Original Article
Brief Report
A Patient with HIV-1 Superinfection
N Engl J Med 2002; 347:731-736September 5, 2002
- Article
The detection of an increasing number of circulating recombinant strains of human immunodeficiency virus type 1 (HIV-1) indicates that genetic recombination can occur in cells infected with two strains of HIV-1.1,2 Coinfection with two circulating strains of HIV-1 has been detected in a few subjects in communities where HIV-1 infection is endemic.3 Coinfection may result from exposure to a second virus either shortly after the initial infection or during the course of established HIV-1 infection; the latter circumstance is called superinfection.
Most viral infections induce lifelong immunity, but reinfection with respiratory viruses such as respiratory syncytial virus is common, most likely because immunity becomes nonprotective or fades. It is thought that HIV-1 superinfection is a rare event1-6 and that it is prevented by previous viral exposure through a phenomenon called superinfection immunity.5 However, HIV-1 superinfection has been induced experimentally in chimpanzees.7 In this animal model and in superinfection induced with the simian immunodeficiency virus in macaques, the second infection produces a slower deterioration in immunity than does the initial infection,7-9 and there is more efficient control of viremia. In this article, we report a case of HIV-1 superinfection.
Case Report
In November 1998, a 38-year-old man presented with an acute retroviral syndrome. Anti–HIV-1 antibodies were undetectable, the level of p24 antigen was greater than 100 pg per millimeter, the plasma level of HIV-1 RNA was 805,000 copies per milliliter, and the CD4 cell count was 684 per cubic millimeter. Sequences of the HIV-1 reverse transcriptase and protease genes revealed no mutations associated with drug resistance and identified the HIV-1 as subtype AE. For years, the patient had had sexual contacts with multiple unknown male partners. He enrolled in the QUEST trial10 in November 1998 and received highly active antiretroviral treatment (HAART) with zidovudine, lamivudine, abacavir, and amprenavir for 27 months. From month 21 to month 27 he participated in a vaccination trial and was randomly assigned to receive ALVAC vector vCP1452.11
Six weeks after the initiation of HAART, the plasma level of HIV-1 RNA declined to 1000 copies per milliliter. Treatment was then interrupted for six weeks because of toxic effects on the liver. After HAART was resumed, the HIV-1 RNA level decreased rapidly, to less than 50 copies per milliliter (Figure 1Figure 1
HIV-1 RNA Levels and CD4 Cell Counts during Acute HIV-1 Infection and 31 Months of Follow-up.). After vaccination, HAART was again interrupted (on January 21, 2001) as part of the vaccine research protocol. In February 2001, the patient's plasma HIV-1 RNA level rose to 80,000 copies per milliliter (the first rebound) and then decreased to 21,000 copies per milliliter. A rapid increase in the HIV-1 RNA level was next observed on April 10 (the second rebound), and for the next four months the level fluctuated between 200,000 and 400,000 copies per milliliter. The patient's symptoms (transient fatigue and fever) were mild, and he declined to resume HAART during this period. His history revealed that he had had several unprotected sexual contacts in Brazil three weeks before the second rebound of viremia. Four months after the second rebound, however, HAART was resumed, and the plasma level of HIV-1 RNA rapidly decreased. Treatment was again interrupted after an increase in the alanine aminotransferase level to 800 U per liter, as compared with a level of 200 U per liter before HAART. At this time, serologic data and quantification of hepatitis C virus (HCV) RNA (Figure 1) documented an acute HCV infection. The increase in alanine aminotransferase was attributed both to HCV infection and to drug-induced toxic effects. Treatment with pegylated interferon and ribavirin was followed by clearance of HCV RNA (to less than 500 copies per milliliter) within two months.Methods
Assays
The levels of HIV-1 and HCV RNA in the plasma were quantitated (Amplicor HIV-1 Monitor Test, version 1.5, Roche Diagnostics), and serologic analyses, including analysis of p24 antigen, were performed with enzyme immunoassays (Abbott). The following steps were performed as previously described12,13: purification of plasma RNA and proviral DNA, population sequencing of HIV-1 reverse transcriptase and protease and of the gag p17 and env C2V3 gene regions, and analyses of sequences.
Subtype-Specific Polymerase Chain Reaction
Primers were selected according to the patient's subtype AE and subtype B protease and reverse-transcriptase sequences, as follows: AE sense primer (position 2289 to 2312, based on the subtype B reference genome HXB2; GenBank accession number, KO3455), 5'ACAGTAAAAATAGGAGGACAG; B sense primer, 5'ATAAAGGTAGGGGGGCAATTAAAG; AE antisense primer (position 2786 to 2806), 5'TCCTGAGTTCTTTTATTGAGC; and B antisense primer (position 2687 to 2712), 5'GATTTTCAGGCCCAATTTTTGAAATT. The polymerase chain reaction (PCR) consisted of 40 amplification cycles at 95°C for 20 seconds and 65°C for 30 seconds. For each PCR, 100 μl of RNA was extracted from plasma.
In mixing experiments, the subtype-specific primers allowed the detection of approximately 20 copies of the homologous subtype among 250,000 copies of the heterologous subtype and did not amplify the heterologous subtype. Successive plasma samples were amplified by both primer pairs within the same experiment. Twenty microliters of the amplicons was placed on a nylon membrane, which was hybridized with digoxigenin–end-labeled probe (2431 to 2451, 5'ATTAAAGCCAGGAATGGATGG) and revealed with the use of anti-digoxigenin Fab fragments conjugated with alkaline phosphatase (DIG High Prime DNA labeling and Detection Starter Kit II reagents, Roche Diagnostics) as recommended by the manufacturer.
