Original Article
Peritoneal Dialysis and Epithelial-to-Mesenchymal Transition of Mesothelial Cells
N Engl J Med 2003; 348:403-413January 30, 2003
- Abstract
Background
During continuous ambulatory peritoneal dialysis, the peritoneum is exposed to bioincompatible dialysis fluids that cause denudation of mesothelial cells and, ultimately, tissue fibrosis and failure of ultrafiltration. However, the mechanism of this process has yet to be elucidated.
Methods
Mesothelial cells isolated from effluents in dialysis fluid from patients undergoing continuous ambulatory peritoneal dialysis were phenotypically characterized by flow cytometry, confocal immunofluorescence, Western blotting, and reverse-transcriptase polymerase chain reaction. These cells were compared with mesothelial cells from omentum and treated with various stimuli in vitro to mimic the transdifferentiation observed during continuous ambulatory peritoneal dialysis. Results were confirmed in vivo by immunohistochemical analysis performed on peritoneal-biopsy specimens.
Results
Soon after dialysis is initiated, peritoneal mesothelial cells undergo a transition from an epithelial phenotype to a mesenchymal phenotype with a progressive loss of epithelial morphology and a decrease in the expression of cytokeratins and E-cadherin through an induction of the transcriptional repressor snail. Mesothelial cells also acquire a migratory phenotype with the up-regulation of expression of α2 integrin. In vitro analyses point to wound repair and profibrotic and inflammatory cytokines as factors that initiate mesothelial transdifferentiation. Immunohistochemical studies of peritoneal-biopsy specimens from patients undergoing continuous ambulatory peritoneal dialysis demonstrate the expression of the mesothelial markers intercellular adhesion molecule 1 and cytokeratins in fibroblast-like cells entrapped in the stroma, suggesting that these cells stemmed from local conversion of mesothelial cells.
Conclusions
Our results suggest that mesothelial cells have an active role in the structural and functional alteration of the peritoneum during peritoneal dialysis. The findings suggest potential targets for the design of new dialysis solutions and markers for the monitoring of patients.
Media in This Article
Video
Two Time-Lapse Video Sequences of Mesothelial Wound Healing.
Figure 1
Morphologic Changes in Mesothelial Cells during Peritoneal Dialysis.Article Activity
- Article
Video
Two Time-Lapse Video Sequences of Mesothelial Wound Healing.
Continuous ambulatory peritoneal dialysis is an alternative to hemodialysis for the treatment of end-stage renal disease.1 The peritoneal membrane is lined with a monolayer of mesothelial cells that have some characteristics of epithelial cells, act as a permeability barrier, and secrete various substances involved in the regulation of peritoneal permeability and local host defense.1,2 Unfortunately, long-term exposure to the hyperosmotic, hyperglycemic, and acidic solutions used in dialysis often causes low-grade, chronic inflammation of and injury to the peritoneum, which progressively becomes denuded of mesothelial cells and undergoes fibrosis.1 Such structural alterations are considered to be the principal cause of failure of ultrafiltration, which affects up to 20 percent of patients undergoing continuous ambulatory peritoneal dialysis.3 This functional decline of the peritoneum may be accelerated by recurrent or severe episodes of peritonitis or hemoperitoneum.3,4
The pathophysiology of peritoneal impairment during long-term continuous ambulatory peritoneal dialysis is not well understood. Peritoneal mesenchymal stem cells entrapped in the stroma have historically been considered to be the primary cells involved in the development of peritoneal fibrosis.5 However, a possible direct involvement of mesothelial cells in this phenomenon has not been examined. In this context, cultured mesothelial cells have the capacity to change their morphologic features and produce extracellular-matrix components in response to a variety of stimuli.6-12 In addition, treatment of mesothelial cells in vitro with mediums that have a high glucose concentration or with inflammatory cytokines induces the expression of transforming growth factor β (TGF-β)13 and decreases the expression of E-cadherin.14 The relevance of the profibrotic growth factor TGF-β15 in the failure of ultrafiltration induced by continuous ambulatory peritoneal dialysis was recently underscored in a rat model in which the TGF-β gene was transduced to the peritoneum, where it was associated with a decrease in peritoneal function.16
In the present study, we demonstrate in vivo and ex vivo that mesothelial cells undergo a transition from an epithelial phenotype to a mesenchymal phenotype — a transition also called transdifferentiation — when they are subjected to peritoneal dialysis. Transdifferentiation is a complex and generally reversible process that starts with the disruption of intercellular junctions and loss of the apical–basolateral polarity typical of epithelial cells, with the cells then transformed into fibroblast-like cells with pseudopodial protrusions and increased migratory, invasive, and fibrogenic features.17 Although transdifferentiation can be induced in most cultured epithelial cells with a wide variety of treatments, this process occurs in vivo only during embryonic development and in some pathologic processes such as wound healing and tumor progression.17,18 The intercellular adhesion molecule E-cadherin appears to have a central role in the control of the epithelial-to-mesenchymal transition, since the loss of E-cadherin expression or function correlates with the ability of epithelial cells to adopt a mesenchymal migratory and invasive phenotype.19,20 The transcription factor snail is a strong repressor of E-cadherin transcription and an inducer of transdifferentiation.21-23 Thus, phenotypic changes of the mesothelial cells during continuous ambulatory peritoneal dialysis may be directly related to the failure of peritoneal membrane function.
Methods
Patients and Cells
Human mesothelial cells from effluent (mean [±SE] number of cells per bag, 25,569±2971) were obtained by centrifugation of dialysis fluid taken randomly from 54 clinically stable patients undergoing nocturnal exchanges with dialysis solutions containing 2.27 percent glucose and 1.25 to 1.75 mmol of calcium per liter. After 10 to 15 days, cultures reached confluence and were split (in a ratio of 1:2) two to three times. The morphologic features of cells in confluent cultures were compared and remained stable during the two to three cell passages. Eighty-five percent of the cultures were obtained before a first episode of peritonitis occurred. Of the 116 effluent cultures evaluated, 62 had cobblestone morphology, 28 contained transitional mesothelial cells, 20 contained fibroblast-like mesothelial cells, and 6 contained a mixed population of cells.
Omental mesothelial cells were obtained by digestion of samples of omentum from 30 patients who were not undergoing continuous ambulatory peritoneal dialysis but were undergoing unrelated abdominal surgery; the samples were digested with 0.05 percent trypsin and 0.02 percent EDTA. Omental fibroblasts were obtained from three different samples of omentum by extensive treatment with trypsin after the removal of mesothelial cells (three 20-minute rounds of exposure to trypsin). All cells were cultured in Earle's M199 medium, 20 percent fetal-calf serum, 50 U of penicillin per milliliter, 50 μg of streptomycin per milliliter, and 2 percent Biogro-2 (containing insulin, transferrin, ethanolamine, and putrescine) (Biological Industries). For the experiments, cells were seeded on films of 50 μg of collagen I per milliliter without Biogro-2. TGF-β1 and interleukin-1β were purchased (R&D), and the doses used were in the range of those detected in peritoneal-dialysis fluids in the presence of peritonitis24 and were similar to those used in previous studies.9 The study was approved by the ethics committee of Hospital Universitario de la Princesa in Madrid, and oral informed consent was obtained from all donors.
Antibodies
Monoclonal antibodies against CD151 (LIA1/1), CD9 (VJ1/20), α3 integrin (VJ1/18), β1 integrin (TS2/16), and α2 integrin (TEA1/41) have been described elsewhere.25 We also used monoclonal antibody against intercellular adhesion molecule 1 (ICAM-1) (HU5/3, provided by Dr. F.W. Luscinskas, Brigham and Women's Hospital, Boston); rabbit polyclonal antibodies against α2 integrin and α3 integrin (provided by Dr. G. Tarone, University of Turin, Turin, Italy); monoclonal antibody against E-cadherin (Calbiochem); antibodies against vimentin, α tubulin, and pancytokeratin (Sigma); and monoclonal antibody against ICAM-1 (Santa Cruz Biotechnology).
