Original Article
Signaling Molecules in Nonfamilial Pulmonary Hypertension
N Engl J Med 2003; 348:500-509February 6, 2003
- Abstract
Background
Biochemical, genetic, and clinical evidence indicates that smooth-muscle proliferation around small pulmonary vessels is an essential part of the pathogenesis of pulmonary hypertension. Mutations in the bone morphogenetic protein receptor type 2 (BMPR2) have been linked to familial cases of pulmonary hypertension, but the molecular basis of the common nonfamilial forms is unknown.
Methods
We evaluated the pattern of expression of angiopoietin-1, a protein involved in the recruitment of smooth-muscle cells around blood vessels; TIE2, the endothelial-specific receptor for angiopoietin-1; and bone morphogenetic protein receptor type 1A (BMPR1A) and BMPR2 in lung-biopsy specimens from patients with pulmonary hypertension and from normotensive control patients. The effect of angiopoietin-1 on the modulation of BMPR expression was also evaluated in subcultures of human pulmonary arteriolar endothelial cells.
Results
The expression of angiopoietin-1 messenger RNA and the protein itself and the phosphorylation of TIE2 were strongly up-regulated in the lungs of patients with various forms of pulmonary hypertension, correlating directly with the severity of disease. A mechanistic link between familial and acquired pulmonary hypertension was demonstrated by the finding that angiopoietin-1 shuts off the expression of BMPR1A, a transmembrane protein required for BMPR2 signaling, in pulmonary arteriolar endothelial cells. Similarly, we found that the expression of BMPR1A was severely reduced in the lungs of patients with various forms of acquired as well as primary nonfamilial pulmonary hypertension.
Conclusions
These findings suggest that all forms of pulmonary hypertension are linked by defects in the signaling pathway involving angiopoietin-1, TIE2, BMPR1A, and BMPR2 and consequently identify specific molecular targets for therapeutic intervention.
Media in This Article
Figure 1
Angiopoietin-1 Expression in the Lung as a Molecular Marker for the Severity of Disease in Different Forms of Pulmonary Hypertension, as Assessed by Reverse Transcriptase–Polymerase Chain Reaction (RT-PCR) and Western Blotting (Panel A), Northern and Western Blotting (Panel B), and Linear-Regression Analysis (Panel C).Figure 2
Correlation between Phosphorylation of the Endothelial-Specific TIE2 Receptor in the Lung and Disease Severity as Indicated by Western Blotting (Panel A), Immunoprecipitation with Immunoblotting (Panel B), and Linear Regression Analysis (Panel C).Article Activity
- Article
The pulmonary vascular bed is a high-flow, low-pressure circuit that has the capacity to dilate and recruit unused vasculature in order to accommodate increases in blood flow. In pulmonary hypertension, this capacity is lost, resulting in elevated pulmonary arterial pressure at rest and further increases in pressure with exercise.1 At the cellular level, this pathologic process is characterized by the proliferation of vascular smooth-muscle cells and asymmetric neointimal hyperplasia in small pulmonary arteries and arterioles.2 The molecular mechanism underlying the vasculopathy responsible for pulmonary hypertension is unknown.
Recently, heterozygous mutations have been characterized in the gene for bone morphogenetic protein receptor type 2 (BMPR2) in families with inherited pulmonary hypertension.3,4 Mutations were found to occur at highly conserved sites, predicted to perturb heterodimerization with its sister receptor, bone morphogenetic protein receptor type 1A (BMPR1A), or to disrupt the ligand-binding function of this protein.5 In addition, missense, deletion, and nonsense mutations in the activin-receptor–like kinase 1 gene (ALK1) have been identified in patients with hereditary hemorrhagic telangiectasia in whom pulmonary hypertension develops.6 However, most cases of pulmonary hypertension are sporadic or are due to a variety of causes, including hypoxia, thromboembolism, left-sided heart failure, and drugs.7 One puzzling aspect of this disease is whether any common molecular pathway underlies the seemingly different causes of the same pulmonary vascular pathologic process.
Angiopoietin-1 is a 70-kD angiogenic factor essential for lung vascular development. Produced by smooth-muscle cells and precursor pericytes, angiopoietin-1 stabilizes the development of blood vessels by recruiting muscle cells, through migration and division, to endothelial tubes, creating mature arterial structures.8,9 Animals lacking angiopoietin-1 die in utero, with little arterial development in the lungs and other organs.10 The receptor for angiopoietin-1, TIE2, is present only on vascular endothelium.11 The ligand–receptor interaction between angiopoietin-1 secreted by smooth-muscle cells and endothelium-specific TIE2 during organ development induces the proliferation of muscle cells around the endothelial vascular network. After development is completed, angiopoietin-1 is expressed at a minimally detectable level in the human lung.12
Since angiopoietin-1 has been linked to the proliferation of smooth-muscle cells during blood-vessel development, we postulated the following: first, that the excessive muscularization of pulmonary arterioles seen in most forms of pulmonary hypertension could be the result of aberrant overexpression of angiopoietin-1 in the adult lung and, second, that constitutive expression of angiopoietin-1 could be linked mechanistically to signaling by bone morphogenetic protein receptors (BMPRs) and the development of pulmonary hypertension through modulation of the expression or function of this receptor. To test our hypotheses, we studied the expression and localization of angiopoietin-1, TIE2, and BMPR1A gene products in the lung in various forms of acquired and nonfamilial primary pulmonary hypertension and investigated the ability of angiopoietin-1 to modulate the levels of BMPR in human pulmonary endothelial cells. Our goal was to establish a molecular fingerprint that unites different forms of this disease.
Methods
Collection of Specimens
Between July 2000 and January 2002, lung biopsy was performed in 22 consecutive patients undergoing pulmonary thromboendarterectomy for thromboembolic pulmonary hypertension, 8 patients undergoing lung transplantation (5 with primary pulmonary hypertension and 3 with pulmonary hypertension from scleroderma), 3 patients undergoing heart–lung transplantation as a result of Eisenmenger's syndrome, 9 patients undergoing mitral-valve replacement because of mitral regurgitation and pulmonary hypertension, and 19 patients without pulmonary hypertension who were undergoing pulmonary resection for benign causes (i.e., noncancerous pulmonary nodules). Written informed consent was obtained from each patient. Patients who were undergoing thromboendarterectomy, transplantation, or mitral-valve surgery (the group with pulmonary hypertension) had a mean pulmonary vascular resistance of 929 dyn
sec
For patients with thromboembolic pulmonary hypertension, tissue was obtained from the lobe determined to be most affected by occlusive disease on preoperative angiography. Patients with mitral-valve abnormalities underwent lingular biopsy, patients who received a heart–lung transplant underwent biopsy of the upper and lower lobes of both lungs, and patients who received a single lung transplant and control patients underwent a biopsy of the upper and lower lobe on the affected side. Specimens were obtained before cardiopulmonary bypass was instituted or before lung resection was performed, during ventilation at a fraction of inspired oxygen of 100 percent.
