Original Article
Response to Imatinib Mesylate in Patients with Chronic Myeloproliferative Diseases with Rearrangements of the Platelet-Derived Growth Factor Receptor Beta
N Engl J Med 2002; 347:481-487August 15, 2002
- Abstract
Background
A small proportion of patients with chronic myeloproliferative diseases have constitutive activation of the gene for platelet-derived growth factor receptor beta (PDGFRB), which encodes a receptor tyrosine kinase. The gene is located on chromosome 5q33, and the activation is usually caused by a t(5;12)(q33;p13) translocation associated with an ETV6-PDGFRB fusion gene. The tyrosine kinase inhibitor imatinib mesylate specifically inhibits ABL, PDGFR, and KIT kinases and has impressive clinical efficacy in BCR-ABL–positive chronic myeloid leukemia.
Methods
We treated four patients who had chronic myeloproliferative diseases and chromosomal translocations involving 5q33 with imatinib mesylate (400 mg daily). Three of the four patients presented with leukocytosis and eosinophilia; their leukemia cells carried the ETV6-PDGFRB fusion gene. The fourth patient had leukocytosis, eosinophilia, and a t(5;12) translocation involving PDGFRB and an unknown partner gene; he also had extensive raised, ulcerated skin lesions that had been present for a long time.
Results
In all four patients, a normal blood count was achieved within four weeks after treatment began. In the patient with skin disease, the lesions began to resolve shortly after treatment began. The t(5;12) translocation was undetectable by 12 weeks in three patients and by 36 weeks in the fourth patient. In the three patients with the ETV6-PDGFRB fusion gene, the transcript level decreased, and in one patient, it became undetectable by 36 weeks. All responses were durable at 9 to 12 months of follow-up.
Conclusions
Imatinib mesylate induces durable responses in patients with chronic myeloproliferative diseases associated with activation of PDGFRB.
Media in This Article
Figure 3
Viability of Mononuclear Cells on Exposure to Imatinib.Figure 2
Two-Color Fluorescence in Situ Hybridization of Cells from Patient 2, with Schematic Representation of Chromosomes 5 and 12 Indicating the Break Points of t(5;12)(q33;p13).Article Activity
- Article
The association of leukemia, eosinophilia, and abnormalities of chromosome 12p13 was originally reported by Keene et al. in 19871; two of the four patients included in that report also had translocations involving chromosome 5q3. Subsequently, Golub et al.2 showed that the previously described t(5;12)(q31–q33;p13) chromosomal abnormality, characteristic of some cases of chronic myelomonocytic leukemia, was associated with a fusion gene linking TEL (now known as ETV6) with platelet-derived growth factor receptor beta (PDGFRB). At least 34 cases of chronic myeloproliferative disease associated with a t(5;12)(q31–q33;p13) translocation have now been reported,3 and the PDGFRB gene is known to be rearranged in some of these cases. There are also additional cases involving translocations of the PDGFRB-containing region of chromosome 5 — that is, 5q31–q35 — and chromosomal partners other than 12p13.4-6 All these leukemias, although heterogeneous, have some common features — most notably, the frequent presence of eosinophilia in peripheral blood and bone marrow.
Imatinib mesylate (formerly STI571; now Gleevec in the United States and Glivec in Europe [Novartis]) is a 2-phenylaminopyrimidine compound based on a candidate molecule designed specifically to interact with the ATP-binding site of protein tyrosine kinases. Imatinib specifically inhibits the kinase activity of ABL (including BCR-ABL), PDGFRB, and c-KIT. Recently, this compound has shown efficacy in the treatment of chronic myeloid leukemia7-9 and gastrointestinal stromal tumors.10
We report here the results of imatinib treatment in four patients with chronic myeloproliferative diseases characterized by leukocytosis, peripheral-blood eosinophilia, and molecular rearrangements involving the PDGFRB gene. Normal peripheral-blood counts and normal appearances of bone marrow were restored in all patients, and the cytogenetic abnormalities resolved.
