figure 2B).
When cells were pretreated for one hour with 10–7 M mifepristone, the inhibitory effect of the glucocorticoids on the secretion of interleukin-6 was substantially reduced (Figure 2C). However, preincubation for 24 hours with 1 μM C/EBPα antisense oligonucleotides did not significantly alter the inhibitory effect of the glucocorticoids on the serum-induced secretion of interleukin-6.
Previously, we reported that a single dose of 10–8 M budesonide led to a mean (±SE) maximal decrease of 21±4 percent in the serum-induced proliferation of bronchial smooth-muscle cells from subjects without asthma.26 In the present study, we observed a similar inhibition of fetal-calf serum–stimulated cell proliferation after three days of culture in the presence of any one of the four glucocorticoids studied after a single treatment on day 1 (Figure 3AFigure 3
The Antiproliferative Efficacy of Glucocorticoids in Bronchial Smooth-Muscle Cells from Subjects with Asthma and Those without Asthma.). In bronchial smooth-muscle cells from 10 subjects, 10–8 M budesonide reduced the serum-dependent proliferation of cells by 28±4 percent (P<0.01 by an unpaired Student's t-test), 10–8 M dexamethasone reduced proliferation by 21±4 percent (P<0.01), and 10–8 M prednisolone reduced proliferation by 24±3 percent (P<0.01), whereas 10–8 M hydrocortisone did not inhibit proliferation significantly (Figure 3A). A comparison of Figure 3A and Figure 3B shows that bronchial smooth-muscle cells from 15 subjects with asthma grew about 1.5 times as fast as bronchial smooth-muscle cells from subjects without asthma, a finding that is similar to our previous findings.3 Surprisingly, none of the glucocorticoids inhibited the proliferation of bronchial smooth-muscle cells from subjects with asthma (Figure 3B).To investigate whether the absence of antiproliferative action of glucocorticoids on bronchial smooth-muscle cells from subjects with asthma could be overcome by long-term treatment, we exchanged the culture medium and drugs daily over a period of three days. In bronchial smooth-muscle cells from 8 subjects without asthma, long-term treatment resulted in a stronger antiproliferative effect of the glucocorticoids than did a single treatment, but it had no significant effect on bronchial smooth-muscle cells from 10 subjects with asthma (Figure 3C). The absence of an antiproliferative effect of glucocorticoids was confirmed by assessing [3H]thymidine incorporation in the two groups of smooth-muscle cells (Figure 3D).
Given our previous results,25,26 we assessed the role of C/EBPα in glucocorticoid-inhibited proliferation of bronchial smooth-muscle cells. As shown in a set of representative immunoblots (Figure 4AFigure 4
Expression of C/EBPα in Bronchial Smooth-Muscle Cells from Subjects with Asthma and Those without Asthma.), bronchial smooth-muscle cells from 20 subjects with asthma did not express C/EBPα, whereas serum-starved bronchial smooth-muscle cells from 8 subjects with emphysema and 15 controls expressed the 46-kD C/EBPα protein. The expression of C/EBPα could be induced by 5 percent fetal-calf serum within 24 hours in all bronchial smooth-muscle cells from subjects without asthma (Figure 2B and Figure 4A). However, bronchial smooth-muscle cells from 4 of the 20 subjects with asthma expressed a smaller protein that reacted with the antibody against C/EBPα antibody (Figure 4A). However, to visualize these smaller protein bands, we had to double the duration of exposure of the immunoblots.To determine whether the absence of C/EBPα is a pathophysiological characteristic present in cell types other than bronchial smooth-muscle cells, we isolated peripheral-blood lymphocytes from four subjects with asthma and four without asthma. We detected C/EBPα protein in all the samples (Figure 4B).
To overcome the absence of C/EBPα in bronchial smooth-muscle cells from subjects with asthma, we transiently transfected three such cell lines with an expression vector for the human C/EBPα isolated from bronchial smooth-muscle cells from subjects without asthma. Immunoblotting revealed a time-dependent increase in the expression of C/EBPα within 24 and 48 hours after transfection (Figure 4C). The smooth-muscle cells expressed two proteins that reacted with the antibody against C/EBPα (Figure 4C). According to the molecular-weight markers, the upper band appeared at the expected size for C/EBPα, whereas the smaller band was similar to the second C/EBPα band that was observed in nontransfected bronchial smooth-muscle cells from subjects with asthma (Figure 4A and Figure 4C). The rate of transfection was controlled with the use of a cytomegalovirus epidermal growth factor promoter–driven vector; the level of expression of epidermal growth factor by bronchial smooth-muscle cells was 62 percent 24 hours after transfection (Figure 4D).