HIV-1 Proviral DNA PCR
PCR was performed with 1 μg of DNA purified from peripheral-blood mononuclear cells by nested PCR. The first reaction consisted of 40 amplification cycles at 95°C for 20 seconds and 50°C for 30 seconds with the use of sense and antisense primers (positions 1627 to 1655 and 2791 to 2812 of HXB2). Five percent of the amplicons were introduced into the nested PCR with the use of subtype-specific primers as described above. In mixing experiments, the subtype-specific primers allowed the detection of approximately 10 copies of the homologous proviral DNA subtype among 1000 copies of the heterologous subtype and did not amplify the heterologous subtype. Twenty microliters of the amplicons was subjected to electrophoresis on 2 percent agarose gel and stained with ethidium bromide.
Isolation and Growth of Subtypes AE and B in Vitro
Stored peripheral-blood mononuclear cells collected at the time of acute infection and one month after the second rebound of viremia after the discontinuation of HAART were depleted of CD8 T cells by beads coated with anti-CD8 (Dynabeads, Dynal), cocultivated with phytohemagglutinin-stimulated CD8-depleted peripheral-blood mononuclear cells from a single uninfected blood donor. Culture supernatants were collected during viral exponential growth, which was assessed by quantification of p24 antigen in culture supernatant (detection limit, 3 pg per milliliter). New cultures of CD8-depleted peripheral-blood mononuclear cells (2×106 cells) were inoculated in duplicate with 20 pg and 100 pg of p24 antigen recovered from the primary cultures containing the AE and B subtypes, respectively. Viral replication was monitored by quantification of p24 antigen in the culture supernatants.
Interferon-γ CD8 Enzyme-Linked Immunospot Assay
Peptides (8- to 15-mers) were synthesized according to the patient's available subtype AE and B sequences and his HLA subtypes (HLA-A*01/02 and HLA-B*51/57). CD8 enzyme-linked immunospot assays (Elispot) were performed as previously reported.14 We also used an algorithm to generate a score that would predict the degree of binding between a peptide and an HLA molecule.14
Results
The evolution of HIV-1 viremia and CD4 cell counts is shown in Figure 1. Successive serologic analyses for hepatitis B virus (HBV) and HCV as well as quantification of HCV RNA indicate that the patient was coinfected with HBV and HIV-1 in October or November 1998 and was infected with HCV in about March 2001. Sequencing of the reverse transcriptase and protease genes in three successive plasma samples obtained at the time of acute infection, in a DNA sample obtained in January 2001, and in a plasma sample obtained at the time of the first rebound (in February 2001) identified the HIV-1 subtype AE in all instances (data not shown). Sequencing of the gag p17 and env C2V3 regions performed during the same period also indicated that the AE subtype was present. In contrast, sequencing of reverse transcriptase, protease, gag p17, and env C2V3 from plasma collected in April, May, and November 2001 indicated the presence of the HIV-1 subtype B (GenBank accession numbers: subtype AE, AY122635-40, and subtype B, AF517666-72). Figure 2Figure 2
Phylogenetic Analysis of env C2V3 Sequences. shows the results of the phylogenetic analysis of the env C2V3 sequences. The subtype B sequences in our patient from the end of April 2001 to April 2002 segregated with subtype B sequences from Brazil (BR.U16219, BR.U08800, and BR.U08799), with a bootstrap value of 86 percent.To enhance the sensitivity of the detection of HIV-1 species, we performed plasma PCR with subtype B- and AE-specific primers. The only detectable virus circulating in plasma during the acute HIV-1 infection from November 1998 to March 2001 was of the AE subtype (Figure 3AFigure 3
HIV-1 Subtype-Specific Analysis of Plasma RNA and Proviral DNA Amplified by the Polymerase Chain Reaction.). In April 2001, during the second rebound of viremia, amplicons from both the AE subtype (weak staining) and B subtype (predominant staining) were detected. In subsequent plasma samples, the B subtype was predominant, with intermittent traces of the AE subtype. Only the AE-specific primers amplified proviral DNA purified from peripheral-blood mononuclear cells collected in November 1998 and March 2001, whereas both AE- and B-specific primers amplified DNA collected in April 2001 (Figure 3B). Three months later, only B subtype amplicons were detectable.The responses of CD8 cells to the patient's AE- and B-specific epitopes were investigated with the use of enzyme-linked immunospot assays. Only cells directed against AE-specific epitope SLYNTVATL (denoted with single-letter codes for amino acids) were detected between November 1998 and March 2001 (from 595 to 727 spot-forming cells per 106 peripheral-blood mononuclear cells). They markedly decreased in number after the switch to the B subtype (epitope SLFNTIAVL) in April 2001 (100 spot-forming cells per 106 peripheral-blood mononuclear cells) (Table 1Table 1
Responses of CD8 Cells to Peptide-Specific Epitopes.). This B sequence, which contained mutations affecting the HLA-A2 binding score (which was 157 for the AE peptide and 75 for the B peptide), was not recognized at any time. In addition, 10 other reverse-transcriptase peptides corresponding to AE or B sequences were tested but were not identified at any time.We assessed the growth of subtype AE and B isolates in cultures with inocula of 20 pg and 100 pg of p24 antigen. The release of p24 antigen in culture supernatant was detected on day 3 with both the 100-pg and 20-pg inocula of B isolate, whereas with the subtype AE isolate, p24 antigen was detected only on day 7 (100-pg inoculum) and day 9 (20-pg inoculum).