Flow Cytometry, Immunohistochemical Analysis, Immunofluorescence Studies, and Confocal Microscopy
Flow cytometry and immunofluorescence studies were performed as described previously.25 Immunohistochemical studies were performed with a streptavidin–biotin method (Dako LSAB-2 Kit, Dako) on paraffin-embedded peritoneal-tissue samples from 17 patients undergoing continuous ambulatory peritoneal dialysis and 8 control patients. All patients who underwent biopsy gave written informed consent. Diaminobenzidine and fast red were used as chromogens for visualization.
Western Blotting
Monolayers of mesothelial cells were lysed in RIPA buffer, and equivalent amounts of protein were resolved by sodium dodecyl sulfate–polyacrylamide-gel electrophoresis and Western blotting as described previously.25 Imaging was performed with an LAS-1000 CCD camera (Fujifilm), and signals were quantified with Image Gauge software (version 3.46, Fujifilm).
Reverse-Transcriptase Polymerase Chain Reaction
Mesothelial RNA was extracted with the use of a reagent (RNAwiz, Ambion). The complementary DNA was obtained from 1 μg of total RNA with the use of a kit (Applied Biosystems). Amplification of snail was performed for 40 cycles (40 seconds at 95°C, 30 seconds at 53°C, and 1 minute at 72°C) with the use of primer 1 (5'CACATCCTTCTCACTGCCATG3') and primer 2 (5'GCATCTAAACTCTAGTCTGC3'). For nested reverse-transcriptase–polymerase-chain-reaction (RT-PCR) analysis of snail, a 30-cycle reaction was performed under the same conditions, and a 1:50 dilution of the product of the reaction was amplified for 20 cycles (40 seconds at 95°C, 30 seconds at 60°C, and 1 minute at 70°C) with primer 1 and primer 3 (5'CCTGAGTGGGGTGGGAGCTTCC3').22 PCR analysis of E-cadherin was carried out for 32 cycles as described previously.22
Migration Assays
Assays of chemotaxis and haptotaxis (migration toward matrix proteins) were performed in polycarbonate transwell inserts (5-μm pore [Costar]), some of which were coated at the bottom with 10 μg of collagen I or laminin-5 per milliliter,26 as previously described.27
Time-Lapse Videomicroscopy
Videomicroscopical analysis was performed with the use of an inverted microscope equipped with a video camera (SSC-M350CE CCD, Sony) coupled to a time-lapse videocassette recorder (SVT-5000P, Sony). Mesothelial cells from omentum were subjected to mechanical injury with an adapted cell scraper approximately 1500 μm in width and recorded for two to three days until the “wound” closed in an incubator that maintained the sample at 37°C in an environment containing 5 percent carbon dioxide. Digitalization of the images was performed with the use of Optimas software (version 5.2, Bioscan).
Results
Morphologic Changes in Mesothelial Cells during Peritoneal Dialysis
Mesothelial-cell cultures from effluents from patients undergoing continuous ambulatory peritoneal dialysis had markedly varied morphologic features, ranging from a cobblestone-like appearance similar to that of mesothelium derived from omentum to fibroblast-like cells or mixed cell populations (Figure 1AFigure 1
Morphologic Changes in Mesothelial Cells during Peritoneal Dialysis.). The prevalence of nonepithelioid cells appeared to be related both to the duration of continuous ambulatory peritoneal dialysis in each patient (Figure 1B) and to whether and when hemoperitoneum or peritonitis had occurred. Fibroblast-like mesothelial cells appeared sporadically in samples in which hemorrhage or infiltrating lymphoid cells were present in the effluent, and a reversion to cobblestone or transitional phenotype was evident (in eight of eight cases) when cultures from the same patient were analyzed after the episode of peritonitis or hemoperitoneum had resolved (Figure 1C).To determine the nature of cells derived from effluent, the expression of cytokeratins, as typical epithelial markers, and of ICAM-1, which is constitutively expressed on mesothelial cells,28 was analyzed. A high level of expression of cytokeratins was observed in omental mesothelial cells and effluent cells with cobblestone-like appearance (Figure 1A). Cells derived from effluent showed a progressive reduction in the expression of cytokeratins, although even in cultures of fibroblast-like cells, a small population of positive cells was maintained (Figure 2Figure 2
Epithelial-to-Mesenchymal Transition of Mesothelial Cells during Peritoneal Dialysis.). Two peaks of keratin expression were observed in mixed cultures, whereas keratin expression was absent from fibroblasts from omentum. However, all cells from effluent, even in mixed cultures, had a high level of homogeneous expression of ICAM-1 that was independent of their morphologic features. In contrast, ICAM-1 expression was negligible on fibroblasts taken directly from both omentum and skin (Figure 1A), supporting the theory that fibroblastoid cells in effluent have a mesothelial origin and their presence is not the result of contamination by fibroblasts.Epithelial-to-Mesenchymal Transition in Vivo
The morphologic changes and down-regulation of keratin in mesothelial cells derived from effluent could be indicative of an epithelial-to-mesenchymal transition.17 We analyzed the expression of E-cadherin and the intermediate filament proteins cytokeratin and vimentin by Western blotting, as markers of transdifferentiation. There was a markedly lower level of E-cadherin expression in cobblestone and nonepithelioid mesothelial cultures than in omental cultures (Figure 2A). The expression of cytokeratins (Figure 2A) paralleled that of E-cadherin, whereas there was greater vimentin expression in nonepithelioid mesothelial cultures.
Confocal immunofluorescence microscopy demonstrated the loss of intercellular E-cadherin and the reorganization of the actin cytoskeleton from the cortical band typical of epithelial cells to fibroblastic stress fibers (Figure 2B). Cytokeratin was replaced by vimentin, although some fibroblastoid mesothelial cells were still positive for keratin. Preparations stained for CD9 (Figure 2C), which is expressed at apical microvilli and intercellular contacts,29 showed a gradual loss of cuboid epithelial morphologic features, which was already evident in cobblestone-like mesothelial cells that were half as high as omental mesothelium in confocal vertical sections. Fibroblast-like mesothelial cells lost contact inhibition and frequently piled up on one another.
Effects of Mechanical Injury, TGF-β1, and Interleukin-1β
The behavior of mesothelial cells during in vitro wound healing was dynamically assessed after the mechanical denudation of confluent monolayers of cells derived from omentum. Mechanical stimulus was sufficient to induce migration of mesothelial cells, and migrating cells underwent a transitional transdifferentiation in which a mesenchymal morphology reverted to an epithelial aspect only after the monolayer was restored (Figure 3AFigure 3
Mesothelial Transdifferentiation in Vitro, Induced by Mechanical Injury, Transforming Growth Factor β1 and Interleukin-1β., Figure 3B, Figure 3C, Figure 3D, Figure 3E, and Figure 3F). This effect was confined to cells at the edge of the wound and neighboring areas, whereas cells at a distance from the wound were not modified, reinforcing the theory that the mechanical stimulus was sufficient to induce transdifferentiation. Complete time-lapse video sequences are available with the full text of this article at http://www.nejm.org.To determine whether TGF-β1 and interleukin-1β, two cytokines detected in effluents from patients undergoing continuous ambulatory peritoneal dialysis primarily during episodes of peritonitis,24 could reproduce the phenotypic changes observed ex vivo, cultured mesothelial cells derived from omentum were treated with TGF-β1 alone or in combination with interleukin-1β. An additive morphologic effect of both stimuli could be observed (Figure 3G). E-cadherin expression was almost completely abolished (Figure 3H), and its localization at intercellular junctions could hardly be detected by immunofluorescence. Cytokeratin expression was also diminished, and an additive effect with interleukin-1β was observed. In contrast, these treatments were associated with an increment in vimentin expression.
