Original Article
Endogenous Antimicrobial Peptides and Skin Infections in Atopic Dermatitis
N Engl J Med 2002; 347:1151-1160October 10, 2002
- Abstract
Background
The innate immune system of human skin contains antimicrobial peptides known as cathelicidins (LL-37) and β-defensins. In normal skin these peptides are negligible, but they accumulate in skin affected by inflammatory diseases such as psoriasis. We compared the levels of expression of LL-37 and human β-defensin 2 (HBD-2) in inflamed skin from patients with atopic dermatitis and from those with psoriasis.
Methods
The expression of LL-37 and HBD-2 protein in skin-biopsy specimens from patients with psoriasis, patients with atopic dermatitis, and normal subjects was determined by immunohistochemical analysis. The amount of antimicrobial peptides in extracts of skin samples was also analyzed by immunodot blot analysis (for LL-37) and Western blot analysis (for HBD-2). Quantitative, real-time reverse-transcriptase–polymerase-chain-reaction (RT-PCR) assays were used to confirm the relative expression of HBD-2 and LL-37 messenger RNA (mRNA) in the skin-biopsy specimens. These peptides were also tested for antimicrobial activity against Staphylococcus aureus with the use of a colony-forming assay.
Results
Immunohistochemical analysis confirmed the presence of abundant LL-37 and HBD-2 in the superficial epidermis of all patients with psoriasis. In comparison, immunostaining for these peptides was significantly decreased in acute and chronic lesions from patients with atopic dermatitis (P=0.006 and P=0.03, respectively). These results were confirmed by immunodot blot and Western blot analyses. Real-time RT-PCR showed significantly lower expression of HBD-2 mRNA and LL-37 mRNA in atopic lesions than in psoriatic lesions (P=0.009 and P=0.02, respectively). The combination of LL-37 and HBD-2 showed synergistic antimicrobial activity by effectively killing S. aureus.
Conclusions
A deficiency in the expression of antimicrobial peptides may account for the susceptibility of patients with atopic dermatitis to skin infection with S. aureus.
Media in This Article
Figure 6
Cytotoxic Activity of HBD-2 and LL-37 against Wild-Type Staphylococcus aureus.Figure 5
Effects of Interleukin-4 and Interleukin-13 on Tumor Necrosis Factor α (TNF-α)–Induced HBD-2 Expression in HaCat Cells.Article Activity
- Article
The skin's first line of defense against invasion by microbial agents is the stratum corneum, a nonviable, desiccated layer of the epidermis.1 However, this physical barrier is susceptible to injuries that allow the entry of opportunistic microbial agents into the skin. The innate immune system can immediately respond to this intrusion by helping to prevent further invasion. This immune response includes phagocytosis by neutrophils and macrophages and their production of reactive oxygen intermediates that kill microbial agents.2
A number of endogenous antimicrobial peptides have been shown to play an integral part in innate immunity.3 Two major classes of peptides in mammalian skin, β-defensins4,5 and cathelicidins,6,7 have antimicrobial activity against bacterial, fungal, and viral pathogens.4,7,9 These peptides, which are produced by keratinocytes in the skin,4,7,8 disrupt the membrane of the target microbe or penetrate the microbial membrane, interfering with intracellular functions.10 The expression of some of these peptides, such as human β-defensin 1 (HBD-1), is constitutive,8 whereas the expression of others, including human β-defensin 2 (HBD-2) and LL-37, a cathelicidin, is triggered by injury or inflammation of the skin.4,7 Animal models have shown that the expression or activation of antimicrobial peptides is essential for the ability of skin to resist bacterial infection.11,12
Atopic dermatitis, a chronic inflammatory skin disease frequently found in families with asthma and allergic rhinitis,13 is complicated by recurrent infections of skin lesions by bacterial, viral, and fungal pathogens.14 About 30 percent of patients with atopic dermatitis have bacterial or viral infections of the skin, as compared with only 7 percent of patients with psoriasis,15 even though both diseases are characterized by a defective skin barrier.16 We compared the expression of HBD-2 and LL-37 in skin lesions from patients with atopic dermatitis with their expression in psoriatic lesions and normal skin, using immunohistochemical staining, Western and immunodot blotting, and a quantitative, real-time reverse-transcriptase–polymerase-chain-reaction (RT-PCR) assay. We also examined the capacity of tumor necrosis factor α (TNF-α) to induce HBD-2 expression in a human keratinocyte cell line after treatment with interleukin-4 and interleukin-13, cytokines that are abundant in the skin of patients with atopic dermatitis.13 Finally, we evaluated the combined antimicrobial effects of LL-37 and HBD-2 on Staphylococcus aureus.
Methods
Patients
The study participants included 8 patients with moderate-to-severe atopic dermatitis (mean age, 33 years; extent of skin involvement, 20 to 60 percent), 11 patients with psoriasis (mean age, 38 years; extent of skin involvement, 15 to 40 percent), and 6 healthy persons (mean age, 38 years). None of the patients had received systemic corticosteroids previously, and none had received topical corticosteroids for at least one week before enrollment. The study was approved by the institutional review board at National Jewish Medical and Research Center, in Denver; all patients and normal subjects gave written informed consent.
Punch biopsies were performed, with 2-mm samples obtained from erythematous lesions that were less than three days old (acute atopic dermatitis), lichenified lesions that were more than two weeks old (chronic atopic dermatitis), psoriatic lesions, and normal skin. The skin samples were immediately frozen at –70°C for immunohistochemical studies or Western and immunodot blot analyses.
Immunohistochemical Staining
For immunostaining of HBD-2, frozen 5-μm skin-tissue sections were fixed in acetone for 10 minutes and then incubated with 10 percent nonimmune goat serum (Zymed) for 10 minutes. Blocking serum was removed, and the sections were stained with anti–HBD-2 rabbit polyclonal antibody (Peptide Institute) at a 1:50 dilution (vol/vol) in phosphate-buffered saline for one hour at room temperature in a humid atmosphere. The slides were rinsed twice with phosphate-buffered saline and incubated with a biotinylated goat antirabbit secondary antibody (Zymed) at room temperature for 30 minutes, rinsed twice with phosphate-buffered saline, and incubated with a mixture of avidin and biotinylated horseradish peroxidase (1:1 vol/vol, Dako) for an additional 30 minutes. The reaction was developed with the use of amino-ethyl-carbazole single solution (Zymed) for 10 minutes and then counterstained with hematoxylin. Negative controls were established with the use of nonimmune isotype antibodies and preincubation of the anti–HBD-2 antibodies with a synthetic HBD-2 peptide (Peptide Institute) to ensure the binding specificity of the anti–HBD-2 antibodies. All slides were coded before the samples were evaluated so that the identity of the study subjects was not revealed. The intensity of the immunostaining was graded with the use of microscopy on a scale from 0 to 3, with 0 indicating no staining and 3 the most intense staining.
For immunostaining of LL-37, frozen skin sections were treated similarly at first and then incubated with rabbit anti–LL-37 antibody, as previously described,17 in phosphate-buffered saline and 0.1 percent bovine serum albumin. The sections were washed in phosphate-buffered saline and stained with goat antirabbit horseradish peroxidase (Vectastain Elite ABC Rabbit kit, Vector Laboratories) and diaminobenzidine substrate (Sigma) according to the manufacturer's instructions. The sections were counterstained with hematoxylin. The specificity of the primary antibody reaction was confirmed in separate experiments by adsorption of either anti–LL-37 antibody with excess amounts of the synthetic peptide. The specificity of the secondary antibody reaction and of the immunostaining reagents was confirmed by routine use of rabbit nonimmune serum.
Measurement of HBD-2 and LL-37 Peptides
Skin-biopsy samples were weighed and then homogenized for 10 minutes with a loose-fitting Dounce homogenizer in 1 ml of 1 M hydrogen chloride and 1 percent trifluoroacetic acid on ice. Homogenized tissues in solution were then rotated overnight at 4°C. After centrifugation for 20 minutes at 14,000 rpm at 4°C, supernatants were transferred to new tubes and lyophilized completely. The resulting protein pellets were dissolved with distilled water to obtain a final protein concentration of 0.1 mg of tissue per microliter.
For the measurement of HBD-2, 15 μl of each sample was lyophilized again and resuspended in sodium dodecyl sulfate buffer overnight at 4°C. Samples and known amounts of HBD-2 for use as standards were then boiled for five minutes and loaded onto a 16.5 percent sodium dodecyl sulfate–tricine polyacrylamide gel. The samples were placed on Immobilon–PSQ membranes (Millipore) for one hour at 0.18 mA in 0.05 M sodium borate, pH 9.0, with 20 percent methanol and 0.05 percent sodium dodecyl sulfate. Blots were fixed for 30 minutes with 0.5 percent glutaraldehyde in TRIS-buffered saline (500 mM sodium chloride and 20 mM TRIS, pH 7.5), blocked for 30 minutes in 0.75 percent Blotto (nonfat powdered milk) in phosphate-buffered saline (0.9 percent sodium chloride and 10 mM sodium phosphate buffer, pH 7.4), then incubated for 18 hours in a 1:500 dilution of rabbit anti–HBD-2 serum in antibody dilution buffer (0.25 percent Blotto in phosphate-buffered saline containing 0.01 percent thimerosal as a preservative). The blots were washed in 0.1 percent bovine serum albumin in Blotto TRIS-buffered saline (0.9 percent sodium chloride and 20 mM TRIS–hydrogen chloride, pH 4.5 to 5.0) three times for 10 minutes each time. The membranes were incubated in a 1:2000 dilution of alkaline phosphatase–conjugated goat antirabbit IgG in antibody dilution buffer for one hour, then washed three times as before and developed in alkaline phosphatase development solution (bromochloroindolyl phosphate–nitroblue tetrazolium).
For the measurement of LL-37, immunodot blot analysis was performed. Positive controls and standard curves were generated with a synthetic LL-37 peptide (C-terminal, 18-mer fragment; amino acid sequence, CZQPIKDFLRNLVPRTES; molecular weight, 2204). The peptide was diluted serially from 50 to 1600 nM; 100 μl of each peptide standard and 5 μl of each sample (equivalent to 0.5 mg of tissue), extracted in a manner identical to that for HBD-2 measurements, were dotted in triplicate on nitrocellulose membrane. The membrane was blocked with 10 percent nonfat dry milk (Bio-Rad) and 0.1 percent Tween 20 in TRIS-buffered saline at room temperature for three hours and then incubated at 4°C overnight with rabbit anti–LL-37 antibody diluted to 1:2500 in the blocking solution. The membrane was then incubated at room temperature for two hours with goat antirabbit antibody–horseradish peroxidase (Dako) that was diluted to 1:4000 in blocking solution. Western Lightning chemiluminescence reagent (Perkin–Elmer Life Sciences) was used to detect electro-chemiluminescence. A low-light imaging system (ChemiImager 4400, Alpha Innotech) was used for densitometrical analysis. Signal detected by dot blot analysis was confirmed in some experiments by Western blot analysis, which identified full-length LL-37 at 18 kD. For quantification of both LL-37 and HBD-2, the signal intensity of tissue extracts was directly compared with that of a simultaneously prepared standard consisting of known amounts of each synthetic peptide. The concentration of antimicrobial peptide in the original skin-biopsy sample was then estimated by dividing the experimentally determined mass of antimicrobial peptide from the skin-biopsy sample by the epidermal volume. The epidermal volume was estimated by assuming an epidermal thickness of 0.1 mm; thus, the volume of epidermis in a 2-mm punch-biopsy specimen was 3.14×10–1 mm3.
RT-PCR Analysis of HBD-2 and LL-37 Messenger RNA
Total RNA was isolated from 2-mm skin-biopsy samples from the subjects with the use of TRI Reagent (Sigma) according to the manufacturer's protocol. The primers and probe for HBD-2 were designed with the use of Prism 7700 sequence-detection software (Primer Express, Perkin–Elmer Applied Biosystems). The primer sequences were 5' TCCTCTTCTCGTTCCTCTTCATATTC3' (forward primer) and 5'TTAAGGCAGGTAACAGGATCGC3' (reverse primer). The sequence for the probe (TaqMan, Perkin–Elmer) was 5'ACCACCAAAAACACCTGGAAGAGGCA3'; the 5' end was labeled with 6-carboxyfluorescein, and the 3' end was labeled with 6-carboxytetramethylrhodamine.
Amplification reactions were performed with the use of a sequence detector (ABI Prism 7700, Perkin–Elmer Applied Biosystems) in MicroAmp optical tubes (Perkin–Elmer Applied Biosystems) in a 25-μl mixture containing 8 percent glycerol, 1× TaqMan buffer A (500 mM potassium chloride, 100 mM TRIS-hydrogen chloride, 0.1 M EDTA, and 600 nM passive reference dye ROX, pH 8.3, at room temperature), 300 μM each of deoxyadenosine triphosphate, deoxyguanosine triphosphate, and deoxycytidine triphosphate, and 600 μM deoxyuridine triphosphate; 5.5 mM magnesium chloride; 900 nM forward primer; 900 nM reverse primer; 200 nM probe; 0.625 U of AmpliTaq Gold DNA Polymerase (Perkin–Elmer); 6.25 U of Moloney murine leukemia virus reverse transcriptase (Life Technologies); 10 U of RNasin ribonuclease inhibitor (Promega); and the template RNA. The RT assay was performed at 48°C for 30 minutes, followed by activation of TaqGold at 95°C for 10 minutes. Forty cycles of amplification were then performed at 95°C for 15 seconds and at 60°C for 1 minute.
After amplification, real-time data acquisition and analysis were performed. The fluorescence data were expressed as normalized reporter signal, calculated by dividing the amount of reporter signal by the amount of passive reference signal, or as the change in the normal reporter signal, calculated as the amount of normalized reporter signal minus the amount of reporter signal before PCR. The detection threshold was set above the mean base-line value for fluorescence determined on the basis of the first 15 cycles. Amplification reactions in which the intensity of fluorescence exceeded the threshold were defined as positive reactions. The threshold cycle (Ct) is the PCR cycle at which an increase in reporter signal above the base-line signal can first be detected. A standard curve was generated with the use of the fluorescence data from the 10-fold serial dilutions of total RNA from a skin-biopsy sample from a patient with psoriasis. This curve was used to calculate the relative amounts of HBD-2 in test samples. Quantities of HBD-2 in test samples were normalized to the corresponding 18S ribosomal RNA (rRNA) (P/N 4308310, Perkin–Elmer Applied Biosystems).
The real-time, quantitative PCR assay for LL-37 was performed with the use of a sequence-detection system (GeneAmp 5700, Perkin–Elmer). Classic 18S primers (Ambion) were used to amplify 18S rRNA. The primer sequences used to amplify LL-37 complementary DNA (cDNA) were 5'GCAGTCACCAGAGGATTGTGAC3' (forward primer) and 5'CACCGCTTCACCAGCCC3' (reverse primer). For the PCR assay of LL-37, 1.2 μl of RT reaction was used; 1.2 μl of 200-fold diluted RT reaction was used for PCR of 18S rRNA. Amplification reactions were performed in a final total volume of 25.7 μl containing SYBR Green PCR Master Mix (Applied Biosystems), 10 μM primer, and nuclease-free water. The assay was performed at 50°C for 2 minutes and at 95°C for 10 minutes. Forty cycles of amplification were then performed at 94°C for 15 seconds and at 60°C for 1 minute. The results were analyzed with the use of the comparative Ct method. This method is based on the assumption that the target (LL-37) and reference (18S) primers amplify with the same efficiency within a given range of initial messenger RNA (mRNA) concentrations. To test this assumption, cDNA was made from total RNA of a psoriasis sample at the initial total RNA concentrations of 1000, 500, 100, 50, and 10 ng. Real-time PCR was performed in triplicate for each starting concentration, and the change in Ct (ΔCt) was calculated. For each starting concentration of total RNA, ΔCt = CtR – CtG, where CtR denotes the reference Ct and CtG the target Ct. This value was plotted against the log of the initial total RNA concentration. The efficiencies of gene amplification were close enough that a correction factor over the specified range was not required if the slope was less than or equal to 0.1. We calculated the ΔΔCt for samples as follows: ΔΔCt = ΔCtE – ΔCtB, where CtE denotes the experimental Ct and CtB the base-line Ct. The base-line sample was a normal control sample, which had low expression of LL-37 mRNA. The relative expression was calculated as 2ΔΔCt in order to account for the exponential amplification of the PCR reaction.
Cell Culture
HaCat cells, a human keratinocyte cell line, were grown in Dulbecco's Modified Eagle's medium (Cellgro), supplemented with 10 percent fetal-calf serum (Gemini) and 1 percent of each of the following: 200 mM L-glutamine, minimal essential medium (MEM) with nonessential amino acids (GIBCO), MEM Vitamins Solution (Life Technologies), and penicillin–streptomycin. To study the effects of interleukin-4 and interleukin-13 on HBD-2 mRNA expression in HaCat cells, 5×105 cells per milliliter were incubated in control medium, 20 ng of TNF-α per milliliter alone or 20 ng of TNF-α per milliliter plus 50 ng of interleukin-4 per milliliter, alone or in combination with 50 ng of interleukin-13 per milliliter, for 24 hours. The cells were then washed once and homogenized in TRI reagent by repeated pipetting. Total RNA was isolated according to the manufacturer's protocol.
Measurement of Antimicrobial Activity
LL-37 and HBD-2 peptides were synthesized as previously described.17,18 The antimicrobial activity of the peptides was determined with the use of a solution colony-forming unit (CFU) assay. Wild-type S. aureus isolated from patients with atopic dermatitis was assessed. Bacteria were grown to a concentration at which they were multiplying exponentially (mid log phase; A600 1.5=8.0×109 CFU per milliliter) in Todd Hewitt broth medium (Sigma). Bacteria were washed twice with 10 mM sodium phosphate buffer (pH 7.4) containing 0.1 percent (wt/vol) Todd Hewitt broth and were diluted to a final concentration of 2.0×107 cells per milliliter in the same buffer. Ten microliters of this bacterial suspension was then placed in round-bottom, 96-well cell-culture plates and incubated at 37°C and 100 percent humidity for two hours with various concentrations of LL-37, HBD-2, or both. The cytotoxic activity and minimal bactericidal activity of LL-37 and HBD-2 were analyzed by plating serial dilutions of the incubation mixture in triplicate on Todd Hewitt broth agar plates and determining the CFU the following day. The percentage of killed bacteria was expressed as [1 – (CFU after peptide incubation) ÷ (CFU after control incubation)] × 100.
Statistical Analysis
The nonparametric median test from the JMP4 statistical package19 was used to determine significant differences. We constrained experimentwise error rates to the standard alpha level of 0.05 by the Bonferroni method; the alpha level was 0.025 for a comparison of two means and 0.017 for a comparison of three means.