The absence of C/EBPα in bronchial smooth-muscle cells from subjects with asthma was confirmed with the use of a supershift electrophoretic mobility-shift assay with a p21(Waf1/Cip1) promoter fragment containing the glucocorticoid receptor–C/EBPα complex binding site23-25,27,29 as the target for C/EBPα proteins, in the presence and absence of antibodies specific for C/EBPα or the glucocorticoid receptor; antibodies against c-Fos/AP-1 protein served as a negative control. As shown in Figure 4E, incubation of the p21(Waf1/Cip1) promoter fragment with nuclear-protein extracts that were obtained from bronchial smooth-muscle cells from subjects without asthma in the presence of 10–8 M budesonide for three hours resulted in a defined signal that could be abrogated by incubation with 10 times the normal amount of cold CCAAT oligonucleotide overnight at 4°C. When the complex formed by the p21(Waf1/Cip1) promoter fragment and the nuclear-protein extracts of budesonide-treated bronchial smooth-muscle cells was further incubated with antibodies specific for C/EBPα, the level of the complex increased and its migration was further delayed (Figure 4E, lane 4). A similar supershift was observed when the p21(Waf1/Cip1) promoter fragment formed a complex with the nuclear-protein extract of budesonide-treated bronchial smooth-muscle cells from subjects without asthma and was incubated with antibodies specific for the glucocorticoid receptor (Figure 4E, lane 6), whereas no such supershift was detected when we used antibodies against c-Fos/AP-1 (lane 8). In contrast, the nuclear-protein fraction obtained from budesonide-treated bronchial smooth-muscle cells from subjects with asthma did not produce any clear signal when they were incubated with the p21(Waf1/Cip1) promoter fragment (Figure 4E, lanes 5, 7, and 9).
To further assess the role of C/EBPα in bronchial smooth-muscle cells from subjects with asthma, we transiently transfected subconfluent cultures with an expression vector for human C/EBPα or the empty vector as a control (Figure 5AFigure 5
The Glucocorticoid Receptor (GR)–C/EBPα Complex and Its Antiproliferative Function in Bronchial Smooth-Muscle Cells from Subjects with Asthma.). The level of the C/EBPα protein in nuclear extracts of bronchial smooth-muscle cells from subjects with asthma increased within 48 hours in the presence of budesonide (Figure 5A, lanes 1 and 2), preincubation with 10 times the normal level of unlabeled CCAAT oligonucleotide diminished the signal (Figure 5A, lane 3), and no signal was observed when the cells were transfected with the empty control vector for 48 hours (Figure 5A, lane 4). When the extract was subsequently incubated with antibodies specific for C/EBPα, migration of the DNA-protein band was retarded (Figure 5A, lane 5), whereas there was no signal when the cells were transfected with the empty control vector (Figure 5A, lane 6). We observed no supershifts when the same extracts were incubated in the presence of antibodies against c-Fos/AP-1 (Figure 5A, lane 7), whereas a supershift was observed in the presence of antibodies against glucocorticoid receptor (Figure 5A, lane 8). Bronchial smooth-muscle cells transfected with an empty vector did not show a supershift in the presence of antibodies against the glucocorticoid receptor (Figure 5A, lane 9).To investigate whether, in asthmatic bronchial smooth-muscle cells from subjects with asthma, transient transfection with the human C/EBPα expression vector reestablished the formation of the glucocorticoid receptor–C/EBPα complex previously noted in bronchial smooth-muscle cells from subjects without asthma,25,26 we performed coimmunoprecipitation experiments with the use of nuclear extracts of bronchial smooth-muscle cells that had been incubated with 10–8 M budesonide for three hours (Figure 5B). Western blot analysis of the coimmunoprecipitates showed a clear band for C/EBPα when we used an antibody against the glucocorticoid receptor for immunoprecipitation and for the glucocorticoid receptor when an antibody against C/EBP-α was used. In contrast, nontransfected bronchial smooth-muscle cells from subjects with asthma did not show any signal for either C/EBPα or the glucocorticoid receptor. However, when these bronchial smooth-muscle cells were transfected with a human C/EBPα expression vector 48 hours before stimulation with budesonide and nuclear extracts were prepared 3 hours after the addition of the drug and subsequent coimmunoprecipitation, we observed a band for C/EBPα when an antibody against the glucocorticoid receptor was used, as well as a band for the receptor when an antibody against C/EBPα was used (Figure 5B).
We obtained further evidence of the function of the transfected C/EBPα expression vector in bronchial smooth-muscle cells from subjects with asthma by counting cells. The numbers of cells in five such nontransfected cell lines doubled within three days in the presence of 5 percent fetal-calf serum, and daily treatment with budesonide (10–8 M) did not significantly alter cell growth (Figure 5C). Transient transfection with an expression vector for human C/EBPα significantly slowed the proliferation of smooth-muscle cells in the presence of fetal-calf serum (by 30±4.9 percent, P<0.01 by an unpaired Student's t-test), on the basis of the increase in the numbers of cells from day 1 to day 3 in the presence of 5 percent fetal-calf serum. Transfection with the empty vector did not inhibit proliferation. In contrast, transfected cells treated daily with 10–8 M budesonide had a further reduction of proliferation, as compared with transfected cells that were not treated with budesonide (Figure 5C). The additional effect of the glucocorticoid on the inhibitory effect of the C/EBPα expression vector was significant (P<0.01) in bronchial smooth-muscle cells from five subjects with asthma and was significantly different (P<0.01) from the effect achieved with the C/EBPα vector alone. The presence of the empty vector together with budesonide did not inhibit the proliferation of bronchial smooth-muscle cells from subjects with asthma.