Expression of snail in Mesothelial Cells Undergoing Epithelial-to-Mesenchymal Transition
Recently, a transcription factor called snail has been described as a potent repressor of E-cadherin expression and an inducer of epithelial-to-mesenchymal transition.21-23 To determine whether snail expression was associated with the phenotypic changes observed in the cells of the peritoneal membrane in patients undergoing continuous ambulatory peritoneal dialysis, RT-PCR analysis was used to estimate the expression of this transcription factor, as well as that of E-cadherin, in mesothelial cells derived from effluent and omentum (Figure 4AFigure 4
Transdifferentiation of Mesothelial Cells and Early Expression of the snail Transcription Factor.). No snail messenger RNA (mRNA) signal was detected in omental cells, whereas a progressive increase in the expression of snail mRNA was observed in effluent preparations as the process of transdifferentiation progressed. A dramatic down-regulation of expression of E-cadherin mRNA was already apparent in effluent cells that had a cobblestone appearance, a finding consistent with the decrease in expression of E-cadherin protein (Figure 2A).Stimulation of cultured mesothelial cells with TGF-β1 plus interleukin-1β revealed a rapid and transient induction of snail mRNA. E-cadherin mRNA was decreased by the time of the first observation and remained almost undetectable even after snail transcription had declined (Figure 4B). Similarly, after in vitro wound healing, a transient induction of snail mRNA was observed, which probably corresponded to the transitional process in the cells next to the wound. Since the majority of the cells were not involved in the wound-healing process, no down-regulation of E-cadherin was observed in the total population (Figure 4C).
Up-Regulation of α2 Integrin and Acquisition of a Migratory Phenotype
Failure of ultrafiltration in patients undergoing continuous ambulatory peritoneal dialysis is accompanied by peritoneal fibrosis. Therefore, we analyzed the characteristics of matrix-adhesion receptors in mesothelial preparations. A rapid up-regulation of α2 integrin expression was already evident in cobblestone-like mesothelium derived from effluent (Figure 5AFigure 5
Up-Regulation of α2 Integrin Expression and Down-Regulation of Expression of Tetraspanins through the Process of Mesothelial Transdifferentiation. and Figure 5B). In contrast, expression of α3 integrin was augmented in cobblestone-like cells and diminished in late stages of epithelial-to-mesenchymal transition (transitional and fibroblastic mesothelial preparations). Similarly, expression of the integrin-associated tetraspanins CD9 and CD151 was down-regulated as the transdifferentiation progressed. TGF-β1 plus interleukin-1β induced an increase in α2 integrin in all the mesothelial preparations, whereas α3 integrin was increased in omental samples and decreased in transdifferentiated transitional cells (Figure 5C). Interleukin-1β potentiated the effects of TGF-β1, even though it did not affect integrin expression on its own.Tetraspanins are functionally associated with cell migration.30 The changes in the integrin repertoire and the switch from a keratin-based to a vimentin-based cytoskeleton could also affect the migratory capacity of mesothelial cells. We have observed that the transdifferentiation process was accompanied by a higher overall migratory capacity of mesothelial cells. Treatment with TGF-β1 plus interleukin-1β enhanced the haptotaxis to collagen, the main ligand for α2β1 integrin. Migration toward laminin-5 followed the changes in the expression of its receptor, α3β1 integrin; it was enhanced in epithelioid cultures and reduced in transitional and fibroblastic cells (data not shown).
Evidence of Epithelial-to-Mesenchymal Transition of Mesothelial Cells in Peritoneal Tissue
Our data suggest that mesothelial cells undergo an epithelial-to-mesenchymal transition in the course of continuous ambulatory peritoneal dialysis. To confirm this hypothesis in vivo, we used immunohistochemical staining of peritoneal-biopsy specimens from nine patients who had been undergoing continuous ambulatory peritoneal dialysis for up to nine months and confirmed the loss of epithelial morphologic features on the monolayer of mesothelial cells in the early stages of this type of dialysis (Figure 6BFigure 6
Evidence of Epithelial-to-Mesenchymal Transition of Mesothelial Cells in Peritoneal Tissue of Patients Undergoing Continuous Ambulatory Peritoneal Dialysis.). In biopsy specimens from eight patients who had undergone such dialysis for 8 to 77 months, the monolayer of mesothelial cells disappeared, and elongated mesothelial cells positive for cytokeratin and ICAM-1 were found embedded in the fibrotic tissue (Figure 6C and Figure 6D); these specimens corresponded to cultures of nonepithelioid mesothelial cells from effluent.Discussion
Peritoneal dialysis is an increasingly common alternative to hemodialysis. However, the procedure subjects mesothelial cells to high osmotic pressure and bioincompatible substances. Studies using standard histologic techniques on peritoneum from patients undergoing continuous ambulatory peritoneal dialysis show a complete loss of the monolayer of mesothelial cells and fibrosis, which might be responsible for the ultimate functional failure of the peritoneal membrane.1 Our data show that mesothelial cells undergo a transition from an epithelial phenotype to a mesenchymal phenotype during peritoneal dialysis, with the induction of snail expression and a dramatic down-regulation of E-cadherin expression. Moreover, these findings are evidence of a direct and active role of mesothelial cells in the tissue fibrosis and failure of ultrafiltration in this process, generating new fibroblastic cells and leading to peritoneal fibrosis.
Previous studies have characterized the cobblestone-like mesothelial cells from peritoneal effluents as indistinguishable from mesothelial cells derived from omentum.10 However, even early in continuous ambulatory peritoneal dialysis, a loss of cuboid morphology is observed both in vivo and ex vivo, accompanied by an induction of snail expression that down-regulates E-cadherin expression, even when cells retain an epithelioid appearance. If peritoneal dialysis is continued, long-term exposure to mechanical denudation, profibrotic factors such as TGF-β, and inflammatory cytokines may induce a complete transition of mesothelial cells, which could be responsible for tissue fibrosis and failure of ultrafiltration. Patients with recurrent episodes of peritonitis have high levels of expression of TGF-β24 and have accelerated failure of ultrafiltration.4
The fact that mesothelial cells undergo epithelial-to-mesenchymal transition during continuous ambulatory peritoneal dialysis may change our view of the pathophysiology of ultrafiltration failure. Our data reveal a series of markers such as snail, E-cadherin, and α2 integrin that are already modified in the early phases of the transdifferentiation process. In addition, ICAM-1 appears to be a potential marker that discriminates between mesothelial cells and fibroblasts. All these markers may be useful in the follow-up of patients undergoing peritoneal dialysis and in the development of new solutions for peritoneal dialysis. Furthermore, these data suggest new therapeutic targets that might ultimately prevent the fibrosis associated with continuous ambulatory peritoneal dialysis.
Supported by Fresenius Medical Care; by grants (01/0063-02 to Dr. Selgas and 00/0602 to Dr. López-Cabrera) from the Fondo de Investigaciones Sanitarias; and by a grant (02-00536 to Dr. Sánchez-Madrid) from the Programa de Biología Molecular y Celular.
Drs. Yáñez-Mó and Lara-Pezzi contributed equally to the article.
We are indebted to Angela Nieto for critical discussion and to Francisco Rodríguez for statistical analysis of the data.
Source Information
From the Servicio de Inmunología (M.Y.-M., M.R.-H., C.D.-J., F.S.-M.), Biología Molecular (E.L.-P., C.G., M.L.-C.), and Nefrología (R.S., A.A., J.A.S.-T., V.A., A.C.), Hospital Universitario de la Princesa, Universidad Autónoma de Madrid; the Servicio de Nefrología, Hospital Universitario La Paz (M.A.B., M.A.C., G.P.); and the Instituto Reina Sofía de Investigaciones Nefrológicas (M.Y.-M., E.L.-P., R.S., M.R.-H., C.D.-J., J.A.J.-H., A.A., J.A.S.-T., M.A.B., V.A., M.A.C., G.P., A.C., C.G., F.S.-M., M.L.-C.) — all in Madrid; the Servicio de Anatomía Patológica, Hospital Universitario de Guadalajara, Guadalajara, Spain (J.A.J.-H.).
Address reprint requests to Dr. López-Cabrera at the Departamento de Biología Molecular, Hospital Universitario de la Princesa, C/Diego de León no. 62, 28006 Madrid, Spain, or at mlopez@hlpr.insalud.es.