Results
Figure 1Figure 1
Immunostaining for HBD-2 (Panel A) and LL-37 (Panel B) in Frozen Skin Sections from Patients with Psoriasis or Atopic Dermatitis (AD) and Normal Subjects. shows the immunostaining of HBD-2 and LL-37 in skin-biopsy samples. The samples from psoriatic lesions had much more intense staining for both HBD-2 and LL-37 than the samples from acute or chronic atopic lesions or normal skin. Figure 2Figure 2
Intensity of Immunostaining for HBD-2 in Skin from Patients with Atopic Dermatitis, Patients with Psoriasis, and Normal Subjects. shows the composite data on HBD-2 immunostaining for all the skin-biopsy samples. The intensity of the immunostaining of samples from acute atopic lesions did not differ significantly from that of chronic atopic lesions or normal skin. Psoriatic lesions, however, had significantly more intense immunostaining than acute atopic lesions (P=0.006), chronic atopic lesions (P=0.03), or normal skin (P=0.02). The results of immunostaining for LL-37 in the samples of normal skin and psoriatic lesions were consistent with a previous study showing that psoriatic lesions have greater expression of LL-37 than normal skin.7 The inflammatory skin lesions from patients with atopic dermatitis had markedly lower expression of LL-37 than the skin lesions from patients with psoriasis. The biggest difference was in the region of the granular cell layer and stratum corneum, which was relatively devoid of LL-37 in the atopic lesions but had the highest expression of LL-37 in the psoriatic lesions. The absence of HBD-2 and LL-37 in the normal skin also confirms previous reports that these antimicrobial peptides are not normally produced but are up-regulated under inflammatory conditions.4,7 For further quantification of the relative amounts of antimicrobial peptides in skin lesions, 2-mm biopsy specimens were acid-extracted, and the total amount of LL-37 and HBD-2 was measured (Figure 3Figure 3
Quantification of HBD-2 (Panel A) and LL-37 (Panel B) in Epidermis of Atopic and Psoriatic Skin Lesions.). Sufficient skin samples were available for analysis from only five patients with psoriasis and six with atopic dermatitis. Western blotting, as compared with a standard curve of recombinant HBD-2, showed that the amount of HBD-2 present in the psoriatic lesions ranged from 2.3 to 157 μM (median, 20), whereas no HBD-2 was detectable in the atopic lesions (Figure 3A). The results of quantification of LL-37 in skin-biopsy samples with the use of immunodot blot analysis were similar, with an abundance of LL-37 in the psoriatic lesions (median, 304 μM; range, 0 to 1605); only one of the six atopic lesions had detectable LL-37 (Figure 3B). The single positive sample from a patient with atopic dermatitis was from a chronic lesion, probably reflecting the contribution of LL-37 from an inflammatory-cell infiltrate.The difference in the expression of HBD-2 and LL-37 protein between atopic lesions and psoriatic lesions was further confirmed by the measurement of mRNA with the use of real-time RT-PCR. As shown in Figure 4Figure 4
HBD-2 and LL-37 Messenger RNA (mRNA) in Atopic and Psoriatic Skin Lesions., the expression of HBD-2 mRNA was significantly lower in acute atopic lesions (median, 98 pg per nanogram of rRNA) and chronic atopic lesions (median, 3268 pg per nanogram of rRNA) than in psoriatic lesions (median, 31,660 pg per nanogram of rRNA; P=0.009 for both comparisons). Real-time RT-PCR analyses of LL-37 mRNA showed similar results, with significantly lower expression of LL-37 peptide in acute and chronic atopic lesions than in psoriatic lesions (P=0.02 for both comparisons) (Figure 4).Previous studies have shown that LL-37 and HBD-2 are greatly increased in patients with inflammatory skin conditions.5-7 Therefore, the diminished expression of the peptides in lesions from patients with atopic dermatitis was an unexpected observation. To determine the mechanism underlying the reduced expression of antimicrobial peptides in atopic dermatitis, we studied the effects of two cytokines (interleukin-4 and interleukin-13) that are elevated in atopic dermatitis but not in psoriasis.13 Figure 5Figure 5
Effects of Interleukin-4 and Interleukin-13 on Tumor Necrosis Factor α (TNF-α)–Induced HBD-2 Expression in HaCat Cells. shows the effects of interleukin-4 and interleukin-13 on TNF-α–induced expression of HBD-2 in HaCat cells. Interleukin-4 alone or in combination with interleukin-13 significantly suppressed the up-regulation of HBD-2 mRNA by TNF-α (P=0.04). In normal human skin, both interleukin-4 and interleukin-13 suppressed TNF-α–induced HBD-2 mRNA expression in these explants (data not shown). Since atopic lesions are characterized by the predominance of interleukin-4 and interleukin-13 expression, the suppression of HBD-2 mRNA by these cytokines may account for the low expression of HBD-2 in these lesions.The relative absence of HBD-2 and LL-37 in the epidermis in atopic lesions, as compared with psoriatic lesions, suggested that the lack of these antimicrobial peptides in patients with atopic dermatitis might contribute to their susceptibility to bacterial colonization and infection. To investigate this possibility, we evaluated the susceptibility of clinical isolates of S. aureus to cytotoxic activity by both LL-37 and HBD-2. Alone, LL-37 showed strong activity (Figure 6AFigure 6
Cytotoxic Activity of HBD-2 and LL-37 against Wild-Type Staphylococcus aureus.), whereas HBD-2 was much less potent (minimal bactericidal concentration, >160 μM). No significant difference in susceptibility to these antimicrobial peptides was detected in clinical isolates, as compared with wild-type S. aureus (American Type Culture Collection number 25923), but all the isolates were more resistant than defensin-sensitive strains lacking cell-wall charge modifications that confer resistance.20 The relative resistance of S. aureus isolates from patients with atopic dermatitis argues against the reversion of the bacteria to less resistant forms in this disorder. When these resistant strains of S. aureus were exposed to antimicrobial peptides expressed in psoriatic skin, however, the presence of both peptides enhanced their cytotoxic activity (Figure 6). A combination of HBD-2 (at 80 μM or 160 μM) and LL-37 (at 4 μM) killed significantly more S. aureus organisms than did HBD-2 alone.Discussion
Atopic dermatitis is a very common skin disease known to be associated with a high prevalence of skin infections, particularly with S. aureus.13 The density of S. aureus in inflamed atopic lesions without clinical superinfection can be as high as 107 colony-forming units per square centimeter of lesional skin. The important role of S. aureus is supported by the observation that even in patients with atopic dermatitis who do not have superinfection, the severity of the skin disease is reduced by treatment with a combination of antistaphylococcal antibiotics and topical corticosteroids.21
Since S. aureus infection is a frequent trigger for the exacerbation of skin disease, there has been considerable interest in the mechanisms underlying the increased colonization of atopic skin lesions with S. aureus.22 Atopic skin has significantly greater binding affinity for S. aureus than nonatopic or psoriatic skin, probably as the result of underlying inflammation.23 This view is supported by the observation that treatment with topical glucocorticoids or tacrolimus reduces S. aureus counts on atopic skin.24,25 Indeed, a recent study has shown that the number of S. aureus organisms that bind to inflammatory skin lesions is significantly higher when the inflammation is mediated by type 2 helper T cells than when it is mediated by type 1 helper T cells.26
The increased avidity of S. aureus for atopic skin, however, can account only for a several-fold increase in S. aureus on atopic skin.23 Examination of skin-biopsy samples from patients with atopic dermatitis has shown that S. aureus grows in colonies in the upper layers of the epidermis between keratinocytes.27 This suggests that an exponential increase in S. aureus could result from failure of the innate immune defense system of atopic skin to restrict the growth of the organisms. Naturally occurring antimicrobial peptides are a critical component of this innate immune system that have been shown to provide mammalian skin with resistance to bacterial infection.11 The antimicrobial peptides HBD-2 and LL-37 are normally produced by keratinocytes in response to inflammatory stimuli such as psoriasis or injury.7 Consistent with the concept that the activity of keratinocytes in atopic dermatitis differs from that in psoriasis, recent observations indicate that in atopic dermatitis, but not psoriasis, keratinocytes produce a distinct profile of chemokines that promote the influx of eosinophils and type 2 helper T cells into the skin, whereas psoriatic keratinocytes promote infiltration by neutrophils and type 1 helper T cells.28
In our study, several independent approaches demonstrated that at both the protein level and the mRNA level, LL-37 and HBD-2 are deficient in skin lesions from patients with atopic dermatitis. We also demonstrated that the combination of HBD-2 and LL-37 at the concentrations found in psoriatic lesions, but not atopic lesions, was sufficient to kill S. aureus. These antimicrobial peptides have activity not only against bacteria but also against fungi and viruses. Thus, our observations may explain the increased susceptibility of patients with atopic dermatitis to fungal and viral infections such as herpes simplex and molluscum contagiosum.
We also investigated the potential mechanism (or mechanisms) for the reduced expression of antimicrobial peptides such as HBD-2. Since it is well established that atopic skin lesions are associated with increased expression of interleukin-4 and interleukin-13, we explored the possibility that these type 2 helper cytokines may inhibit HBD-2 gene expression. Indeed, we found that the combination of interleukin-4 and interleukin-13 was highly effective in inhibiting HBD-2 gene expression. Thus, type 2 helper cytokines account not only for the high IgE concentrations and eosinophilia in patients with atopic dermatitis but also for their increased susceptibility to skin infections.
In summary, our study showed that inflammatory skin lesions from patients with atopic dermatitis had significantly lower concentrations of HBD-2 and LL-37 than skin lesions from patients with psoriasis. The inhibitory effects of interleukin-4 and interleukin-13, both of which are abundant in atopic skin, may account for this finding. Furthermore, the low concentrations of HBD-2 and LL-37 in the patients with atopic dermatitis were unable to kill S. aureus. Therefore, a deficiency in the expression of inflammation-induced antimicrobial peptides may explain the susceptibility of patients with atopic dermatitis to skin infections. Our findings demonstrate the presence of skin-localized immunodeficiency in atopic dermatitis and the correlation between deficient expression of antimicrobial peptides and infection. These findings point to the role of antimicrobial-peptide function in clinical disease and highlight the importance of considering the interaction between the innate and adaptive immune systems.
Supported in part by grants from the National Institutes of Health (HL36577, AR41256, and HL37260), the Division of Research Resources (Clinical Research Center grant MO1 RR00051), and the University of Colorado Cancer Center to Dr. Leung; a National Research Service Award (T32 AI 07365) and a Fujisawa Health Care Allergic Skin Diseases Award to Dr. Ong; a Veterans Affairs Merit Review Award and grants from the Stern Foundation and the National Institutes of Health (AI48176) to Dr. Gallo; and a grant from the National Institutes of Health (HL46809) to Dr. Ganz.
We are indebted to Birgitta Agerberth for the gift of anti–LL-37 antibody, to Dr. Bryan R. Hauge and Umarani Pugazhenthi at the University of Colorado Cancer Center Core Facility for assistance with the real time RT-PCR analyses of HBD-2, to Maureen Sandoval for assistance with the preparation of the manuscript, to Dr. James Murphy for assistance with the statistical analyses, and to Dr. Hal Jenkins for his critical reading of the manuscript.
Source Information
From the Division of Allergy and Immunology, Department of Pediatrics, National Jewish Medical and Research Center, Denver (P.Y.O., I.S., M.B., D.Y.M.L.); the Department of Pediatrics, University of Colorado Health Sciences Center, Denver (M.B., D.Y.M.L.); the Division of Dermatology, Department of Medicine and Pediatrics, University of California, San Diego, and the Veterans Affairs San Diego Health Care System, San Diego (T.O., C.B., R.L.G.); and the Division of Pulmonary and Critical Care Medicine, Departments of Medicine and Pathology, School of Medicine, University of California, Los Angeles (T.G.).
Address reprint requests to Dr. Leung at the National Jewish Medical and Research Center, Department of Pediatrics, Rm. K926, 1400 Jackson St., Denver, CO 80206.
- References
References
1
Jackson SM, Elias PM. Skin as an organ of protection. In: Fitzpatrick TB, Eisen AZ, Wolff K, Freedberg IM, Austen KF, eds. Dermatology in general medicine. 4th ed. Vol. 1. New York: McGraw-Hill, 1993:241-53.
2
Fearon DT ,Locksley RM . The instructive role of innate immunity in the acquired immune response. Science 1996;272:50-53
CrossRef | Web of Science | Medline3
Lehrer RI ,Lichtenstein AK ,Ganz T . Defensins: antimicrobial and cytotoxic peptides of mammalian cells. Annu Rev Immunol 1993;11:105-128
CrossRef | Web of Science | Medline4
Harder J ,Bartels J ,Christophers E ,Schroder JM . A peptide antibiotic from human skin. Nature 1997;387:861-861
CrossRef | Web of Science | Medline5
Stolzenberg ED ,Anderson GM ,Ackermann MR ,Whitlock RH ,Zasloff M . Epithelial antibiotic induced in states of disease. Proc Natl Acad Sci U S A 1997;94:8686-8690
CrossRef | Web of Science | Medline6
Gallo RL ,Ono M ,Povsic T , et al. Syndecans, cell surface heparan sulfate proteoglycans, are induced by a proline-rich antimicrobial peptide from wounds. Proc Natl Acad Sci U S A 1994;91:11035-11039
CrossRef | Web of Science | Medline7
Frohm M ,Agerberth B ,Ahangari G , et al. The expression of the gene coding for the antibacterial peptide LL-37 is induced in human keratinocytes during inflammatory disorders. J Biol Chem 1997;272:15258-15263
CrossRef | Web of Science | Medline8
Fulton C ,Anderson GM ,Zasloff M ,Bull R ,Quinn AG . Expression of natural peptide antibiotics in human skin. Lancet 1997;350:1750-1751
CrossRef | Web of Science | Medline9
Gropp R ,Frye M ,Wagner TO ,Bargon J . Epithelial defensins impair adenoviral infection: implication for adenovirus-mediated gene therapy. Hum Gene Ther 1999;10:957-964
CrossRef | Web of Science | Medline10
Gallo RL ,Huttner KM . Antimicrobial peptides: an emerging concept in cutaneous biology. J Invest Dermatol 1998;111:739-743
CrossRef | Web of Science | Medline11
Nizet V ,Ohtake T ,Lauth X , et al. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature 2001;414:454-457
CrossRef | Web of Science | Medline12
Panyutich A ,Shi J ,Boutz PL ,Zhao C ,Ganz T . Porcine polymorphonuclear leukocytes generate extracellular microbicidal activity by elastase-mediated activation of secreted proprotegrins. Infect Immun 1997;65:978-985
Web of Science | Medline13
Leung DYM . Atopic dermatitis: new insights and opportunities for therapeutic intervention. J Allergy Clin Immunol 2000;105:860-876
CrossRef | Web of Science | Medline14
Leung DYM, Tharp M, Boguniewicz M. Atopic dermatitis (atopic eczema). In: Freedberg IM, Eisen AZ, Wolff K, et al., eds. Fitzpatrick's dermatology in general medicine. 5th ed. Vol. 1. New York: McGraw-Hill, 1998:1464-80.
15
Christophers E ,Henseler T . Contrasting disease patterns in psoriasis and atopic dermatitis. Arch Dermatol Res 1987;279:Suppl:S48-S51
CrossRef | Web of Science | Medline16
Grice K ,Sattar H ,Baker H ,Sharratt M . The relationship of transepidermal water loss to skin temperature in psoriasis and eczema. J Invest Dermatol 1975;64:313-315
CrossRef | Web of Science | Medline17
Dorschner RA ,Pestonjamasp VK ,Tamakuwala S , et al. Cutaneous injury induces the release of cathelicidin anti-microbial peptides active against group A Streptococcus. J Invest Dermatol 2001;117:91-97
CrossRef | Web of Science | Medline18
Liu AY ,Destoumieux D ,Wong AV , et al. Human β-defensin-2 production in keratinocytes is regulated by interleukin-1, bacteria, and the state of differentiation. J Invest Dermatol 2002;118:275-281
CrossRef | Web of Science | Medline19
Conover WJ. Practical nonparametric statistics. 2nd ed. New York: John Wiley, 1980.
20
Peschel A ,Jack RW ,Otto M , et al. Staphylococcus aureus resistance to human defensins and evasion of neutrophil killing via the novel virulence factor MprF is based on modification of membrane lipids with L-lysine. J Exp Med 2001;193:1067-1076
CrossRef | Web of Science | Medline21
Leyden JJ ,Kligman AM . The case for steroid-antibiotic combinations. Br J Dermatol 1977;96:179-187
CrossRef | Web of Science | Medline22
Bunikowski R ,Mielke ME ,Skarabis H , et al. Evidence for a disease-promoting effect of Staphylococcus aureus-derived exotoxins in atopic dermatitis. J Allergy Clin Immunol 2000;105:814-819
CrossRef | Web of Science | Medline23
Cho SH ,Strickland I ,Tomkinson A ,Fehringer AP ,Gelfand EW ,Leung DY . Preferential binding of Staphylococcus aureus to skin sites of Th2-mediated inflammation in a murine model. J Invest Dermatol 2001;116:658-663
CrossRef | Web of Science | Medline24
Nilsson EJ ,Henning CG ,Magnusson J . Topical corticosteroids and Staphylococcus aureus in atopic dermatitis. J Am Acad Dermatol 1992;27:29-34
CrossRef | Web of Science | Medline25
Remitz A ,Kyllonen H ,Granlund H ,Reitamo S . Tacrolimus ointment reduces staphylococcal colonization of atopic dermatitis lesions. J Allergy Clin Immunol 2001;107:196-197
CrossRef | Web of Science | Medline26
Cho SH ,Strickland I ,Boguniewicz M ,Leung DY . Fibronectin and fibrinogen contribute to the enhanced binding of Staphylococcus aureus to atopic skin. J Allergy Clin Immunol 2001;108:269-274
CrossRef | Web of Science | Medline27
Morishita Y ,Tada J ,Sato A , et al. Possible influences of Staphylococcus aureus on atopic dermatitis -- the colonizing features and the effects of staphylococcal enterotoxins. Clin Exp Allergy 1999;29:1110-1117
CrossRef | Web of Science | Medline28
Giustizieri ML ,Mascia F ,Frezzolini A , et al. Keratinocytes from patients with atopic dermatitis and psoriasis show a distinct chemokine production profile in response to T cell-derived cytokines. J Allergy Clin Immunol 2001;107:871-877
CrossRef | Web of Science | Medline
- Citing Articles (456)
Citing Articles
1
J. Just. (2012) Histoire naturelle de la dermatite atopique : expérience des cohortes néonatales. Revue Française d'Allergologie
CrossRef2
J. L. Reed, D. E. Scott, M. Bray. (2012) Eczema Vaccinatum. Clinical Infectious Diseases
CrossRef3
Ian A. Myles, Sandip K. Datta. (2012) Staphylococcus aureus: an introduction. Seminars in Immunopathology
CrossRef4
Terhi Savinko, Sampsa Matikainen, Ulpu Saarialho-Kere, Maili Lehto, Guoying Wang, Sari Lehtimäki, Piia Karisola, Timo Reunala, Henrik Wolff, Antti Lauerma, Harri Alenius. (2012) IL-33 and ST2 in Atopic Dermatitis: Expression Profiles and Modulation by Triggering Factors. Journal of Investigative Dermatology
CrossRef5
Eric L. Simpson. (2012) Comorbidity in Atopic Dermatitis. Current Dermatology Reports
CrossRef6
LeAnna Lane, Jonathan Dyer. (2012) Comorbid Infections of Pediatric Inflammatory Skin Diseases. Pediatric Annals
CrossRef7
Juan Shen, Xue-mei Lu, Xiao-bao Jin, Jing Ding, Xiao-bo Li, Han-fang Mei, Fu-jiang Chu, Jia-yong Zhu. (2012) Expression of a novel dual-functional protein – The antimicrobial peptide LL-37 fused with human acidic fibroblast growth factor in Escherichia coli. Protein Expression and Purification 81:1, 119-125
CrossRef8
Kathryn J. Sowerwine, Steven M. Holland, Alexandra F. Freeman. (2012) Hyper-IgE syndrome update. Annals of the New York Academy of Sciencesno-no
CrossRef9
Joanne Domenico, Joseph J. Lucas, Mayumi Fujita, Erwin W. Gelfand. (2012) Susceptibility to Vaccinia Virus Infection and Spread in Mice Is Determined by Age at Infection, Allergen Sensitization and Mast Cell Status. International Archives of Allergy and Immunology 158:2, 196-205
CrossRef10
J. Carlos Rodríguez-Cabello, Carmen García-Arévalo, Alessandra Girotti, Laura Martín, Mercedes Santos. 2011. Recombinant Antimicrobial Peptides. , 227-260.