Discussion
Our data indicate that the proliferation of airway smooth-muscle cells in patients with asthma may result from an absence of C/EBPα. The absence of C/EBPα also explains why the antiproliferative action of glucocorticoids on these cells was absent, while the glucocorticoid-induced suppression of interleukin-6 was not affected. Since peripheral-blood lymphocytes had normal levels of C/EBPα, we propose that the absence of C/EBP-α is cell-type–specific.
Hypertrophy and hyperplasia are characteristic of the bronchial smooth-muscle bundles in asthmatic airways, and this increased layer of bronchial smooth muscle may explain the hyperresponsiveness of asthmatic bronchi.1,2,4 It may also explain the local recruitment of immunocompetent cells into the smooth muscle, leading to chronic inflammation.1,2,4 Glucocorticoids are potent suppressors of this chronic inflammation and are the mainstay of therapy for moderate and severe asthma.5-11
Impaired expression of the glucocorticoid receptor or a mutation in it has been linked to asthma but has never been proved to play a causative role.30-32 The expression of the receptor has been assumed to be faulty in patients with asthma, but no significant differences between patients with asthma and those without asthma have been found in the tissue distribution of the glucocorticoid receptor in lung-biopsy specimens.32 Some data have suggested that the receptor has two isoforms, α and β, resulting from differential splicing of the same messenger RNA.33 Both isoforms bind to the same DNA consensus sequence. Because the consensus sequence has a higher affinity for the β isoform, it has been assumed that this isoform inhibits binding of the α isoform,33 but a link between overexpression of the β isoform and the diagnosis of asthma has not been established.34 In our study, glucocorticoids activated the glucocorticoid receptor in all lines of bronchial smooth-muscle cells, irrespective of the disease state, and we did not observe a stronger signal for the β isoform in bronchial smooth-muscle cells from subjects with asthma than in those without asthma. Furthermore, we did not detect a double band for the receptor in the cytosolic protein fractions, whereas a second protein band that reacted with the antibody against the glucocorticoid receptor became visible only in the nuclear protein fractions early after treatment with a glucocorticoid.
The activation of the glucocorticoid receptor by various glucocorticoids suppressed serum-stimulated secretion of interleukin-6 in all lines of bronchial smooth-muscle cells, and mifepristone reversed this effect. Our data indicate that the inhibition of interleukin-6 secretion by glucocorticoids does not involve C/EBPα in human bronchial smooth-muscle cells. Therefore, distinct signaling pathways mediate the antiproliferative and the interleukin-6–blocking effects of glucocorticoids. However, the latter effect may include the interaction of the receptor with other transcription factors, including nuclear factor-κB, AP-1, and signal transducers and activators of transcription (STATs).10,12,13,35-38
The observed failure of glucocorticoids to inhibit cell proliferation in bronchial smooth-muscle cells from subjects with asthma could not be explained by an absent or defective glucocorticoid receptor. Several studies have shown that the antiproliferative effect of glucocorticoids is mediated by the receptor and C/EBPα,14,23-25 and both active transcription factors are required to induce the synthesis of p21(Waf1/Cip1).24,25,27 Moreover, in human cells, including lung fibroblasts, pulmonary and bronchial smooth-muscle cells, and peripheral-blood lymphocytes, the glucocorticoid receptor forms a complex with C/EBPα, which then binds to the CCAAT DNA consensus sequence in the p21(Waf1/Cip1) promoter.25,27,28 We found that this complex was absent in budesonide-treated bronchial smooth-muscle cells from subjects with asthma, but that it could be reestablished by transfecting the cells with a human C/EBPα expression vector. Furthermore, transfected cells had a slower rate of proliferation than nontransfected cells, and their proliferation could be inhibited by glucocorticoids. These findings indicate that the absence of C/EBPα in bronchial smooth-muscle cells from patients with asthma may account for their increased rate of proliferation.3 In addition, direct protein–protein interaction with the glucocorticoid receptor and other transcription factors has been demonstrated only for members of the STAT family13,37,38 for C/EBPα23,25,27 and C/EBPβ.36 Therefore, the receptor may regulate cell proliferation and cell differentiation or apoptosis through its interaction with various members of the C/EBP family. We did not observe any interaction between the glucocorticoid receptor and AP-1, which indicates that this transcription factor is not involved in the p21(Waf1/Cip1) regulating complex consisting of the receptor and C/EBPα.
Moreover, the antiproliferative action of glucocorticoids was preserved in bronchial smooth-muscle cells from eight subjects with emphysema, and C/EBPα was also normally expressed in these cells. These observations suggest a difference in the pathogenesis of asthma and emphysema, even though the latter is sometimes regarded as a subtype of asthma.39,40
In conclusion, we have demonstrated that the antiproliferative and the cytokine-inhibitory effects of glucocorticoids are mediated by different signaling pathways. Both pathways involve the activation of the glucocorticoid receptor, but the pathways subsequently diverge. The antiproliferative pathway does not function in patients with asthma because bronchial smooth-muscle cells in these patients lack C/EBPα protein required to form a complex with the glucocorticoid receptor. The pathological implications of this absence of C/EBPα require evaluation.
Supported by the Medical Foundation of the University of Sydney, Australia; Freiwillige Akademische Gesellschaft, University of Basel, Switzerland; the National Health and Medical Research Council of Australia; GlaxoSmithKline, Loughborough, United Kingdom; and AstraZeneca, Lund, Sweden.