- References
References
1
Krediet RT . The peritoneal membrane in chronic peritoneal dialysis patients. Kidney Int 1999;55:341-356
CrossRef | Web of Science | Medline2
Brulez HF ,Verbrugh HA . First-line defense mechanisms in the peritoneal cavity during peritoneal dialysis. Perit Dial Int 1995;15:Suppl:S24-S33
Web of Science | Medline3
Chaimovitz C . Peritoneal dialysis. Kidney Int 1994;45:1226-1240[Erratum, Kidney Int 1994;46:285.]
CrossRef | Web of Science | Medline4
Selgas R ,Fernandez-Reyes MJ ,Bosque E , et al. Functional longevity of the human peritoneum: how long is continuous peritoneal dialysis possible? Results of a prospective medium long-term study. Am J Kidney Dis 1994;23:64-73
Web of Science | Medline5
Dobbie JW . Pathogenesis of peritoneal fibrosing syndromes (sclerosing peritonitis) in peritoneal dialysis. Perit Dial Int 1992;12:14-27
Web of Science | Medline6
Fang CC ,Yen C-J ,Chen Y-M , et al. Pentoxifylline inhibits human peritoneal mesothelial cell growth and collagen synthesis: effects of TGF-β. Kidney Int 2000;57:2626-2633
CrossRef | Web of Science | Medline7
Medcalf JF ,Walls J ,Pawluczyk IZ ,Harris KPG . Effects of glucose dialysate on extracellular matrix production by human peritoneal mesothelial cells (HPMC): the role of TGF-β. Nephrol Dial Transplant 2001;16:1885-1892
CrossRef | Web of Science | Medline8
Rampino T ,Cancarini G ,Gregorini M , et al. Hepatocyte growth factor/scatter factor released during peritonitis is active on mesothelial cells. Am J Pathol 2001;159:1275-1285
CrossRef | Web of Science | Medline9
Yang WS ,Kim BS ,Lee SK ,Park JS ,Kim SB . Interleukin-1β stimulates the production of extracellular matrix in cultured human peritoneal mesothelial cells. Perit Dial Int 1999;19:211-220
Web of Science | Medline10
Leavesley DI ,Stanley JM ,Faull RJ . Epidermal growth factor modifies the expression and function of extracellular matrix adhesion receptors expressed by peritoneal mesothelial cells from patients on CAPD. Nephrol Dial Transplant 1999;14:1208-1216
CrossRef | Web of Science | Medline11
Connell ND ,Rheinwald JG . Regulation of the cytoskeleton in mesothelial cells: reversible loss of keratin and increase in vimentin during rapid growth in culture. Cell 1983;34:245-253
CrossRef | Web of Science | Medline12
Faull RJ ,Stanley JM ,Fraser S ,Power DA ,Leavesley DI . HB-EGF is produced in the peritoneal cavity and enhances mesothelial cell adhesion and migration. Kidney Int 2001;59:614-624
CrossRef | Web of Science | Medline13
Ha H ,Yu MR ,Lee HB . High glucose-induced PKC activation mediates TGF-β1 and fibronectin synthesis by peritoneal mesothelial cells. Kidney Int 2001;59:463-470
CrossRef | Web of Science | Medline14
Ito T ,Yorioka N ,Yamamoto M ,Kataoka K ,Yamakido M . Effect of glucose on intercellular junctions of cultured human peritoneal mesothelial cells. J Am Soc Nephrol 2000;11:1969-1979
Web of Science | Medline15
Massague J . TGF-β signal transduction. Annu Rev Biochem 1998;67:753-791
CrossRef | Web of Science | Medline16
Margetts PJ ,Kolb M ,Galt T ,Hoff CM ,Shockley TR ,Gauldie J . Gene transfer of transforming growth factor-β1 to the rat peritoneum: effects on membrane function. J Am Soc Nephrol 2001;12:2029-2039
Web of Science | Medline17
Hay ED . An overview of epithelio-mesenchymal transformation. Acta Anat (Basel) 1995;154:8-20
CrossRef | Medline18
Birchmeier C ,Birchmeier W ,Brand-Saberi B . Epithelial-mesenchymal transitions in cancer progression. Acta Anat (Basel) 1996;156:217-226
CrossRef | Medline19
Perl AK ,Wilgenbus P ,Dahl U ,Semb H ,Christofori G . A causal role for E-cadherin in the transition from adenoma to carcinoma. Nature 1998;392:190-193
CrossRef | Web of Science | Medline20
Takeichi M . Morphogenetic roles of classic cadherins. Curr Opin Cell Biol 1995;7:619-627
CrossRef | Web of Science | Medline21
Batlle E ,Sancho E ,Franci C , et al. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol 2000;2:84-89
CrossRef | Web of Science | Medline22
Cano A ,Perez-Moreno MA ,Rodrigo I , et al. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol 2000;2:76-83
CrossRef | Web of Science | Medline23
Carver EA ,Jiang R ,Lan Y ,Oram KF ,Gridley T . The mouse snail gene encodes a key regulator of the epithelial-mesenchymal transition. Mol Cell Biol 2001;21:8184-8188
CrossRef | Web of Science | Medline24
Lai KN ,Lai KB ,Lam CW ,Chan TM ,Li FK ,Leung JC . Changes of cytokine profiles during peritonitis in patients on continuous ambulatory peritoneal dialysis. Am J Kidney Dis 2000;35:644-652
CrossRef | Web of Science | Medline25
Yanez-Mo M ,Alfranca A ,Cabanas C , et al. Regulation of endothelial cell motility by complexes of tetraspan molecules CD81/TAPA-1 and CD151/PETA-3 with α3β1 integrin localized at endothelial lateral junctions. J Cell Biol 1998;141:791-804
CrossRef | Web of Science | Medline26
Rousselle P ,Golbik R ,van der Rest M ,Aumailley M . Structural requirement for cell adhesion to kalinin (laminin-5). J Biol Chem 1995;270:13766-13770
CrossRef | Web of Science | Medline27
Lara-Pezzi E ,Serrador JM ,Montoya MC , et al. The hepatitis B virus X protein (HBx) induces a migratory phenotype in a CD44-dependent manner: possible role of HBx in invasion and metastasis. Hepatology 2001;33:1270-1281
CrossRef | Web of Science | Medline28
Suassuna JH ,Neves FCD ,Hartley RB ,Ogg CS ,Cameron JS . Immunohistochemical studies of the peritoneal membrane and infiltrating cells in normal subjects and in patients on CAPD. Kidney Int 1994;46:443-454
CrossRef | Web of Science | Medline29
Yanez-Mo M ,Tejedor R ,Rousselle P ,Sanchez-Madrid F . Tetraspanins in intercellular adhesion of polarized epithelial cells: spatial and functional relationship to integrins and cadherins. J Cell Sci 2001;114:577-587
Web of Science | Medline30
Hemler ME . Integrin associated proteins. Curr Opin Cell Biol 1998;10:578-585
CrossRef | Web of Science | Medline
- Citing Articles (103)
Citing Articles
1
Sándor Katz, Petra Balogh, Nándor Nagy, Anna L. Kiss. (2012) Epithelial-To-Mesenchymal Transition Induced by Freund’s Adjuvant Treatment in Rat Mesothelial Cells: A Morphological and Immunocytochemical Study. Pathology & Oncology Research
CrossRef2