CrossRef11
Teruaki Nakatsuji, Richard L Gallo. (2011) Antimicrobial Peptides: Old Molecules with New Ideas. Journal of Investigative Dermatology
CrossRef12
Andreas Wollenberg, Helen-Caroline Räwer, Jürgen Schauber. (2011) Innate Immunity in Atopic Dermatitis. Clinical Reviews in Allergy & Immunology 41:3, 272-281
CrossRef13
Domenico Santoro, Rosanna Marsella, David Bunick, Thomas K. Graves, Karen L. Campbell. (2011) Expression and distribution of canine antimicrobial peptides in the skin of healthy and atopic beagles. Veterinary Immunology and Immunopathology 144:3-4, 382-388
CrossRef14
Peter M. Elias, Joan S. Wakefield. (2011) Therapeutic Implications of a Barrier-Based Pathogenesis of Atopic Dermatitis. Clinical Reviews in Allergy & Immunology 41:3, 282-295
CrossRef15
Jeffrey B. Travers, Amal Kozman, Yongxue Yao, Wenyu Ming, Weiguo Yao, Mathew J. Turner, Mark H. Kaplan, Nico Mousdicas, Anita N. Haggstrom, Chandan Saha. (2011) Treatment Outcomes of Secondarily Impetiginized Pediatric Atopic Dermatitis Lesions and the Role of Oral Antibiotics. Pediatric Dermatologyno-no
CrossRef16
Paola Di Meglio, Gayathri K. Perera, Frank O. Nestle. (2011) The Multitasking Organ: Recent Insights into Skin Immune Function. Immunity 35:6, 857-869
CrossRef17
Sheila Krishna, Lloyd S Miller. (2011) Host–pathogen interactions between the skin and Staphylococcus aureus. Current Opinion in Microbiology
CrossRef18
Sheila Krishna, Lloyd S. Miller. (2011) Innate and adaptive immune responses against Staphylococcus aureus skin infections. Seminars in Immunopathology
CrossRef19
E. M. Savilahti, A. K. Kukkonen, T. Haahtela, T. Tuure, M. Kuitunen, E. Savilahti. (2011) Intestinal defensin secretion in infancy is associated with the emergence of sensitization and atopic dermatitis. Clinical & Experimental Allergyn/a-n/a
CrossRef20
D. Jönsson, B.-O. Nilsson. (2011) The antimicrobial peptide LL-37 is anti-inflammatory and proapoptotic in human periodontal ligament cells. Journal of Periodontal Researchno-no
CrossRef21
S.C.S. Cai, H. Chen, W.-P. Koh, J.E.A. Common, H.P. van Bever, W.H.I. McLean, E.B. Lane, Y.C. Giam, M.B.Y. Tang. (2011) Filaggrin mutations are associated with recurrent skin infection in Singaporean Chinese patients with atopic dermatitis. British Journal of Dermatologyno-no
CrossRef22
Jens-Michael Jensen, Kerstin Ahrens, Josef Meingassner, Andreas Scherer, Matthias Bräutigam, Anton Stütz, Thomas Schwarz, Regina Fölster-Holst, Jürgen Harder, Regine Gläser, Ehrhardt Proksch. (2011) Differential suppression of epidermal antimicrobial protein expression in atopic dermatitis and in EFAD mice by pimecrolimus compared to corticosteroids. Experimental Dermatology 20:10, 783-788
CrossRef23
E. Andrès. (2011) Cationic antimicrobial peptides in clinical development, with special focus on thanatin and heliomicin. European Journal of Clinical Microbiology & Infectious Diseases
CrossRef24
Aurélie Kern, Elody Collin, Cathy Barthel, Chloé Michel, Benoît Jaulhac, Nathalie Boulanger. (2011) Tick Saliva Represses Innate Immunity and Cutaneous Inflammation in a Murine Model of Lyme Disease. Vector-Borne and Zoonotic Diseases 11:10, 1343-1350
CrossRef25
Richard L Gallo, Teruaki Nakatsuji. (2011) Microbial Symbiosis with the Innate Immune Defense System of the Skin. Journal of Investigative Dermatology 131:10, 1974-1980
CrossRef26
M. C. Liu, H.-Q. Xiao, A. J. Brown, C. S. Ritter, J. Schroeder. (2011) Association of vitamin D and antimicrobial peptide production during late-phase allergic responses in the lung. Clinical & Experimental Allergyn/a-n/a
CrossRef27
Naoko Kanda, Shinichi Watanabe. (2011) Increased serum human β-defensin-2 levels in atopic dermatitis: relationship to IL-22 and oncostatin M. Immunobiology
CrossRef28
Brenda J Curtis, Katherine A Radek. (2011) Cholinergic Regulation of Keratinocyte Innate Immunity and Permeability Barrier Integrity: New Perspectives in Epidermal Immunity and Disease. Journal of Investigative Dermatology
CrossRef29
Hamid R Rezvani, Nsrein Ali, Lars J Nissen, Ghida Harfouche, Hubert de Verneuil, Alain Taïeb, Frédéric Mazurier. (2011) HIF-1α in Epidermis: Oxygen Sensing, Cutaneous Angiogenesis, Cancer, and Non-Cancer Disorders. Journal of Investigative Dermatology 131:9, 1793-1805
CrossRef30
John Hayman. (2011) Charles Darwin returns to the dermatologist. International Journal of Dermatology 50:9, 1162-1165
CrossRef31
Andreas Cederlund, Gudmundur H. Gudmundsson, Birgitta Agerberth. (2011) Antimicrobial peptides important in innate immunity. FEBS Journalno-no
CrossRef32
Shin Morizane, Kenshi Yamasaki, Beda Mühleisen, Paul F Kotol, Masamoto Murakami, Yumi Aoyama, Keiji Iwatsuki, Tissa Hata, Richard L Gallo. (2011) Cathelicidin Antimicrobial Peptide LL-37 in Psoriasis Enables Keratinocyte Reactivity against TLR9 Ligands. Journal of Investigative Dermatology
CrossRef33
Peter M. Elias. 2011. Role of Stratum Corneum in Permeability Barrier Function and Antimicrobial Defense. , 59-72.
CrossRef34
Neelam Muizzudin. 2011. Defensins. , 109-116.
CrossRef35
Whasun O. Chung, Henrik Dommisch. 2011. Antimicrobial Peptides of Skin and Oral Mucosa. , 117-144.
CrossRef36
Shamim A. Ansari. 2011. Resident Microflora and Antimicrobial Peptides of Skin. , 83-107.
CrossRef37
Gengi Imokawa. 2011. Deranged Antimicrobial Barrier in Atopic Dermatitis: Roles of Sphingosine, Hexadecenoic Acid, and Beta-Defensine-2. , 305-323.
CrossRef38
Barbara Geusens, Ilse Mollet, Chris D. Anderson, Sarah Terras, Michael S. Roberts, Jo Lambert. 2011. Changes in Skin Immunity with Age and Disease. , 215-258.
CrossRef39
Chong Zhang, Lianrong Zhao, Li Ma, Cheng Lv, Yang Ding, Tingting Xia, Jingyan Wang, Xiaoguang Dou. (2011) Vitamin D Status and Expression of Vitamin D Receptor and LL-37 in Patients with Spontaneous Bacterial Peritonitis. Digestive Diseases and Sciences
CrossRef40
Lloyd S. Miller, John S. Cho. (2011) Immunity against Staphylococcus aureus cutaneous infections. Nature Reviews Immunology 11:8, 505-518
CrossRef41
Amy T. Y. Yeung, Shaan L. Gellatly, Robert E. W. Hancock. (2011) Multifunctional cationic host defence peptides and their clinical applications. Cellular and Molecular Life Sciences 68:13, 2161-2176
CrossRef42
Alexander Kreuter, Mohamed Jaouhar, Marina Skrygan, Christian Tigges, Markus Stücker, Peter Altmeyer, Regine Gläser, Thilo Gambichler. (2011) Expression of antimicrobial peptides in different subtypes of cutaneous lupus erythematosus. Journal of the American Academy of Dermatology 65:1, 125-133
CrossRef43
N. Novak, D. Simon. (2011) Atopic dermatitis - from new pathophysiologic insights to individualized therapy. Allergy 66:7, 830-839
CrossRef44
Mark Boguniewicz, Donald Y. M. Leung. (2011) Atopic dermatitis: a disease of altered skin barrier and immune dysregulation. Immunological Reviews 242:1, 233-246
CrossRef45
Christine Bangert, Patrick M. Brunner, Georg Stingl. (2011) Immune functions of the skin. Clinics in Dermatology 29:4, 360-376
CrossRef46
Reinaldo Ramos, João Pedro Silva, Ana Cristina Rodrigues, Raquel Costa, Luísa Guardão, Fernando Schmitt, Raquel Soares, Manuel Vilanova, Lucília Domingues, Miguel Gama. (2011) Wound healing activity of the human antimicrobial peptide LL37. Peptides 32:7, 1469-1476
CrossRef47
Jamie J. Bernard, Richard L. Gallo. (2011) Protecting the boundary: the sentinel role of host defense peptides in the skin. Cellular and Molecular Life Sciences 68:13, 2189-2199
CrossRef48
W. Todd Penberthy, Soumya Chari, Amy L. Cole, Alexander M. Cole. (2011) Retrocyclins and their activity against HIV-1. Cellular and Molecular Life Sciences 68:13, 2231-2242
CrossRef49
David Dunkin, M. Cecilia Berin, Lloyd Mayer. (2011) Allergic sensitization can be induced via multiple physiologic routes in an adjuvant-dependent manner. Journal of Allergy and Clinical Immunology
CrossRef50
Clive B. Archer. 2011. Immunopharmacological Mechanisms in Atopic Dermatitis. , 25.1-25.13.
CrossRef51
Christina Schnopp, Martin Mempel. 2011. Microbiology in Atopic Eczema. , 26.1-26.9.
CrossRef52
Martin Hewison. (2011) Antibacterial effects of vitamin D. Nature Reviews Endocrinology 7:6, 337-345
CrossRef53
Byung Eui Kim, Michael D Howell, Emma Guttman, Patricia M Gilleaudeau, Irma R Cardinale, Mark Boguniewicz, James G Krueger, Donald Y M Leung. (2011) TNF-α Downregulates Filaggrin and Loricrin through c-Jun N-terminal Kinase: Role for TNF-α Antagonists to Improve Skin Barrier. Journal of Investigative Dermatology 131:6, 1272-1279
CrossRef54
P. Montreekachon, P. Chotjumlong, J. G. M. Bolscher, K. Nazmi, V. Reutrakul, S. Krisanaprakornkit. (2011) Involvement of P2X7 purinergic receptor and MEK1/2 in interleukin-8 up-regulation by LL-37 in human gingival fibroblasts. Journal of Periodontal Research 46:3, 327-337
CrossRef55
M. Matsuo, Y. Oogai, F. Kato, M. Sugai, H. Komatsuzawa. (2011) Growth-phase dependence of susceptibility to antimicrobial peptides in Staphylococcus aureus. Microbiology 157:6, 1786-1797
CrossRef56
Emma Guttman-Yassky, Kristine E. Nograles, James G. Krueger. (2011) Contrasting pathogenesis of atopic dermatitis and psoriasis—Part II: Immune cell subsets and therapeutic concepts. Journal of Allergy and Clinical Immunology 127:6, 1420-1432
CrossRef57
D.F. Fiorentino, R.O. Chen, D.B. Stewart, K.K. Brown, U.N. Sundram. (2011) The direct cellular target of topically applied pimecrolimus may not be infiltrating lymphocytes. British Journal of Dermatology 164:5, 996-1003
CrossRef58
Marijke Kamsteeg, Mieke Bergers, Roelie de Boer, Patrick L.J.M. Zeeuwen, Stanleyson V. Hato, Joost Schalkwijk, Geuranne S. Tjabringa. (2011) Type 2 Helper T-Cell Cytokines Induce Morphologic and Molecular Characteristics of Atopic Dermatitis in Human Skin Equivalent. The American Journal of Pathology 178:5, 2091-2099
CrossRef59
Sebastian Lippross, Tim Klueter, Nadine Steubesand, Stefanie Oestern, Rolf Mentlein, Frank Hildebrandt, Rainer Podschun, Thomas Pufe, Andreas Seekamp, Deike Varoga. (2011) Multiple trauma induces serum production of host defence peptides. Injury
CrossRef60
Elizabeth A. Grice, Julia A. Segre. (2011) The skin microbiome. Nature Reviews Microbiology 9:4, 244-253
CrossRef61
Donald Y.M. Leung, Pei-Song Gao, Dmitry N. Grigoryev, Nicholas M. Rafaels, Joanne E. Streib, Michael D. Howell, Patricia A. Taylor, Mark Boguniewicz, Jennifer Canniff, Brian Armstrong, Daniel J. Zaccaro, Lynda C. Schneider, Tissa R. Hata, Jon M. Hanifin, Lisa A. Beck, Adriana Weinberg, Kathleen C. Barnes. (2011) Human atopic dermatitis complicated by eczema herpeticum is associated with abnormalities in IFN-γ response. Journal of Allergy and Clinical Immunology 127:4, 965-973.e5
CrossRef62
TF Leung, KW Ching, APS Kong, GWK Wong, JCN Chan, KL Hon. (2011) Circulating LL-37 is a biomarker for eczema severity in children. Journal of the European Academy of Dermatology and Venereologyno-no
CrossRef63
Nicola Fuiano, Cristoforo Incorvaia. (2011) The atopy patch test: is it time to redefine its significance?. Annals of Allergy, Asthma & Immunology 106:4, 278-282
CrossRef64
ShelleyD Cathcart, Amy Theos. (2011) Inpatient management of atopic dermatitis. Dermatologic Therapy 24:2, 249-255
CrossRef65
Charles R. Wira, Mickey V. Patel, Mimi Ghosh, Lucy Mukura, John V. Fahey. (2011) Innate Immunity in the Human Female Reproductive Tract: Endocrine Regulation of Endogenous Antimicrobial Protection Against HIV and Other Sexually Transmitted Infections. American Journal of Reproductive Immunology 65:3, 196-211
CrossRef66
K. Reginald, K. Westritschnig, T. Werfel, A. Heratizadeh, N. Novak, M. Focke-Tejkl, A. M. Hirschl, D. Y. M. Leung, O. Elisyutina, E. Fedenko, R. Valenta. (2011) Immunoglobulin E antibody reactivity to bacterial antigens in atopic dermatitis patients. Clinical & Experimental Allergy 41:3, 357-369
CrossRef67
Maria L Salskov-Iversen, Claus Johansen, Knud Kragballe, Lars Iversen. (2011) Caspase-5 Expression Is Upregulated in Lesional Psoriatic Skin. Journal of Investigative Dermatology 131:3, 670-676
CrossRef68
Feifei Feng, Chen Chen, Wenjuan Zhu, Weiyu He, Huijuan Guang, Zheng Li, Duo Wang, Jingze Liu, Ming Chen, Yipeng Wang, Haining Yu. (2011) Gene cloning, expression and characterization of avian cathelicidin orthologs, Cc-CATHs, from Coturnix coturnix. FEBS Journalno-no
CrossRef69
Andrew Johnston, Johann E Gudjonsson, Abhishek Aphale, Andrew M Guzman, Stefan W Stoll, James T Elder. (2011) EGFR and IL-1 Signaling Synergistically Promote Keratinocyte Antimicrobial Defenses in a Differentiation-Dependent Manner. Journal of Investigative Dermatology 131:2, 329-337
CrossRef70
Andrew W Borkowski, Richard L Gallo. (2011) The Coordinated Response of the Physical and Antimicrobial Peptide Barriers of the Skin. Journal of Investigative Dermatology 131:2, 285-287
CrossRef71
Domenico Santoro, David Bunick, Thomas K. Graves, Karen L. Campbell. (2011) Expression and distribution of antimicrobial peptides in the skin of healthy beagles. Veterinary Dermatology 22:1, 61-67
CrossRef72
Kazuhiko Okumura. (2011) Cathelicidins—Therapeutic antimicrobial and antitumor host defense peptides for oral diseases. Japanese Dental Science Review 47:1, 67-81
CrossRef73
Heleen D de Koning, Marijke Kamsteeg, Diana Rodijk-Olthuis, Ivonne M J J van Vlijmen-Willems, Piet E J van Erp, Joost Schalkwijk, Patrick L J M Zeeuwen. (2011) Epidermal Expression of Host Response Genes upon Skin Barrier Disruption in Normal Skin and Uninvolved Skin of Psoriasis and Atopic Dermatitis Patients. Journal of Investigative Dermatology 131:1, 263-266
CrossRef74
Kenshi YAMASAKI. (2011) Nishi Nihon Hifuka 73:1, 3-7
CrossRef75
Jens-M. Schröder. (2011) Antimicrobial Peptides in Healthy Skin and Atopic Dermatitis. Allergology International 60:1, 17-24
CrossRef76
Sang-Il Lee, Jihyun Kim, Youngshin Han, Kangmo Ahn. (2011) A proposal: Atopic Dermatitis Organizer (ADO) guideline for children. Asia Pacific Allergy 1:2, 53
CrossRef77
Suzanne Zuyderduyn, Dennis K Ninaber, Jasmijn A Schrumpf, Marianne AJA van Sterkenburg, Renate M Verhoosel, Frans A Prins, Sandra van Wetering, Klaus F Rabe, Pieter S Hiemstra. (2011) IL-4 and IL-13 exposure during mucociliary differentiation of bronchial epithelial cells increases antimicrobial activity and expression of antimicrobial peptides. Respiratory Research 12:1, 59
CrossRef78
Timothy Voorhees, Jihoon Chang, Yongxue Yao, Mark H. Kaplan, Cheong-Hee Chang, Jeffrey B. Travers. (2011) Dendritic cells produce inflammatory cytokines in response to bacterial products from Staphylococcus aureus-infected atopic dermatitis lesions. Cellular Immunology 267:1, 17-22
CrossRef79
Tova Dybvig, Marina Facci, Volker Gerdts, Heather L. Wilson. (2011) Biological roles of host defense peptides: lessons from transgenic animals and bioengineered tissues. Cell and Tissue Research 343:1, 213-225
CrossRef80
Michael Matzner, Abdul Rahim Al Samie, Heide-Maria Winkler, Johannes Nemeth, Andreas Grasnek, Alexander Indra, Christian Bieglmayer, Stefan Winkler. (2011) Low serum levels of cathelicidin LL-37 in leprosy. Acta Tropica 117:1, 56-59
CrossRef81
U-C. Hipler, C. Wiegand. 2011. Biofunctional textiles based on cellulose and their approaches for therapy and prevention of atopic eczema. , 280-294.