Discussion
The patient we describe had HIV-1 seroconversion in November 1998 as a result of infection with HIV-1 subtype AE; the infection was successfully treated with HAART. After the interruption of HAART at the end of January 2001, subtype AE viremia rebounded (in February); the viremia then declined during the following two weeks before a second rebound, at which time the HIV-1 RNA level plateaued at 400,000 copies per milliliter. This second rebound involved HIV-1 subtype B, which rapidly replaced subtype AE. This subtype B virus segregated with isolates from Brazil, a finding consistent with the patient's recent travel and sexual exposures in that country.
This observation provides strong evidence of HIV-1 superinfection. To rule out coinfection, we attempted to amplify subtype B by means of subtype-specific PCR. We failed to detect subtype B in plasma RNA or in proviral DNA samples obtained up until the second viremia rebound. In addition, the subtype B isolate had a higher replicative capacity in vitro than the subtype AE isolate and, once detected, rapidly replaced subtype AE in vivo.
Strong, HIV-1–specific CD8-cell responses were directed against a single AE-derived epitope during the period of infection with subtype AE. None of the subtype B epitopes derived from the patient's sequences were recognized at any time during either subtype AE or subtype B infection. The drop in subtype AE CD8 cells at the time of the switch in subtypes could be attributed to the sequence variation in the B epitope that affected HLA-binding capacity. That the inhibition of subtype AE replication was due to an immune response to ALVAC epitopes after immunization cannot be ruled out, since the p17 peptide SLYNTVATL in the patient's AE was identical to the “subtype B” gag sequence inserted into ALVAC.11
The biologic course after HIV-1 subtype B superinfection was characterized by the persistence of high plasma levels of HIV-1 RNA and a loss of 300 CD4 cells per cubic millimeter within the four months after the emergence of subtype B. The subtype B superinfection led to rapid progression of disease,16 in contrast to the pattern of disease observed after experimental superinfection in monkeys.7-9 The early initiation of HAART in our patient may have limited his exposure to HIV-1 antigens and his HIV-1–specific immune responses. In North America and western Europe, subtype B predominates and diversifies rapidly within individual patients,17 rendering the detection of superinfection especially difficult; the frequency of superinfection might thus be underestimated.
Our data indicate that natural infection does not necessarily induce cross-clade protection. There should be close monitoring of circulating HIV-1 strains in the context of vaccine development. Our observations also support the use of safe-sex precautions even among HIV-1–infected persons.
Supported by an unrestricted grant from GlaxoSmithKline and by a grant (3345-64120.00) from the Swiss National Research Foundation.
We are indebted to Kim Zollinger, Chantal Gaille, Laurence Wegmann, and Virginie Perrin for excellent technical support and to Anne-Marie Alajarin for editorial help.
Source Information
From the Division of Infectious Diseases, University of Geneva, Geneva (S.J., M.-C.B., L.K., S.Y., B.H., L.P.); the Laboratoire d'Immunologie Cellulaire, Hôpital Pitié Salpêtrière, Paris (A.S., B.A.); and Clinical Development Medical Affairs, GlaxoSmithKline, Greenford, United Kingdom (L.-E.G.).
Address reprint requests to Dr. Perrin at the Laboratory of Virology, Geneva University Hospital, 1211 Geneva 14, Switzerland, or at luc.perrin@hcuge.ch.
- References
References
1
Korber B ,Gaschen B ,Yusim K ,Thakallapally R ,Kesmir C ,Detours V . Evolutionary and immunological implications of contemporary HIV-1 variation. Br Med Bull 2001;58:19-42
CrossRef | Web of Science | Medline2
HIV sequence data base: the circulating recombinant forms (CRFs) of HIV-1. Los Alamos, N.M.: Los Alamos National Laboratory, 2002. (Also available at http://hiv-web.lanl.gov/CRFs/CRFs.html.)
3
Kampinga GA ,Simonon A ,Van de Perre P ,Karita E ,Msellati P ,Goudsmit J . Primary infections with HIV-1 of women and their offspring in Rwanda: findings of heterogeneity at seroconversion, coinfection, and recombinants of HIV-1 subtypes A and C. Virology 1997;227:63-76
CrossRef | Web of Science | Medline4
Zhu T ,Wang N ,Carr A ,Wolinsky S ,Ho DD . Evidence for coinfection by multiple strains of human immunodeficiency virus type 1 subtype B in an acute seroconvertor. J Virol 1995;69:1324-1327
Web of Science | Medline5
Malim MH ,Emerman M . HIV-1 sequence variation: drift, shift, and attenuation. Cell 2001;104:469-472
CrossRef | Web of Science | Medline6
Angel JB, Kravcik S, Balaskas E, et al. Documentation of HIV-1 superinfection and acceleration of disease progression. In: Program and abstracts of the 7th Conference on Retroviruses and Opportunistic Infections, San Francisco, January 30–February 2, 2000. San Francisco: Foundation for Retrovirology and Human Health, 2000:235. abstract.
7
Shibata R ,Siemon C ,Cho MW , et al. Resistance of previously infected chimpanzees to successive challenges with a heterologous intraclade B strain of human immunodeficiency virus type 1. J Virol 1996;70:4361-4369
Web of Science | Medline8
Stephens EB ,Joag SV ,Atkinson B , et al. Infected macaques that controlled replication of SIVmac or nonpathogenic SHIV developed sterilizing resistance against pathogenic SHIV(KU-1). Virology 1997;234:328-339
CrossRef | Web of Science | Medline9
Stahl-Hennig C ,Dittmer U ,Nisslein T , et al. Rapid development of vaccine protection in macaques by live-attenuated simian immunodeficiency virus. J Gen Virol 1996;77:2969-2981
CrossRef | Web of Science | Medline10
Goh LE ,Perrin L ,Hoen B , et al. Study protocol for the evaluation of the potential for durable viral suppression after quadruple HAART with or without HIV vaccination: the QUEST study. HIV Clin Trials 2001;2:438-444
CrossRef | Medline11
Clinical investigator's brochure, ALVAC(2) 120 (B,MN)GNP (vCP1452). Swiftwater, Pa.: Aventis Pasteur, 1999.