J.-H. Cho, J.-Y. Do, E.-J. Oh, H.-M. Ryu, S.-Y. Park, S.-O. Kim, S.-H. Hyun, H.-J. Seo, G.-H. Kim, J.-Y. Choi, C.-D. Kim, S.-H. Park, Y.-L. Kim. (2011) Are ex vivo mesothelial cells representative of the in vivo transition from epithelial-to-mesenchymal cells in peritoneal membrane?. Nephrology Dialysis Transplantation
CrossRef3
Sally M. Lansley, Richelle G. Searles, Aina Hoi, Carla Thomas, Helena Moneta, Sarah E. Herrick, Philip J. Thompson, Newman Mark, Gregory F. Sterrett, Cecilia M. Prêle, Steven E. Mutsaers. (2011) Mesothelial cell differentiation into osteoblast- and adipocyte-like cells. Journal of Cellular and Molecular Medicine 15:10, 2095-2105
CrossRef4
T. Kushiyama, T. Oda, M. Yamada, K. Higashi, K. Yamamoto, N. Oshima, Y. Sakurai, S. Miura, H. Kumagai. (2011) Effects of liposome-encapsulated clodronate on chlorhexidine gluconate-induced peritoneal fibrosis in rats. Nephrology Dialysis Transplantation 26:10, 3143-3154
CrossRef5
N. Washida, S. Wakino, Y. Tonozuka, K. Homma, H. Tokuyama, Y. Hara, K. Hasegawa, H. Minakuchi, K. Fujimura, K. Hosoya, K. Hayashi, H. Itoh. (2011) Rho-kinase inhibition ameliorates peritoneal fibrosis and angiogenesis in a rat model of peritoneal sclerosis. Nephrology Dialysis Transplantation 26:9, 2770-2779
CrossRef6
T. Bellon, V. Martinez, B. Lucendo, G. del Peso, M. J. Castro, L. S. Aroeira, A. Rodriguez-Sanz, M. Ossorio, R. Sanchez-Villanueva, R. Selgas, M. A. Bajo. (2011) Alternative activation of macrophages in human peritoneum: implications for peritoneal fibrosis. Nephrology Dialysis Transplantation 26:9, 2995-3005
CrossRef7
Mario R. Korte, Denise E. Sampimon, Michiel G. H. Betjes, Raymond T. Krediet. (2011) Encapsulating peritoneal sclerosis: the state of affairs. Nature Reviews Nephrology
CrossRef8
Ramesh Saxena. (2011) Growing a peritoneal dialysis program: A single-center experience. Dialysis & Transplantation 40:8, 343-348
CrossRef9
R. Carmona, E. Cano, E. Grueso, A. Ruiz-Villalba, T. K. Bera, J. Gaztambide, J. C. Segovia, R. Muñoz-Chápuli. (2011) Peritoneal repairing cells: a type of bone marrow derived progenitor cells involved in mesothelial regeneration. Journal of Cellular and Molecular Medicine 15:5, 1200-1209
CrossRef10
Cengiz Candan, Pınar Turhan, Lale Sever, Mahmut Civilibal, Nur Canpolat, Salim Caliskan, Ozgur Kasapcopur, Nil Arisoy. (2011) Dialysate CA125 levels after 5 years on continuous peritoneal dialysis. Pediatric Nephrology 26:5, 783-788
CrossRef11
Jeffrey Perl, Sharon J Nessim, Joanne M Bargman. (2011) The biocompatibility of neutral pH, low-GDP peritoneal dialysis solutions: benefit at bench, bedside, or both?. Kidney International 79:8, 814-824
CrossRef12
Catriona Goodlad, Edwina A. Brown. (2011) Encapsulating Peritoneal Sclerosis: What Have We Learned?. Seminars in Nephrology 31:2, 183-198
CrossRef13
Tom Cornelis, Dimitrios G. Oreopoulos. (2011) Update on potential medical treatments for encapsulating peritoneal sclerosis; human and experimental data. International Urology and Nephrology 43:1, 147-156
CrossRef14
Simon J. Davies, Lily Mushahar, Zanzhe Yu, Mark Lambie. (2011) Determinants of Peritoneal Membrane Function Over Time. Seminars in Nephrology 31:2, 172-182
CrossRef15
M. R. Korte, M. W. Fieren, D. E. Sampimon, H. F. Lingsma, W. Weimar, M. G. H. Betjes, . (2011) Tamoxifen is associated with lower mortality of encapsulating peritoneal sclerosis: results of the Dutch Multicentre EPS Study. Nephrology Dialysis Transplantation 26:2, 691-697
CrossRef16
Carolina Sánchez-Rodríguez, Concepción Peiró, Susana Vallejo, Nuria Matesanz, Mariam El-Assar, Verónica Azcutia, Tania Romacho, Carlos Félix Sánchez-Ferrer, Leocadio Rodríguez-Mañas, Julián Nevado. (2011) Pathways Responsible for Apoptosis Resulting from Amadori-Induced Oxidative and Nitrosative Stress in Human Mesothelial Cells. American Journal of Nephrology 34:2, 104-114
CrossRef17
Sonoo Mizuiri, Hiromichi Hemmi, Michitsune Arita, Reibin Tai, Yoshinari Hattori, Atsuhiko Muto, Yasunori Suzuki, Yasushi Ohashi, Ken Sakai, Atsushi Aikawa. (2011) Effluent Markers Related to Epithelial Mesenchymal Transition with Adjusted Values for Effluent Cancer Antigen 125 in Peritoneal Dialysis Patients. International Journal of Nephrology 2011, 1-5
CrossRef18
Xinrui Tian, Zhuola Liu, Bo Niu, Jianlin Zhang, Thian Kui Tan, So Ra Lee, Ye Zhao, David C. H. Harris, Guoping Zheng. (2011) E-Cadherin/β-Catenin Complex and the Epithelial Barrier. Journal of Biomedicine and Biotechnology 2011, 1-6
CrossRef19
Sukhwinder S Sohal, David Reid, Amir Soltani, Chris Ward, Steven Weston, H Konrad Muller, Richard Wood-Baker, E Haydn Walters. (2011) Evaluation of epithelial mesenchymal transition in patients with chronic obstructive pulmonary disease. Respiratory Research 12:1, 130
CrossRef20
M. A. Bajo, M. L. Perez-Lozano, P. Albar-Vizcaino, G. del Peso, M.-J. Castro, G. Gonzalez-Mateo, A. Fernandez-Perpen, A. Aguilera, R. Sanchez-Villanueva, J. A. Sanchez-Tomero, M. Lopez-Cabrera, M. E. Peter, J. Passlick-Deetjen, R. Selgas. (2011) Low-GDP peritoneal dialysis fluid ('balance') has less impact in vitro and ex vivo on epithelial-to-mesenchymal transition (EMT) of mesothelial cells than a standard fluid. Nephrology Dialysis Transplantation 26:1, 282-291
CrossRef21
R. M. McLoughlin, N. Topley. (2011) Switching on EMT in the peritoneal membrane: considering the evidence. Nephrology Dialysis Transplantation 26:1, 12-15
CrossRef22
Changhwan Kim, Dong-Gyu Kim, Sung-Hoon Park, Yong Il Hwang, Seung Hun Jang, Cheol Hong Kim, Ki-Suck Jung, Kwangseon Min, Jae Woong Lee, Young Sook Jang. (2011) Epithelial to Mesenchymal Transition of Mesothelial Cells in Tuberculous Pleurisy. Yonsei Medical Journal 52:1, 51
CrossRef23
Susan Yung, Tak Mao Chan. (2011) Pathophysiology of the Peritoneal Membrane during Peritoneal Dialysis: The Role of Hyaluronan. Journal of Biomedicine and Biotechnology 2011, 1-11
CrossRef24
Pilar Sandoval, Jesús Loureiro, Guadalupe González-Mateo, Maria L Pérez-Lozano, Alejandra Maldonado-Rodríguez, José A Sánchez-Tomero, Lorea Mendoza, Beatriz Santamaría, Alberto Ortiz, Marta Ruíz-Ortega, Rafael Selgas, Pilar Martín, Francisco Sánchez-Madrid, Abelardo Aguilera, Manuel López-Cabrera. (2010) PPAR-γ agonist rosiglitazone protects peritoneal membrane from dialysis fluid-induced damage. Laboratory Investigation 90:10, 1517-1532
CrossRef25
Cheng Zhu, Peter R. Mertens. (2010) Epithelial–mesenchymal transition to be or not to be? Is the answer yes and no at the same time?. International Urology and Nephrology 42:3, 843-846