CrossRef82
Gerry K. Schwalfenberg. (2011) A review of the critical role of vitamin D in the functioning of the immune system and the clinical implications of vitamin D deficiency. Molecular Nutrition & Food Research 55:1, 96-108
CrossRef83
Toshiro Takai, Shigaku Ikeda. (2011) Barrier Dysfunction Caused by Environmental Proteases in the Pathogenesis of Allergic Diseases. Allergology International 60:1, 25-35
CrossRef84
Philipp Stockmann, Falk Wehrhan, Stephan Schwarz-Furlan, Florian Stelzle, Susanne Trabert, Friedrich W Neukam, Emeka Nkenke. (2011) Increased human defensine levels hint at an inflammatory etiology of bisphosphonate-associated osteonecrosis of the jaw: An immunohistological study. Journal of Translational Medicine 9:1, 135
CrossRef85
Laura Maintz, Natalija Novak. (2011) Modifications of the Innate Immune System in Atopic Dermatitis. Journal of Innate Immunity 3:2, 131-141
CrossRef86
Ichiro Katayama, Yoichi Kohno, Kazuo Akiyama, Zenro Ikezawa, Naomi Kondo, Kunihiko Tamaki, Osamu Kouro. (2011) Japanese Guideline for Atopic Dermatitis. Allergology International 60:2, 205-220
CrossRef87
T. Agner. (2010) Staphylococcal-mediated worsening of atopic dermatitis: many players involved. British Journal of Dermatology 163:6, 1147-1147
CrossRef88
Sayaka Hayashida, Norihiro Furusho, Hiroshi Uchi, Shougo Miyazaki, Kunimitsu Eiraku, Chisato Gondo, Gaku Tsuji, Junichi Hachisuka, Shuji Fukagawa, Makiko Kido, Takeshi Nakahara, Yoichi Moroi, Jun Hayashi, Akihito Hagihara, Masutaka Furue. (2010) Are lifetime prevalence of impetigo, molluscum and herpes infection really increased in children having atopic dermatitis?. Journal of Dermatological Science 60:3, 173-178
CrossRef89
Jim Bartley. (2010) Vitamin D: emerging roles in infection and immunity. Expert Review of Anti-infective Therapy 8:12, 1359-1369
CrossRef90
T.F. Leung, K.W. Ching, H.Y. Sy, A.P.S. Kong, L.Y. Tse, S.S. Wang, C.W.K. Lam, J.C.N. Chan, G.W.K. Wong, K.L. Hon. (2010) CHIA confers susceptibility to childhood eczema. British Journal of Dermatology 163:6, 1360-1362
CrossRef91
R. Foelster Holst, S. Reitamo, R. Yankova, M. Worm, M. Kadurina, K. Thaci, T. Bieber, N. Tsankov, A. Enk, T. Luger, M. Duffy, R. Tansley. (2010) The novel protease inhibitor SRD441 ointment is not effective in the treatment of adult subjects with atopic dermatitis: results of a randomized, vehicle-controlled study. Allergy 65:12, 1594-1599
CrossRef92
Peter Maximilian Heil, Dieter Maurer, Brigitte Klein, Thomas Hultsch, Georg Stingl. (2010) Omalizumab therapy in atopic dermatitis: depletion of IgE does not improve the clinical course - a randomized, placebo-controlled and double blind pilot study. JDDG: Journal der Deutschen Dermatologischen Gesellschaft 8:12, 990-998
CrossRef93
John S. Cho, Caiyun Xuan, Lloyd S. Miller. (2010) Lucky Number Seven: RNase 7 Can Prevent Staphylococcus aureus Skin Colonization. Journal of Investigative Dermatology 130:12, 2703-2706
CrossRef94
Anh Tuan Vu, Tadashi Baba, Xue Chen, Tuan Anh Le, Hirokazu Kinoshita, Yang Xie, Seiji Kamijo, Keiichi Hiramatsu, Shigaku Ikeda, Hideoki Ogawa, Ko Okumura, Toshiro Takai. (2010) Staphylococcus aureus membrane and diacylated lipopeptide induce thymic stromal lymphopoietin in keratinocytes through the Toll-like receptor 2–Toll-like receptor 6 pathway. Journal of Allergy and Clinical Immunology 126:5, 985-993.e3
CrossRef95
Heleen D de Koning, Diana Rodijk-Olthuis, Ivonne M J J van Vlijmen-Willems, Leo A B Joosten, Mihai G Netea, Joost Schalkwijk, Patrick L J M Zeeuwen. (2010) A Comprehensive Analysis of Pattern Recognition Receptors in Normal and Inflamed Human Epidermis: Upregulation of Dectin-1 in Psoriasis. Journal of Investigative Dermatology 130:11, 2611-2620
CrossRef96
Jocelyn M. Biagini Myers, Gurjit K. Khurana Hershey. (2010) Eczema in Early Life: Genetics, the Skin Barrier, and Lessons Learned from Birth Cohort Studies. The Journal of Pediatrics 157:5, 704-714
CrossRef97
S. Mrabet-Dahbi, M. Maurer. (2010) Does allergy impair innate immunity? Leads and lessons from atopic dermatitis. Allergy 65:11, 1351-1356
CrossRef98
F Eun-Hyung Lee, Steve N Georas, Lisa A Beck. (2010) IL-17: Important for Host Defense, Autoimmunity, and Allergy?. Journal of Investigative Dermatology 130:11, 2540-2542
CrossRef99
Yongxue Yao, Amal Kozman, Mohammed Al-Hassani, Chandan K Saha, Qiaofang Yi, Weiguo Yao, Nico Mousdicas, Mark H Kaplan, Jeffrey B Travers. (2010) Identification of Staphylococcal Protein A in Infected Atopic Dermatitis Lesions. Journal of Investigative Dermatology 130:10, 2502-2504
CrossRef100
Stefano Guglielmetti, John KG Dart, Virginia Calder. (2010) Atopic keratoconjunctivitis and atopic dermatitis. Current Opinion in Allergy and Clinical Immunology 10:5, 478-485
CrossRef101
Thomas S. McCormick, Aaron Weinberg. (2010) Epithelial cell-derived antimicrobial peptides are multifunctional agents that bridge innate and adaptive immunity. Periodontology 2000 54:1, 195-206
CrossRef102
Qiurong Li, Qiang Zhang, Chenyang Wang, Chun Tang, Yanmei Zhang, Shaojun Jiang, Ning Li, Jieshou Li. (2010) Influence of alemtuzumab on the intestinal Paneth cells and microflora in macaques. Clinical Immunology 136:3, 375-386
CrossRef103
T.R. Hata, P. Kotol, M. Boguniewicz, P. Taylor, A. Paik, M. Jackson, M. Nguyen, F. Kabigting, J. Miller, M. Gerber, D. Zaccaro, B. Armstrong, R. Dorschner, D.Y.M. Leung, R.L. Gallo. (2010) History of eczema herpeticum is associated with the inability to induce human β-defensin (HBD)-2, HBD-3 and cathelicidin in the skin of patients with atopic dermatitis. British Journal of Dermatology 163:3, 659-661
CrossRef104
Ján Krahulec, Marcela Hyršová, Stanislav Pepeliaev, Jana Jílková, Zbyněk Černý, Jana Machálková. (2010) High level expression and purification of antimicrobial human cathelicidin LL-37 in Escherichia coli. Applied Microbiology and Biotechnology 88:1, 167-175
CrossRef105
T. McPherson, V.J. Sherman, A. Aslam, L. Crack, H. Chan, A. Lloyd-Lavery, L. Jones, M. Ardern-Jones, G. Ogg. (2010) Filaggrin null mutations associate with increased frequencies of allergen-specific CD4+ T-helper 2 cells in patients with atopic eczema. British Journal of Dermatology 163:3, 544-549
CrossRef106
Patricia Méndez-Samperio. (2010) The human cathelicidin hCAP18/LL-37: A multifunctional peptide involved in mycobacterial infections. Peptides 31:9, 1791-1798
CrossRef107
Jonathan M. Spergel. (2010) Epidemiology of Atopic Dermatitis and Atopic March in Children. Immunology and Allergy Clinics of North America 30:3, 269-280
CrossRef108
Daniel A. Searing, Donald Y.M. Leung. (2010) Vitamin D in Atopic Dermatitis, Asthma and Allergic Diseases. Immunology and Allergy Clinics of North America 30:3, 397-409
CrossRef109
Rafeul Alam. (2010) Foreword. Immunology and Allergy Clinics of North America 30:3, xiii-xiv
CrossRef110
Andreas Wollenberg, Christina Schnopp. (2010) Evolution of Conventional Therapy in Atopic Dermatitis. Immunology and Allergy Clinics of North America 30:3, 351-368
CrossRef111
Peck Y Ong. (2010) Human β Defensin-2: Too Good to Be Dismissed in Atopic Dermatitis. Journal of Investigative Dermatology 130:8, 2138-2139
CrossRef112
Peck Y. Ong, Donald Y.M. Leung. (2010) The Infectious Aspects of Atopic Dermatitis. Immunology and Allergy Clinics of North America 30:3, 309-321
CrossRef113
Priyanka Pundir, Marianna Kulka. (2010) The role of G protein-coupled receptors in mast cell activation by antimicrobial peptides: is there a connection?. Immunology and Cell Biology 88:6, 632-640
CrossRef114
Peck Y. Ong, Mark Boguniewicz. (2010) Investigational and Unproven Therapies in Atopic Dermatitis. Immunology and Allergy Clinics of North America 30:3, 425-439
CrossRef115
Yvonne Dombrowski, Mark Peric, Sarah Koglin, Thomas Ruzicka, Jürgen Schauber. (2010) Control of cutaneous antimicrobial peptides by vitamin D3. Archives of Dermatological Research 302:6, 401-408
CrossRef116
K. Vähävihu, M. Ala-Houhala, M. Peric, P. Karisola, H. Kautiainen, T. Hasan, E. Snellman, H. Alenius, J. Schauber, T. Reunala. (2010) Narrowband ultraviolet B treatment improves vitamin D balance and alters antimicrobial peptide expression in skin lesions of psoriasis and atopic dermatitis. British Journal of Dermatology 163:2, 321-328
CrossRef117
Jawoong Goo, Jae Hong Ji, Hyerin Jeon, Min Jung Kim, Soo-Young Jeon, Mee-Yon Cho, Seung Hun Lee, Eung Ho Choi. (2010) Expression of Antimicrobial Peptides Such as LL-37 and hBD-2 in Nonlesional Skin of Atopic Individuals. Pediatric Dermatology 27:4, 341-348
CrossRef118
Kam Lun Ellis Hon, Ting Fan Leung. (2010) Seromarkers in childhood atopic dermatitis. Expert Review of Dermatology 5:3, 299-314
CrossRef119
Chao-Kai Hsu, Masashi Akiyama, Hiroshi Shimizu. (2010) Update on filaggrin mutations and atopic dermatitis. Expert Review of Dermatology 5:3, 315-323
CrossRef120
John S. Cho, Eric M. Pietras, Nairy C. Garcia, Romela Irene Ramos, David M. Farzam, Holly R. Monroe, Julie E. Magorien, Andrew Blauvelt, Jay K. Kolls, Ambrose L. Cheung, Genhong Cheng, Robert L. Modlin, Lloyd S. Miller. (2010) IL-17 is essential for host defense against cutaneous Staphylococcus aureus infection in mice. Journal of Clinical Investigation 120:5, 1762-1773
CrossRef121
Min Kyung Jung, Dae Young Hur, Seok Bean Song, Yoorim Park, Tae Sung Kim, Sa Ik Bang, Seonghan Kim, Hyun Keun Song, Hyunjeong Park, Dae Ho Cho. (2010) Tannic Acid and Quercetin Display a Therapeutic Effect in Atopic Dermatitis via Suppression of Angiogenesis and TARC Expression in Nc/Nga Mice. Journal of Investigative Dermatology 130:5, 1459-1463
CrossRef122
Gudmundur Hrafn Gudmundsson, Peter Bergman, Jan Andersson, Rubhana Raqib, Birgitta Agerberth. (2010) Battle and balance at mucosal surfaces – The story of Shigella and antimicrobial peptides. Biochemical and Biophysical Research Communications 396:1, 116-119
CrossRef123
Sandrine Dubrac, Matthias Schmuth, Susanne Ebner. (2010) Atopic dermatitis: the role of Langerhans cells in disease pathogenesis. Immunology and Cell Biology 88:4, 400-409
CrossRef124
Shin Morizane, Kenshi Yamasaki, Filamer D Kabigting, Richard L Gallo. (2010) Kallikrein Expression and Cathelicidin Processing Are Independently Controlled in Keratinocytes by Calcium, Vitamin D3, and Retinoic Acid. Journal of Investigative Dermatology 130:5, 1297-1306
CrossRef125
Jürgen Harder, Stefanie Dressel, Maike Wittersheim, Jesko Cordes, Ulf Meyer-Hoffert, Ulrich Mrowietz, Regina Fölster-Holst, Ehrhard Proksch, Jens-Michael Schröder, Thomas Schwarz, Regine Gläser. (2010) Enhanced Expression and Secretion of Antimicrobial Peptides in Atopic Dermatitis and after Superficial Skin Injury. Journal of Investigative Dermatology 130:5, 1355-1364
CrossRef126
Lotus Mallbris, Lina Carlén, Tianling Wei, Johan Heilborn, Margareta Frohm Nilsson, Fredrik Granath, Mona Ståhle. (2010) Injury downregulates the expression of the human cathelicidin protein hCAP18/LL-37 in atopic dermatitis. Experimental Dermatology 19:5, 442-449
CrossRef127
Zekuan Lu, Yipeng Wang, Lei Zhai, Qiaolin Che, Hui Wang, Shuyuan Du, Duo Wang, Feifei Feng, Jingze Liu, Ren Lai, Haining Yu. (2010) Novel cathelicidin-derived antimicrobial peptides from Equus asinus. FEBS Journal 277:10, 2329-2339
CrossRef128
Jens-Michael Schröder. (2010) The role of keratinocytes in defense against infection. Current Opinion in Infectious Diseases 23:2, 106-110
CrossRef129
Johan D. Heilborn, Günther Weber, Alvar Grönberg, Christine Dieterich, Mona Ståhle. (2010) Topical treatment with the vitamin D analogue calcipotriol enhances the upregulation of the antimicrobial protein hCAP18/LL-37 during wounding in human skin in vivo. Experimental Dermatology 19:4, 332-338
CrossRef130
Michael Otto. (2010) Staphylococcus colonization of the skin and antimicrobial peptides. Expert Review of Dermatology 5:2, 183-195
CrossRef131
Eduardo Guaní-Guerra, Teresa Santos-Mendoza, Saúl O. Lugo-Reyes, Luis M. Terán. (2010) Antimicrobial peptides: General overview and clinical implications in human health and disease. Clinical Immunology 135:1, 1-11
CrossRef132
Maili Lehto, Terhi Savinko, Henrik Wolff, Peter H Kvist, Kaare Kemp, Antti Lauerma, Harri Alenius. (2010) A murine model of epicutaneous protein sensitization is useful to study efficacies of topical drugs in atopic dermatitis. International Immunopharmacology 10:4, 377-384
CrossRef133
Marc Torrent, Marina Badia, Mohammed Moussaoui, Daniel Sanchez, M. Victòria Nogués, Ester Boix. (2010) Comparison of human RNase 3 and RNase 7 bactericidal action at the Gram-negative and Gram-positive bacterial cell wall. FEBS Journal 277:7, 1713-1725
CrossRef134
P. S. Friedmann, M. R. Ardern-Jones, C. A. Holden. 2010. Atopic Dermatitis. , 1-34.
CrossRef135
M. Steinhoff, R. W. Groves, P. E. LeBoit, T. A. Luger. 2010. Inflammation. , 1-76.
CrossRef136
C. B. Archer. 2010. Functions of the Skin. , 1-11.
CrossRef137
C. E. M. Griffiths, J. N. W. N. Barker. 2010. Psoriasis. , 1-60.
CrossRef138
Robert I. Lehrer, Tomas Ganz. 2010. Antimicrobial Peptides: Defensins and Cathelicidins. .
CrossRef139
Kristine E. Nograles, Mayte Suárez-Fariñas, Avner Shemer, Judilyn Fuentes-Duculan, Andrea Chiricozzi, Irma Cardinale, Lisa C. Zaba, Toyoko Kikuchi, Michal Ramon, Reuven Bergman, James G. Krueger, Emma Guttman-Yassky. (2010) Atopic dermatitis keratinocytes exhibit normal TH17 cytokine responses. Journal of Allergy and Clinical Immunology 125:3, 744-746.e2
CrossRef140
M. Kamsteeg, P.A.M. Jansen, I.M.J.J. van Vlijmen-Willems, P.E.J. van Erp, D. Rodijk-Olthuis, P.G. van der Valk, T. Feuth, P.L.J.M. Zeeuwen, J. Schalkwijk. (2010) Molecular diagnostics of psoriasis, atopic dermatitis, allergic contact dermatitis and irritant contact dermatitis. British Journal of Dermatology 162:3, 568-578
CrossRef141
Dorothea Terhorst, Behnam Naderi Kalali, Markus Ollert, Johannes Ring, Martin Mempel. (2010) The Role of Toll-Like Receptors in Host Defenses and Their Relevance to Dermatologic Diseases. American Journal of Clinical Dermatology 11:1, 1-10
CrossRef142
Peter M. Elias. (2010) Therapeutic Implications of a Barrier-based Pathogenesis of Atopic Dermatitis. Annals of Dermatology 22:3, 245
CrossRef143
David Farhi, Alain Taïeb, Gérard Tilles, Daniel Wallach. (2010) The historical basis of a misconception leading to undertreating atopic dermatitis (eczema):facts and controversies. Clinics in Dermatology 28:1, 45-51
CrossRef144
S. Thomas, S. Karnik, R. S. Barai, V. K. Jayaraman, S. Idicula-Thomas. (2010) CAMP: a useful resource for research on antimicrobial peptides. Nucleic Acids Research 38:Database, D774-D780
CrossRef145
Mark Boguniewicz, Donald Y.M. Leung. (2010) Recent insights into atopic dermatitis and implications for management of infectious complications. Journal of Allergy and Clinical Immunology 125:1, 4-13
CrossRef146
Thomas Bieber. (2010) Atopic Dermatitis. Annals of Dermatology 22:2, 125
CrossRef147
Dmitry N. Grigoryev, Michael D. Howell, Tonya N. Watkins, Yu-Chi Chen, Chris Cheadle, Mark Boguniewicz, Kathleen C. Barnes, Donald Y.M. Leung. (2010) Vaccinia virus–specific molecular signature in atopic dermatitis skin. Journal of Allergy and Clinical Immunology 125:1, 153-159.e28
CrossRef148
Kui Young Park, Dong Ha Kim, Mi Sook Jeong, Kapsok Li, Seong Jun Seo. (2010) Changes of Antimicrobial Peptides and Transepidermal Water Loss After Topical Application of Tacrolimus and Ceramide-dominant Emollient in Patients with Atopic Dermatitis. Journal of Korean Medical Science 25:5, 766
CrossRef149
Jeffrey B. Travers, Amal Kozman, Nico Mousdicas, Chandan Saha, Megan Landis, Mohammed Al-Hassani, Weiguo Yao, Yongxue Yao, Ann-Marie Hyatt, Michael P. Sheehan, Anita N. Haggstrom, Mark H. Kaplan. (2010) Infected atopic dermatitis lesions contain pharmacologic amounts of lipoteichoic acid. Journal of Allergy and Clinical Immunology 125:1, 146-152.e2
CrossRef150
Aswin Hari, Tracy L. Flach, Yan Shi, P. Régine Mydlarski. (2010) Toll-Like Receptors: Role in Dermatological Disease. Mediators of Inflammation 2010, 1-16
CrossRef151
Rudolf A. Rupec, Susanne Boneberger, Thomas Ruzicka. (2010) What is really in control of skin immunity: lymphocytes, dendritic cells, or keratinocytes? facts and controversies. Clinics in Dermatology 28:1, 62-66
CrossRef152
Li-Hua Lo, Pei-Chang Wu, Yi-Chen Wu, Jentaie Shiea. (2010) Characterization of human neutrophil peptides (α-Defensins) in the tears of dry eye patients. Analytical Methods 2:12, 1934
CrossRef153
Yutaka Hatano, Mao-Qiang Man, Yoshikazu Uchida, Debra Crumrine, Theodora M. Mauro, Kenneth R. Feingold, Peter M. Elias, Walter M. Holleran. (2010) Murine atopic dermatitis responds to peroxisome proliferator-activated receptors α and β/δ (but not γ) and liver X receptor activators. Journal of Allergy and Clinical Immunology 125:1, 160-169.e5
CrossRef154
Sue Kyung Kim, Sun Park, Eun-So Lee. (2010) Toll-like Receptors and Antimicrobial Peptides Expressions of Psoriasis: Correlation with Serum Vitamin D Level. Journal of Korean Medical Science 25:10, 1506
CrossRef155
Jeremiah Miller, Richard L. Gallo. (2010) Vitamin D and innate immunity. Dermatologic Therapy 23:1, 13-22
CrossRef156
Daniel D. Bikle. (2009) Vitamin D Regulation of Immune Function: Implications for Bone Loss During Inflammation. Clinical Reviews in Bone and Mineral Metabolism 7:4, 301-309
CrossRef157
Toshiaki Kawakami, Tomoaki Ando, Miho Kimura, Bridget S Wilson, Yuko Kawakami. (2009) Mast cells in atopic dermatitis. Current Opinion in Immunology 21:6, 666-678
CrossRef158
Adrian F Gombart. (2009) The vitamin D–antimicrobial peptide pathway and its role in protection against infection. Future Microbiology 4:9, 1151-1165
CrossRef159
T. Gambichler, M. Skrygan, C. Tigges, S. Kobus, R. Gläser, A. Kreuter. (2009) Significant upregulation of antimicrobial peptides and proteins in lichen sclerosus. British Journal of Dermatology 161:5, 1136-1142
CrossRef160
Michael D Howell, Joanne E Streib, Byung Eui Kim, Leighann J Lesley, Annegret P Dunlap, Dianliang Geng, Yanshu Feng, Paul B Savage, Donald Y M Leung. (2009) Ceragenins: A Class of Antiviral Compounds to Treat Orthopox Infections. Journal of Investigative Dermatology 129:11, 2668-2675
CrossRef161
Ming-Hui Yang, Li-Hua Lo, Yi-Hsuan Chen, Jentaie Shiea, Pei-Chang Wu, Yu-Chang Tyan, Yuh-Jyh Jong. (2009) Study of human neutrophil peptides in saliva by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Rapid Communications in Mass Spectrometry 23:19, 3220-3226
CrossRef162
Peter M Elias, Matthias Schmuth. (2009) Abnormal skin barrier in the etiopathogenesis of atopic dermatitis. Current Opinion in Allergy and Clinical Immunology 9:5, 437-446
CrossRef163
P. Haslund, N. Bangsgaard, J.O. Jarløv, L. Skov, R. Skov, T. Agner. (2009) Staphylococcus aureus and hand eczema severity. British Journal of Dermatology 161:4, 772-777
CrossRef164
Tiffany C Scharschmidt, Karin List, Elizabeth A Grice, Roman Szabo, Gabriel Renaud, Chyi-Chia R Lee, Tyra G Wolfsberg, Thomas H Bugge, Julia A Segre. (2009) Matriptase-Deficient Mice Exhibit Ichthyotic Skin with a Selective Shift in Skin Microbiota. Journal of Investigative Dermatology 129:10, 2435-2442
CrossRef165
Mikiko Tohyama, Yasushi Hanakawa, Yuji Shirakata, Xjuju Dai, Lujun Yang, Satoshi Hirakawa, Sho Tokumaru, Hidenori Okazaki, Koji Sayama, Koji Hashimoto. (2009) IL-17 and IL-22 mediate IL-20 subfamily cytokine production in cultured keratinocytes via increased IL-22 receptor expression. European Journal of Immunology 39:10, 2779-2788
CrossRef166
Claire M P Marchal, Benjamin J Luft, Xiaohua Yang, Jean Sibilia, Benoît Jaulhac, Nathalie M Boulanger. (2009) Defensin Is Suppressed by Tick Salivary Gland Extract During the In Vitro Interaction of Resident Skin Cells with Borrelia burgdorferi. Journal of Investigative Dermatology 129:10, 2515-2517
CrossRef167
Mamta Sharma, Louis D. Saravolatz. 2009. Severe Skin and Soft Tissue Infections inCritical Care. , 295-321.