Drs. Johnson, Borger, Black, and Tamm contributed equally to this article.
Source Information
From the Department of Pharmacology and the Woolcock Institute of Medical Research, University of Sydney, Sydney, Australia (M.R., P.R.A.J., P.B., G.G.K., Q.G., K.H., J.K.B., J.L.B.); and the Departments of Research and Internal Medicine, Pulmonary Cell Research, University Hospitals Basel, Basel, Switzerland (M.R., M.P.B., J.J.R., M.T.).
- References
References
1
Jeffery PK . Remodeling in asthma and chronic obstructive lung disease. Am J Respir Crit Care Med 2001;164:S28-S38
Web of Science | Medline2
Jeffery PK . Comparative morphology of the airways in asthma and chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1994;150:S6-S13
Web of Science | Medline3
Johnson PRA ,Roth M ,Tamm M , et al. Airway smooth muscle cell proliferation is increased in asthma. Am J Respir Crit Care Med 2001;164:474-477
Web of Science | Medline4
Demoly P ,Simony-Lafontaine J ,Chanez P , et al. Cell proliferation in the bronchial mucosa of asthmatics and chronic bronchitis. Am J Respir Crit Care Med 1994;150:214-217
Web of Science | Medline5
Hirst SJ ,Lee TH . Airway smooth muscle as a target of glucocorticoid action in the treatment of asthma. Am J Respir Crit Care Med 1998;158:S201-S206
Web of Science | Medline6
Zitnik RJ ,Whiting NL ,Elias JA . Glucocorticoid inhibition of interleukin-1-induced interleukin-6 production by human lung fibroblasts: evidence for transcriptional and post-transcriptional regulatory mechanisms. Am J Respir Cell Mol Biol 1994;10:643-650
Web of Science | Medline7
Korn SH ,Jerre A ,Brattsand R . Effects of formoterol and budesonide on GM-CSF and IL-8 secretion by triggered human bronchial epithelial cells. Eur Respir J 2001;17:1070-1077
CrossRef | Web of Science | Medline8
Pang L ,Knox AJ . Synergistic inhibition by β2-agonists and corticosteroids on tumour necrosis factor-α-induced interleukin-8 release from cultured human airway smooth-muscle cells. Am J Respir Cell Mol Biol 2000;23:79-85
Web of Science | Medline9
Van der Velden VH . Glucocorticoids: mechanisms of action and anti-inflammatory potential in asthma. Mediators Inflammation 1998;7:229-237
CrossRef | Web of Science | Medline10
Adcock IM ,Caramori G . Cross-talk between pro-inflammatory transcription factors and glucocorticoids. Immunol Cell Biol 2001;79:376-384
CrossRef | Web of Science | Medline11
Tsai MJ ,O'Malley BW . Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 1994;63:451-486
CrossRef | Web of Science | Medline12
Gougat C ,Jaffuel D ,Gagliardo R , et al. Overexpression of the human glucocorticoid receptor alpha and beta isoforms inhibits AP-1 and NF-kappaB activities hormone independently. J Mol Med 2002;80:309-318
CrossRef | Web of Science | Medline13
Biola A ,Andreau K ,David M , et al. The glucocorticoid receptor and STAT6 physically and functionally interact in T-lymphocytes. FEBS Lett 2000;487:229-233
CrossRef | Web of Science | Medline14
Timichenko NA ,Wilde M ,Nakanishi M ,Smith JR ,Darlington GJ . CCAAT/enhancer-binding protein alpha (C/EBP alpha) inhibits cell proliferation through the p21 (WAF-1/CIP-1/SDI-1) protein. Genes Dev 1996;10:804-815
CrossRef | Web of Science | Medline15
Timichenko NA ,Harris TE ,Wilde M , et al. CCAAT/enhancer binding protein alpha regulates p21 protein and hepatocyte proliferation in newborn mice. Mol Cell Biol 1997;17:7353-7361
Web of Science | Medline16
Ramji DP ,Foka P . CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J 2002;365:561-575
Web of Science | Medline17
Parkin SE ,Baer M ,Copeland TD ,Schwartz RC ,Johnson PF . Regulation of CCAAT/enhancer binding protein (C/EBP) activator proteins by heterodimerization with C/EBP-γ (Ig/EBP). J Biol Chem 2002;277:23563-23572
CrossRef | Web of Science | Medline18
Eaton EM ,Hanlon M ,Bundy L ,Sealy L . Characterization of C/EBPβ isoforms in normal versus neoplastic mammary epithelial cells. J Cell Physiol 2001;189:91-105[Erratum, J Cell Physiol 2002;190:131.]