CrossRef26
Sukhwinder S. SOHAL, David REID, Amir SOLTANI, Chris WARD, Steven WESTON, H. Konrad MULLER, Richard WOOD-BAKER, Eugene H. WALTERS. (2010) Reticular basement membrane fragmentation and potential epithelial mesenchymal transition is exaggerated in the airways of smokers with chronic obstructive pulmonary disease. Respirology 15:6, 930-938
CrossRef27
Sharon J Nessim, Jeffrey Perl, Joanne M Bargman. (2010) The renin–angiotensin–aldosterone system in peritoneal dialysis: is what is good for the kidney also good for the peritoneum?. Kidney International 78:1, 23-28
CrossRef28
J. H. Cho, I. K. Hur, C. D. Kim, S. H. Park, H. M. Ryu, J. M. Yook, J. Y. Choi, H. J. Choi, H. J. Choi, J. W. Park, J. Y. Do, Y. L. Kim. (2010) Impact of systemic and local peritoneal inflammation on peritoneal solute transport rate in new peritoneal dialysis patients: a 1-year prospective study. Nephrology Dialysis Transplantation 25:6, 1964-1973
CrossRef29
Y. Hotta, K. Kaneko, J. Inuma, Y. Inami, S. Aruga, T. Shimaoka, Y. Sekiguchi, H. Io, C. Hamada, M. Obinata, M. Ueda, Y. Tomino. (2010) Establishment of a peritoneal mesothelial cell line from a transgenic rat harbouring the temperature-sensitive simian virus 40 large T-antigen gene. Nephrology Dialysis Transplantation 25:6, 1825-1832
CrossRef30
A. Pletinck, C. Consoli, M. Van Landschoot, S. Steppan, N. Topley, J. Passlick-Deetjen, R. Vanholder, W. Van Biesen. (2010) Salt intake induces epithelial-to-mesenchymal transition of the peritoneal membrane in rats. Nephrology Dialysis Transplantation 25:5, 1688-1696
CrossRef31
P.J. Phelan, J.J. Walshe, A. Al-Aradi, J.P. Garvey, K. Finnegan, P. O'Kelly, J. McWilliams, J.P. Ti, M.M. Morrin, N. Morgan, P.J. Conlon. (2010) Encapsulating peritoneal sclerosis: experience of a tertiary referral center. Renal Failure 32:4, 459-463
CrossRef32
J. Loureiro, M. Schilte, A. Aguilera, P. Albar-Vizcaino, M. Ramirez-Huesca, M. L. Perez-Lozano, G. Gonzalez-Mateo, L. S. Aroeira, R. Selgas, L. Mendoza, A. Ortiz, M. Ruiz-Ortega, J. van den Born, R. H. J. Beelen, M. Lopez-Cabrera. (2010) BMP-7 blocks mesenchymal conversion of mesothelial cells and prevents peritoneal damage induced by dialysis fluid exposure. Nephrology Dialysis Transplantation 25:4, 1098-1108
CrossRef33
Charles J Diskin. (2010) Lessons From Single Cell Organisms: Insights Into the Antimicrobial and Toxic Effects of Peritoneal Dialysate Bases. Therapeutic Apheresis and Dialysis 14:2, 127-135
CrossRef34
A. O. Phillips, D. J. Fraser. (2010) BMP-7 stops TGF- in peritoneal fibrosis. Nephrology Dialysis Transplantation 25:4, 1036-1038
CrossRef35
T. Miyamoto, M. Tamura, N. Kabashima, R. Serino, T. Shibata, Y. Furuno, M. Miyazaki, R. Baba, N. Sato, Y. Doi, M. Okazaki, Y. Otsuji. (2010) An integrin-activating peptide, PHSRN, ameliorates inhibitory effects of conventional peritoneal dialysis fluids on peritoneal wound healing. Nephrology Dialysis Transplantation 25:4, 1109-1119
CrossRef36
Pranali Patel, Judy West-Mays, Martin Kolb, Juan-Carlos Rodrigues, Catherine M. Hoff, Peter J. Margetts. (2010) Platelet derived growth factor B and epithelial mesenchymal transition of peritoneal mesothelial cells. Matrix Biology 29:2, 97-106
CrossRef37
Yasuhiro Yamauchi, Tadashi Kohyama, Hajime Takizawa, Sumiko Kamitani, Masashi Desaki, Kazutaka Takami, Shin Kawasaki, Jun Kato, Takahide Nagase. (2010) Tumor necrosis factor-αα enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-ββ1. Experimental Lung Research 36:1, 12-24
CrossRef38
Pranali Patel, Yoshimi Sekiguchi, Kook-Hwan Oh, Sarah E Patterson, Martin R J Kolb, Peter J Margetts. (2010) Smad3-dependent and -independent pathways are involved in peritoneal membrane injury. Kidney International 77:4, 319-328
CrossRef39
Jean Paul Thiery, Hervé Acloque, Ruby Y.J. Huang, M. Angela Nieto. (2009) Epithelial-Mesenchymal Transitions in Development and Disease. Cell 139:5, 871-890
CrossRef40
Marcello Guarino, Antonella Tosoni, Manuela Nebuloni. (2009) Direct contribution of epithelium to organ fibrosis: epithelial-mesenchymal transition. Human Pathology 40:10, 1365-1376
CrossRef41
Zeev Estrov. (2009) Stem Cells and Somatic Cells: Reprogramming and Plasticity. Clinical Lymphoma, Myeloma & Leukemia 9:0, S319-S328
CrossRef42
Jian Xu, Samy Lamouille, Rik Derynck. (2009) TGF-β-induced epithelial to mesenchymal transition. Cell Research 19:2, 156-172
CrossRef43
Seung Wan Chea, Kyu-Beck Lee. (2009) TGF-β Mediated Epithelial-Mesenchymal Transition in Autosomal Dominant Polycystic Kidney Disease. Yonsei Medical Journal 50:1, 105
CrossRef44
D. Cina, P. Patel, J. C. Bethune, J. Thoma, J. C. Rodriguez-Lecompte, C. M. Hoff, L. Liu, P. J. Margetts. (2008) Peritoneal morphological and functional changes associated with platelet-derived growth factor B. Nephrology Dialysis Transplantation 24:2, 448-457
CrossRef45
I. Hirahara, Y. Ishibashi, S. Kaname, E. Kusano, T. Fujita. (2008) Methylglyoxal induces peritoneal thickening by mesenchymal-like mesothelial cells in rats. Nephrology Dialysis Transplantation 24:2, 437-447
CrossRef46
Kae Okoshi, Hajime Kubo, Satoshi Nagayama, Chiharu Tabata, Yoshio Kadokawa, Shigeo Hisamori, Yoshikuni Yonenaga, Akihisa Fujimoto, Akira Mori, Hisashi Onodera, Go Watanabe, Yoshiharu Sakai. (2008) All-trans-Retinoic Acid Attenuates Radiation-Induced Intestinal Fibrosis in Mice. Journal of Surgical Research 150:1, 53-59
CrossRef47
R. Vargha, T. O. Bender, A. Riesenhuber, M. Endemann, K. Kratochwill, C. Aufricht. (2008) Effects of epithelial-to-mesenchymal transition on acute stress response in human peritoneal mesothelial cells. Nephrology Dialysis Transplantation 23:11, 3494-3500
CrossRef48
Elizabeth M. Hosfield, Joseph T. Rabban, Lee-may Chen, Charles J. Zaloudek. (2008) Squamous Metaplasia of the Ovarian Surface Epithelium and Subsurface Fibrosis: Distinctive Pathologic Findings in the Ovaries and Fallopian Tubes of Patients on Peritoneal Dialysis. International Journal of Gynecological Pathology 27:4, 465-474
CrossRef49
D. G. Struijk. (2008) Monitoring of the peritoneal membrane. NDT Plus 1:Supplement 4, iv29-iv35
CrossRef50
Thorsten O. Bender, Janusz Witowski, Christoph Aufricht, Michaela Endemann, Ulrich Frei, Jutta Passlick-Deetjen, Achim Jörres. (2008) Biocompatibility of a bicarbonate-buffered amino-acid-based solution for peritoneal dialysis. Pediatric Nephrology 23:9, 1537-1543