CrossRef168
Ehrhardt Proksch, Regina Fölster-Holst, Matthias Bräutigam, Marjan Sepehrmanesh, Stephan Pfeiffer, Jens-Michael Jensen. (2009) Role of the epidermal barrier in atopic dermatitis. Journal der Deutschen Dermatologischen Gesellschaft 7:10, 899-910
CrossRef169
Mark Peric, Sarah Koglin, Yvonne Dombrowski, Kathrin Groß, Eva Bradac, Thomas Ruzicka, Jürgen Schauber. (2009) VDR and MEK-ERK dependent induction of the antimicrobial peptide cathelicidin in keratinocytes by lithocholic acid. Molecular Immunology 46:16, 3183-3187
CrossRef170
Erin G Harper, Changsheng Guo, Heather Rizzo, Joseph V Lillis, Stephen E Kurtz, Iliyana Skorcheva, David Purdy, Erin Fitch, Mihail Iordanov, Andrew Blauvelt. (2009) Th17 Cytokines Stimulate CCL20 Expression in Keratinocytes In Vitro and In Vivo: Implications for Psoriasis Pathogenesis. Journal of Investigative Dermatology 129:9, 2175-2183
CrossRef171
Tiffany C. Scharschmidt, Mao-Qiang Man, Yutaka Hatano, Debra Crumrine, Roshan Gunathilake, John P. Sundberg, Kathleen A. Silva, Theodora M. Mauro, Melanie Hupe, Soyun Cho, Yan Wu, Anna Celli, Matthias Schmuth, Kenneth R. Feingold, Peter M. Elias. (2009) Filaggrin deficiency confers a paracellular barrier abnormality that reduces inflammatory thresholds to irritants and haptens. Journal of Allergy and Clinical Immunology 124:3, 496-506.e6
CrossRef172
R. Gläser, U. Meyer-Hoffert, J. Harder. (2009) Antimikrobielle Peptide bei atopischer Dermatitis. Der Hautarzt 60:9, 761-762
CrossRef173
Michael Zasloff. (2009) Antimicrobial RNases of Human Skin. Journal of Investigative Dermatology 129:9, 2091-2093
CrossRef174
H. Dommisch, S. Vorderwülbecke, J. Eberhard, M. Steglich, S. Jepsen. (2009) SELDI–TOF-MS of gingival crevicular fluid—A methodological approach. Archives of Oral Biology 54:9, 803-809
CrossRef175
Thomas Werfel. (2009) The Role of Leukocytes, Keratinocytes, and Allergen-Specific IgE in the Development of Atopic Dermatitis. Journal of Investigative Dermatology 129:8, 1878-1891
CrossRef176
Peter M. Elias, Gopinathan Menon, Bruce K. Wetzel, John (Jack) W. Williams. (2009) Evidence that stress to the epidermal barrier influenced the development of pigmentation in humans. Pigment Cell & Melanoma Research 22:4, 420-434
CrossRef177
K. Wichmann, W. Uter, J. Weiss, K. Breuer, A. Heratizadeh, U. Mai, T. Werfel. (2009) Isolation of α-toxin-producing Staphylococcus aureus from the skin of highly sensitized adult patients with severe atopic dermatitis. British Journal of Dermatology 161:2, 300-305
CrossRef178
Catharina M.M. van Damme, Ton Willemse, Albert van Dijk, Henk P. Haagsman, Edwin J.A. Veldhuizen. (2009) Altered cutaneous expression of β-defensins in dogs with atopic dermatitis. Molecular Immunology 46:13, 2449-2455
CrossRef179
Lianghua Bin, Michael D. Howell, Byung Eui Kim, Clifton F. Hall, Joanne E. Streib, Donald Y.M. Leung. (2009) Inhibition of S100A11 gene expression impairs keratinocyte response against vaccinia virus through downregulation of the IL-10 receptor 2 chain. Journal of Allergy and Clinical Immunology 124:2, 270-277.e1
CrossRef180
Verónica Ruíz-González, Juan C. Cancino-Diaz, Sandra Rodríguez-Martínez, Mario E. Cancino-Diaz. (2009) Keratinocytes treated with peptidoglycan from Staphylococcus aureus produce vascular endothelial growth factor, and its expression is amplified by the subsequent production of interleukin-13. International Journal of Dermatology 48:8, 846-854
CrossRef181
Lisa A. Beck, Mark Boguniewicz, Tissa Hata, Lynda C. Schneider, Jon Hanifin, Rich Gallo, Amy S. Paller, Susi Lieff, Jamie Reese, Daniel Zaccaro, Henry Milgrom, Kathleen C. Barnes, Donald Y.M. Leung. (2009) Phenotype of atopic dermatitis subjects with a history of eczema herpeticum. Journal of Allergy and Clinical Immunology 124:2, 260-269.e7
CrossRef182
Lisa V. Reiter, Sheila M. F. Torres, Philip W. Wertz. (2009) Characterization and quantification of ceramides in the nonlesional skin of canine patients with atopic dermatitis compared with controls. Veterinary Dermatology 20:4, 260-266
CrossRef183
ANNIKA NELSON, KJELL HULTENBY, ÉVA HELL, HILDE M. RIEDEL, HJALMAR BRISMAR, JAN-INGMAR FLOCK, JOACHIM LUNDAHL, CHRISTIAN G. GISKE, GIOVANNA MARCHINI. (2009) Staphylococcus epidermidis Isolated From Newborn Infants Express Pilus-Like Structures and Are Inhibited by the Cathelicidin-Derived Antimicrobial Peptide LL37. Pediatric Research 66:2, 174-178
CrossRef184
N. Ballardini, C. Johansson, G. Lilja, M. Lindh, Y. Linde, A. Scheynius, B. Agerberth. (2009) Enhanced expression of the antimicrobial peptide LL-37 in lesional skin of adults with atopic eczema. British Journal of Dermatology 161:1, 40-47
CrossRef185
Peter M. Elias, Matthias Schmuth. (2009) Abnormal skin barrier in the etiopathogenesis of atopic dermatitis. Current Allergy and Asthma Reports 9:4, 265-272
CrossRef186
Daniel D. Bikle. (2009) Vitamin D and immune function: Understanding common pathways. Current Osteoporosis Reports 7:2, 58-63
CrossRef187
Johann E Gudjonsson, Andrew Johnston. (2009) Current understanding of the genetic basis of psoriasis. Expert Review of Clinical Immunology 5:4, 433-443
CrossRef188
Curdin Conrad, Stephan Meller, Michel Gilliet. (2009) Plasmacytoid dendritic cells in the skin: To sense or not to sense nucleic acids. Seminars in Immunology 21:3, 101-109
CrossRef189
ALEXANDRA F. FREEMAN, STEVEN M. HOLLAND. (2009) Clinical Manifestations, Etiology, and Pathogenesis of the Hyper-IgE Syndromes. Pediatric Research 65:Supplement, 32R-37R
CrossRef190
Marlies Wakkee, Tamar Nijsten. (2009) Comorbidities in Dermatology. Dermatologic Clinics 27:2, 137-147
CrossRef191
Hyun Jeong Park, Dae Ho Cho, Hee Jung Kim, Jun Young Lee, Baik Kee Cho, Sa Ik Bang, Sang Yong Song, Kenshi Yamasaki, Anna Di Nardo, Richard L Gallo. (2009) Collagen Synthesis Is Suppressed in Dermal Fibroblasts by the Human Antimicrobial Peptide LL-37. Journal of Investigative Dermatology 129:4, 843-850
CrossRef192
Tao Zheng, Min H Oh, Sun Y Oh, John T Schroeder, Adam B Glick, Zhou Zhu. (2009) Transgenic Expression of Interleukin-13 in the Skin Induces a Pruritic Dermatitis and Skin Remodeling. Journal of Investigative Dermatology 129:3, 742-751
CrossRef193
Regine Gläser, Ulf Meyer-Hoffert, Jürgen Harder, Jesko Cordes, Maike Wittersheim, Julia Kobliakova, Regina Fölster-Holst, Ehrhardt Proksch, Jens-Michael Schröder, Thomas Schwarz. (2009) The Antimicrobial Protein Psoriasin (S100A7) Is Upregulated in Atopic Dermatitis and after Experimental Skin Barrier Disruption. Journal of Investigative Dermatology 129:3, 641-649
CrossRef194
Christina L Thomas-Virnig, John M Centanni, Colette E Johnston, Li-Ke He, Sandy J Schlosser, Kelly F Van Winkle, Ruibing Chen, Angela L Gibson, Andrea Szilagyi, Lingjun Li, Ravi Shankar, B Lynn Allen-Hoffmann. (2009) Inhibition of Multidrug-resistant Acinetobacter baumannii by Nonviral Expression of hCAP-18 in a Bioengineered Human Skin Tissue. Molecular Therapy 17:3, 562-569
CrossRef195
Massilva Rahmoun, Jean-Pierre Molès, Nathalie Pedretti, Marc Mathieu, Isabelle Fremaux, Nadia Raison-Peyron, Jean-Claude Lecron, Hans Yssel, Jérôme Pène. (2009) Cytokine-Induced CEACAM1 Expression on Keratinocytes Is Characteristic for Psoriatic Skin and Contributes to a Prolonged Lifespan of Neutrophils. Journal of Investigative Dermatology 129:3, 671-681
CrossRef196
Yuping Lai, Richard L. Gallo. (2009) AMPed up immunity: how antimicrobial peptides have multiple roles in immune defense. Trends in Immunology 30:3, 131-141
CrossRef197
N. Novak. (2009) New insights into the mechanism and management of allergic diseases: atopic dermatitis. Allergy 64:2, 265-275
CrossRef198
F. Niyonsaba, A. Suzuki, H. Ushio, I. Nagaoka, H. Ogawa, K. Okumura. (2009) The human antimicrobial peptide dermcidin activates normal human keratinocytes. British Journal of Dermatology 160:2, 243-249
CrossRef199
Kilian Eyerich, Davide Pennino, Claudia Scarponi, Stefanie Foerster, Francesca Nasorri, Heidrun Behrendt, Johannes Ring, Claudia Traidl-Hoffmann, Cristina Albanesi, Andrea Cavani. (2009) IL-17 in atopic eczema: Linking allergen-specific adaptive and microbial-triggered innate immune response. Journal of Allergy and Clinical Immunology 123:1, 59-66.e4
CrossRef200
Kazumoto KATAGIRI. (2009) Nishi Nihon Hifuka 71:4, 383-387
CrossRef201
Beom Joon Kim, Yong Kwan Rho, Hye In Lee, Mi Sook Jeong, Kapsok Li, Seong Jun Seo, Myeung Nam Kim, Chang Kwun Hong. (2009) The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes. Clinical and Developmental Immunology 2009, 1-8
CrossRef202
Anastasia Nijnik, Robert EW Hancock. (2009) The roles of cathelicidin LL-37 in immune defences and novel clinical applications. Current Opinion in Hematology 16:1, 41-47
CrossRef203
Ki Hyung Kim, Jae-Gu Cho, Jae-Jun Song, Jeong-Soo Woo, Heung-Man Lee, Hak Hyun Jung, Soon-Jae Hwang, Sungwon Chae. (2009) Psoriasin (S100A7), an antimicrobial peptide, is increased in human middle ear cholesteatoma. Acta Oto-laryngologica 129:10, 1067-1071
CrossRef204
Anna De Benedetto, Ritesh Agnihothri, Laura Y McGirt, Lora G Bankova, Lisa A Beck. (2009) Atopic Dermatitis: A Disease Caused by Innate Immune Defects?. Journal of Investigative Dermatology 129:1, 14-30
CrossRef205
Qun Wu, Hong Wei Chu. (2009) Role of infections in the induction and development of asthma: genetic and inflammatory drivers. Expert Review of Clinical Immunology 5:1, 97-109
CrossRef206
Neeloffer Mookherjee, Pamela Hamill, Jennifer Gardy, Darren Blimkie, Reza Falsafi, Avinash Chikatamarla, David J. Arenillas, Silvana Doria, Tobias R. Kollmann, Robert E. W. Hancock. (2009) Systems biology evaluation of immune responses induced by human host defence peptide LL-37 in mononuclear cells. Molecular BioSystems 5:5, 483
CrossRef207
Mayumi Komine. (2009) Analysis of the Mechanism for the Development of Allergic Skin Inflammation and the Application for Its Treatment: Keratinocytes in Atopic Dermatitis — Their Pathogenic Involvement. Journal of Pharmacological Sciences 110:3, 260-264
CrossRef208
Joseph Lam, Sheila F Friedlander. (2008) Atopic dermatitis: a review of recent advances in the field. Pediatric Health 2:6, 733-747
CrossRef209
Thomas Kruse, Hans-Henrik Kristensen. (2008) Using antimicrobial host defense peptides as anti-infective and immunomodulatory agents. Expert Review of Anti-infective Therapy 6:6, 887-895
CrossRef210
Delphine J Lee, Robert L Modlin. (2008) DNA transportation authority. Nature Medicine 14:12, 1319-1320
CrossRef211
Michelle L Paulson, Alexandra F Freeman, Steven M Holland. (2008) Hyper IgE syndrome: an update on clinical aspects and the role of signal transducer and activator of transcription 3. Current Opinion in Allergy and Clinical Immunology 8:6, 527-533
CrossRef212
A. Gueniche, B. Knaudt, E. Schuck, T. Volz, P. Bastien, R. Martin, M. Röcken, L. Breton, T. Biedermann. (2008) Effects of nonpathogenic gram-negative bacterium Vitreoscilla filiformis lysate on atopic dermatitis: a prospective, randomized, double-blind, placebo-controlled clinical study. British Journal of Dermatology 159:6, 1357-1363
CrossRef213
Thomas Jung, Georg Stingl. (2008) Atopic dermatitis: Therapeutic concepts evolving from new pathophysiologic insights. Journal of Allergy and Clinical Immunology 122:6, 1074-1081
CrossRef214
Seung P Hong, Min J Kim, Min-young Jung, Hyerin Jeon, Jawoong Goo, Sung K Ahn, Seung H Lee, Peter M Elias, Eung H Choi. (2008) Biopositive Effects of Low-Dose UVB on Epidermis: Coordinate Upregulation of Antimicrobial Peptides and Permeability Barrier Reinforcement. Journal of Investigative Dermatology 128:12, 2880-2887
CrossRef215
Un-Bock Jo, Gil-Nam Jeong. (2008) Lectin Histochemistry on the Effects of Smoking on Glycoconjugates of Rat Sebaceous Glands. Journal of Life Science 18:11, 1543-1550
CrossRef216
Jay K. Kolls, Paul B. McCray, Yvonne R. Chan. (2008) Cytokine-mediated regulation of antimicrobial proteins. Nature Reviews Immunology 8:11, 829-835
CrossRef217
Andrew H. Liu. (2008) Innate microbial sensors and their relevance to allergy. Journal of Allergy and Clinical Immunology 122:5, 846-858
CrossRef218
Amanda S Büchau, Jürgen Schauber, Thomas Hultsch, Anton Stuetz, Richard L Gallo. (2008) Pimecrolimus Enhances TLR2/6-Induced Expression of Antimicrobial Peptides in Keratinocytes. Journal of Investigative Dermatology 128:11, 2646-2654
CrossRef219
Lloyd S. Miller. (2008) Toll-Like Receptors in Skin. Advances in Dermatology 24, 71-87
CrossRef220
Margarete Niebuhr, Uwe Mai, Alexander Kapp, Thomas Werfel. (2008) Antibiotic treatment of cutaneous infections with Staphylococcus aureus in patients with atopic dermatitis: current antimicrobial resistances and susceptibilities. Experimental Dermatology 17:11, 953-957
CrossRef221
Tissa R. Hata, Paul Kotol, Michelle Jackson, Meggie Nguyen, Aimee Paik, Don Udall, Kimi Kanada, Kenshi Yamasaki, Doru Alexandrescu, Richard L. Gallo. (2008) Administration of oral vitamin D induces cathelicidin production in atopic individuals. Journal of Allergy and Clinical Immunology 122:4, 829-831
CrossRef222
J. Schmitt, A. Bauer, M. Meurer. (2008) Atopisches Ekzem im Erwachsenenalter. Der Hautarzt 59:10, 841-852
CrossRef223
MLA Schuttelaar, PJ Coenraads. (2008) A randomized, double-blind study to assess the efficacy of addition of tetracycline to triamcinolone acetonide in the treatment of moderate to severe atopic dermatitis. Journal of the European Academy of Dermatology and Venereology 22:9, 1076-1082
CrossRef224
Liza Suh, Susan Coffin, Kateri Heydon Leckerman, Joel M. Gelfand, Paul J. Honig, Albert C. Yan. (2008) Methicillin-Resistant Staphylococcus aureus Colonization in Children with Atopic Dermaitis. Pediatric Dermatology 25:5, 528-534
CrossRef225
Michael D Howell, Heather R Fairchild, Byung Eui Kim, Lianghua Bin, Mark Boguniewicz, Jasmina S Redzic, Kirk C Hansen, Donald Y M Leung. (2008) Th2 Cytokines Act on S100/A11 to Downregulate Keratinocyte Differentiation. Journal of Investigative Dermatology 128:9, 2248-2258
CrossRef226
Geuranne Tjabringa, Mieke Bergers, Desiree van Rens, Roelie de Boer, Evert Lamme, Joost Schalkwijk. (2008) Development and Validation of Human Psoriatic Skin Equivalents. The American Journal of Pathology 173:3, 815-823
CrossRef227
Fabienne Ranc, Mark Boguniewicz, Susanne Lau. (2008) New visions for atopic eczema: An iPAC summary and future trends. Pediatric Allergy and Immunology 19, 17-25
CrossRef228
Jrgen Schauber, Richard L. Gallo. (2008) The vitamin D pathway: a new target for control of the skins immune response?. Experimental Dermatology 17:8, 633-639
CrossRef229
Jürgen Schauber, Richard L. Gallo. (2008) Antimicrobial peptides and the skin immune defense system. Journal of Allergy and Clinical Immunology 122:2, 261-266
CrossRef230
Peter M Elias. (2008) Barrier-repair therapy for atopic dermatitis: corrective lipid biochemical therapy. Expert Review of Dermatology 3:4, 441-452
CrossRef231
Peck Y Ong. (2008) Atopic dermatitis phenotypes, filaggrin mutations and implications in barrier-repair therapy. Expert Review of Dermatology 3:4, 425-427
CrossRef232
Dong-Youn Lee, Kenshi Yamasaki, Jennifer Rudsil, Christos C Zouboulis, Geon Tae Park, Jun-Mo Yang, Richard L Gallo. (2008) Sebocytes Express Functional Cathelicidin Antimicrobial Peptides and Can Act to Kill Propionibacterium Acnes. Journal of Investigative Dermatology 128:7, 1863-1866
CrossRef233
S. Asano, Y. Ichikawa, T. Kumagai, M. Kawashima, G. Imokawa. (2008) Microanalysis of an antimicrobial peptide, β-defensin-2, in the stratum corneum from patients with atopic dermatitis. British Journal of Dermatology 159:1, 97-104
CrossRef234
Sarika Namjoshi, Rima Caccetta, Heather A.E. Benson. (2008) Skin peptides: Biological activity and therapeutic opportunities. Journal of Pharmaceutical Sciences 97:7, 2524-2542
CrossRef235
Peter M. Elias. (2008) Skin barrier function. Current Allergy and Asthma Reports 8:4, 299-305
CrossRef236
Albert van Dijk, Edwin J.A. Veldhuizen, Henk P. Haagsman. (2008) Avian defensins. Veterinary Immunology and Immunopathology 124:1-2, 1-18
CrossRef237
Yan Zheng, François Niyonsaba, Hiroko Ushio, Shigaku Ikeda, Isao Nagaoka, Ko Okumura, Hideoki Ogawa. (2008) Microbicidal protein psoriasin is a multifunctional modulator of neutrophil activation. Immunology 124:3, 357-367
CrossRef238
M. Niebuhr, J. Langnickel, C. Draing, H. Renz, A. Kapp, T. Werfel. (2008) Dysregulation of toll-like receptor-2 (TLR-2)-induced effects in monocytes from patients with atopic dermatitis: impact of the TLR-2 R753Q polymorphism. Allergy 63:6, 728-734
CrossRef239
Katherine A Radek, Belen Lopez-Garcia, Melanie Hupe, Ingrid R Niesman, Peter M Elias, Laurent Taupenot, Sushil K Mahata, Daniel T O'Connor, Richard L Gallo. (2008) The Neuroendocrine Peptide Catestatin Is a Cutaneous Antimicrobial and Induced in the Skin after Injury. Journal of Investigative Dermatology 128:6, 1525-1534
CrossRef240
Valencia P. Walker, Henry T. Akinbi, Jareen Meinzen-Derr, Vivek Narendran, Marty Visscher, Steven B. Hoath. (2008) Host Defense Proteins on the Surface of Neonatal Skin: Implications for Innate Immunity. The Journal of Pediatrics 152:6, 777-781
CrossRef241
Richard L. Gallo, Victor Nizet. (2008) Innate barriers against skin infection and associated disorders. Drug Discovery Today: Disease Mechanisms 5:2, e145-e152
CrossRef242
Peter M. Elias, Yutaka Hatano, Mary L. Williams. (2008) Basis for the barrier abnormality in atopic dermatitis: Outside-inside-outside pathogenic mechanisms. Journal of Allergy and Clinical Immunology 121:6, 1337-1343
CrossRef243
Azza Eissa, Eleftherios P. Diamandis. (2008) Human tissue kallikreins as promiscuous modulators of homeostatic skin barrier functions. Biological Chemistry 389:6, 669-680
CrossRef244
A KRAKOWSKI, M DOHIL. (2008) Topical Therapy in Pediatric Atopic Dermatitis. Seminars in Cutaneous Medicine and Surgery 27:2, 161-167
CrossRef245
M BOGUNIEWICZ, N NICOL, K KELSAY, D LEUNG. (2008) A Multidisciplinary Approach to Evaluation and Treatment of Atopic Dermatitis. Seminars in Cutaneous Medicine and Surgery 27:2, 115-127
CrossRef246
T HATA, R GALLO. (2008) Antimicrobial Peptides, Skin Infections, and Atopic Dermatitis. Seminars in Cutaneous Medicine and Surgery 27:2, 144-150
CrossRef247
Thomas A Luger, Martin Steinhoff, Anita Remitz, Sakari Reitamo. 2008. Topical calcineurin inhibitors. , 221-236.