CrossRef | Web of Science | Medline19
O'Rourke JP ,Hutt JA ,DeWille J . Transcriptional regulation of C/EBPδ in G(0) growth-arrested mouse mammary epithelial cells. Biochem Biophys Res Commun 1999;262:696-701
CrossRef | Web of Science | Medline20
Paschen W ,Gissel C ,Linden T ,Althausen S ,Doutheil J . Activation of gadd153 expression through transient cerebral ischemia: evidence that ischemia causes endoplasmic reticulum dysfunction. Brain Res Mol Brain Res 1998;60:115-122
CrossRef | Medline21
Stewart AG ,Fernandes D ,Tomlinson PR . The effect of glucocorticoids on proliferation of human cultured airway smooth muscle. Br J Pharmacol 1995;166:3219-322622
Fernandes D ,Guida E ,Koutsoubos V , et al. Glucocorticoids inhibit proliferation, cyclin D1 expression, and retinoblastoma protein phosphorylation, but not activity of the extracellular-regulated kinases in human cultured airway smooth muscle. Am J Respir Cell Mol Biol 1999;21:77-88
Web of Science | Medline23
Cha HH ,Cram EJ ,Wang EC ,Huang AJ ,Kasler HG ,Firestone GL . Glucocorticoids stimulate p21 gene expression by targeting multiple transcriptional elements within a steroid responsive region of the p21(waf1/cip1) promoter in rat hepatoma cells. J Biol Chem 1998;273:1998-2007
CrossRef | Web of Science | Medline24
Cram EJ ,Ramos RA ,Wang EC ,Cha HH ,Nishio Y ,Firestone GL . Role of the CCAAT/enhancer binding protein-α transcription factor in the glucocorticoid stimulation of p21(waf1/cip1) gene promoter activity in growth-arrested rat hepatoma cells. J Biol Chem 1998;273:2008-2014
CrossRef | Web of Science | Medline25
Rudiger JJ ,Roth M ,Bihl MP , et al. Interaction of C/EBP-α and the glucocorticoid receptor in vivo and in nontransformed human cells. FASEB J 2002;16:177-184
CrossRef | Web of Science | Medline26
Roth M ,Johnson PRA ,Rudiger JJ , et al. Interaction between glucocorticoids and β2 agonists on bronchial airway smooth muscle cells through synchronised cellular signalling. Lancet 2002;360:1293-1299
CrossRef | Web of Science | Medline27
Ramos RA ,Meilandt WJ ,Wang EC ,Firestone GL . Dysfunctional glucocorticoid receptor with a single point mutation ablates the CCAAT/enhancer binding protein-dependent growth suppression response in a steroid-resistant hepatoma cell variant. FASEB J 1999;13:169-180
Web of Science | Medline28
Eickelberg O ,Roth M ,Lorx R , et al. Ligand-independent activation of the glucocorticoid receptor by β2-adrenergic receptor agonists in primary human lung fibroblasts and vascular smooth muscle cells. J Biol Chem 1999;274:1005-1010
CrossRef | Web of Science | Medline29
el-Deiry WS ,Tokino T ,Wladman T , et al. Topological control of p21WAF1/CIP1 expression in normal and neoplastic tissues. Cancer Res 1995;55:2910-2919
Web of Science | Medline30
Lane SJ ,Arm JP ,Staynov DZ ,Lee TH . Chemical mutation analysis of the human glucocorticoid receptor cDNA in glucocorticoid-resistant bronchial asthma. Am J Respir Cell Mol Biol 1994;11:42-48
Web of Science | Medline31
Corrigan CJ ,Brown PH ,Barnes NC , et al. Glucocorticoid resistance in chronic asthma: glucocorticoid pharmacokinetics, glucocorticoid receptor characteristics, and inhibition of peripheral blood T cell proliferation by glucocorticoids in vitro. Am Rev Respir Dis 1991;144:1016-1025
CrossRef | Web of Science | Medline32
Adcock IM ,Gilbey T ,Gelder CM ,Chung KF ,Barnes PJ . Glucocorticoid receptor localization in normal and asthmatic lung. Am J Respir Crit Care Med 1996;154:771-782
Web of Science | Medline33
Sousa AR ,Lane SJ ,Cidlowski JA ,Staynov DZ ,Lee TH . Glucocorticoid resistance in asthma is associated with elevated in vivo expression of the glucocorticoid receptor beta-isoform. J Allergy Clin Immunol 2000;105:943-950
CrossRef | Web of Science | Medline34
Gagliardo R ,Chanez P ,Vignola AM , et al. Glucocorticoid receptor alpha and beta in glucocorticoid dependent asthma. Am J Respir Crit Care Med 2000;162:7-13
Web of Science | Medline35
Wilson SJ ,Wallin A ,Della-Cioppa G ,Sandstrom T ,Holgate ST . Effects of budesonide and formoterol on NF-kappaB, adhesion molecules, and cytokines. Am J Respir Crit Care Med 2001;164:1047-1052
Web of Science | Medline36
Gotoh T ,Chowdhury S ,Takiguchi M ,Mori M . The glucocorticoid-responsive gene cascade: activation of the rat arginase gene through induction of C/EBPbeta. J Biol Chem 1997;272:3694-3698
CrossRef | Web of Science | Medline37
Zhang Z ,Jones S ,Hagood JS ,Fuentes GM ,Fuller GM . STAT3 acts as a co-activator of glucocorticoid receptor signalling. J Biol Chem 1997;272:30607-30610
CrossRef | Web of Science | Medline38
Stocklin E ,Wissler M ,Gouilleux F ,Groner B . Functional interaction between Stat5 and the glucocorticoid receptor. Nature 1996;383:726-728
CrossRef | Web of Science | Medline39
Sutherland ER ,Martin RJ . Airway inflammation in chronic obstructive pulmonary disease: comparisons with asthma. J Allergy Clin Immunol 2003;112:819-827
CrossRef | Web of Science | Medline40