12
Yerly S ,Quadri R ,Negro F , et al. Nosocomial outbreak of multiple bloodborne viral infections. J Infect Dis 2001;184:369-372
CrossRef | Web of Science | Medline13
Yerly S ,Vora S ,Rizzardi P , et al. Acute HIV infection: impact on the spread of HIV and transmission of drug resistance. AIDS 2001;15:2287-2292
CrossRef | Web of Science | Medline14
Samri A ,Haas G ,Duntze J , et al. Immunogenicity of mutations induced by nucleoside reverse transcriptase inhibitors for human immunodeficiency virus type 1-specific cytotoxic T cells. J Virol 2000;74:9306-9312
CrossRef | Web of Science | Medline15
Felsenstein J. PHYLIP, Phylogeny Inference Package, version 3.6 (alpha). Seattle: Department of Genetics, University of Washington, 2001.
16
Farzadegan H ,Henrard DR ,Kleeberger CA , et al. Virologic and serologic markers of rapid progression to AIDS after HIV-1 seroconversion. J Acquir Immune Defic Syndr Hum Retrovirol 1996;13:448-455
CrossRef | Medline17
Liu SL ,Schacker T ,Musey L , et al. Divergent patterns of progression to AIDS after infection from the same source: human immunodeficiency virus type 1 evolution and antiviral responses. J Virol 1997;71:4284-4295
Web of Science | Medline
- Citing Articles (89)
Citing Articles
1
Y. Omar Whiteside, Anwar T. Merchant, James Hussey, Swann Arp Adams, Wayne A. Duffus. (2012) Occurrence of New Sexually Transmitted Diseases in Males After HIV Diagnosis. AIDS and Behavior
CrossRef2
Carol Dawson Rose, Kimberly A. Koester, Mi-Suk Kang Dufour, Janet J. Myers, Starley B. Shade, Karen McCready, Stephen Morin. (2012) Messages HIV clinicians use in prevention with positives interventions. AIDS Care1-8
CrossRef3
S. Capomaccio, Z.A. Willand, S.J. Cook, C.J. Issel, E.M. Santos, J.K.P. Reis, R.F. Cook. (2012) Detection, Molecular Characterization and Phylogenetic Analysis of Full-Length Equine Infectious Anemia (EIAV) Gag Genes isolated from Shackleford Banks Wild Horses. Veterinary Microbiology
CrossRef4
M. Cornelissen, A. O. Pasternak, M. L. Grijsen, F. Zorgdrager, M. Bakker, P. Blom, J. M. Prins, S. Jurriaans, A. C. van der Kuyl. (2011) HIV-1 Dual Infection Is Associated With Faster CD4+ T-Cell Decline in a Cohort of Men With Primary HIV Infection. Clinical Infectious Diseases
CrossRef5
Laura Waters, Erasmus Smit. (2011) HIV-1 superinfection. Current Opinion in Infectious Diseases1
CrossRef6
Mary E. Pacold, Sergei L. Kosakovsky Pond, Gabriel A. Wagner, Wayne Delport, Daniel L. Bourque, Douglas D. Richman, Susan J. Little, Davey M. Smith. (2011) Clinical, virologic, and immunologic correlates of HIV-1 intraclade B dual infection among Men who Have Sex with Men. AIDS1
CrossRef7
Feili Wei, Xicheng Wang, Lifeng Liu, Rong Gao, Ying Shi, Yulin Zhang, Luxin Qiao, Dexi Chen. (2011) Characterization of HIV Type 1 env Gene in Cerebrospinal Fluid and Blood of Infected Chinese Patients. AIDS Research and Human Retroviruses 27:7, 793-796
CrossRef8
A. Rachinger, P. Manyenga, J. A. Burger, T. L. P. Derks van de Ven, I. G. Stolte, M. Prins, A. B. van 't Wout, H. Schuitemaker. (2011) Low Incidence of HIV-1 Superinfection Even After Episodes of Unsafe Sexual Behavior of Homosexual Men in the Amsterdam Cohort Studies on HIV Infection and AIDS. Journal of Infectious Diseases 203:11, 1621-1628
CrossRef9
Antoinette C. van der Kuyl, Suzanne Jurriaans, Nicole K.T. Back, Herman G. Sprenger, Tjip S. van der Werf, Fokla Zorgdrager, Ben Berkhout, Marion Cornelissen. (2011) Unusual Cluster of HIV Type 1 Dual Infections in Groningen, The Netherlands. AIDS Research and Human Retroviruses 27:4, 429-433
CrossRef10
Deogratius Ssemwanga, Frederick Lyagoba, Nicaise Ndembi, Billy N. Mayanja, Natasha Larke, Shuyi Wang, Joshua Baalwa, Carolyn Williamson, Heiner Grosskurth, Pontiano Kaleebu. (2011) Multiple HIV-1 infections with evidence of recombination in heterosexual partnerships in a low risk Rural Clinical Cohort in Uganda. Virology 411:1, 113-131
CrossRef11
Philip L. Bulterys, Sudeb C. Dalai, David A. Katzenstein. (2010) Viral Sequence Analysis from HIV-Infected Mothers and Infants: Molecular Evolution, Diversity, and Risk Factors for Mother-To-Child Transmission. Clinics in Perinatology 37:4, 739-750
CrossRef12
L. Heath, L. M. Frenkel, B. T. Foley, J. I. Mullins. (2010) Comment on "The Origins of Sexually Transmitted HIV Among Men Who Have Sex with Men". Science Translational Medicine 2:50, 50le1-50le1
CrossRef13
Martine Braibant, Jing Xie, Assia Samri, Henri Agut, Brigitte Autran, Francis Barin. (2010) Disease progression due to dual infection in an HLA-B57-positive asymptomatic long-term nonprogressor infected with a nef-defective HIV-1 strain. Virology 405:1, 81-92