CrossRef248
Salima Mrabet-Dahbi, Harald Renz. 2008. Role of inhalant allergens in atopic dermatitis. , 101-116.
CrossRef249
Sandra Rodríguez-Martínez, Juan Carlos Cancino-Diaz, Luis Martin Vargas-Zuñiga, Mario Eugenio Cancino-Diaz. (2008) LL-37 regulates the overexpression of vascular endothelial growth factor (VEGF) and c-IAP-2 in human keratinocytes. International Journal of Dermatology 47:5, 457-462
CrossRef250
A. D. Leung, A. M. Schiltz, C. F. Hall, A. H. Liu. (2008) Severe atopic dermatitis is associated with a high burden of environmental Staphylococcus aureus. Clinical & Experimental Allergy 38:5, 789-793
CrossRef251
Ali Salmassi, Yahya Acil, Andreas Gerd Schmutzler, Kerstin Koch, Walter Jonat, Liselotte Mettler. (2008) Differential interleukin-6 messenger ribonucleic acid expression and its distribution pattern in eutopic and ectopic endometrium. Fertility and Sterility 89:5, 1578-1584
CrossRef252
Andreas Wollenberg, Stefanie Kamann. 2008. Role of viruses. , 69-76.
CrossRef253
Donald YM Leung. 2008. Staphylococcus aureus in atopic dermatitis. , 59-68.
CrossRef254
Bieber, Thomas, . (2008) Atopic Dermatitis. New England Journal of Medicine 358:14, 1483-1494
Full Text255
Karin M Aberg, Mao-Qiang Man, Richard L Gallo, Tomas Ganz, Debra Crumrine, Barbara E Brown, Eung-Ho Choi, Dong-Kun Kim, Jens M Schröder, Kenneth R Feingold, Peter M Elias. (2008) Co-Regulation and Interdependence of the Mammalian Epidermal Permeability and Antimicrobial Barriers. Journal of Investigative Dermatology 128:4, 917-925
CrossRef256
Salima Mrabet-Dahbi, Alexander H. Dalpke, Margarete Niebuhr, Markus Frey, Christian Draing, Stephanie Brand, Klaus Heeg, Thomas Werfel, Harald Renz. (2008) The Toll-like receptor 2 R753Q mutation modifies cytokine production and Toll-like receptor expression in atopic dermatitis. Journal of Allergy and Clinical Immunology 121:4, 1013-1019
CrossRef257
Marie Mandron, Marie-Françoise Ariès, Franck Boralevi, Hélène Martin, Marie Charveron, Alain Taieb, Christian Davrinche. (2008) Age-Related Differences in Sensitivity of Peripheral Blood Monocytes to Lipopolysaccharide and Staphylococcus Aureus Toxin B in Atopic Dermatitis. Journal of Investigative Dermatology 128:4, 882-889
CrossRef258
Jürgen Schauber, Yuko Oda, Amanda S Büchau, Qian-Chun Yun, Andreas Steinmeyer, Ulrich Zügel, Daniel D Bikle, Richard L Gallo. (2008) Histone Acetylation in Keratinocytes Enables Control of the Expression of Cathelicidin and CD14 by 1,25-Dihydroxyvitamin D3. Journal of Investigative Dermatology 128:4, 816-824
CrossRef259
L. G. Miller, B. A. Diep. (2008) Colonization, Fomites, and Virulence: Rethinking the Pathogenesis of Community-Associated Methicillin-Resistant Staphylococcus aureus Infection. Clinical Infectious Diseases 46:5, 752-760
CrossRef260
Lindsey A. Brodell, Kenneth S. Rosenthal. (2008) Skin Structure and Function. Infectious Diseases in Clinical Practice 16:2, 113-117
CrossRef261
Peck Y. Ong, Mark Boguniewicz. (2008) Atopic Dermatitis. Primary Care: Clinics in Office Practice 35:1, 105-117
CrossRef262
Georgia Avgerinou, Andreas V. Goules, Panayiotis G. Stavropoulos, Andreas D. Katsambas. (2008) Atopic dermatitis: new immunologic aspects. International Journal of Dermatology 47:3, 219-224
CrossRef263
Aljoscha Kaus, Frank Jacobsen, Michael Sorkin, Andrea Rittig, Bruno Voss, Adrien Daigeler, Holger Sudhoff, Hans-Ulrich Steinau, Lars Steinstraesser. (2008) Host defence peptides in human burns. Burns 34:1, 32-40
CrossRef264
Jürgen Harder. (2008) Antimicrobial peptides: ancient molecules as modern therapeutics?. Expert Review of Dermatology 3:1, 1-5
CrossRef265
Dorothy M Supp, Alice N Neely. (2008) Cutaneous antimicrobial gene therapy: engineering human skin replacements to combat wound infection. Expert Review of Dermatology 3:1, 73-84
CrossRef266
Thilo Gambichler, Marina Skrygan, Nordwig S. Tomi, Nick Othlinghaus, Norbert H. Brockmeyer, Peter Altmeyer, Alexander Kreuter. (2008) Differential mRNA Expression of Antimicrobial Peptides and Proteins in Atopic Dermatitis as Compared to Psoriasis Vulgaris and Healthy Skin. International Archives of Allergy and Immunology 147:1, 17-24
CrossRef267
Mao-Qiang Man, Yutaka Hatano, Seung H Lee, Mona Man, Sandra Chang, Kenneth R Feingold, Donald Y M Leung, Walter Holleran, Yoshikazu Uchida, Peter M Elias. (2008) Characterization of a Hapten-Induced, Murine Model with Multiple Features of Atopic Dermatitis: Structural, Immunologic, and Biochemical Changes following Single Versus Multiple Oxazolone Challenges. Journal of Investigative Dermatology 128:1, 79-86
CrossRef268
Richard L Gallo. (2008) Sounding the Alarm: Multiple Functions of Host Defense Peptides. Journal of Investigative Dermatology 128:1, 5-6
CrossRef269
J. Schauber, T. Ruzicka, R.A. Rupec. (2008) Cathelicidin LL-37. Der Hautarzt 59:1, 72-74
CrossRef270
Jonathan M Spergel. (2008) Immunology and Treatment of Atopic Dermatitis. American Journal of Clinical Dermatology 9:4, 233-244
CrossRef271
Erin Fitch, Erin Harper, Iliyana Skorcheva, Stephen E. Kurtz, Andrew Blauvelt. (2007) Pathophysiology of psoriasis: Recent advances on IL-23 and Th17 cytokines. Current Rheumatology Reports 9:6, 461-467
CrossRef272
Liang-Shiou Ou, Jing-Long Huang. (2007) Cellular Aspects of Atopic Dermatitis. Clinical Reviews in Allergy & Immunology 33:3, 191-198
CrossRef273
Y. Zheng, F. Niyonsaba, H. Ushio, I. Nagaoka, S. Ikeda, K. Okumura, H. Ogawa. (2007) Cathelicidin LL-37 induces the generation of reactive oxygen species and release of human α-defensins from neutrophils. British Journal of Dermatology 157:6, 1124-1131
CrossRef274
Jordan E. Scott, Abdallah ElKhal, Eva-Jasmin Freyschmidt, Daniel H. MacArthur, Douglas McDonald, Michael D. Howell, Donald Y.M. Leung, Amale Laouar, N. Manjunath, Teresa Bianchi, Marianne Boes, Hans C. Oettgen, Raif S. Geha. (2007) Impaired immune response to vaccinia virus inoculated at the site of cutaneous allergic inflammation. Journal of Allergy and Clinical Immunology 120:6, 1382-1388
CrossRef275
Yu-Tsan Lin, Chen-Ti Wang, Bor-Luen Chiang. (2007) Role of Bacterial Pathogens in Atopic Dermatitis. Clinical Reviews in Allergy & Immunology 33:3, 167-177
CrossRef276
Jong Soon Kang, Jong-Kyung Youm, Se Kyoo Jeong, Byeong Deog Park, Won Kee Yoon, Mi Hwa Han, Hyunju Lee, Sang-Bae Han, Kiho Lee, Song-Kyu Park, Seung Hun Lee, Kyu-Hwan Yang, Eun-Yi Moon, Hwan Mook Kim. (2007) Topical application of a novel ceramide derivative, K6PC-9, inhibits dust mite extract-induced atopic dermatitis-like skin lesions in NC/Nga mice. International Immunopharmacology 7:13, 1589-1597
CrossRef277
Amanda S Büchau, Mohamed Hassan, Gabriela Kukova, Virginia Lewerenz, Sabine Kellermann, Jens U Würthner, Ronald Wolf, Markus Walz, Richard L Gallo, Thomas Ruzicka. (2007) S100A15, an Antimicrobial Protein of the Skin: Regulation by E. coli through Toll-Like Receptor 4. Journal of Investigative Dermatology 127:11, 2596-2604
CrossRef278
Amanda S. Büchau, Richard L. Gallo. (2007) Innate immunity and antimicrobial defense systems in psoriasis. Clinics in Dermatology 25:6, 616-624
CrossRef279
Lionel Fry, Barbara S. Baker. (2007) Triggering psoriasis: the role of infections and medications. Clinics in Dermatology 25:6, 606-615
CrossRef280
Roberto Lande, Josh Gregorio, Valeria Facchinetti, Bithi Chatterjee, Yi-Hong Wang, Bernhard Homey, Wei Cao, Yui-Hsi Wang, Bing Su, Frank O. Nestle, Tomasz Zal, Ira Mellman, Jens-Michael Schröder, Yong-Jun Liu, Michel Gilliet. (2007) Plasmacytoid dendritic cells sense self-DNA coupled with antimicrobial peptide. Nature 449:7162, 564-569
CrossRef281
Antonia K. Kienast, Hans W. Kreth, Peter H. Höger. (2007) Varicella vaccination in children with atopic eczema. JDDG 5:10, 875-880
CrossRef282
Michael D Howell. (2007) The role of human beta defensins and cathelicidins in atopic dermatitis. Current Opinion in Allergy and Clinical Immunology 7:5, 413-417
CrossRef283
Heidi Goodarzi, Janet Trowbridge, Richard L. Gallo. (2007) Innate Immunity: A Cutaneous Perspective. Clinical Reviews in Allergy & Immunology 33:1-2, 15-26
CrossRef284
Juliana A. Candido-Silva, Gabriela M. Zanarotti, Ana P. Gallina, Jorge C. de Almeida. (2007) Developmental regulation ofBhSGAMP-1, a gene encoding an antimicrobial peptide in the salivary glands ofBradysia hygida (Diptera, Sciaridae). genesis 45:10, 630-638
CrossRef285
Andreas Wollenberg, Elisabeth Klein. (2007) Current Aspects of Innate and Adaptive Immunity in Atopic Dermatitis. Clinical Reviews in Allergy & Immunology 33:1-2, 35-44
CrossRef286
Martin Mempel, Behnam Naderi Kalali, Markus Ollert, Johannes Ring. (2007) Toll-Like Receptors in Dermatology. Dermatologic Clinics 25:4, 531-540
CrossRef287
Nicole Baumgarth, Charles L. Bevins. (2007) Autoimmune disease: Skin deep but complex. Nature
CrossRef288
M. Teresa de la Morena. (2007) Specific Immune Globulin Therapy for Prevention of Nosocomial Staphylococcal Bloodstream Infection in Premature Infants: Not What We Hoped for!. The Journal of Pediatrics 151:3, 232-234
CrossRef289
Kenshi Yamasaki, Anna Di Nardo, Antonella Bardan, Masamoto Murakami, Takaaki Ohtake, Alvin Coda, Robert A Dorschner, Chrystelle Bonnart, Pascal Descargues, Alain Hovnanian, Vera B Morhenn, Richard L Gallo. (2007) Increased serine protease activity and cathelicidin promotes skin inflammation in rosacea. Nature Medicine 13:8, 975-980
CrossRef290
Christian Herr, Renat Shaykhiev, Robert Bals. (2007) The role of cathelicidin and defensins in pulmonary inflammatory diseases. Expert Opinion on Biological Therapy 7:9, 1449-1461
CrossRef291
Neeloffer Mookherjee, Linda M Rehaume, Robert EW Hancock. (2007) Cathelicidins and functional analogues as antisepsis molecules. Expert Opinion on Therapeutic Targets 11:8, 993-1004
CrossRef292
J. Michael Conlon, Nadia Al-Ghaferi, Bency Abraham, Jérôme Leprince. (2007) Strategies for transformation of naturally-occurring amphibian antimicrobial peptides into therapeutically valuable anti-infective agents. Methods 42:4, 349-357
CrossRef293
Charles L Bevins, Fu-Tong Liu. (2007) Rosacea: skin innate immunity gone awry?. Nature Medicine 13:8, 904-906
CrossRef294
Michael D. Howell, Byung Eui Kim, Peisong Gao, Audrey V. Grant, Mark Boguniewicz, Anna DeBenedetto, Lynda Schneider, Lisa A. Beck, Kathleen C. Barnes, Donald Y.M. Leung. (2007) Cytokine modulation of atopic dermatitis filaggrin skin expression. Journal of Allergy and Clinical Immunology 120:1, 150-155
CrossRef295
Victor Nizet. (2007) Understanding how leading bacterial pathogens subvert innate immunity to reveal novel therapeutic targets. Journal of Allergy and Clinical Immunology 120:1, 13-22
CrossRef296
Christopher EM Griffiths, Jonathan NWN Barker. (2007) Pathogenesis and clinical features of psoriasis. The Lancet 370:9583, 263-271
CrossRef297
Jens-M. Schröder, Regine Gläser, Jürgen Harder. (2007) Antimicrobial peptides: Effector molecules of the cutaneous defense system. International Congress Series 1302, 26-35
CrossRef298
Peck Y. Ong, Mark Boguniewicz. (2007) Atopic Dermatitis and Contact Dermatitis in the Emergency Department. Clinical Pediatric Emergency Medicine 8:2, 81-86
CrossRef299
Annelies S. Zinkernagel, Victor Nizet. (2007) Staphylococcus aureus: A Blemish on Skin Immunity. Cell Host & Microbe 1:3, 161-162
CrossRef300
Simon R. Clarke, Ramlan Mohamed, Li Bian, Alexander F. Routh, John F. Kokai-Kun, James J. Mond, Andrej Tarkowski, Simon J. Foster. (2007) The Staphylococcus aureus Surface Protein IsdA Mediates Resistance to Innate Defenses of Human Skin. Cell Host & Microbe 1:3, 199-212
CrossRef301
Katherine Radek, Richard Gallo. (2007) Antimicrobial peptides: natural effectors of the innate immune system. Seminars in Immunopathology 29:1, 27-43
CrossRef302
Lloyd S. Miller, Robert L. Modlin. (2007) Toll-like receptors in the skin. Seminars in Immunopathology 29:1, 15-26
CrossRef303
Moise L Levy, Jeffrey M Weinberg. (2007) Current issues in uncomplicated skin and skin structure infections. Expert Review of Dermatology 2:2, 153-165
CrossRef304
Mohamed Zaiou. (2007) Multifunctional antimicrobial peptides: therapeutic targets in several human diseases. Journal of Molecular Medicine 85:4, 317-329
CrossRef305
François Niyonsaba, Hiroko Ushio, Nobuhiro Nakano, William Ng, Koji Sayama, Koji Hashimoto, Isao Nagaoka, Ko Okumura, Hideoki Ogawa. (2007) Antimicrobial Peptides Human β-Defensins Stimulate Epidermal Keratinocyte Migration, Proliferation and Production of Proinflammatory Cytokines and Chemokines. Journal of Investigative Dermatology 127:3, 594-604
CrossRef306
Laura E. Tovar-Castillo, Juan C. Cancino-Díaz, Francisco García-Vázquez, Francisco G. Cancino-Gómez, Gladys León-Dorantes, Fernando Blancas-González, Luis Jiménez-Zamudio, Ethel García-Latorre, Mario E. Cancino-Díaz. (2007) Under-expression of VHL and over-expression of HDAC-1, HIF-1?, LL-37, and IAP-2 in affected skin biopsies of patients with psoriasis. International Journal of Dermatology 46:3, 239-246
CrossRef307
Xuejun Chen, François Niyonsaba, Hiroko Ushio, Mutsuko Hara, Hidenori Yokoi, Kenji Matsumoto, Hirohisa Saito, Isao Nagaoka, Shigaku Ikeda, Ko Okumura, Hideoki Ogawa. (2007) Antimicrobial peptides human β-defensin (hBD)-3 and hBD-4 activate mast cells and increase skin vascular permeability. European Journal of Immunology 37:2, 434-444
CrossRef308
Katja Langer, Kristine Breuer, Alexander Kapp, Thomas Werfel. (2007) Staphylococcus aureus-derived enterotoxins enhance house dust mite-induced patch test reactions in atopic dermatitis. Experimental Dermatology 16:2, 124-129
CrossRef309
Byung Eui Kim, Donald Y.M. Leung, Joanne E. Streib, Mark Boguniewicz, Qutayba A. Hamid, Michael D. Howell. (2007) Macrophage inflammatory protein 3α deficiency in atopic dermatitis skin and role in innate immune response to vaccinia virus. Journal of Allergy and Clinical Immunology 119:2, 457-463
CrossRef310
H. R. Ashbee. (2007) Update on the genus Malassezia. Medical Mycology 45:4, 287-303
CrossRef311
S. Kamann, T. Ruzicka. (2007) Outside-Inside oder Inside-Outside?. Der Hautarzt 58:1, 72-76
CrossRef312
Takeshi Yamamoto, Kenji Yodogawa, Satoshi Wakita, Michio Ogano, Miwa Tokita, Yasuo Miyagi, Naoki Sato, Takashi Nitta, Keiji Tanaka, Teruo Takano. (2007) Recurrent Prosthetic Valve Endocarditis Caused by Staphylococcus aureus Colonizing Skin Lesions in Severe Atopic Dermatitis. Internal Medicine 46:9, 571-573
CrossRef313
J. Wohlrab, G. Jost, D. Abeck. (2007) Antiseptic Efficacy of a Low-Dosed Topical Triclosan/Chlorhexidine Combination Therapy in Atopic Dermatitis. Skin Pharmacology and Physiology 20:2, 71-76
CrossRef314
Koji SAYAMA. (2007) Nishi Nihon Hifuka 69:1, 3-7
CrossRef315
Douglas A. Plager, Alexey A. Leontovich, Susan A. Henke, Mark D.P. Davis, Marian T. McEvoy, Gabriel F. Sciallis, Mark R. Pittelkow. (2007) Early cutaneous gene transcription changes in adult atopic dermatitis and potential clinical implications. Experimental Dermatology 16:1, 28-36
CrossRef316
Graham Jones. (2007) Susceptibility to asthma and eczema from mucosal and epidermal expression of distinctive genes. Current Allergy and Asthma Reports 7:1, 11-17
CrossRef317
Michael D. Howell, Mark Boguniewicz, Saveria Pastore, Natalija Novak, Thomas Bieber, Giampiero Girolomoni, Donald Y.M. Leung. (2006) Mechanism of HBD-3 deficiency in atopic dermatitis. Clinical Immunology 121:3, 332-338