Bellia V ,Battaglia S ,Catalano F , et al. Aging and disability affect misdiagnosis of COPD in elderly asthmatics: the SARA study. Chest 2003;123:1066-1072
CrossRef | Web of Science | Medline
- Citing Articles (57)
Citing Articles
1
Qi Ge, Maree H. Poniris, Lyn M. Moir, Judith L. Black, Janette K. Burgess. (2012) Combined Beta-Agonists and Corticosteroids Do Not Inhibit Extracellular Matrix Protein Production In Vitro. Journal of Allergy 2012, 1-7
CrossRef2
Sheharyar R. Durrani, Ravi K. Viswanathan, William W. Busse. (2011) What effect does asthma treatment have on airway remodeling? Current perspectives. Journal of Allergy and Clinical Immunology 128:3, 439-448
CrossRef3
H. Alkhouri, F. Hollins, L. M. Moir, C. E. Brightling, C. L. Armour, J.M. Hughes. (2011) Human lung mast cells modulate the functions of airway smooth muscle cells in asthma. Allergy 66:9, 1231-1241
CrossRef4
Pierre-Olivier Girodet, Annaig Ozier, Imane Bara, Jose-Manuel Tunon de Lara, Roger Marthan, Patrick Berger. (2011) Airway remodeling in asthma: New mechanisms and potential for pharmacological intervention. Pharmacology & Therapeutics 130:3, 325-337
CrossRef5
Lynne G. Maxwell, Salvatore R. Goodwin, Thomas J. Mancuso, Victor C. Baum, Aaron L. Zuckerberg, Philip G. Morgan, Etsuro K. Motoyama, Peter J. Davis, Kevin J. Sullivan. 2011. Systemic Disorders. , 1098-1182.
CrossRef6
P.-O. Girodet, A. Ozier, T. Trian, H. Begueret, O. Ousova, J.-M. Vernejoux, P. Chanez, R. Marthan, P. Berger, J. M. Tunon de Lara. (2010) Mast cell adhesion to bronchial smooth muscle in asthma specifically depends on CD51 and CD44 variant 6. Allergy 65:8, 1004-1012
CrossRef7
Ya
Juan Chen, Tao Wang, Dai
CrossRef8
Robert Newton, Richard Leigh, Mark A. Giembycz. (2010) Pharmacological strategies for improving the efficacy and therapeutic ratio of glucocorticoids in inflammatory lung diseases. Pharmacology & Therapeutics 125:2, 286-327
CrossRef9
Margaret M. Kelly, Terence M. O'Connor, Richard Leigh, Joceline Otis, Carol Gwozd, Gail M. Gauvreau, Jack Gauldie, Paul M. O'Byrne. (2010) Effects of budesonide and formoterol on allergen-induced airway responses, inflammation, and airway remodeling in asthma. Journal of Allergy and Clinical Immunology 125:2, 349-356.e13
CrossRef10
Justine Y. LAU, Brian G. OLIVER, Lyn M. MOIR, Judith L. BLACK, Janette K. BURGESS. (2010) Differential expression of peroxisome proliferator activated receptor γ and cyclin D1 does not affect proliferation of asthma- and non-asthma-derived airway smooth muscle cells. Respirology 15:2, 303-312
CrossRef11
G Damera, HW Fogle, P Lim, EA Goncharova, H Zhao, A Banerjee, O Tliba, VP Krymskaya, RA Panettieri. (2009) Vitamin D inhibits growth of human airway smooth muscle cells through growth factor-induced phosphorylation of retinoblastoma protein and checkpoint kinase 1. British Journal of Pharmacology 158:6, 1429-1441
CrossRef12
Janette K. Burgess, Claudia Ceresa, Simon R. Johnson, Varsha Kanabar, Lyn M. Moir, Trang T.B. Nguyen, Brian G.G. Oliver, Michael Schuliga, Jane Ward. (2009) Tissue and matrix influences on airway smooth muscle function. Pulmonary Pharmacology & Therapeutics 22:5, 379-387
CrossRef13
Alaina J. Ammit, Janette K. Burgess, Stuart J. Hirst, J. Margaret Hughes, Manminder Kaur, Justine Y. Lau, Suzanne Zuyderduyn. (2009) The effect of asthma therapeutics on signalling and transcriptional regulation of airway smooth muscle function. Pulmonary Pharmacology & Therapeutics 22:5, 446-454
CrossRef14
Peter Bradding, Heike Wulff. (2009) The K + channels K Ca 3.1 and K v 1.3 as novel targets for asthma therapy. British Journal of Pharmacology 157:8, 1330-1339
CrossRef15
Michael Roth, Judith L Black. (2009) An imbalance in C/EBPs and increased mitochondrial activity in asthmatic airway smooth muscle cells: novel targets in asthma therapy?. British Journal of Pharmacology 157:3, 334-341
CrossRef16
Janette K. Burgess. (2009) The role of the extracellular matrix and specific growth factors in the regulation of inflammation and remodelling in asthma. Pharmacology & Therapeutics 122:1, 19-29
CrossRef17
Peter Borger, Nicola Miglino, Melissa Baraket, Judith L. Black, Michael Tamm, Michael Roth. (2009) Impaired translation of CCAAT/enhancer binding protein α mRNA in bronchial smooth muscle cells of asthmatic patients. Journal of Allergy and Clinical Immunology 123:3, 639-645
CrossRef18
Sandra Verstraelen, Inge Nelissen, Jef Hooyberghs, Hilda Witters, Greet Schoeters, Paul Van Cauwenberge, Rosette Van Den Heuvel. (2009) Gene profiles of a human bronchial epithelial cell line after in vitro exposure to respiratory (non-)sensitizing chemicals: Identification of discriminating genetic markers and pathway analysis. Toxicology 255:3, 151-159
CrossRef19
Hirohisa Saito. (2009) Role of mast cells in airway remodeling of asthma. Folia Pharmacologica Japonica 134:2, 64-67
CrossRef20
Peter J. Barnes, Jeffrey M. Drazen. 2009. Pathophysiology of Asthma. , 399-423.