CrossRef14
Andrea Rachinger, Tom Derks van de Ven, Judith A. Burger, Hanneke Schuitemaker, Angélique B. van ’t Wout. (2010) Evaluation of pre-screening methods for the identification of HIV-1 superinfection. Journal of Virological Methods 165:2, 311-317
CrossRef15
Olivier Clerc, Sara Colombo, Sabine Yerly, Amalio Telenti, Matthias Cavassini. (2010) HIV-1 elite controllers: Beware of super-infections. Journal of Clinical Virology 47:4, 376-378
CrossRef16
Isaac Chun-Hai Fung, Manoj Gambhir, Ard van Sighem, Frank de Wolf, Geoffrey P. Garnett. (2010) Superinfection with a heterologous HIV strain per se does not lead to faster progression. Mathematical Biosciences 224:1, 1-9
CrossRef17
Bapi Pahar, Andrew A. Lackner, Michael Piatak, Jeffrey D. Lifson, Xiaolei Wang, Arpita Das, Binhua Ling, David C. Montefiori, Ronald S. Veazey. (2009) Control of viremia and maintenance of intestinal CD4+ memory T cells in SHIV162P3 infected macaques after pathogenic SIVMAC251 challenge. Virology 387:2, 273-284
CrossRef18
Christopher J Weatherall, Anthony D Kelleher, David A Cooper. (2009) Trials and tribulations of HIV vaccines. HIV Therapy 3:2, 145-160
CrossRef19
Vladimir Novitsky, Stephen Lagakos, Michaela Herzig, Caitlin Bonney, Lemme Kebaabetswe, Raabya Rossenkhan, David Nkwe, Lauren Margolin, Rosemary Musonda, Sikhulile Moyo, Elias Woldegabriel, Erik van Widenfelt, Joseph Makhema, M. Essex. (2009) Evolution of proviral gp120 over the first year of HIV-1 subtype C infection. Virology 383:1, 47-59
CrossRef20
Carlos Augusto Yabar, Javier Salvatierra, Eberth Quijano. (2008) Polymorphism, Recombination, and Mutations in HIV Type 1 gag- Infecting Peruvian Male Sex Workers. AIDS Research and Human Retroviruses 24:11, 1405-1413
CrossRef21
Allison M. Land, T. Blake Ball, Ma Luo, John Rutherford, Caitlin Sarna, Charles Wachihi, Joshua Kimani, Francis A. Plummer. (2008) Full-Length HIV Type 1 Proviral Sequencing of 10 Highly Exposed Women from Nairobi, Kenya Reveals a High Proportion of Intersubtype Recombinants. AIDS Research and Human Retroviruses 24:6, 865-872
CrossRef22
Laure Y. Juompan, Karen Hutchinson, David C. Montefiori, Soumya Nidtha, François Villinger, Francis J. Novembre. (2008) Analysis of the Immune Responses in Chimpanzees Infected with HIV Type 1 Isolates. AIDS Research and Human Retroviruses 24:4, 573-586
CrossRef23
Martine Braibant, Henri Agut, Christine Rouzioux, Dominique Costagliola, Brigitte Autran, Francis Barin. (2008) Characteristics of the env Genes of HIV Type 1 Quasispecies in Long-Term Nonprogressors With Broadly Neutralizing Antibodies. JAIDS Journal of Acquired Immune Deficiency Syndromes 47:3, 274-284
CrossRef24
Suzanne Jurriaans, Karolina Kozaczynska, Fokla Zorgdrager, Radjin Steingrover, Jan M Prins, Antoinette C van der Kuyl, Marion Cornelissen. (2008) A Sudden Rise in Viral Load Is Infrequently Associated With HIV-1 Superinfection. JAIDS Journal of Acquired Immune Deficiency Syndromes 47:1, 69-73
CrossRef25
Julie Overbaugh. 2008. Biology of HIV-1 Transmission. , 75-80.
CrossRef26
Mohsin M. Sidat, Anne M. Mijch, Sharon R. Lewin, Jennifer F. Hoy, Jane Hocking, Christopher K. Fairley. (2008) Incidence of putative HIV superinfection and sexual practices among HIV-infected men who have sex with men. Sexual Health 5:1, 61
CrossRef27
Mark A. Wainberg, Marco Petrella. 2008. Development and Transmission of HIV Drug Resistance. , 149-159.
CrossRef28
G. S. Gottlieb, D. C. Nickle, M. A. Jensen, K. G. Wong, R. A. Kaslow, J. C. Shepherd, J. B. Margolick, J. I. Mullins. (2007) HIV Type 1 Superinfection with a Dual-Tropic Virus and Rapid Progression to AIDS: A Case Report. Clinical Infectious Diseases 45:4, 501-509
CrossRef29
Valérie Courgnaud, Rémonie Seng, Pierre Becquart, Abdel Boulahtouf, Christine Rouzioux, Faroudy Boufassa, Christiane Deveau, Philippe Van De Perre, Laurence Meyer, Vincent Foulongne. (2007) HIV-1 co-infection prevalence in two cohorts of early HIV-1 seroconverters in France. AIDS 21:8, 1055-1056
CrossRef30
Nicole M.C. van Kesteren, Harm J. Hospers, Gerjo Kok. (2007) Sexual risk behavior among HIV-positive men who have sex with men: A literature review. Patient Education and Counseling 65:1, 5-20
CrossRef31
Nicole M.C. Van Kesteren, Gerjo Kok, Harm J. Hospers, Jan Schippers, Wencke De Wildt. (2006) Systematic Development of a Self-Help and Motivational Enhancement Intervention to Promote Sexual Health in HIV-Positive Men Who Have Sex with Men. AIDS Patient Care and STDs 20:12, 858-875
CrossRef32
Andrew M. L. Lever. 2006. AIDS/HIV, Molecular and Cell Biology. .