CrossRef318
Norito KATOH, Hajime HOSOI, Tohru SUGIMOTO, Saburo KISHIMOTO. (2006) Features and prognoses of infantile patients with atopic dermatitis hospitalized for severe complications. The Journal of Dermatology 33:12, 827-832
CrossRef319
Barbara S. Baker, Anne Powles, Lionel Fry. (2006) Peptidoglycan: a major aetiological factor for psoriasis?. Trends in Immunology 27:12, 545-551
CrossRef320
T. Gambichler, M. Skrygan, N.S. Tomi, P. Altmeyer, A. Kreuter. (2006) Changes of antimicrobial peptide mRNA expression in atopic eczema following phototherapy. British Journal of Dermatology 155:6, 1275-1278
CrossRef321
R. Randall Wickett, Marty O. Visscher. (2006) Structure and function of the epidermal barrier. American Journal of Infection Control 34:10, S98-S110
CrossRef322
Barbra Fischer Casagrande, Sabine Flückiger, Maria T Linder, Catharina Johansson, Annika Scheynius, Reto Crameri, Peter Schmid-Grendelmeier. (2006) Sensitization to the Yeast Malassezia Sympodialis Is Specific for Extrinsic and Intrinsic Atopic Eczema. Journal of Investigative Dermatology 126:11, 2414-2421
CrossRef323
Peck Y. Ong, Donald M. Y. Leung. (2006) Immune dysregulation in atopic dermatitis. Current Allergy and Asthma Reports 6:5, 384-389
CrossRef324
Wolfram Hoetzenecker, Simone Meindl, Anton Stuetz, Georg Stingl, Adelheid Elbe-Bürger. (2006) Both Pimecrolimus and Corticosteroids Deplete Plasmacytoid Dendritic Cells in Patients with Atopic Dermatitis. Journal of Investigative Dermatology 126:9, 2141-2144
CrossRef325
Ehrhardt Proksch, Regina Fölster-Holst, Jens-Michael Jensen. (2006) Skin barrier function, epidermal proliferation and differentiation in eczema. Journal of Dermatological Science 43:3, 159-169
CrossRef326
C. A. Akdis, M. Akdis, T. Bieber, C. Bindslev-Jensen, M. Boguniewicz, P. Eigenmann, Q. Hamid, A. Kapp, D. Y. M. Leung, J. Lipozencic, T. A. Luger, A. Muraro, N. Novak, T. A. E. Platts-Mills, L. Rosenwasser, A. Scheynius, F. E. R. Simons, J. Spergel, K. Turjanmaa, U. Wahn, S. Weidinger, T. Werfel, T. Zuberbier, . (2006) Diagnosis and treatment of atopic dermatitis in children and adults: European Academy of Allergology and Clinical Immunology/American Academy of Allergy, Asthma and Immunology/PRACTALL Consensus Report. Allergy 61:8, 969-987
CrossRef327
C. Abels, E. Proksch. (2006) Therapie des atopischen Ekzems. Der Hautarzt 57:8, 711-725
CrossRef328
T. Hinz, A. Staudacher, T. Bieber. (2006) Neues in der Pathophysiologie der atopischen Dermatitis. Der Hautarzt 57:7, 567-575
CrossRef329
Xuejun Chen, François Niyonsaba, Hiroko Ushio, Isao Nagaoka, Shigaku Ikeda, Ko Okumura, Hideoki Ogawa. (2006) Human cathelicidin LL-37 increases vascular permeability in the skin via mast cell activation, and phosphorylates MAP kinases p38 and ERK in mast cells. Journal of Dermatological Science 43:1, 63-66
CrossRef330
H. C. Rerinck, S. Kamann, A. Wollenberg. (2006) Eczema herpeticatum. Der Hautarzt 57:7, 586-591
CrossRef331
Jurgen Schauber, Robert A. Dorschner, Kenshi Yamasaki, Brook Brouha, Richard L. Gallo. (2006) Control of the innate epithelial antimicrobial response is cell-type specific and dependent on relevant microenvironmental stimuli. Immunology 0:0, 060606080407003-???
CrossRef332
J??rgen Schauber, Daniel Rieger, Frank Weiler, Jan Wehkamp, Matthias Eck, Klaus Fellermann, Wolfgang Scheppach, Richard L. Gallo, Eduard F. Stange. (2006) Heterogeneous expression of human cathelicidin hCAP18/LL-37 in inflammatory bowel diseases. European Journal of Gastroenterology & Hepatology 18:6, 615-621
CrossRef333
Susan Nedorost, Amy L Gosnell. (2006) How do environmental agents affect inflammatory skin disease?. Expert Review of Dermatology 1:3, 439-450
CrossRef334
L. Bandholtz, G. Jacobsson Ekman, M. Vilhelmsson, E. Buentke, B. Agerberth, A. Scheynius, G. H. Gudmundsson. (2006) Antimicrobial Peptide LL-37 Internalized by Immature Human Dendritic Cells Alters their Phenotype. Scandinavian Journal of Immunology 63:6, 410-419
CrossRef335
Yasuyuki Sumikawa, Hideo Asada, Katsuaki Hoshino, Hiroaki Azukizawa, Ichiro Katayama, Shizuo Akira, Satoshi Itami. (2006) Induction of β-defensin 3 in keratinocytes stimulated by bacterial lipopeptides through toll-like receptor 2. Microbes and Infection 8:6, 1513-1521
CrossRef336
Saveria Pastore, Francesca Mascia, Valentina Mariani, Giampiero Girolomoni. (2006) Keratinocytes in skin inflammation. Expert Review of Dermatology 1:2, 279-291
CrossRef337
Barbara S. Baker. (2006) The role of microorganisms in atopic dermatitis. Clinical and Experimental Immunology 144:1, 1-9
CrossRef338
B. Agerberth, E. Buentke, P. Bergman, H. Eshaghi, S. Gabrielsson, G. H. Gudmundsson, A. Scheynius. (2006) Malassezia sympodialis differently affects the expression of LL-37 in dendritic cells from atopic eczema patients and healthy individuals. Allergy 61:4, 422-430
CrossRef339
Michael D. Howell, Richard L. Gallo, Mark Boguniewicz, James F. Jones, Cathy Wong, Joanne E. Streib, Donald Y.M. Leung. (2006) Cytokine Milieu of Atopic Dermatitis Skin Subverts the Innate Immune Response to Vaccinia Virus. Immunity 24:3, 341-348
CrossRef340
Thomas Hohwy, Kristian Otkjaer, Jens Madsen, Gritt Søerensen, Ole Nielsen, Christian Vestergaard, Torben Steiniche, Uffe Holmskov, Hans Lomholt. (2006) Surfactant protein D in atopic dermatitis and psoriasis. Experimental Dermatology 15:3, 168-174
CrossRef341
Robert Sidbury, Solmaz Poorsattar. (2006) Pediatric atopic dermatitis: should we treat it differently?. Dermatologic Therapy 19:2, 83-90
CrossRef342
Jodie M. Harrison, Ian A. Ramshaw. (2006) Cytokines, Skin, and Smallpox–A New Link to an Antimicrobial Peptide. Immunity 24:3, 245-247
CrossRef343
Ai Ikeda, Yoko Nakanishi, Tohru Sakimoto, Jun Shoji, Mitsuru Sawa, Norimichi Nemoto. (2006) Expression of β Defensins in Ocular Surface Tissue of Experimentally Developed Allergic Conjunctivitis Mouse Model. Japanese Journal of Ophthalmology 50:1, 1-6
CrossRef344
Kelly L Brown, Robert EW Hancock. (2006) Cationic host defense (antimicrobial) peptides. Current Opinion in Immunology 18:1, 24-30
CrossRef345
Seong Jun Seo, Ji-Young Ahn, Chang-Kwun Hong, Eun-Young Seo, Kyung-Chae Kye, Woong-Hee Lee, Sang-Keun Lee, Jong-Soon Lim, Myong-Joon Hahn, Lars Kjeldsen, Niels Borregaard, Chang Deok Kim, Jang-Kyu Park, Jeung-Hoon Lee. (2006) Expression of Neutrophil Gelatinase-Associated Lipocalin in Skin Epidermis. Journal of Investigative Dermatology 126:2, 510-512
CrossRef346
A. Taïeb (Bordeaux, France), A. Giannetti (Modena, Italy), K. Thestrup-Pedersen (Aarhus, Denmark), J. Ring (Munich, Germany), Alain Taïeb, Jon Hanifin, Kevin Cooper, Jan D. Bos, Genji Imokawa, Tim J. David, Johannes Ring, Carlo Gelmetti, Alexander Kapp, Masutaka Furue, Yves de Prost, Ulf Darsow, Thomas Werfel, David Atherton, Arnold P. Oranje. (2006) Proceedings of the 4th Georg Rajka International Symposium on Atopic Dermatitis, Arcachon, France, September 15-17, 2005. Journal of Allergy and Clinical Immunology 117:2, 378-390
CrossRef347
Bodo Melnik. (2006) Disturbances of antimicrobial lipids in atopic dermatitis. JDDG 4:2, 114-123
CrossRef348
Y. Hashimoto, I. Arai, N. Takano, M. Tanaka, S. Nakaike. (2006) Induction of scratching behaviour and dermatitis in various strains of mice cohabiting with NC/Nga mice with chronic dermatitis. British Journal of Dermatology 154:1, 28-33
CrossRef349
Eric L. Simpson, Jon M. Hanifin. (2006) Atopic Dermatitis. Medical Clinics of North America 90:1, 149-167
CrossRef350
Lars Steinstraesser, Andre Ring, Robert Bals, Hans-Ulrich Steinau, Stefan Langer. (2006) The Human Host Defense Peptide LL37/hCAP Accelerates Angiogenesis in PEGT/PBT Biopolymers. Annals of Plastic Surgery 56:1, 93-98
CrossRef351
Ji‐Sook Lee, In Sik Kim, Dong‐Hee Kim, Chi‐Young Yun. (2006) Cytokines regulate the expression of the thymus and activation‐regulated chemokine (TARC; CCL17) in human skin fibroblast cells. Integrative Biosciences 10:1, 15-20
CrossRef352
Kai Wehkamp, Lars Schwichtenberg, Jens-Michael M Schröder, Jürgen Harder. (2006) Pseudomonas Aeruginosa- and IL-1β-Mediated Induction of Human β-Defensin-2 in Keratinocytes Is Controlled by NF-κB and AP-1. Journal of Investigative Dermatology 126:1, 121-127
CrossRef353
Hitoshi Komatsuzawa, Kazuhisa Ouhara, Sakuo Yamada, Tamaki Fujiwara, Koji Sayama, Koji Hashimoto, Motoyuki Sugai. (2006) Innate defences against methicillin-resistantStaphylococcus aureus (MRSA) infection. The Journal of Pathology 208:2, 249-260
CrossRef354
François Niyonsaba, Hideoki Ogawa. (2005) Protective roles of the skin against infection: Implication of naturally occurring human antimicrobial agents β-defensins, cathelicidin LL-37 and lysozyme. Journal of Dermatological Science 40:3, 157-168
CrossRef355
Qian Lu, Lakshman P. Samaranayake, Richard P. Darveau, Lijian Jin. (2005) Expression of human β-defensin-3 in gingival epithelia. Journal of Periodontal Research 40:6, 474-481
CrossRef356
Gys J. Jongh, Patrick L. J. M. Zeeuwen, Martina Kucharekova, Rolph Pfundt, Pieter G. Valk, Willeke Blokx, Aynur Dogan, Pieter S. Hiemstra, Peter C. Kerkhof, Joost Schalkwijk. (2005) High Expression Levels of Keratinocyte Antimicrobial Proteins in Psoriasis Compared with Atopic Dermatitis. Journal of Investigative Dermatology 125:6, 1163-1173
CrossRef357
Donald Leung. (2005) 2. Superantigens, steroid insensitivity and innate immunity in atopic eczema. Acta Dermato-Venereologica 85:0, 11-15
CrossRef358
Deike Varoga, Thomas Pufe, Rolf Mentlein, Susanne Kohrs, Susanne Grohmann, Bernhard Tillmann, Joachim Hassenpflug, Friedrich Paulsen. (2005) Expression and regulation of antimicrobial peptides in articular joints. Annals of Anatomy - Anatomischer Anzeiger 187:5-6, 499-508
CrossRef359
Thomas Bieber. (2005) 1. Putative mechanisms underlying chronicity in atopic eczema. Acta Dermato-Venereologica 85:0, 7-10
CrossRef360
G. Sandra Tjabringa, Klaus F. Rabe, Pieter S. Hiemstra. (2005) The human cathelicidin LL-37: a multifunctional peptide involved in infection and inflammation in the lung. Pulmonary Pharmacology & Therapeutics 18:5, 321-327
CrossRef361
Rachael Clark, Thomas Kupper. (2005) Old Meets New: The Interaction Between Innate and Adaptive Immunity. Journal of Investigative Dermatology 125:4, 629-637
CrossRef362
Michael D. Howell, Natalija Novak, Thomas Bieber, Saveria Pastore, Giampiero Girolomoni, Mark Boguniewicz, Joanne Streib, Cathy Wong, Richard L. Gallo, Donald Y. M. Leung. (2005) Interleukin-10 Downregulates Anti-Microbial Peptide Expression in Atopic Dermatitis. Journal of Investigative Dermatology 125:4, 738-745
CrossRef363
Michael J Sladden, Graham A Johnston. (2005) Current options for the treatment of impetigo in children. Expert Opinion on Pharmacotherapy 6:13, 2245-2256
CrossRef364
Keertan Dheda, Jung-Su Chang, Ronan AM Breen, Jamanda A Haddock, Marc C Lipman, Louise U Kim, Jim F Huggett, Margaret A Johnson, Graham AW Rook, Alimuddin Zumla. (2005) Expression of a novel cytokine, IL-4delta2, in HIV and HIV–tuberculosis co-infection. AIDS 19:15, 1601-1606
CrossRef365
Clemens Esche, Cristiana Stellato, Lisa A. Beck. (2005) Chemokines: Key Players in Innate and Adaptive Immunity. Journal of Investigative Dermatology 125:4, 615-628
CrossRef366
T. Bieber. (2005) Actualités dans la dermatite atopique : nouvelle nomenclature, génétique et évolution naturelle. Annales de Dermatologie et de Vénéréologie 132:10, 3-6
CrossRef367
A. Körber, S. Grabbe, J. Dissemond. (2005) Antimikrobielle Peptide. Der Hautarzt 56:9, 860-865
CrossRef368
K. Breuer, M. Wittmann, K. Kempe, A. Kapp, U. Mai, O. Dittrich-Breiholz, M. Kracht, S. Mrabet-Dahbi, T. Werfel. (2005) Alpha-toxin is produced by skin colonizing Staphylococcus aureus and induces a T helper type 1 response in atopic dermatitis. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 35:8, 1088-1095
CrossRef369
Belen Lopez-Garcia, Phillip H. A. Lee, Kenshi Yamasaki, Richard L. Gallo. (2005) Anti-Fungal Activity of Cathelicidins and their Potential Role in Candida albicans Skin Infection. Journal of Investigative Dermatology 125:1, 108-115
CrossRef370
Marissa H. Braff, Antoanella Bardan, Victor Nizet, Richard L. Gallo. (2005) Cutaneous Defense Mechanisms by Antimicrobial Peptides. Journal of Investigative Dermatology 125:1, 9-13
CrossRef371
Peter Bergman, Linda Johansson, Vendela Asp, Laura Plant, Gudmundur H. Gudmundsson, Ann-Beth Jonsson, Birgitta Agerberth. (2005) Neisseria gonorrhoeae downregulates expression of the human antimicrobial peptide LL-37. Cellular Microbiology 7:7, 1009-1017
CrossRef372
T. Witthöft, C. S. Pilz, K. Fellermann, M. Nitschke, E. F. Stange, D. Ludwig. (2005) Enhanced Human β-Defensin-2 (hBD-2) Expression by Corticosteroids Is Independent of NF-κB in Colonic Epithelial Cells (CaCo2). Digestive Diseases and Sciences 50:7, 1252-1259
CrossRef373
Koji Sayama, Hitoshi Komatsuzawa, Kenshi Yamasaki, Yuji Shirakata, Yasushi Hanakawa, Kazuhisa Ouhara, Sho Tokumaru, Xiuju Dai, Mikiko Tohyama, Peter ten Dijke, Motoyuki Sugai, Hidenori Ichijo, Koji Hashimoto. (2005) New mechanisms of skin innate immunity: ASK1-mediated keratinocyte differentiation regulates the expression of β-defensins, LL37, and TLR2. European Journal of Immunology 35:6, 1886-1895
CrossRef374
H. Dommisch, Y. Acil, A. Dunsche, J. Winter, S. Jepsen. (2005) Differential gene expression of human beta-defensins (hBD-1, -2, -3) in inflammatory gingival diseases. Oral Microbiology and Immunology 20:3, 186-190
CrossRef375
Peter Bergman, Stefan Termén, Linda Johansson, Lisbeth Nyström, Ernest Arenas, Ann-Beth Jonsson, Tomas Hökfelt, Gudmundur H. Gudmundsson, Birgitta Agerberth. (2005) The antimicrobial peptide rCRAMP is present in the central nervous system of the rat. Journal of Neurochemistry 93:5, 1132-1140
CrossRef376
J.D. Bos, M.A. de Rie, M.B.M. Teunissen, G. Piskin. (2005) Psoriasis: dysregulation of innate immunity. British Journal of Dermatology 152:6, 1098-1107
CrossRef377
Michael E Selsted, Andre J Ouellette. (2005) Mammalian defensins in the antimicrobial immune response. Nature Immunology 6:6, 551-557
CrossRef378
Stefan Kippenberger, Stefan Loitsch, Diamant Thaci, Roland Kaufmann, August Bernd. (2005) Detection of human beta defensin-1 and ?2 by RT-competitive multiplex PCR. Archives of Dermatological Research 296:11, 539-542
CrossRef379
U Darsow, J Lubbe, A Taieb, S Seidenari, A Wollenberg, AM Calza, F Giusti, J Ring, . (2005) Position paper on diagnosis and treatment of atopic dermatitis. Journal of the European Academy of Dermatology and Venereology 19:3, 286-295
CrossRef380
Li-Li An, Ying-Hua Yang, Xiao-Tong Ma, Yong-Min Lin, Ge Li, Yu-Hua Song, Ke-Fu Wu. (2005) LL-37 enhances adaptive antitumor immune response in a murine model when genetically fused with M-CSFRJ6-1 DNA vaccine. Leukemia Research 29:5, 535-543
CrossRef381
T. J. Guzik, M. Bzowska, A. Kasprowicz, G. Czerniawska-Mysik, K. Wojcik, D. Szmyd, T. Adamek-Guzik, J. Pryjma. (2005) Persistent skin colonization with Staphylococcus aureus in atopic dermatitis: relationship to clinical and immunological parameters. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 35:4, 448-455
CrossRef382
Benjamin Schwartz, Mark Lebwohl. (2005) Complications of the smallpox vaccine. International Journal of Dermatology 44:4, 289-292
CrossRef383