Sequence of BMPR2 and ALK1 in Patients with Primary Pulmonary Hypertension
The complementary DNA (cDNA) of BMPR2 and ALK1 was amplified from human-lung RNA by reverse transcriptase–polymerase chain reaction (RT-PCR), subcloned, and sequenced with use of an ABI-PRISM 3100 genetic analyzer (Applied Biosystems). Sequence data were compared with those in the National Center for Biotechnology Information Entrez Nucleotide data base (accession numbers, NM_001204 for BMPR2 and Z22533 for ALK1).
Purification of Angiopoietin-1 and Treatment of Endothelial Cells
An epitope tag, a C-terminal polyhistidine, was added to murine angiopoietin-1 cDNA, the cDNA was subcloned into a plasmid, and recombinant angiopoietin-1 protein was produced in BL21 bacteria. The protein was purified with use of an affinity column (Ni-NTA, Stratagene). The size and the purity of recombinant angiopoietin-1 were verified by staining with Coomassie blue and immunoblotting, and the biologic activity of the protein was confirmed by the induction of TIE2-receptor phosphorylation in vitro.13
Primary pulmonary endothelial cells were isolated from arterioles that were 500 to 1500 μm in diameter from the lung tissue of normotensive subjects and grown to 60 percent confluence. Subcultures of these cells were incubated for two hours in serum-free medium and treated with recombinant angiopoietin-1 protein (50 ng per milliliter). Aliquots of cells were serially removed for the quantitation of TIE2 phosphorylation and the expression of BMPR1A.
Immunoprecipitation and Western Blotting
Western blotting was performed as previously described12 with goat polyclonal anti-TIE2, mouse monoclonal anti-BMPR2 (R&D Systems), and goat polyclonal anti–angiopoietin-1, anti–angiopoietin-2, anti-BMPR1A, and anti-actin (Santa Cruz Biotechnology). TIE2 phosphorylation was assessed by first incubating protein extracts with anti-TIE2 antibody prebound to protein G–coated agarose beads (Roche). The immunoprecipitated proteins were then separated by sodium dodecyl sulfate–polyacrylamide-gel electrophoresis and transferred to nitrocellulose. Quantitative TIE2 phosphorylation immunoblotting was performed with anti-phosphotyrosine antibody (Cell Signaling Technology). The blots were washed and probed again with goat anti-TIE2 to verify equal levels of TIE2.
RT-PCR and Northern Blotting
RT-PCR was performed as previously described,14 with the use of the following primers: angiopoietin-1, 5'GGCAACTGTCGTGAGAGTACGA3' and 5'CATTTAGATTGGAGGGGCCACA3'; BMPR1A, 5'GGTAAAGGCCGATATGGAGAAG3' and 5'TAGGCCGAAGCTGTAGATGTCA3'; BMPR2, 5'ATGAGCCTTTACTGAGACGAGAG3' and 5'CGCCACCGCTTAAGAGAATAG3'; and glyceraldehyde-3-phosphate dehydrogenase, 5'CCTGCTTCACCACCTTCTTG3' and 5'CATCATCTCTGCCCCCTCTG3'. For Northern blotting, 20 μg of RNA was separated on 1.2 percent formaldehyde–agarose gels and then transferred to Nytran Supercharge membranes (Schleicher and Schuell). Membranes were hybridized with the use of probes labeled with phosphorus-32. Bands were visualized by autoradiography.
Histologic and Immunohistochemical Analyses
Six lung sections from each patient were stained with hematoxylin and eosin and examined by means of digital photomicroscopy at various magnifications to determine the severity of pulmonary hypertension. A pulmonary pathologist who was unaware of the patients' diagnoses reviewed the photomicrograph slides and determined, for vessels measuring 100 to 1000 μm in diameter, the percentage of vessels with medial hyperplasia or hypertrophy, the number of myocytes per vessel wall, the percentage of occluded vessels, and the percentage of vessels with plexiform lesions.
Immunohistochemical analyses were performed as previously described,14 with the same antibodies that were used in the immunoblotting experiments and with biotinylated anti-goat IgG as a secondary antibody (Vector). Each specimen had two negative controls: one section without primary antibody and one section with nonspecific goat IgG.
Statistical Analysis
The preoperative characteristics of patients with pulmonary hypertension and control patients were compared with use of Student's independent-group t-test for normally distributed variables and the Wilcoxon rank-sum test for measures that were not normally distributed. The normality of distribution was evaluated with use of the Shapiro–Wilks test. Sex was compared with use of Pearson's chi-square test. A P value of less than 0.05 was considered to indicate statistical significance, and all tests were two-sided. The relation between pulmonary vascular resistance and the level of TIE2 phosphorylation and angiopoietin-1 protein was characterized with the use of linear regression.
Results
Angiopoietin-1 Expression in Different Forms of Pulmonary Hypertension
The expression of angiopoietin-1 in lung tissue was measured by RT-PCR and immunoblot analysis (Figure 1AFigure 1
Angiopoietin-1 Expression in the Lung as a Molecular Marker for the Severity of Disease in Different Forms of Pulmonary Hypertension, as Assessed by Reverse Transcriptase–Polymerase Chain Reaction (RT-PCR) and Western Blotting (Panel A), Northern and Western Blotting (Panel B), and Linear-Regression Analysis (Panel C).). Before molecular analysis was performed, lung sections from each patient were examined under a light microscope to quantitate the pulmonary hypertensive changes according to the Heath–Edwards classification15 (Table 1Table 1
Semiquantitative Morphometric Analysis of Pulmonary Vascular Lesions.). Specimens from patients with pulmonary hypertension demonstrated Heath–Edwards stage 2, 3, 4, or 5 disease, with diffuse medial arteriolar hypertrophy or hyperplasia and stenosis of at least one third of all arterioles examined. There was a direct correlation between preoperative pulmonary arterial systolic pressure and pulmonary vascular resistance and the pathological grading of affected specimens.Patients in the pulmonary hypertension group had higher steady-state levels of angiopoietin-1 mRNA and protein in their biopsy specimens (Figure 1A) than did control patients. Angiopoietin-1 transcripts were not detected and angiopoietin-1 protein was barely detectable in biopsy specimens from control patients.
Correlation of Angiopoietin-1 Expression and TIE2 Phosphorylation with Disease Severity
Patients with pulmonary hypertension had greater amounts of steady-state angiopoietin-1 mRNA and protein in the lung than did control patients (Figure 1B). The level of angiopoietin-1 correlated directly with the severity of pulmonary hypertension as measured by the preoperative pulmonary vascular resistance and pulmonary arterial systolic pressure (Figure 1C). We found this correlation between gene expression and phenotype (elevated pulmonary vascular resistance) in all samples from the patients, irrespective of the cause of the disease. Angiopoietin-1 was not detected by immunoblotting in the serum or wall of the main pulmonary artery of patients with pulmonary hypertension, suggesting that this protein and its effect are confined to the lung.
We also examined the expression of angiopoietin-2, a competitive inhibitor of angiopoietin-1 in vasculogenesis,16 in lung tissue from patients with pulmonary hypertension and in lung tissue from those without it. In contrast to angiopoietin-1, the steady-state levels of angiopoietin-2 mRNA or protein did not differ significantly between lung tissue from normotensive patients and lung tissue from patients with pulmonary hypertension (data not shown).