CrossRef33
Karl-Heinz Herbinger, Martina Gerhardt, Sucheep Piyasirisilp, Doreen Mloka, Miguel A. Arroyo, Oliver Hoffmann, Leonard Maboko, Deborah L. Birx, Donan Mmbando, Francine E. Mccutchan, Michael Hoelscher. (2006) Frequency of HIV Type 1 Dual Infection and HIV Diversity: Analysis of Low- and High-Risk Populations in Mbeya Region, Tanzania. AIDS Research and Human Retroviruses 22:7, 599-606
CrossRef34
Gayatri C. Jayaraman, Chris P. Archibald, John Kim, Michael L. Rekart, Ameeta E. Singh, Sonia Harmen, Michelyn Wood, Paul Sandstrom. (2006) A Population-Based Approach to Determine the Prevalence of Transmitted Drug-Resistant HIV Among Recent Versus Established HIV Infections. JAIDS Journal of Acquired Immune Deficiency Syndromes 42:1, 86-90
CrossRef35
P. N. Fernández Larrosa, A. Ceballos, G. Andreani, S. Marquina, L. Martínez Peralta, R. D. Rabinovich. (2006) Viral reactivation and pseudotype production in an in vitro superinfection system with two different strains of HIV-1. Archives of Virology 151:4, 651-662
CrossRef36
Peter V Chin-Hong, Steven G Deeks, Teri Liegler, Elilta Hagos, Melissa R Krone, Robert M Grant, Jeffrey N Martin. (2005) High-Risk Sexual Behavior in Adults With Genotypically Proven Antiretroviral-Resistant HIV Infection. JAIDS Journal of Acquired Immune Deficiency Syndromes 40:4, 463-471
CrossRef37
Perry N. Halkitis, Leo Wilton, Jack Drescher. (2005) Introduction: Why Barebacking?. Journal of Gay & Lesbian Psychotherapy 9:3-4, 1-8
CrossRef38
Michael Shernoff. (2005) Condomless Sex: Considerations for Psychotherapy with Individual Gay Men and Male Couples Having Unsafe Sex. Journal of Gay & Lesbian Psychotherapy 9:3-4, 149-169
CrossRef39
Michael J Kozal, K Rivet Amico, Jennifer Chiarella, Deborah Cornman, William Fisher, Jeffrey Fisher, Gerald Friedland. (2005) HIV Drug Resistance and HIV Transmission Risk Behaviors Among Active Injection Drug Users. JAIDS Journal of Acquired Immune Deficiency Syndromes 40:1, 106-109
CrossRef40
Ricardo Sobhie Diaz, Regina Pardini, Márcia Catroxo, Eva A. Operskalski, James W. Mosley, Michael P Busch. (2005) HIV-1 superinfection is not a common event. Journal of Clinical Virology 33:4, 328-330
CrossRef41
Davey M Smith, Joseph K Wong, George K Hightower, Caroline C Ignacio, Kersten K Koelsch, Christos J Petropoulos, Douglas D Richman, Susan J Little. (2005) HIV drug resistance acquired through superinfection. AIDS 19:12, 1251-1256
CrossRef42
André Inwoley, Patricia Recordon-Pinson, Marion Dupuis, Jessintha Gaston, Mathieu Genête, Albert Minga, Franck Letourneur, Fran^ois Rouet, Jeannine Choppin, Hervé Fleury, Jean-Gérard Guillet, Muriel Andrieu. (2005) Cross-Clade Conservation of HIV Type 1 Nef Immunodominant Regions Recognized by CD8 + T Cells of HIV Type 1 CRF02_AG-Infected Ivorian (West Africa). AIDS Research and Human Retroviruses 21:7, 620-628
CrossRef43
Robert H. Remien, Perry N. Halkitis, Ann O’Leary, Richard J. Wolitski, Cynthia A. Gómez. (2005) Risk Perception and Sexual Risk Behaviors Among HIV-Positive Men on Antiretroviral Therapy. AIDS and Behavior 9:2, 167-176
CrossRef44
Matthias L Cavassini, Valérie D’Acremont, Hansjakob Furrer, Blaise Genton, Philip E Tarr. (2005) Pharmacotherapy, vaccines and malaria advice for HIV-infected travellers. Expert Opinion on Pharmacotherapy 6:6, 891-913
CrossRef45
Vicki Brower. (2005) New superbug or tempest in a teapot?. EMBO reports 6:6, 502-504
CrossRef46
Malini Soogoor, Eric S. Daar. (2005) Primary human immunodeficiency virus type 1 infection. Current HIV/AIDS Reports 2:2, 55-60
CrossRef47
Perry N Halkitis, Kelly A Green, Robert H Remien, Michael J Stirratt, Colleen C Hoff, Richard J Wolitski, Jeffrey T Parsons. (2005) Seroconcordant sexual partnerings of HIV-seropositive men who have sex with men. AIDS 19:Supplement 1, S77-S86
CrossRef48
Barry D Adam, Winston Husbands, James Murray, John Maxwell. (2005) Risk construction in the reinfection discourses of HIV-positive men. Health, Risk & Society 7:1, 63-71
CrossRef49
Laura H. Bachmann, Diane M. Grimley, Yvonne Waithaka, Renee Desmond, Michael S. Saag, Edward W. Hook. (2005) Sexually Transmitted Disease/HIV Transmission Risk Behaviors and Sexually Transmitted Disease Prevalence Among HIV-Positive Men Receiving Continuing Care. Sexually Transmitted Diseases 32:1, 20-26