S. Mrabet-Dahbi, K. Breuer, M. Klotz, U. Herz, K. Heeg, T. Werfel, H. Renz. (2005) Deficiency in immunoglobulin G2 antibodies against staphylococcal enterotoxin C1 defines a subgroup of patients with atopic dermatitis. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 35:3, 274-281
CrossRef384
N. Novak, B. Kwiek, T. Bieber. (2005) The mode of topical immunomodulators in the immunological network of atopic dermatitis. Clinical and Experimental Dermatology 30:2, 160-164
CrossRef385
C. Vollmert, H. Behrendt. (2005) Bactericidal activity of flucloxacillin against Staphylococcus aureus in primary keratinocyte cultures of lesional and unaffected skin of patients suffering from atopic dermatitis. Experimental Dermatology 14:3, 215-224
CrossRef386
Marissa H Braff, Anna Di Nardo, Richard L Gallo. (2005) Keratinocytes Store the Antimicrobial Peptide Cathelicidin in Lamellar Bodies. Journal of Investigative Dermatology 124:2, 394-400
CrossRef387
Hirohisa Saito. (2005) Much Atopy about the Skin: Genome-Wide Molecular Analysis of Atopic Eczema. International Archives of Allergy and Immunology 137:4, 319-325
CrossRef388
Setsuko Matsukura, Michiko Aihara, Tsutomu Hirasawa, Zenro Ikezawa. (2005) Effects of TNCB Sensitization in DS-<i>Nh</i> Mice, Serving as a Model of Atopic Dermatitis, in Comparison with NC/Nga Mice. International Archives of Allergy and Immunology 136:2, 173-180
CrossRef389
H. Sugiura, H. Ebise, T. Tazawa, K. Tanaka, Y. Sugiura, M. Uehara, K. Kikuchi, T. Kimura. (2005) Large-scale DNA microarray analysis of atopic skin lesions shows overexpression of an epidermal differentiation gene cluster in the alternative pathway and lack of protective gene expression in the cornified envelope. British Journal of Dermatology 152:1, 146-149
CrossRef390
A. Taïeb. (2005) Dermatite atopique : définition, épidémiologie, histoire naturelle, gravité et scores. Annales de Dermatologie et de Vénéréologie 132, 35-43
CrossRef391
Charles L Bevins. (2005) An important clue: fingerprints point to psoriasin in defense against E. coli. Nature Immunology 6:1, 12-13
CrossRef392
Ji Eun Kim, Beom Joon Kim, Mi Sook Jeong, Seong Jun Seo, Myeung Nam Kim, Chang Kwun Hong, Byung In Ro. (2005) Expression and Modulation of LL-37 in Normal Human Keratinocytes, HaCaT cells, and Inflammatory Skin Diseases. Journal of Korean Medical Science 20:4, 649
CrossRef393
F. Bérard. (2005) Bases physiopathologiques de la dermatite atopique. Annales de Dermatologie et de Vénéréologie 132, 151-182
CrossRef394
Regine Gläser, Jürgen Harder, Hans Lange, Joachim Bartels, Enno Christophers, Jens-Michael Schröder. (2005) Antimicrobial psoriasin (S100A7) protects human skin from Escherichia coli infection. Nature Immunology 6:1, 57-64
CrossRef395
P. Plantin. (2005) Quelle est la place des thérapeutiques non immunosuppressives dans le traitement de la dermatite atopique ?. Annales de Dermatologie et de Vénéréologie 132, 73-78
CrossRef396
Nobuyuki Fukuishi, Mino Yoshioka, Masaaki Akagi. (2005) Folia Pharmacologica Japonica 125:5, 259-264
CrossRef397
Orr Barak, James R. Treat, William D. James. (2005) Antimicrobial Peptides: Effectors of Innate Immunity in the Skin. Advances in Dermatology 21, 357-374
CrossRef398
Kristine Breuer, Thomas T Werfel, Alexander Kapp. (2005) Pimecrolimus for the treatment of atopic dermatitis. Therapy 2:1, 37-56
CrossRef399
MASAMOTO MURAKAMI, ROBERT A. DORSCHNER, LAUREN J. STERN, KENNETH H. LIN, RICHARD L. GALLO. (2005) Expression and Secretion of Cathelicidin Antimicrobial Peptides in Murine Mammary Glands and Human Milk. Pediatric Research 57:1, 10-15
CrossRef400
Deike Varoga, Thomas Pufe, J
rgen Harder, Ulf Meyer-Hoffert, Rolf Mentlein, Jens-Michael Schr
CrossRef401
Jane Fore-Pfliger. (2004) The Epidermal Skin Barrier. Advances in Skin & Wound Care 17:9, 480-488
CrossRef402
Irina A. Buhimschi, Maher Jabr, Catalin S. Buhimschi, Anelia P. Petkova, Carl P. Weiner, Ghassan M. Saed. (2004) The novel antimicrobial peptide β3-defensin is produced by the amnion: A possible role of the fetal membranes in innate immunity of the amniotic cavity. American Journal of Obstetrics and Gynecology 191:5, 1678-1687
CrossRef403
L STEINSTRAESSER, Y OEZDOGAN, S WANG, H STEINAU. (2004) Host defense peptides in burns. Burns 30:7, 619-627
CrossRef404
Antonie Roll, Antonio Cozzio, Barbra Fischer, Peter Schmid-Grendelmeier. (2004) Microbial colonization and atopic dermatitis. Current Opinion in Allergy and Clinical Immunology 4:5, 373-378
CrossRef405
E. Andrès, J.-L. Dimarcq. (2004) Peptides antimicrobiens cationiques : de l'étude de l'immunité innée à la production de médicaments. La Revue de Médecine Interne 25:9, 629-635
CrossRef406
S. Rieg, C. Garbe, B. Sauer, H. Kalbacher, B. Schittek. (2004) Dermcidin is constitutively produced by eccrine sweat glands and is not induced in epidermal cells under inflammatory skin conditions. British Journal of Dermatology 151:3, 534-539
CrossRef407
Michael Raghunath, Lambrini Tontsidou, Vinzenz Oji, Karin Aufenvenne, Funda Schurmeyer-Horst, Arumugam Jayakumar, Hartmut Stander, Josef Smolle, Gary L. Clayman, Heiko Traupe. (2004) SPINK5 and Netherton Syndrome: Novel Mutations, Demonstration of Missing LEKTI, and Differential Expression of Transglutaminases. Journal of Investigative Dermatology 123:3, 474-483
CrossRef408
Robert I. Lehrer. (2004) Primate defensins. Nature Reviews Microbiology 2:9, 727-738
CrossRef409
Donald Y.M. Leung, Richard A. Nicklas, James T. Li, I.L. Bernstein, Joann Blessing-Moore, Mark Boguniewicz, Jean A. Chapman, David A. Khan, David Lang, Rufus E. Lee, Jay M. Portnoy, Diane E. Schuller, Sheldon L. Spector, Stephen A. Tilles. (2004) Disease management of atopic dermatitis: an updated practice parameter. Annals of Allergy, Asthma & Immunology 93:3, S1-S21
CrossRef410
Jurgen Harder, Ulf Meyer-Hoffert, Kai Wehkamp, Lars Schwichtenberg, Jens-Michael Schroder. (2004) Differential Gene Induction of Human beta-Defensins (hBD-1, -2, -3, and -4) in Keratinocytes Is Inhibited by Retinoic Acid. Journal of Investigative Dermatology 123:3, 522-529
CrossRef411
Li Dongsheng, Li Jiawen, Duan Yiqun, Zhou Xiaoyong. (2004) Expression of LL-37, human beta defensin-2, and CCR6 mRNA in patients with psoriasis vulgaris. Journal of Huazhong University of Science and Technology [Medical Sciences] 24:4, 404-406
CrossRef412
Janet Butmarc, Tatyana Yufit, Polly Carson, Vincent Falanga. (2004) Human beta-defensin-2 expression is increased in chronic wounds. Wound Repair and Regeneration 12:4, 439-443
CrossRef413
Kerstin Wolk, Stefanie Kunz, Ellen Witte, Markus Friedrich, Khusru Asadullah, Robert Sabat. (2004) IL-22 Increases the Innate Immunity of Tissues. Immunity 21:2, 241-254
CrossRef414
Tokiyoshi Ayabe, Toshifumi Ashida, Yutaka Kohgo, Toru Kono. (2004) The role of Paneth cells and their antimicrobial peptides in innate host defense. Trends in Microbiology 12:8, 394-398
CrossRef415
Hiroyuki Yoshio, Hugo Lagercrantz, Gudmundur H. Gudmundsson, Birgitta Agerberth. (2004) First line of defense in early human life. Seminars in Perinatology 28:4, 304-311
CrossRef416
Andreas Wollenberg, Renata Engler. (2004) Smallpox, vaccination and adverse reactions to smallpox vaccine. Current Opinion in Allergy and Clinical Immunology 4:4, 271-275
CrossRef417
Jürgen Schauber, Konrad Iffland, Susanne Frisch, Theodor Kudlich, Bernd Schmausser, Matthias Eck, Thomas Menzel, Andrea Gostner, Hardi Lührs, Wolfgang Scheppach. (2004) Histone-deacetylase inhibitors induce the cathelicidin LL-37 in gastrointestinal cells. Molecular Immunology 41:9, 847-854
CrossRef418
Clemens Esche, Anna Benedetto, Lisa A. Beck. (2004) Keratinocytes in Atopic dermatitis: Inflammatory signals. Current Allergy and Asthma Reports 4:4, 276-284
CrossRef419
Jean S Marshall, Dunia M Jawdat. (2004) Mast cells in innate immunity. Journal of Allergy and Clinical Immunology 114:1, 21-27
CrossRef420
Spuls Phyllis I., Bos Jan D., Rudikoff Donald. (2004) Smallpox: What the Dermatologist Should Know. SKINmed 3:4, 197-208
CrossRef421
Allen P Anandarajah, Christopher T Ritchlin. (2004) Pathogenesis of psoriatic arthritis. Current Opinion in Rheumatology 16:4, 338-343
CrossRef422
Phillip H.A. Lee, Jennifer A. Rudisill, Kenneth H. Lin, Lijuan Zhang, Scott M. Harris, Timothy J. Falla, Richard L. Gallo. (2004) HB-107, a nonbacteriostatic fragment of the antimicrobial peptide cecropin B, accelerates murine wound repair. Wound Repair and Regeneration 12:3, 351-358
CrossRef423
E. Nivenius, P. G. Montan, E. Chryssanthou, K. Jung, M. van Hage-Hamsten, I. van der Ploeg. (2004) No apparent association between periocular and ocular microcolonization and the degree of inflammation in patients with atopic keratoconjunctivitis. Clinical <html_ent glyph="@amp;" ascii="&"/> Experimental Allergy 34:5, 725-730
CrossRef424
J.-M. Schröder. (2004) Peptides épithéliaux antimicrobiens. Annales de Dermatologie et de Vénéréologie 131:4, 411-416
CrossRef425
Antoanella Bardan, Victor Nizet, Richard L Gallo. (2004) Antimicrobial peptides and the skin. Expert Opinion on Biological Therapy 4:4, 543-549
CrossRef426
Parviz Ahmad-Nejad, Salima Mrabet-Dahbi, Kristine Breuer, Martina Klotz, Thomas Werfel, Udo Herz, Klaus Heeg, Michael Neumaier, Harald Renz. (2004) The Toll-like receptor 2 R753Q polymorphism defines a subgroup of patients with atopic dermatitis having severe phenotype. Journal of Allergy and Clinical Immunology 113:3, 565-567
CrossRef427
Francois Niyonsaba, Hideoki Ogawa, Isao Nagaoka. (2004) Human beta-defensin-2 functions as a chemotactic agent for tumour necrosis factor-alpha-treated human neutrophils. Immunology 111:3, 273-281
CrossRef428
Klaus Wolff, Anton Stuetz. (2004) Pimecrolimus for the treatment of inflammatory skin disease. Expert Opinion on Pharmacotherapy 5:3, 643-655
CrossRef429
Thomas S. Kupper, Robert C. Fuhlbrigge. (2004) Immune surveillance in the skin: mechanisms and clinical consequences. Nature Reviews Immunology 4:3, 211-222
CrossRef430
Donald Y.M. Leung, Mark Boguniewicz, Michael D. Howell, Ichiro Nomura, Qutayba A. Hamid. (2004) New insights into atopic dermatitis. Journal of Clinical Investigation 113:5, 651-657
CrossRef431
Jere D. Guin. (2004) Eyelid dermatitis: A report of 215 patients. Contact Dermatitis 50:2, 87-90
CrossRef432
Lijuan Zhang, Timothy J Falla. (2004) Cationic antimicrobial peptides – an update. Expert Opinion on Investigational Drugs 13:2, 97-106
CrossRef433
Emma Guttman-Yassky. (2004) Exogenous Factors in Atopic Dermatitis. Exogenous Dermatology 3:5, 228-236
CrossRef434
Frank Rippke, Volker Schreiner, Thomas Doering, Howard I Maibach. (2004) Stratum Corneum pH in Atopic Dermatitis. American Journal of Clinical Dermatology 5:4, 217-223
CrossRef435
Ichiro Nomura, Bifeng Gao, Mark Boguniewicz, Marc A. Darst, Jeffrey B. Travers, Donald Y.M. Leung. (2003) Distinct patterns of gene expression in the skin lesions of atopic dermatitis and psoriasis. Journal of Allergy and Clinical Immunology 112:6, 1195-1202
CrossRef436
Koji Hase, Masamoto Murakami, Mitsutoshi Iimura, Sheri P Cole, Yoshimune Horibe, Takaaki Ohtake, Marygorret Obonyo, Richard L Gallo, Lars Eckmann, Martin F Kagnoff. (2003) Expression of LL-37 by human gastric epithelial cells as a potential host defense mechanism against Helicobacter pylori. Gastroenterology 125:6, 1613-1625
CrossRef437
Miguel E Qui??ones-Mateu, Michael M Lederman, Zhimin Feng, Bikram Chakraborty, Jan Weber, Hector R Rangel, Michael L Marotta, Muneer Mirza, Bin Jiang, Patti Kiser, Kathy Medvik, Scott F Sieg, Aaron Weinberg. (2003) Human epithelial ??-defensins 2 and 3 inhibit HIV-1 replication. AIDS 17:16, F39-F48
CrossRef438
Ying-Hua Yang, Guo-Guang Zheng, Ge Li, Bin Zhang, Yu-Hua Song, Ke-Fu Wu. (2003) Expression of LL-37/hCAP-18 gene in human leukemia cells. Leukemia Research 27:10, 947-950
CrossRef439
Kelly D. Stone. (2003) Atopic diseases of childhood. Current Opinion in Pediatrics 15:5, 495-511
CrossRef440
Richard L. Gallo, Victor Nizet. (2003) Endogenous production of antimicrobial peptides in innate immunity and human disease. Current Allergy and Asthma Reports 3:5, 402-409
CrossRef441
H. G. Boman. (2003) Antibacterial peptides: basic facts and emerging concepts. Journal of Internal Medicine 254:3, 197-215
CrossRef442
Donald Y. M. Leung. (2003) Infection in atopic dermatitis. Current Opinion in Pediatrics 15:4, 399-404
CrossRef443
(2003) Flavonoids and Antimicrobial Activity of the Ethanol Extract of Korean Cherry (Prunus tomentosa Thunberg). Journal of the Korean Society of Food Science and Nutrition 32:6, 833-839
CrossRef444
Jan Wehkamp, Juergen Harder, Michael Weichenthal, Oliver Mueller, Klaus R. Herrlinger, Klaus Fellermann, Jens M. Schroeder, Eduard F. Stange. (2003) Inducible and Constitutive ??-Defensins Are Differentially Expressed in Crohn's Disease and Ulcerative Colitis. Inflammatory Bowel Diseases 9:4, 215-223
CrossRef445
Rembert Koczulla, Georges von Degenfeld, Christian Kupatt, Florian Krötz, Stefan Zahler, Torsten Gloe, Katja Issbrücker, Pia Unterberger, Mohamed Zaiou, Corinna Lebherz, Alexander Karl, Philip Raake, Achim Pfosser, Peter Boekstegers, Ulrich Welsch, Pieter S. Hiemstra, Claus Vogelmeier, Richard L. Gallo, Matthias Clauss, Robert Bals. (2003) An angiogenic role for the human peptide antibiotic LL-37/hCAP-18. Journal of Clinical Investigation 111:11, 1665-1672
CrossRef446
Peter Elsbach. (2003) What is the real role of antimicrobial polypeptides that can mediate several other inflammatory responses?. Journal of Clinical Investigation 111:11, 1643-1645
CrossRef447
Klaus Fellermann, Jan Wehkamp, Klaus R Herrlinger, Eduard F Stange. (2003) Crohn's disease. European Journal of Gastroenterology & Hepatology 15:6, 627-634
CrossRef448
Mohamed Zaiou, Victor Nizet, Richard L Gallo. (2003) Antimicrobial and Protease Inhibitory Functions of the Human Cathelicidin (hCAP18/LL-37) Prosequence. Journal of Investigative Dermatology 120:5, 810-816
CrossRef449
Damien Vanhoye, Francine Bruston, Pierre Nicolas, Mohamed Amiche. (2003) Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain. European Journal of Biochemistry 270:9, 2068-2081
CrossRef450
Mike Bray. (2003) Pathogenesis and potential antiviral therapy of complications of smallpox vaccination. Antiviral Research 58:2, 101-114
CrossRef451
ROBERT A. DORSCHNER, KENNETH H. LIN, MASAMOTO MURAKAMI, RICHARD L. GALLO. (2003) Neonatal Skin in Mice and Humans Expresses Increased Levels of Antimicrobial Peptides: Innate Immunity During Development of the Adaptive Response. Pediatric Research 53:4, 566-572
CrossRef452
(2003) Antimicrobial Peptides in the Skin. New England Journal of Medicine 348:4, 361-363
Full Text453
Donald YM Leung, Thomas Bieber. (2003) Atopic dermatitis. The Lancet 361:9352, 151-160
CrossRef454
Jann L??bbe. (2003) Secondary Infections in Patients with Atopic Dermatitis. American Journal of Clinical Dermatology 4:9, 641-654
CrossRef455
Masamoto Murakami, Takaaki Ohtake, Robert A Dorschner, Birgit Schittek, Claus Garbe, Richard L Gallo. (2002) Cathelicidin Anti-Microbial Peptide Expression in Sweat, an Innate Defense System for the Skin. Journal of Investigative Dermatology 119:5, 1090-1095
CrossRef456
Zasloff, Michael, . (2002) Antimicrobial Peptides in Health and Disease. New England Journal of Medicine 347:15, 1199-1200
Full Text
- Letters