CrossRef51
L. P. Kihm, D. Wibisono, S. Muller-Krebs, F. Pfisterer, C. Morath, M. L. Gross, M. Morcos, Y. Seregin, A. Bierhaus, P. P. Nawroth, M. Zeier, V. Schwenger. (2008) RAGE expression in the human peritoneal membrane. Nephrology Dialysis Transplantation 23:10, 3302-3306
CrossRef52
B. Santamaria, A. C. Ucero, A. Reyero, R. Selgas, M. Ruiz-Ortega, M. Catalan, J. Egido, A. Ortiz. (2008) 3,4-Dideoxyglucosone-3-ene as a mediator of peritoneal demesothelization. Nephrology Dialysis Transplantation 23:10, 3307-3315
CrossRef53
M. F. Flessner. (2008) Distributed model of peritoneal transport: implications of the endothelial glycocalyx. Nephrology Dialysis Transplantation 23:7, 2142-2146
CrossRef54
Eric Goffin. (2008) Peritoneal Membrane Structural and Functional Changes during Peritoneal Dialysis. Seminars in Dialysis 21:3, 258-265
CrossRef55
Ramesh Saxena. (2008) Pathogenesis and treatment of peritoneal membrane failure. Pediatric Nephrology 23:5, 695-703
CrossRef56
C.-C. Szeto, K.-M. Chow, B. C.-H. Kwan, K.-B. Lai, K.-Y. Chung, C.-B. Leung, P. K.-T. Li. (2008) The relationship between bone morphogenic protein-7 and peritoneal transport characteristics. Nephrology Dialysis Transplantation 23:9, 2989-2994
CrossRef57
G del Peso, J A Jiménez-Heffernan, M A Bajo, L S Aroeira, A Aguilera, A Fernández-Perpén, A Cirugeda, M J Castro, R de Gracia, R Sánchez-Villanueva, J A Sánchez-Tomero, M López-Cabrera, R Selgas. (2008) Epithelial-to-mesenchymal transition of mesothelial cells is an early event during peritoneal dialysis and is associated with high peritoneal transport. Kidney International 73, S26-S33
CrossRef58
A Canepa, E Verrina, F Perfumo. (2008) Use of new peritoneal dialysis solutions in children. Kidney International 73, S137-S144
CrossRef59
J-C Contreras-Velázquez, V Soto, Y Jaramillo-Rodríguez, L-I Samaniego-Ríos, V Quiñones-Pérez, M ávila, D Amato, R Paniagua. (2008) Clinical outcomes and peritoneal histology in patients starting peritoneal dialysis are related to diabetic status and serum albumin levels. Kidney International 73, S34-S41
CrossRef60
Yoshiaki Nishioka, Masanobu Miyazaki, Katsushige Abe, Akira Furusu, Takashi Harada, Yoshiyuki Ozono, Takashi Taguchi, Takehiko Koji, Shigeru Kohno. (2008) Regeneration of Peritoneal Mesothelium in a Rat Model of Peritoneal Fibrosis. Renal Failure 30:1, 97-105
CrossRef61
Rafael Selgas, Gloria Del Peso, M. Auxiliadora Bajo. (2008) Opinion: What Are the Problems with Using the Peritoneal Membrane for Long-Term Dialysis?. Seminars in Dialysis 21:1, 20-22
CrossRef62
Krzysztof Ksiazek, João F. Passos, Sharon Olijslagers, Gabriele Saretzki, Carmen Martin-Ruiz, Thomas von Zglinicki. (2007) Premature senescence of mesothelial cells is associated with non-telomeric DNA damage. Biochemical and Biophysical Research Communications 362:3, 707-711
CrossRef63
Hiroaki Kajiyama, Kiyosumi Shibata, Kazuhiko Ino, Akihiro Nawa, Shigehiko Mizutani, Fumitaka Kikkawa. (2007) Possible involvement of SDF-1α/CXCR4-DPPIV axis in TGF-β1-induced enhancement of migratory potential in human peritoneal mesothelial cells. Cell and Tissue Research 330:2, 221-229
CrossRef64
Gunnar H. HEINE, Chantal Y. KASTNER, Thomas JAHNKE, Hans KÖHLER, Martin K. KUHLMANN. (2007) Does a history of peritoneal dialysis result in an impaired gastrointestinal life quality?. Hemodialysis International 11:4, 461-467
CrossRef65
Leila Jahangiri ., Seyed Adel Moallem ., Tahereh Foroutan ., Ahmad Hosseini ., Fatemeh Nazemian .. (2007) Characterization and Transdifferentiation of Human Mesothelial Progenitor/Stem Cells of the Peritoneum Cavity. Journal of Biological Sciences 7:7, 1179-1186
CrossRef66
Mufazzal Ahmad, Hemal Shah, Theodori Pliakogiannis, Dimitrios G. Oreopoulos. (2007) Prevention of membrane damage in patient on peritoneal dialysis with new peritoneal dialysis solutions. International Urology and Nephrology 39:1, 299-312
CrossRef67
Hee Jun Cho, Kyoung Eun Baek, Shizuya Saika, Moon-Jin Jeong, Jiyun Yoo. (2007) Snail is required for transforming growth factor-β-induced epithelial–mesenchymal transition by activating PI3 kinase/Akt signal pathway. Biochemical and Biophysical Research Communications 353:2, 337-343
CrossRef68
K Tanabe, Y Maeshima, K Ichinose, H Kitayama, Y Takazawa, K Hirokoshi, M Kinomura, H Sugiyama, H Makino. (2007) Endostatin peptide, an inhibitor of angiogenesis, prevents the progression of peritoneal sclerosis in a mouse experimental model. Kidney International 71:3, 227-238
CrossRef69
Hi Bahl Lee, Hunjoo Ha. (2007) Mechanisms of Epithelial-Mesenchymal Transition of Peritoneal Mesothelial Cells During Peritoneal Dialysis. Journal of Korean Medical Science 22:6, 943
CrossRef70
L Rodríguez-Mañas, C Sánchez-Rodríguez, S Vallejo, M El-Assar, C Peiró, V Azcutia, N Matesanz, C F Sánchez-Ferrer, J Nevado. (2006) Pro-inflammatory effects of early non-enzymatic glycated proteins in human mesothelial cells vary with cell donor's age. British Journal of Pharmacology 149:8, 979-987
CrossRef71
Agnès Boutet, Cristina A De Frutos, Patrick H Maxwell, M José Mayol, J Romero, M Angela Nieto. (2006) Snail activation disrupts tissue homeostasis and induces fibrosis in the adult kidney. The EMBO Journal 25:23, 5603-5613
CrossRef72
Peter J Margetts, Kenneth S Brimble. (2006) Peritoneal dialysis, membranes and beyond. Current Opinion in Nephrology and Hypertension 15:6, 571-576
CrossRef73
Hong-Jun Liu, Chu-Tse Wu, Hai-Feng Duan, Bin Wu, Zhuo-Zhuang Lu, Lisheng Wang. (2006) Adenoviral-mediated gene expression of hepatocyte growth factor prevents postoperative peritoneal adhesion in a rat model. Surgery 140:3, 441-447
CrossRef74
B Rogachev, N Y Ziv, J Mazar, S Nakav, C Chaimovitz, M Zlotnik, A Douvdevani. (2006) Adenosine is upregulated during peritonitis and is involved in downregulation of inflammation. Kidney International 70:4, 675-681
CrossRef75
Hidekazu Sekine, Tatsuya Shimizu, Seiichi Kosaka, Eiji Kobayashi, Teruo Okano. (2006) Cardiomyocyte Bridging Between Hearts and Bioengineered Myocardial Tissues With Mesenchymal Transition of Mesothelial Cells. The Journal of Heart and Lung Transplantation 25:3, 324-332
CrossRef76
Sylvia Stadlmann, Juergen Pollheimer, Kathrin Renner, Alain G. Zeimet, Felix A. Offner, Albert Amberger. (2006) Response of human peritoneal mesothelial cells to inflammatory injury is regulated by interleukin-1b and tumor necrosis factor-a. Wound Repair and Regeneration 14:2, 187-194