Since angiopoietin-1 has been shown in other angiogenesis systems to bind and induce tyrosine phosphorylation of TIE2,17 we examined whether activation of TIE2 in the lung was a marker for the severity of pulmonary hypertension. Steady-state levels of TIE2 protein were similar in lung-biopsy specimens from patients with pulmonary hypertension and control patients (Figure 2AFigure 2
Correlation between Phosphorylation of the Endothelial-Specific TIE2 Receptor in the Lung and Disease Severity as Indicated by Western Blotting (Panel A), Immunoprecipitation with Immunoblotting (Panel B), and Linear Regression Analysis (Panel C).). However, using quantitative phosphotyrosine immunoblotting, we found that the degree of TIE2 phosphorylation was directly proportional to the clinical severity of pulmonary hypertension (as measured by pulmonary arterial systolic pressure and pulmonary vascular resistance) in the group with pulmonary hypertension (Figure 2B and Figure 2C). In normotensive patients, minimal levels of phosphorylated TIE2 protein were detected.BMPR2 and ALK1 Genes in Patients with Primary Pulmonary Hypertension
We sequenced the BMPR2 and ALK1 genes in the five patients with primary pulmonary hypertension in this study to confirm the absence of familial disease. None of the patients had deletion, missense, or nonsense mutations in the BMPR2 or ALK1 genes. None had a polymorphism in the BMPR2 gene at position 354 in exon 3, as has previously been reported in such patients.18 These results illustrate that not all cases of primary pulmonary hypertension are defined by mutations in these two genes.
Down-Regulation of BMPR1A in the Lungs in Various Forms of Pulmonary Hypertension
Using RT-PCR and immunoblot analysis, we found that BMPR1A and BMPR2 mRNA and protein were expressed in lung samples from normotensive patients. In contrast, despite the high sensitivity of our assays, almost no BMPR1A mRNA or protein was detected in lung tissue from patients with primary pulmonary hypertension and patients with four different acquired forms of the disease (Figure 3Figure 3
Diminution of Expression of Bone Morphogenetic Protein Receptor Type 1A (BMPR1A) in Different Forms of Acquired and Nonfamilial Primary Pulmonary Hypertension as Assessed by Reverse Transcriptase–Polymerase Chain Reaction (Panel A) and Western Blotting (Panel B).). These results suggest that, although familial forms of pulmonary hypertension are defined by mutations in the BMPR2 gene, nonfamilial forms of pulmonary hypertension are characterized by severely diminished or absent steady-state levels of the BMPR2 coreceptor, BMPR1A, in the lung.Down-Regulation of BMPR1A in Pulmonary Arteriolar Endothelial Cells Incubated with Angiopoietin-1
Our findings suggested a link between constitutive angiopoietin-1 levels in the lung, the transcriptional down-regulation of BMPR1A (either by decreased transcription or enhanced degradation) in pulmonary endothelium, and the genesis of pulmonary hypertension. On the basis of these results, we hypothesized that angiopoietin-1 signaling in pulmonary arteriolar endothelial cells down-regulates BMPR1A transcription. To test this hypothesis, we examined whether angiopoietin-1 could directly modulate the expression of BMPR1A. Purified recombinant angiopoietin-1 protein was added to human primary pulmonary endothelial cells in culture. On Northern blotting, subcultured human primary pulmonary endothelial cells exposed to recombinant angiopoietin-1 had undetectable steady-state levels of BMPR1A mRNA, whereas untreated endothelial cells strongly expressed BMPR1A (Figure 4BFigure 4
Increased Phosphorylation of TIE2-Receptors and Down-Regulation of Bone Morphogenetic Protein Receptor Type 1A (BMPR1A) Protein in Pulmonary Endothelial Cells Treated with Angiopoietin-1 (Ang-1), as Assessed by Immunoprecipitation and Immunoblotting (Panel A), Northern Blotting (Panel B), and Serial Time-Point Analysis (Panel C).). We found that in subcultured human primary pulmonary endothelial cells that were exposed to recombinant angiopoietin-1, levels of TIE2 tyrosine phosphorylation increased (Figure 4A) and were followed by a rapid diminution in the steady-state levels of BMPR1A mRNA (Figure 4C). These results suggest that, in vascular endothelial cells, angiopoietin-1–ligand binding results in both TIE2 phosphorylation and subsequent down-regulation of the BMPR1A gene product. The diminished BMPR1A mRNA levels persisted for 36 hours in human primary pulmonary endothelial cells after exposure to recombinant angiopoietin-1.Cellular Localization of Signaling Molecules in Lung Tissue
Staining of sectioned specimens from patients with pulmonary hypertension with anti–angiopoietin-1 antibody revealed that angiopoietin-1 was confined to the cytoplasm of smooth-muscle cells in the media of pulmonary arterioles and small arteries measuring less than 800 μm in diameter (Figure 5AFigure 5
Immunohistochemical Analysis of Representative Lung Samples from Patients with Pulmonary Hypertension (Panels A, C, E, and G) and Normotensive Control Patients (Panels B, D, F, and H) (×200).). Angiopoietin-1 was not detected in the lungs of control patients with normal pulmonary vascular resistance (Figure 5B). Angiopoietin-2 immunoreactivity was detected in the cytoplasm of vascular smooth-muscle cells in large and small vessels in the lung and was present in samples from patients with clinical pulmonary hypertension and from those without it (Figure 5C and Figure 5D).TIE2 protein was limited to the cytoplasm and the surface of endothelial cells lining pulmonary vessels of all sizes from patients with pulmonary hypertension and normotensive patients (Figure 5E and Figure 5F), a finding consistent with previous reports that TIE2 is restricted to the endothelial-cell lineage.19,20
BMPR1A immunoreactivity was detected in endothelium lining pulmonary arterioles measuring less than 800 μm in diameter in biopsy specimens from normotensive patients (Figure 5H). In contrast, we were unable to find staining for BMPR1A using an anti-BMPR1A antibody in any lung sample from patients with pulmonary hypertension (Figure 5G).
Discussion
Most cases of pulmonary hypertension result from diverse causes, including chronic hypoxia, congenital heart defects, autoimmune disease, thromboembolism, left-sided heart failure, ingestion of anorexigens, or idiopathic causes. Whether a common molecular mechanism underlies all these different causes of pulmonary hypertension is unknown. The goal of our research was to determine the genetic steps responsible for this disease and to understand the molecular “cross-talk” between endothelial and smooth-muscle cells in the arteriolar wall that ultimately defines pulmonary vascular structure. We found that pulmonary hypertensive vasculopathy is characterized by high steady-state levels of angiopoietin-1 in smooth-muscle cells lining small pulmonary vessels, tyrosine phosphorylation of the TIE2 receptor in pulmonary vascular endothelium, and nearly complete down-regulation of steady-state levels of BMPR1A mRNA and protein in pulmonary vascular endothelium. We further demonstrated that the level of angiopoietin-1 protein and the degree of phosphorylation of its receptor TIE2 are sensitive molecular markers of the severity of pulmonary hypertension in patients with nonfamilial forms of the disease. These results establish a link between the expression of angiopoietin-1, the phosphorylation of TIE2, and the magnitude of pulmonary vascular resistance. Finally, we found that angiopoietin-1 down-regulates steady-state levels of BMPR1A mRNA and protein in subcultured human pulmonary arteriolar endothelial cells. These results unite nonfamilial primary pulmonary hypertension and multiple forms of secondary pulmonary hypertension by demonstrating that they have a similar pattern of aberrant gene expression and suggest that pulmonary hypertension may occur through a molecular cascade whereby angiopoietin-1 ultimately down-regulates steady-state levels of BMPR1A.