CrossRef50
Guido van Marle, Christopher Power. (2005) Human immunodeficiency virus type 1 genetic diversity in the nervous system: Evolutionary epiphenomenon or disease determinant?. Journal of Neurovirology 11:2, 107-128
CrossRef51
Michael M. Thomson, María Sierra, Amilcar Tanuri, Silvia May, Gema Casado, Nuria Manjón, Rafael Nájera. (2004) Analysis of Near Full-Length Genome Sequences of HIV Type 1 BF Intersubtype Recombinant Viruses from Brazil Reveals Their Independent Origins and Their Lack of Relationship to CRF12_BF. AIDS Research and Human Retroviruses 20:10, 1126-1133
CrossRef52
Bikram Chakraborty, Luisa Valer, Carmen De Mendoza, Vicente Soriano, Miguel E. Quiñones-mateu. (2004) Failure to Detect Human Immunodeficiency Virus Type 1 Superinfection in 28 HIV-Seroconcordant Individuals with High Risk of Reexposure to the Virus. AIDS Research and Human Retroviruses 20:9, 1026-1031
CrossRef53
Bluma Brenner, Jean-Pierre Routy, Yudong Quan, Daniela Moisi, Maureen Oliveira, Dan Turner, Mark A Wainberg. (2004) Persistence of multidrug-resistant HIV-1 in primary infection leading to superinfection. AIDS 18:12, 1653-1660
CrossRef54
Grant Nash Colfax, Robert Guzman, Sarah Wheeler, Gordon Mansergh, Gary Marks, Melissa Rader, Susan P. Buchbinder. (2004) Beliefs About HIV Reinfection (Superinfection) and Sexual Behavior Among a Diverse Sample of HIV-Positive Men Who Have Sex With Men. JAIDS Journal of Acquired Immune Deficiency Syndromes 36:4, 990-992
CrossRef55
Brigitte Autran, Dominique Costagliola, Robert Murphy, Christine Katlama. (2004) Evaluating therapeutic vaccines in patients infected with HIV. Expert Review of Vaccines 3:4s1, S169-S177
CrossRef56
Olivier Manigart, Val??rie Courgnaud, Oumar Sanou, Diane Val??a, Nicolas Nagot, Nicolas Meda, Eric Delaporte, Martine Peeters, Philippe Van de Perre. (2004) HIV-1 superinfections in a cohort of commercial sex workers in Burkina Faso as assessed by an autologous heteroduplex mobility procedure. AIDS 18:12, 1645-1651
CrossRef57
Lance S. Weinhardt, Jeffrey A. Kelly, Michael J. Brondino, Mary Jane Rotheram-Borus, Sheri B. Kirshenbaum, Margaret A. Chesney, Robert H. Remien, Stephen F. Morin, Marguerita Lightfoot, Anke A. Ehrhardt, Mallory O. Johnson, Sheryl L. Catz, Steven D. Pinkerton, Eric G. Benotsch, Daniel Hong, Cheryl Gore-Felton. (2004) HIV Transmission Risk Behavior Among Men and Women Living With HIV in 4 Cities in the United States. JAIDS Journal of Acquired Immune Deficiency Syndromes 36:5, 1057-1066
CrossRef58
J I Mullins, David C Nickle, Laura Heath, Allen G Rodrigo, Gerald H Learn. (2004) Immunogen sequence: the fourth tier of AIDS vaccine design. Expert Review of Vaccines 3:4s1, S151-S159
CrossRef59
Kimber L Gross, Travis C Porco, Robert M Grant. (2004) HIV-1 superinfection and viral diversity. AIDS 18:11, 1513-1520
CrossRef60
David A Garber, Guido Silvestri, Mark B Feinberg. (2004) Prospects for an AIDS vaccine: three big questions, no easy answers. The Lancet Infectious Diseases 4:7, 397-413
CrossRef61
Talal A. Sallam, C.Y. William Tong. (2004) African links and hepatitis B virus genotypes in the Republic of Yemen. Journal of Medical Virology 73:1, 23-28
CrossRef62
Julian W. Tang, Deenan Pillay. (2004) Transmission of HIV-1 drug resistance. Journal of Clinical Virology 30:1, 1-10
CrossRef63
Hans H. Hirsch, Gilbert Kaufmann, Pedram Sendi, Manuel Battegay. (2004) Immune Reconstitution in HIV‐Infected Patients. Clinical Infectious Diseases 38:8, 1159-1166
CrossRef64
Jason T. Blackard, Kenneth H. Mayer. (2004) HIV Superinfection in the Era of Increased Sexual Risk-Taking. Sexually Transmitted Diseases 31:4, 201-204
CrossRef65
Yutaka Takebe, Shigeru Kusagawa, Kazushi Motomura. (2004) Molecular epidemiology of HIV: Tracking AIDS pandemic. Pediatrics International 46:2, 236-244
CrossRef66
Jonathan B Angel, Yu-Wen Hu, Stephen Kravcik, Rose Tsui, Kok H Lee, Jason Barbour, Evan Balaskas, Bernard M Branson, Eric L Delwart, Robert M Grant. (2004) Virological evaluation of the ???Ottawa case??? indicates no evidence for HIV-1 superinfection. AIDS 18:2, 331-334
CrossRef67
Willy MJM Bogers, Lesley A Bergmeier, Julian Ma, Herman Oostermeijer, Yufei Wang, Charles G Kelly, Peter ten Haaft, Mahavir Singh, Jonathan L Heeney, Thomas Lehner. (2004) A novel HIV-CCR5 receptor vaccine strategy in the control of mucosal SIV/HIV infection. AIDS 18:1, 25-36