CrossRef21
Yassine Amrani, Omar Tliba, Vera P. Krymskaya, Michael W. Sims, Reynold A. Panettieri Jr.. 2009. Airway Smooth Muscle. , 225-239.
CrossRef22
Ian M. Adcock, Gaetano Caramori. 2009. Transcription Factors. , 373-380.
CrossRef23
Janette K. Burgess, Jin Hee Lee, Qi Ge, Emma E. Ramsay, Maree H. Poniris, Johannes Parmentier, Michael Roth, Peter R.A. Johnson, Nicholas H. Hunt, Judith L. Black, Alaina J. Ammit. (2008) Dual ERK and phosphatidylinositol 3‐kinase pathways control airway smooth muscle proliferation: Differences in asthma. Journal of Cellular Physiology 216:3, 673-679
CrossRef24
Girolamo Pelaia, Teresa Renda, Luca Gallelli, Alessandro Vatrella, Maria Teresa Busceti, Sergio Agati, Mario Caputi, Mario Cazzola, Rosario Maselli, Serafino A. Marsico. (2008) Molecular mechanisms underlying airway smooth muscle contraction and proliferation: Implications for asthma. Respiratory Medicine 102:8, 1173-1181
CrossRef25
Ynuk Bossé, Peter D. Paré, Chun Y. Seow. (2008) Airway wall remodeling in asthma: From the epithelial layer to the adventitia. Current Allergy and Asthma Reports 8:4, 357-366
CrossRef26
Reinoud Gosens, Sara S. Roscioni, Bart G.J. Dekkers, Tonio Pera, Martina Schmidt, Dedmer Schaafsma, Johan Zaagsma, Herman Meurs. (2008) Pharmacology of airway smooth muscle proliferation. European Journal of Pharmacology 585:2-3, 385-397
CrossRef27
Omar Tliba, Reynold A. Panettieri. (2008) Regulation of inflammation by airway smooth muscle. Current Allergy and Asthma Reports 8:3, 262-268
CrossRef28
M A Giembycz, M Kaur, R Leigh, R Newton. (2008) A Holy Grail of asthma management: toward understanding how long-acting β2-adrenoceptor agonists enhance the clinical efficacy of inhaled corticosteroids. British Journal of Pharmacology 153:6, 1090-1104
CrossRef29
Marc B. Hershenson, Melanie Brown, Blanca Camoretti-Mercado, Julian Solway. (2008) Airway Smooth Muscle in Asthma. Annual Review of Pathology: Mechanisms of Disease 3:1, 523-555
CrossRef30
T. Trian, G. Benard, H. Begueret, R. Rossignol, P.-O. Girodet, D. Ghosh, O. Ousova, J.-M. Vernejoux, R. Marthan, J.-M. Tunon-de-Lara, P. Berger. (2007) Bronchial smooth muscle remodeling involves calcium-dependent enhanced mitochondrial biogenesis in asthma. Journal of Experimental Medicine 204:13, 3173-3181
CrossRef31
Harsha H. Kariyawasam, Douglas S. Robinson. (2007) The role of eosinophils in airway tissue remodelling in asthma. Current Opinion in Immunology 19:6, 681-686
CrossRef32
Thais Mauad, Elisabeth H. Bel, Peter J. Sterk. (2007) Asthma therapy and airway remodeling. Journal of Allergy and Clinical Immunology 120:5, 997-1009
CrossRef33
Salman Siddiqui, Amanda Sutcliffe, Aarti Shikotra, Lucy Woodman, Camille Doe, Sue McKenna, Andrew Wardlaw, Peter Bradding, Ian Pavord, Christopher Brightling. (2007) Vascular remodeling is a feature of asthma and nonasthmatic eosinophilic bronchitis. Journal of Allergy and Clinical Immunology 120:4, 813-819
CrossRef34
Kian Fan Chung. (2007) Should treatments for asthma be aimed at the airway smooth muscle?. Expert Review of Respiratory Medicine 1:2, 209-217
CrossRef35
Pascal Chanez, Sally E. Wenzel, Gary P. Anderson, Josep M. Anto, Elisabeth H. Bel, Louis-Philippe Boulet, Christopher E. Brightling, William W. Busse, Mario Castro, Babro Dahlen, Sven Erik Dahlen, Leo M. Fabbri, Stephen T. Holgate, Marc Humbert, Mina Gaga, Guy F. Joos, Bruce Levy, Klaus F. Rabe, Peter J. Sterk, Susan J. Wilson, Isabelle Vachier. (2007) Severe asthma in adults: What are the important questions?. Journal of Allergy and Clinical Immunology 119:6, 1337-1348
CrossRef36
Etsuko Tagaya, Jun Tamaoki. (2007) Mechanisms of Airway Remodeling in Asthma. Allergology International 56:4, 331-340