Our results link two seemingly unrelated observations in pulmonary hypertension research. First, experiments in our laboratory have shown that targeted overexpression of angiopoietin-1 in the lungs of rodents induces clinical and pathological pulmonary hypertension, specifically the hyperplasia of vascular smooth-muscle cells that is characteristic of the disease. This experiment confirmed that the expression of angiopoietin-1 in the adult lung is causal of pulmonary hypertension rather than secondary to it and parallels results in other laboratories that suggest that angiopoietin-1 induces muscularization of nascent arteries in utero.21 Second, familial pulmonary hypertension, a disease pathologically identical to many forms of secondary pulmonary hypertension, is characterized by haploid mutations in the BMPR2 gene, resulting in dose-dependent modulation of BMPR2 oligomerization with BMPR1A.22 Bone morphogenetic protein ligands exert their effects through the activation and heterodimerization of BMPR1 and BMPR2 on the cell surface, leading to Smad intracellular signaling.23 The effect of the activation of BMPR1A and BMPR2 depends on the type of cell and can result in either promotion or inhibition of transcription.24,25 Although BMPR2 mutations have been seen in patients with sporadic primary pulmonary hypertension,26 they have not been identified in most forms of the disease. Since we found that BMPR1A mRNA levels are controlled by angiopoietin-1 in pulmonary endothelium and that steady-state levels of BMPR1A are markedly diminished in the lung tissue of patients with pulmonary hypertension, we suspect that nonfamilial forms of pulmonary hypertension occur through an angiopoietin-1–BMPR1A pathway. Thus, dose-dependent inactivation of the BMPR complex either by a mutation (in BMPR2 in familial disease) or by regulation of steady-state levels of transcripts (BMPR1A, as we have shown here) is a hallmark of this disease.
In summary, we identified a partial molecular pathway for the generation of nonfamilial forms of pulmonary hypertension, representing a specific pattern of gene expression common to many forms of this disease. Further studies of the way in which angiopoietin-1–induced changes in the stoichiometry between BMPR1A and BMPR2 in vascular endothelium result in signals that stimulate the proliferation of vascular smooth-muscle cells should shed light on the fundamental mechanism of the patterns of endothelial and smooth-muscle cell growth in an organ in which these vessels are critical for gas exchange and survival.
Supported by the Charles B. Wang Foundation and by grants (1R01 HL70852-01, to Dr. Thistlethwaite, and M01 RR00827, to Dr. Deutsch) from the National Institutes of Health.
We are indebted to Feliz Garcia Bannach, Ph.D., Gordon Yung, M.D., and Huntington Potter, Ph.D., for helpful discussions regarding the manuscript.
Source Information
From the Divisions of Cardiothoracic Surgery (L.D., C.C.S., D.C., A.J.C., M.K., S.W.J., P.A.T.), Pulmonary and Critical Care Medicine (J.X.-J.Y.), and Biostatistics (R.D.), University of California, San Diego, San Diego; and the Department of Pathology, Veterans Affairs Medical Center, La Jolla, Calif., and the University of California, San Diego, San Diego (P.L.W.).
Address reprint requests to Dr. Thistlethwaite at the Division of Cardiothoracic Surgery, University of California, San Diego, 200 West Arbor Dr., San Diego, CA 92103-8892, or at pthistlethwaite@ucsd.edu.
- References
References
1
Rubin LJ . Pathology and pathophysiology of primary pulmonary hypertension. Am J Cardiol 1995;75:51A-54A
CrossRef | Web of Science | Medline2
Pietra GG ,Edwards WD ,Kay JM , et al. Histopathology of primary pulmonary hypertension: a qualitative and quantitative study of pulmonary blood vessels from 58 patients in the National Heart, Lung, and Blood Institute, Primary Pulmonary Hypertension Registry. Circulation 1989;80:1198-1206
CrossRef | Web of Science | Medline3
Deng Z ,Morse JH ,Slager SL , et al. Familial primary pulmonary hypertension (gene PPH1) is caused by mutations in the bone morphogenetic protein receptor-II gene. Am J Hum Genet 2000;67:737-744
CrossRef | Web of Science | Medline4
Lane KB ,Machado RD ,Pauciulo MW , et al. Heterozygous germline mutations in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat Genet 2000;26:81-84
CrossRef | Web of Science | Medline5
Machado RD ,Pauciulo MW ,Thomson JR , et al. BMPR2 haploinsufficiency as the inherited molecular mechanism for primary pulmonary hypertension. Am J Hum Genet 2001;68:92-102
CrossRef | Web of Science | Medline6
Trembath RC ,Thomson JR ,Machado RD , et al. Clinical and molecular genetic features of pulmonary hypertension in patients with hereditary hemorrhagic telangiectasia. N Engl J Med 2001;345:325-334
Full Text | Web of Science | Medline7
Jamieson SW ,Kapelanski DP . Pulmonary endarterectomy. Curr Probl Surg 2000;37:165-252
CrossRef | Medline8
Papapetropoulos A ,Garcia-Cardena G ,Dengler TJ ,Maisonpierre PC ,Yancopoulos GD ,Sessa WC . Direct actions of angiopoietin-1 on human endothelium: evidence for network stabilization, cell survival, and interaction with other angiogenic growth factors. Lab Invest 1999;79:213-223
Web of Science | Medline9
Folkman J ,D'Amore PA . Blood vessel formation: what is its molecular basis? Cell 1996;87:1153-1155
CrossRef | Web of Science | Medline10
Suri C ,Jones PF ,Patan S , et al. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 1996;87:1171-1180
CrossRef | Web of Science | Medline11
Davis S ,Aldrich TH ,Jones PF , et al. Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap expression cloning. Cell 1996;87:1161-1169
CrossRef | Web of Science | Medline12
Thistlethwaite PA ,Lee SH ,Du LL , et al. Human angiopoietin gene expression is a marker for severity of pulmonary hypertension in patients undergoing pulmonary thromboendarterectomy. J Thorac Cardiovasc Surg 2001;122:65-73
CrossRef | Web of Science | Medline13
Koblizek TI ,Weiss C ,Yancopoulos GD ,Deutsch U ,Risau W . Angiopoietin-1 in-duces sprouting angiogenesis in vitro. Curr Biol 1998;8:529-532
CrossRef | Web of Science | Medline14
Lee SH ,Wolf PL ,Escudero R ,Deutsch R ,Jamieson SW ,Thistlethwaite PA . Early expression of angiogenesis factors in acute myocardial ischemia and infarction. N Engl J Med 2000;342:626-633
Full Text | Web of Science | Medline15
Heath D ,Edwards JE . The pathology of hypertensive pulmonary vascular disease: a description of six grades of structural changes in the pulmonary arteries with special reference to congenital cardiac septal defects. Circulation 1958;18:533-547
Web of Science | Medline16
Maisonpierre PC ,Suri C ,Jones PF , et al. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 1997;277:55-60
CrossRef | Web of Science | Medline17
Jones N ,Master Z ,Jones J , et al. Identification of Tek/Tie2 binding partners: binding to a multifunctional docking site mediates cell survival and migration. J Biol Chem 1999;274:30896-30905
CrossRef | Web of Science | Medline18
Newman JH ,Wheeler L ,Lane KB , et al. Mutation in the gene for bone morphogenetic protein receptor II as a cause of primary pulmonary hypertension in a large kindred. N Engl J Med 2001;345:319-324[Erratum, N Engl J Med 2001;345:1506, 2002;346:1258.]