CrossRef77
Jean Paul Thiery, Jonathan P. Sleeman. (2006) Complex networks orchestrate epithelial–mesenchymal transitions. Nature Reviews Molecular Cell Biology 7:2, 131-142
CrossRef78
Cheuk-Chun Szeto, Kai-Ming Chow, Ka-Bik Lai, Carol Yi-Ki Szeto, Bonnie Ching-Ha Kwan, Philip Kam-Tao Li. (2006) Connective Tissue Growth Factor Is Responsible for Transforming Growth Factor-Beta-Induced Peritoneal Mesothelial Cell Apoptosis. Nephron Experimental Nephrology 103:4, e166-e174
CrossRef79
J Nevado, S Vallejo, M El-Assar, C Peiró, C F Sánchez-Ferrer, L Rodríguez-Mañas. (2006) Changes in the human peritoneal mesothelial cells during aging. Kidney International 69:2, 313-322
CrossRef80
Ali Akcay, Hasan Micozkadioglu, Fatma Belgin Atac, Erhan Agca, Fatma Nurhan Ozdemir. (2006) Relationship of ENOS and RAS Gene Polymorphisms to Initial Peritoneal Transport Status in Peritoneal Dialysis Patients. Nephron Clinical Practice 104:1, c41-c46
CrossRef81
Luiz S. Aroeira, Abelardo Aguilera, Rafael Selgas, Marta Ramírez-Huesca, M. Luisa Pérez-Lozano, Antonio Cirugeda, M. Auxiliadora Bajo, Gloria del Peso, José A. Sánchez-Tomero, José A. Jiménez-Heffernan, Manuel López-Cabrera. (2005) Mesenchymal Conversion of Mesothelial Cells as a Mechanism Responsible for High Solute Transport Rate in Peritoneal Dialysis: Role of Vascular Endothelial Growth Factor. American Journal of Kidney Diseases 46:5, 938-948
CrossRef82
Julián Nevado, Concepción Peiró, Susana Vallejo, Mariam El-Assar, Nuria Lafuente, Nuria Matesanz, Veronica Azcutia, Elena Cercas, Carlos F Sánchez-Ferrer, Leocadio Rodríguez-Mañas. (2005) Amadori adducts activate nuclear factor-κB-related proinflammatory genes in cultured human peritoneal mesothelial cells. British Journal of Pharmacology 146:2, 268-279
CrossRef83
Gregor Prindull. (2005) Hypothesis: Cell plasticity, linking embryonal stem cells to adult stem cell reservoirs and metastatic cancer cells?. Experimental Hematology 33:7, 738-746
CrossRef84
Ramesh Saxena, Norman M. Caplan, Biff F. Palmer. (2005) Peritoneal Dialysis: A Viable Renal Replacement Therapy Option. The American Journal of the Medical Sciences 330:1, 36-47
CrossRef85
Hideki Yamasaki, Toshihiro Sekimoto, Tadashi Ohkubo, Tsutomu Douchi, Yukihiro Nagata, Masayuki Ozawa, Yoshihiro Yoneda. (2005) Zinc finger domain of Snail functions as a nuclear localization signal for importin β-mediated nuclear import pathway. Genes to Cells 10:5, 455-464
CrossRef86
C. Ward, H. Robertson, I.A. Forrest, J. Lordan, D. Murphy, J.H. Dark, P.A. Corris, D.E.J. Jones, J.A. Kirby. (2005) Hypothesis: Epithelial-to-Mesenchymal Transition is a Common Cause of Chronic Allograft Failure. Transplantation Proceedings 37:2, 977-980
CrossRef87
R. Dale Brown, S. Kelly Ambler, M. Darren Mitchell, Carlin S. Long. (2005) THE CARDIAC FIBROBLAST: Therapeutic Target in Myocardial Remodeling and Failure. Annual Review of Pharmacology and Toxicology 45:1, 657-687
CrossRef88
Cheuk-Chun Szeto, Ka-Bik Lai, Kai-Ming Chow, Carol Yi-Ki Szeto, Teresa Yuk-Hwa Wong, Philip Kam-Tao Li. (2005) Differential Effects of Transforming Growth Factor-Beta on the Synthesis of Connective Tissue Growth Factor and Vascular Endothelial Growth Factor by Peritoneal Mesothelial Cell. Nephron Experimental Nephrology 99:4, e95-e104
CrossRef89
Osamu Ikehara, Hideki Nishimura, Takashi Naito, Chieko Higuchi, Tsutomu Sanaka. (2005) Effects of Neutral pH and Reduced Glucose Degradation Products in a New Peritoneal Dialysis Solution on Morphology of Peritoneal Membrane in Rats. Nephron Experimental Nephrology 100:1, e30-e39
CrossRef90
Hemant K. Roy, Thomas C. Smyrk, Jennifer Koetsier, Thomas A. Victor, Ramesh K. Wali. (2005) The Transcriptional Repressor SNAIL Is Overexpressed in Human Colon Cancer. Digestive Diseases and Sciences 50:1, 42-46
CrossRef91
Steven E. MUTSAERS, Cecilia M. PRELE, Arnold R. BRODY, Steven IDELL. (2004) Pathogenesis of pleural fibrosis. Respirology 9:4, 428-440
CrossRef92
Faustino Marin, M. Angela Nieto. (2004) Expression of chickenslug andsnail in mesenchymal components of the developing central nervous system. Developmental Dynamics 230:1, 144-148
CrossRef93
G. Gillerot. (2004) Genotyping: a new application for the spent dialysate in peritoneal dialysis. Nephrology Dialysis Transplantation 19:5, 1298-1301
CrossRef94
Sarah E. Herrick, Steven E. Mutsaers. (2004) Mesothelial progenitor cells and their potential in tissue engineering. The International Journal of Biochemistry & Cell Biology 36:4, 621-642
CrossRef95
S. TANG, J. C. K. LEUNG, L. Y. Y. CHAN, A. W. L. TSANG, C. X. R. CHEN, W. ZHOU, K. N. LAI, S. H. SACKS. (2004) Regulation of complement C3 and C4 synthesis in human peritoneal mesothelial cells by peritoneal dialysis fluid. Clinical & Experimental Immunology 136:1, 85-94
CrossRef96
J. Witowski. (2004) Peritoneal dialysis with solutions low in glucose degradation products is associated with improved biocompatibility profile towards peritoneal mesothelial cells. Nephrology Dialysis Transplantation 19:4, 917-924
CrossRef97
Steven E Mutsaers. (2004) The mesothelial cell. The International Journal of Biochemistry & Cell Biology 36:1, 9-16
CrossRef98
M. Buemi. (2004) Flowing time on the peritoneal membrane. Nephrology Dialysis Transplantation 19:1, 26-29
CrossRef99
John Ellard. (2003) The future has begun. Australasian Psychiatry 11:4, 473-475
CrossRef100
John D. Williams, Kathrine J. Craig, Chris von Ruhland, Nicholas Topley, Geraint T Williams, . (2003) The natural course of peritoneal membrane biology during peritoneal dialysis. Kidney International 64:s88, S43-S49
CrossRef101
Jean Paul Thiery. (2003) Epithelial–mesenchymal transitions in development and pathologies. Current Opinion in Cell Biology 15:6, 740-746
CrossRef102
Hirokazu Okada, Tsutomu Inoue, Yoshihiko Kanno, Tatsuya Kobayashi, Yusuke Watanabe, Shinichi Ban, Eric G. Neilson, Hiromichi Suzuki. (2003) Selective depletion of fibroblasts preserves morphology and the functional integrity of peritoneum in transgenic mice with peritoneal fibrosing syndrome1. Kidney International 64:5, 1722-1732
CrossRef103
(2003) Peritoneal Dialysis and Epithelial-to-Mesenchymal Transition. New England Journal of Medicine 348:20, 2037-2039
Full Text
- Letters