CrossRef37
Richard M Effros, Hari Nagaraj. (2007) Asthma: new developments concerning immune mechanisms, diagnosis and treatment. Current Opinion in Pulmonary Medicine 13:1, 37-43
CrossRef38
Peter Borger, Hisako Matsumoto, Sarah Boustany, Mikael M.C. Gencay, Janette K. Burgess, Greg G. King, Judith L. Black, Michael Tamm, Michael Roth. (2007) Disease-specific expression and regulation of CCAAT/enhancer-binding proteins in asthma and chronic obstructive pulmonary disease. Journal of Allergy and Clinical Immunology 119:1, 98-105
CrossRef39
Yuki Sumi, Qutayba Hamid. (2007) Airway Remodeling in Asthma. Allergology International 56:4, 341-348
CrossRef40
Miwa Shinohara, Hiroshi Wakiguchi, Hirohisa Saito, Kenji Matsumoto. (2007) Symptoms of Allergic Rhinitis in Women during Early Pregnancy Are Associated with Higher Prevalence of Allergic Rhinitis in Their Offspring. Allergology International 56:4, 411-417
CrossRef41
Stephen T Holgate, Riccardo Polosa. (2006) The mechanisms, diagnosis, and management of severe asthma in adults. The Lancet 368:9537, 780-793
CrossRef42
Carl D Malchoff, Diana M Malchoff. (2006) Clinical syndromes of glucocorticoid resistance and hypersensitivity. Current Opinion in Endocrinology and Diabetes 13:3, 242-247
CrossRef43
Yassine Amrani. (2006) Airway smooth muscle modulation and airway hyper-responsiveness in asthma: new cellular and molecular paradigms. Expert Review of Clinical Immunology 2:3, 353-364
CrossRef44
Don D. Sin, S.F. Paul Man. (2006) Corticosteroids and adrenoceptor agonists: The compliments for combination therapy in chronic airways diseases. European Journal of Pharmacology 533:1-3, 28-35
CrossRef45
Aili L. Lazaar, Reynold A. Panettieri. (2006) Airway Smooth Muscle as a Regulator of Immune Responses and Bronchomotor Tone. Clinics in Chest Medicine 27:1, 53-69
CrossRef46
Sally Wenzel. (2006) Physiologic and Pathologic Abnormalities in Severe Asthma. Clinics in Chest Medicine 27:1, 29-40
CrossRef47
John V. Bonacci, Alastair G. Stewart. (2006) Regulation of human airway mesenchymal cell proliferation by glucocorticoids and β2-adrenoceptor agonists. Pulmonary Pharmacology & Therapeutics 19:1, 32-38
CrossRef48
Brian G Oliver, Judith L Black. (2006) Airway Smooth Muscle and Asthma. Allergology International 55:3, 215-223
CrossRef49
Michael S. Rolph, Mary Sisavanh, Sue M. Liu, Charles R. Mackay. (2006) Clues to asthma pathogenesis from microarray expression studies. Pharmacology & Therapeutics 109:1-2, 284-294
CrossRef50
Kwan Hyoung Kim. (2006) Airway Remodeling. Tuberculosis and Respiratory Diseases 60:6, 608
CrossRef51
Mitsuru Munakata. (2006) Airway Remodeling and Airway Smooth Muscle in Asthma. Allergology International 55:3, 235-243
CrossRef52
Celine Bergeron, Hans Peter Hauber, Mark Gotfried, Kenneth Newman, Rahul Dhanda, Ronald J. Servi, Mara S. Ludwig, Qutayba Hamid. (2005) Evidence of remodeling in peripheral airways of patients with mild to moderate asthma: Effect of hydrofluoroalkane-flunisolide. Journal of Allergy and Clinical Immunology 116:5, 983-989
CrossRef53
P. Berger, P.-O. Girodet, J. Manuel Tunon-de-Lara. (2005) Mast cell myositis: a new feature of allergic asthma?. Allergy 60:10, 1238-1240
CrossRef54
Alan James. (2005) Airway remodeling in asthma. Current Opinion in Pulmonary Medicine 11:1, 1-6
CrossRef55
Henry Milgrom. (2004) Anti-IgE therapy in allergic disease. Current Opinion in Pediatrics 16:6, 642-647
CrossRef56
(2004) C/EBPα in Asthma. New England Journal of Medicine 351:21, 2236-2237
Full Text57
Shore, Stephanie A., . (2004) Airway Smooth Muscle in Asthma — Not Just More of the Same. New England Journal of Medicine 351:6, 531-532
Full Text
- Letters