Full Text | Web of Science | Medline19
Dumont DJ ,Fong GH ,Puri MC ,Gradwohl G ,Alitalo K ,Breitman ML . Vascularization of the mouse embryo: a study of flk-1, tek, tie, and vascular endothelial growth factor expression during development. Dev Dyn 1995;203:80-92
CrossRef | Web of Science | Medline20
Abdulmalek K ,Ashur F ,Ezer N ,Ye F ,Magder S ,Hussain SN . Differential expression of Tie-2 receptors and angiopoietins in response to in vivo hypoxia in rats. Am J Physiol Lung Cell Mol Physiol 2001;281:L582-L590
Web of Science | Medline21
Sato TN ,Tozawa Y ,Deutsch U , et al. Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature 1995;376:70-74
CrossRef | Web of Science | Medline22
Gilboa L ,Nohe A ,Geissendorfer T ,Sebald W ,Henis YI ,Knaus P . Bone morphogenetic protein receptor complexes on the surface of live cells: a new oligomerization mode for serine/threonine kinase receptors. Mol Biol Cell 2000;11:1023-1035
Web of Science | Medline23
Yoshida Y ,Tanaka S ,Umemori H , et al. Negative regulation of BMP/Smad signaling by Tob in osteoblasts. Cell 2000;103:1085-1097
CrossRef | Web of Science | Medline24
Heldin CH ,Miyazono K ,ten Dijke P . TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature 1997;390:465-471
CrossRef | Web of Science | Medline25
Kumura N ,Matuso R ,Shibuya H ,Nakashima K ,Taga T . BMP2-induced apoptosis is mediated by activation of the TAK1-p38 kinase pathway that is negatively regulated by Smad6. J Biol Chem 2000;275:17647-17652
CrossRef | Web of Science | Medline26
Thomson JR ,Machado RD ,Pauciulo MW , et al. Sporadic primary pulmonary hypertension is associated with germline mutations of the gene encoding BMPR-II, a receptor member of the TGF-beta family. J Med Genet 2000;37:741-745
CrossRef | Web of Science | Medline
- Citing Articles (94)
Citing Articles
1
Rebecca R. Vanderpool, Nesrine El-Bizri, Marlene Rabinovitch, Naomi C. Chesler. (2012) Patchy deletion of Bmpr1a potentiates proximal pulmonary artery remodeling in mice exposed to chronic hypoxia. Biomechanics and Modeling in Mechanobiology
CrossRef2
Mee-Jung Kim, Senyon Choe. (2011) BMPs and their clinical potentials. BMB Reports 44:10, 619-634
CrossRef3
Tero-Pekka Alastalo, Molong Li, Vinicio de Jesus Perez, David Pham, Hirofumi Sawada, Jordon K. Wang, Minna Koskenvuo, Lingli Wang, Bruce A. Freeman, Howard Y. Chang, Marlene Rabinovitch. (2011) Disruption of PPARγ/β-catenin–mediated regulation of apelin impairs BMP-induced mouse and human pulmonary arterial EC survival. Journal of Clinical Investigation 121:9, 3735-3746
CrossRef4
Hekim Karapınar, Ozlem Esen, Yunus Emiroğlu, Mustafa Akçakoyun, Selçuk Pala, Ramazan Kargın, Akın İzgi, Cevat Kirma, Ali Metin Esen. (2011) Serum levels of angiopoietin-1 in patients with pulmonary hypertension due to mitral stenosis. Heart and Vessels 26:5, 536-541
CrossRef5
Francois Haddad, Kristina Kudelko, Olaf Mercier, Bojan Vrtovec, Roham T. Zamanian, Vinicio de Jesus Perez. (2011) Pulmonary Hypertension Associated With Left Heart Disease: Characteristics, Emerging Concepts, and Treatment Strategies. Progress in Cardiovascular Diseases 54:2, 154-167
CrossRef6
J. Ryan, K. Bloch, S. L. Archer. (2011) Rodent models of pulmonary hypertension: harmonisation with the world health organisation’s categorisation of human PH. International Journal of Clinical Practice 65, 15-34
CrossRef7
Paul McLoughlin, Michael P. Keane. 2011. Physiological and Pathological Angiogenesis in the Adult Pulmonary Circulation. .
CrossRef8
Robert F. Wideman, Krishna R. Hamal. (2011) Idiopathic pulmonary arterial hypertension: An avian model for plexogenic arteriopathy and serotonergic vasoconstriction. Journal of Pharmacological and Toxicological Methods 63:3, 283-295
CrossRef9
Carlyne D Cool, Norbert F Voelkel, Todd Bull. (2011) Viral infection and pulmonary hypertension: is there an association?. Expert Review of Respiratory Medicine 5:2, 207-216
CrossRef10
C. Mélot, R. Naeije. 2011. Pulmonary Vascular Diseases. .
CrossRef11
Laia Llinàs, Victor I. Peinado, J. Ramon Goñi, Roberto Rabinovich, Sandra Pizarro, Robert Rodriguez-Roisin, Joan Albert Barberà, Ricardo Bastos. (2011) Similar gene expression profiles in smokers and patients with moderate COPD. Pulmonary Pharmacology & Therapeutics 24:1, 32-41
CrossRef12
Terry Young, F. Javier Nieto, Shahrokh Javaheri. 2011. Systemic and Pulmonary Hypertension in Obstructive Sleep Apnea. , 1381-1392.
CrossRef13
William R. Auger, Nick H. Kim, Terence K. Trow. (2010) Chronic Thromboembolic Pulmonary Hypertension. Clinics in Chest Medicine 31:4, 741-758
CrossRef14
M. E. Pugh, A. R. Hemnes. (2010) Metabolic and hormonal derangements in pulmonary hypertension: from mouse to man. International Journal of Clinical Practice 64, 5-13
CrossRef15
Tamara Tajsic, Nicholas W. Morrell. 2010. Smooth Muscle Cell Hypertrophy, Proliferation, Migration and Apoptosis in Pulmonary Hypertension. .
CrossRef16
Marco Guazzi, Ross Arena. (2010) Pulmonary hypertension with left-sided heart disease. Nature Reviews Cardiology 7:11, 648-659
CrossRef17
Stephen Y Chan, Joseph Loscalzo. 2010. Pulmonary Vascular Disease Related to Hemodynamic Stress in the Pulmonary Circulation. .