CrossRef68
Guowei Fang, Barbara Weiser, Carla Kuiken, Sean M Philpott, Sarah Rowland-Jones, Francis Plummer, Joshua Kimani, Binshan Shi, Rupert Kaul, Job Bwayo, Omu Anzala, Harold Burger. (2004) Recombination following superinfection by HIV-1. AIDS 18:2, 153-159
CrossRef69
Bikram Chakraborty, Patti Kiser, Hector R Rangel, Jan Weber, Muneer Mirza, Michael L Marotta, Robert Asaad, Benigno Rodriguez, Hernan Valdez, Michael M Lederman, Miguel E Quiñones-Mateu. (2004) Can HIV-1 superinfection compromise antiretroviral therapy?. AIDS 18:1, 131-134
CrossRef70
Megan C. Steain, Bin Wang, Dominic E. Dwyer, Nitin K. Saksena. (2004) HIV-1 co-infection, superinfection and recombination. Sexual Health 1:4, 239
CrossRef71
Patricia N Fultz. (2004) HIV-1 superinfections. AIDS 18:1, 115-119
CrossRef72
Martine Peeters, Coumba Toure-Kane, John N Nkengasong. (2003) Genetic diversity of HIV in Africa. AIDS 17:18, 2547-2560
CrossRef73
Todd M Allen, Marcus Altfeld. (2003) HIV-1 superinfection. Journal of Allergy and Clinical Immunology 112:5, 829-835
CrossRef74
Jeffrey T. Parsons, Perry N. Halkitis, Richard J. Wolitski, Cynthia A. Gómez, The Seropositive Urban Men's Study Team. (2003) Correlates of Sexual Risk Behaviors among HIV-Positive Men Who Have Sex with Men. AIDS Education and Prevention 15:5, 383-400
CrossRef75
Neal Padte, Leslie Rowe, Arlene Hurley, Viviana Simon, Martin Markowitz. (2003) Sustained viremia during highly active antiretroviral therapy with accelerated proviral DNA decay in the setting of infection with syphilis. AIDS 17:14, 2142-2143
CrossRef76
Yosuke Maeda, Keisuke Yusa, Shinji Harada. (2003) Enhanced infectivity of HIV-1 by X4 HIV-1 coinfection. Biochemical and Biophysical Research Communications 308:4, 906-913
CrossRef77
Thomas Lehner. (2003) Innate and adaptive mucosal immunity in protection against HIV infection. Vaccine 21, S68-S76
CrossRef78
Kersten K Koelsch, Davey M Smith, Susan J Little, Caroline C Ignacio, Theresa R Macaranas, Andrew JLeigh Brown, Christos J Petropoulos, Douglas D Richman, Joseph K Wong. (2003) Clade B HIV-1 superinfection with wild-type virus after primary infection with drug-resistant clade B virus. AIDS 17:7, F11-F16
CrossRef79
Carol A. Ciesielski. (2003) Sexually transmitted diseases in men who have sex with men: An epidemiologic review. Current Infectious Disease Reports 5:2, 145-152
CrossRef80
Anna R Thorner, Eric S Rosenberg. (2003) Early Versus Delayed Antiretroviral Therapy in Patients with HIV Infection. Drugs 63:13, 1325-1337
CrossRef81
Jay A Levy. (2003) Is HIV superinfection worrisome?. The Lancet 361:9352, 98-99
CrossRef82
Luc Perrin, Laurent Kaiser, Sabine Yerly. (2003) Travel and the spread of HIV-1 genetic variants. The Lancet Infectious Diseases 3:1, 22-27
CrossRef83
Saidou Mamadou, Nicole Vidal, Celine Montavon, Aminata Ben, Ali Djibo, Sanata Rabiou, Garba Soga, Eric Delaporte, Souleymane Mboup, Martine Peeters. (2003) Emergence of Complex and Diverse CRF02-AG/CRF06-cpx Recombinant HIV Type 1 Strains in Niger, West Africa. AIDS Research and Human Retroviruses 19:1, 77-82
CrossRef84
Marcus Altfeld, Todd M. Allen, Xu G. Yu, Mary N. Johnston, Deepak Agrawal, Bette T. Korber, David C. Montefiori, David H. O'Connor, Ben T. Davis, Paul K. Lee, Erica L. Maier, Jason Harlow, Philip J. R. Goulder, Christian Brander, Eric S. Rosenberg, Bruce D. Walker. (2002) HIV-1 superinfection despite broad CD8+ T-cell responses containing replication of the primary virus. Nature 420:6914, 434-439
CrossRef85
Andrew J. McMichael, Sarah L. Rowland-Jones. (2002) HIV: Bad news for stop–start therapy?. Nature 420:6914, 371-373
CrossRef86
Goulder, Philip J.R., Walker, Bruce D., . (2002) HIV-1 Superinfection — A Word of Caution. New England Journal of Medicine 347:10, 756-758
Full Text87
&NA;. (2002) HIV-1 superinfection - implications for vaccine development. Inpharma Weekly &NA;:1355, 12
CrossRef88
Britta Wahren, Alan Landay. (2002) HIV immunology better understood and vaccination attempts started. AIDS, Supplement 16, S85-S88
CrossRef89
Rafael Nájera, Elena Delgado, Lucía Pérez-Alvarez, Michael M. Thomson. (2002) Genetic recombination and its role in the development of the HIV-1 pandemic. AIDS, Supplement 16, S3-S16
CrossRef