CrossRef18
P. Kumpers, N. Nickel, A. Lukasz, H. Golpon, V. Westerkamp, K. M. Olsson, D. Jonigk, L. Maegel, C. L. Bockmeyer, S. David, M. M. Hoeper. (2010) Circulating angiopoietins in idiopathic pulmonary arterial hypertension. European Heart Journal 31:18, 2291-2300
CrossRef19
Laurence Dewachter, Robert Naeije. (2010) The newborn piglet: a large animal model of paediatric pulmonary hypertension. Drug Discovery Today: Disease Models 7:3-4, 107-113
CrossRef20
Jonathan W. Lowery, Mark P. de Caestecker. (2010) BMP signaling in vascular development and disease. Cytokine & Growth Factor Reviews 21:4, 287-298
CrossRef21
Duncan J. Stewart, Dominique Yelle. (2010) New insights into the molecular pathogenesis of pulmonary arterial hypertension: Relevance to novel therapeutic strategies. Canadian Journal of Cardiology 26, 29B-32B
CrossRef22
Irene Lang. (2010) Advances in understanding the pathogenesis of chronic thromboembolic pulmonary hypertension. British Journal of Haematology 149:4, 478-483
CrossRef23
Sheila G. Haworth. (2010) Idiopathic Pulmonary Arterial Hypertension in Childhood. Cardiology in Review 18:2, 64-66
CrossRef24
Jagdish Hiremath, Sadagopa Thanikachalam, Keyur Parikh, Somasundaram Shanmugasundaram, Sudhakar Bangera, Leland Shapiro, Gregory B. Pott, Cindy L. Vnencak-Jones, Carl Arneson, Michael Wade, R. James White. (2010) Exercise improvement and plasma biomarker changes with intravenous treprostinil therapy for pulmonary arterial hypertension: A placebo-controlled trial. The Journal of Heart and Lung Transplantation 29:2, 137-149
CrossRef25
Sheila G. Haworth, Marlene Rabinovitch. 2010. Pulmonary Circulation. , 117-141.
CrossRef26
Xiaodong Li, Xiaoxue Zhang, Robin Leathers, Ayako Makino, Chengqun Huang, Pouria Parsa, Jesus Macias, Jason X-J Yuan, Stuart W Jamieson, Patricia A Thistlethwaite. (2009) Notch3 signaling promotes the development of pulmonary arterial hypertension. Nature Medicine 15:11, 1289-1297
CrossRef27
O. Nallet, O. Milleron, F. Monsel, B. Safar, I. Ghrissi, J. Sergent. (2009) Hypertension pulmonaire et insuffisance cardiaque : le rôle de la vascularisation pulmonaire. Annales de Cardiologie et d'Angéiologie 58:5, 304-309
CrossRef28
ALINE VUCKOVIC, BENOÎT RONDELET, JEAN-PIERRE BRION, ROBERT NAEIJE. (2009) Expression of Vasoactive Intestinal Peptide and Related Receptors in Overcirculation-Induced Pulmonary Hypertension in Piglets. Pediatric Research 66:4, 395-399
CrossRef29
L. Kugathasan, J. B. Ray, Y. Deng, E. Rezaei, D. J. Dumont, D. J. Stewart. (2009) The angiopietin-1-Tie2 pathway prevents rather than promotes pulmonary arterial hypertension in transgenic mice. Journal of Experimental Medicine 206:10, 2221-2234
CrossRef30
Nicholas W. Morrell, Serge Adnot, Stephen L. Archer, Jocelyn Dupuis, Peter Lloyd Jones, Margaret R. MacLean, Ivan F. McMurtry, Kurt R. Stenmark, Patricia A. Thistlethwaite, Norbert Weissmann, Jason X.-J. Yuan, E. Kenneth Weir. (2009) Cellular and Molecular Basis of Pulmonary Arterial Hypertension. Journal of the American College of Cardiology 54:1, S20-S31
CrossRef31
Pinar Yildiz. (2009) Molecular mechanisms of pulmonary hypertension. Clinica Chimica Acta 403:1-2, 9-16
CrossRef32
Ming-xia Yang, Zheng-xia Liu, Shu Zhang, Yu Jing, Shi-jiang Zhang, Wei-ping Xie, Lei Ma, Chang-liang Zhu, Hong Wang. (2009) Proteomic analysis of the effect of iptakalim on human pulmonary arterial smooth muscle cell proliferation. Acta Pharmacologica Sinica 30:2, 175-183
CrossRef33
Remedios Otero Candelera, Teresa Elías Hernández. (2009) Etiopatogenia y fisiopatología de la hipertensión pulmonar tromboembólica crónica. Archivos de Bronconeumología 45, 6-10
CrossRef34
Marlene Rabinovitch. (2008) Molecular pathogenesis of pulmonary arterial hypertension. Journal of Clinical Investigation 118:7, 2372-2379
CrossRef35
Kelly M. Chin, Lewis J. Rubin. (2008) Pulmonary Arterial Hypertension. Journal of the American College of Cardiology 51:16, 1527-1538
CrossRef36
Nazzareno Galie, Alessandra Manes, Massimiliano Palazzini, Luca Negro, Alessandro Marinelli, Simona Gambetti, Elisabetta Mariucci, Andrea Donti, Angelo Branzi, Fernando M Picchio. (2008) Management of Pulmonary Arterial Hypertension Associated with Congenital Systemic-to-Pulmonary Shunts and Eisenmenger???s Syndrome. Drugs 68:8, 1049-1066
CrossRef37
Stephen Y. Chan, Joseph Loscalzo. (2008) Pathogenic mechanisms of pulmonary arterial hypertension. Journal of Molecular and Cellular Cardiology 44:1, 14-30
CrossRef38
Simone Post, Wouter Peeters, Els Busser, Dennis Lamers, Joost P.G. Sluijter, Marie-José Goumans, Roel A. de Weger, Frans L. Moll, Pieter A. Doevendans, Gerard Pasterkamp, Aryan Vink. (2008) Balance between Angiopoietin-1 and Angiopoietin-2 Is in Favor of Angiopoietin-2 in Atherosclerotic Plaques with High Microvessel Density. Journal of Vascular Research 45:3, 244-250
CrossRef39
Akihito Yamamoto, Hideki Takahashi, Yuko Kojima, Yasunari Tsuda, Yoshiteru Morio, Masashi Muramatsu, Yoshinosuke Fukuchi. (2008) Downregulation of Angiopoietin-1 and Tie2 in Chronic Hypoxic Pulmonary Hypertension. Respiration 75:3, 328-338
CrossRef40
Eli Gabbay, Robert G. Weintraub, Lewis J. Rubin. 2008. Pulmonary Arterial Hypertension. , 759-771.
CrossRef41
Adolfo Baloira, Carlos Vilariño, Virginia Leiro, Diana Valverde. (2008) Mutaciones en el gen que codifica BMPR2 en pacientes con hipertensión arterial pulmonar esporádica. Archivos de Bronconeumología 44:1, 29-34
CrossRef42
Oliver Eickelberg, Rory E. Morty. (2007) Transforming Growth Factor β/Bone Morphogenic Protein Signaling in Pulmonary Arterial Hypertension: Remodeling Revisited. Trends in Cardiovascular Medicine 17:8, 263-269
CrossRef43
Miguel A. Alejandre-Alcázar, Petar D. Shalamanov, Oana V. Amarie, Julia Sevilla-Pérez, Werner Seeger, Oliver Eickelberg, Rory E. Morty. (2007) Temporal and spatial regulation of bone morphogenetic protein signaling in late lung development. Developmental Dynamics 236:10, 2825-2835
CrossRef44
Omar Ali, John Wharton, John Simon Russell Gibbs, Luke Howard, Martin Russell Wilkins. (2007) Emerging therapies for pulmonary arterial hypertension. Expert Opinion on Investigational Drugs 16:6, 803-818
CrossRef45
David Mooney, Yu Ching Yung. 2007. Engineering Smooth Muscle. , 24-1-24-14.
CrossRef46
Puja Kumari Puri, Arnold M. Schwartz, Jan M. Orenstein. (2007) An Unusual Case of Pulmonary Arterial Hypertension Associated With HIV. Pathology Case Reviews 12:3, 96-99
CrossRef47
Wilhelm Grander, Patrizia Eller, Johannes Gänzer, Herbert Tilg, Ralf Geiger. (2007) Bosentan treatment in chronic pulmonary venous hypertension with significant right heart dysfunction. Current Medical Research and Opinion 23:s2, S71-S76
CrossRef48
KUNIHIKO TAKAHASHI, SHIGETOYO KOGAKI, TOHRU MATSUSHITA, SAYAKA NASUNO, SHUNJI KUROTOBI, KEIICHI OZONO. (2007) Hypoxia Induces Alteration of Bone Morphogenetic Protein Receptor Signaling in Pulmonary Artery Endothelial Cell. Pediatric Research 61:4, 392-397
CrossRef49
William R. Auger, Nick H. Kim, Kim M. Kerr, Victor J. Test, Peter F. Fedullo. (2007) Chronic Thromboembolic Pulmonary Hypertension. Clinics in Chest Medicine 28:1, 255-269
CrossRef50
Dermot O'Callaghan, Sean P. Gaine. (2007) Combination Therapy and New Types of Agents for Pulmonary Arterial Hypertension. Clinics in Chest Medicine 28:1, 169-185
CrossRef51
BENOIT RONDELET, FRAN??OIS KERBAUL, GABRIELA FLORES VIVIAN, IVES HUBLOUE, SANDRINE HUEZ, PIERRE FESLER, MYRIAM REMMELINK, SERGE BRIMIOUILLE, ISABELLE SALMON, ROBERT NAEIJE. (2007) Sitaxsentan for the Prevention of Experimental Shunt-Induced Pulmonary Hypertension. Pediatric Research 61:3, 284-288
CrossRef52
Marlene Rabinovitch. (2007) Pathobiology of Pulmonary Hypertension. Annual Review of Pathology: Mechanisms of Disease 2:1, 369-399
CrossRef53
K.L. Lewis. (2007) Relationship of BMPPR2 Mutations to Vasoreactivity in Pulmonary Arterial Hypertension. Yearbook of Pulmonary Disease 2007, 185-186
CrossRef54
Rachel E. Nisbet, Roy L. Sutliff, C. Michael Hart. (2007) The Role of Peroxisome Proliferator-Activated Receptors in Pulmonary Vascular Disease. PPAR Research 2007, 1-10
CrossRef55
Benjamin Sztrymf, Azzedine Yaïci, Barbara Girerd, Marc Humbert. (2007) Genes and Pulmonary Arterial Hypertension. Respiration 74:2, 123-132
CrossRef56
Judith Therrien, Sherryn Rambihar, Bill Newman, Kathy Siminovitch, David Langleben, Gary Webb, John Granton. (2006) Eisenmenger syndrome and atrial septal defect: Nature or nurture?. Canadian Journal of Cardiology 22:13, 1133-1136
CrossRef57
2006. Acute Ischemic Stroke. .
CrossRef58
C. F. Opitz, R. Ewert. (2006) Dual ETA/ETB vs. selective ETA endothelin receptor antagonism in patients with pulmonary hypertension. European Journal of Clinical Investigation 36:s3, 1-9
CrossRef59
SA Bleuming, LL Kodach, MJ Garcia Leon, DJ Richel, MP Peppelenbosch, PH Reitsma, JC Hardwick, GR van den Brink. (2006) Altered bone morphogenetic protein signalling in theHelicobacter pylori-infected stomach. The Journal of Pathology 209:2, 190-197
CrossRef60
James F. Tobin, Anthony J. Celeste. (2006) Bone morphogenetic proteins and growth differentiation factors as drug targets in cardiovascular and metabolic disease. Drug Discovery Today 11:9-10, 405-411
CrossRef61
Patricia A. Thistlethwaite, Aaron Kemp, Lingling Du, Michael M. Madani, Stuart W. Jamieson. (2006) Outcomes of pulmonary endarterectomy for treatment of extreme thromboembolic pulmonary hypertension. The Journal of Thoracic and Cardiovascular Surgery 131:2, 307-313
CrossRef62
Kelly M. Chin, Peter F. Fedullo. 2006. Chronic Thromboembolic Pulmonary Hypertension. , 188-209.
CrossRef63
Jennifer L. Snow, Peter Lloyd Jones, Darren B. Taichman. 2006. Pathobiologic Mechanisms of Pulmonary Arterial Hypertension. , 33-49.
CrossRef64
Patrick C.H. Hsieh, Richard D. Kenagy, Eileen R. Mulvihill, Joseph P. Jeanette, Xi Wang, Cindy M.C. Chang, Zizhen Yao, Walter L. Ruzzo, Suzanne Justice, Kelly L. Hudkins, Charles E. Alpers, Scott Berceli, Alexander W. Clowes. (2006) Bone morphogenetic protein 4: Potential regulator of shear stress-induced graft neointimal atrophy. Journal of Vascular Surgery 43:1, 150-158
CrossRef65
Eliot B. Friedman, Harold I. Palevsky, Darren B. Taichman. 2006. Classification and Prognosis of Pulmonary Arterial Hypertension. , 66-82.
CrossRef66
C. Gregory Elliott. 2006. Genetics of Pulmonary Arterial Hypertension. , 50-65.
CrossRef67
B. Sztrymf, A. Yaici, X. Jaïs, G. Simonneau, O. Sitbon, M. Humbert. (2005) Génétique de l’hypertension artérielle pulmonaire: données récentes et applications pratiques. Revue des Maladies Respiratoires 22:5, 796-805
CrossRef68
J.C. Caraballo Fonseca, C.D. Martínez Balzano, R. Sánchez de León. (2005) Disfunción endotelial en la hipertensión pulmonar. Archivos de Bronconeumología 41:7, 389-392
CrossRef69
(2005) Guías de Práctica Clínica sobre el diagnóstico y tratamiento de la hipertensión arterial pulmonar. Revista Española de Cardiología 58:5, 523-566
CrossRef70
Kurt R. Stenmark, Steven H. Abman. (2005) LUNG VASCULAR DEVELOPMENT: Implications for the Pathogenesis of Bronchopulmonary Dysplasia. Annual Review of Physiology 67:1, 623-661
CrossRef71
Roxana Sulica, Michael Poon. (2005) Medical therapeutics for pulmonary arterial hypertension: from basic science and clinical trial design to evidence-based medicine. Expert Review of Cardiovascular Therapy 3:2, 347-360
CrossRef72
Masakuni Kido, Lingling Du, Christopher C. Sullivan, Reena Deutsch, Stuart W. Jamieson, Patricia A. Thistlethwaite. (2005) Gene transfer of a TIE2 receptor antagonist prevents pulmonary hypertension in rodents. The Journal of Thoracic and Cardiovascular Surgery 129:2, 268-276
CrossRef73
Terry Young, Shahrokh Javaheri. 2005. Systemic and Pulmonary Hypertension in Obstructive Sleep Apnea. , 1192-1202.
CrossRef74
Farber, Harrison W., Loscalzo, Joseph, . (2004) Pulmonary Arterial Hypertension. New England Journal of Medicine 351:16, 1655-1665
Full Text75
T. Satoh. (2004) Lack of circulating autoantibodies to bone morphogenetic protein receptor-II or activin receptor-like kinase 1 in mixed connective tissue disease patients with pulmonary arterial hypertension. Rheumatology 44:2, 192-196
CrossRef76
Humbert, Marc, Sitbon, Olivier, Simonneau, Gérald, . (2004) Treatment of Pulmonary Arterial Hypertension. New England Journal of Medicine 351:14, 1425-1436
Full Text77
Mehran Mandegar, Yuan-Cheng B. Fung, Wei Huang, Carmelle V. Remillard, Lewis J. Rubin, Jason X.-J. Yuan. (2004) Cellular and molecular mechanisms of pulmonary vascular remodeling: role in the development of pulmonary hypertension. Microvascular Research 68:2, 75-103
CrossRef78
Irene M Lang, Diana Bonderman, Meinhard Kneussl, Manfred Marx. (2004) Paediatric pulmonary vascular disease. Paediatric Respiratory Reviews 5:3, 238-248
CrossRef79
Patricia E Carreira. (2004) Pulmonary hypertension in autoimmune rheumatic diseases. Autoimmunity Reviews 3:4, 313-320
CrossRef80
Marc Humbert, Nicholas W Morrell, Stephen L Archer, Kurt R Stenmark, Margaret R MacLean, Irene M Lang, Brian W Christman, E.Kenneth Weir, Oliver Eickelberg, Norbert F Voelkel, Marlene Rabinovitch. (2004) Cellular and molecular pathobiology of pulmonary arterial hypertension. Journal of the American College of Cardiology 43:12, S13-S24
CrossRef81
Lewis J Rubin, Nazzareno Galiè. (2004) Pulmonary arterial hypertension: a look to the future. Journal of the American College of Cardiology 43:12, S89-S90
CrossRef82
Giuseppe G. Pietra, Frederique Capron, Susan Stewart, Ornella Leone, Marc Humbert, Ivan M. Robbins, Lynne M. Reid, R.M. Tuder. (2004) Pathologic assessment of vasculopathies in pulmonary hypertension. Journal of the American College of Cardiology 43:12, S25-S32
CrossRef83
Peter Carmeliet. (2004) Manipulating angiogenesis in medicine. Journal of Internal Medicine 255:5, 538-561
CrossRef84
Kimberly A. Kasow, Carmem Bonfim, Julie Asch, David A. Margolis, Jesse Jenkins, Robert F. Tamburro, Rupert Handgretinger, Edwin M. Horwitz. (2004) Malignant infantile osteopetrosis & primary pulmonary hypertension: A new combination?. Pediatric Blood & Cancer 42:2, 190-194
CrossRef85
Danny Chu, Christopher C Sullivan, Lingling Du, Augustine J Cho, Masakuni Kido, Paul L Wolf, Matthew D Weitzman, Stuart W Jamieson, Patricia A Thistlethwaite. (2004) A new animal model for pulmonary hypertension based on the overexpression of a single gene, angiopoietin-1. The Annals of Thoracic Surgery 77:2, 449-456
CrossRef86
Mark Avdalovic, Christian Sandrock, Andrea Hoso, Roblee Allen, Timothy E Albertson. (2004) Epoprostenol in Pregnant Patients with Secondary Pulmonary Hypertension. Treatments in Respiratory Medicine 3:1, 29-34
CrossRef87
Akihide ITOH, Jun NISHIHIRA, Hironi MAKITA, Kenji MIYAMOTO, Etsuro YAMAGUCHI, Masaharu NISHIMURA. (2003) Effects of IL-1beta, TNF-alpha, and macrophage migration inhibitory factor on prostacyclin synthesis in rat pulmonary artery smooth muscle cells. Respirology 8:4, 467-472
CrossRef88
Pamela F Jones. (2003) Not just angiogenesis?wider roles for the angiopoietins. The Journal of Pathology 201:4, 515-527
CrossRef89
Stuart W Jamieson, David P Kapelanski, Naohide Sakakibara, Gerard R Manecke, Patricia A Thistlethwaite, Kim M Kerr, Richard N Channick, Peter F Fedullo, William R Auger. (2003) Pulmonary endarterectomy: experience and lessons learned in 1,500 cases. The Annals of Thoracic Surgery 76:5, 1457-1464
CrossRef90
Shelley Shapiro. (2003) Management of pulmonary hypertension resulting from interstitial lung disease. Current Opinion in Pulmonary Medicine 9:5, 426-430
CrossRef91
Hans-Werner Duchna, Ludger Grote, Stefan Andreas, Richard Schulz, Thomas E. Wessendorf, Heinrich F. Becker, Peter Clarenbach, Ingo Fietze, Holger Hein, Ulrich Koehler, Andreas Nachtmann, Winfried Randerath, Kurt Rasche, Karl-Heinz Ruhle, Bernd Sanner, Harald Schafer, Richard Staats, Volker Topfer. (2003) Sleep-Disordered Breathing and Cardio- and Cerebrovascular Diseases: 2003 Update of Clinical Significance and Future Perspectives. Schlafbezogene Atmungsstorungen und kardio- und zerebrovaskulare Erkrankungen: Update 2003 der klinischen Bedeutung und zukunftiger Entwicklungen. Somnologie 7:3, 101-121
CrossRef92
Stelios Tsigkos, Micheal Koutsilieris, Andreas Papapetropoulos. (2003) Angiopoietins in angiogenesis and beyond. Expert Opinion on Investigational Drugs 12:6, 933-941
CrossRef93
(2003) Signaling Molecules in Pulmonary Hypertension. New England Journal of Medicine 348:21, 2151-2151
Full Text94
Rolf Ziesche. (2003) Konsensus-Empfehlungen der Arbeitsgruppe Pulmonalarterielle Hypertension der Österreichischen Gesellschaft für Lungenerkrankungen und Tuberkulose. Wiener Klinische Wochenschrift 115:10, 351-365
CrossRef
- Letters