Case Reports
Patients 1, 2, and 3
Patients 1, 2, and 3 were men 32, 50, and 68 years of age, respectively, who presented with leukocytosis, mild anemia, and eosinophilia (Table 1Table 1
Clinical and Hematologic Characteristics of Four Patients with PDGFRB-Positive Leukemias.). Bone marrow aspirates and trephine biopsies showed hypercellularity with left-shifted myeloid series and an increase in the numbers of immature and mature eosinophils. Patient 1 was initially treated with hydroxyurea for 16 months until the disease progressed, as evidenced by a rising white-cell count and increasing splenomegaly. Pipobroman and interferon alfa failed to control the white-cell count and induced thrombocytopenia. Treatment with imatinib at a dose of 400 mg daily was begun 48 months after diagnosis. Patients 2 and 3 received no treatment until they began treatment with imatinib (400 mg daily) 9 and 12 months after diagnosis, respectively.Patient 4
Patient 4 was a six-year-old boy who presented in 1987 with a generalized erythematous rash and eosinophilia. Skin biopsy showed a dermal infiltrate of eosinophils and atypical histiocytes that varied in size and nuclear morphology, with sparing of the epidermis and cutaneous appendages. There were no Birbeck granules, and a diagnosis of non-X histiocytosis was made. Over the course of the next two years, the skin condition progressed and raised, infiltrative lesions developed. The appearance of the bone marrow was consistent with a myeloproliferative disease, with hypercellularity and an increased number of eosinophils but without the atypical histiocytes that were present in the skin. Cytogenetic analysis revealed a t(5;12)(q33;q13) translocation in 25 percent of the cells in metaphase. The skin condition and hematologic abnormalities failed to respond to corticosteroids or hydroxyurea, and two years of therapy with interferon alfa provided only minimal benefit. By October 2000, when the patient was 19 years old, 90 percent of the surface of the skin was involved, with disfiguring plaques, nodules, and tumors (Figure 1AFigure 1
Patient 4 at the Beginning of Imatinib Therapy (Panel A) and after Eight Months of Therapy (Panel B).). Extensive areas of ulceration developed on the trunk and limbs. Hydroxyurea was recommenced in December 2000, without benefit. Repeated hospitalizations became necessary for control of pain and skin infection and for surgical débridement. Skin biopsies again showed an infiltrate of atypical histiocytes and numerous eosinophils, with surface ulceration. In March 2001 the patient began receiving imatinib at a dose of 400 mg daily.Methods
Study Design
The Novartis STIB2225 study was designed by the investigators and representatives of the study sponsor, Novartis. It was a phase 2 study of STI571 (now called imatinib mesylate) in patients with life-threatening diseases known to be associated with one or more STI571-sensitive tyrosine kinases. The two patients described here are the only two patients with 5q33 abnormalities. The data presented here were collected, interpreted, and analyzed by the academic investigators, who also wrote the article in collaboration with representatives of Novartis.
Cytogenetic Analysis and Fluorescence in Situ Hybridization
Cytogenetic analysis of bone marrow cells was performed by conventional G-banding. Two-color fluorescence in situ hybridization for the PDGFRB rearrangement was performed in Patients 2 and 4 with two flanking cosmid probes for chromosome 5, 9-4 and 4-1, as previously described.5 A total of 100 cells in interphase were scored.
Identification of ETV6-PDGFRB Fusion Transcript
RNA was reverse-transcribed and tested for the ETV6-PDGFRB fusion by single-step reverse-transcriptase polymerase chain reaction (RT-PCR) (limit of detection, 10–2) and hemi-nested RT-PCR (limit of detection, 10–5). Single-step PCR was performed for 30 cycles at an annealing temperature of 60°C with the use of primers ETV6-J (TTCACCATTCTTCCACCCTGGA) and PD-F (TTGACGGCCACTTTCATCGT). For hemi-nested PCR, the products of this reaction were amplified with primers ETV6-J and PD-C (TGGCTTCTTCTGCCAAAGCA) for 30 cycles at an annealing temperature of 64°C.
In Vitro Studies of Sensitivity to Imatinib
Peripheral-blood specimens were obtained from Patients 2 and 4; cells from leukaphereses performed in five patients with Philadelphia (Ph) chromosome–positive chronic myelogenous leukemia in chronic phase and cells from leukaphereses or bone marrow from three healthy donors were used as controls. All specimens were obtained with the written or oral informed consent of the donors. Mononuclear cells were cultured in RPMI 1640 medium supplemented with 10 percent fetal-calf serum, 2 percent L-glutamine, and 2 percent penicillin–streptomycin. Under these conditions (without additional cytokines), there is no proliferation or differentiation of either normal or leukemic cells. Specimens were cultured (1 million cells per milliliter) in the presence or absence of 1 μm of imatinib and were monitored by trypan blue staining for cell viability every two days.
Results
Cytogenetic Analysis and Fluorescence in Situ Hybridization
All the bone marrow cells in metaphase that we examined from Patients 1, 2, and 3 contained the t(5;12)(q33;p13) translocation. Before treatment with imatinib, 5 of 10 cells in metaphase from Patient 4 (50 percent) contained t(5;12)(q33;q13). Two-color fluorescence in situ hybridization performed on cells from Patients 2 and 4 showed one fused signal and separate red and green signals in more than 80 percent of the cells from each patient, indicating disruption of PDGFRB (Figure 2Figure 2
Two-Color Fluorescence in Situ Hybridization of Cells from Patient 2, with Schematic Representation of Chromosomes 5 and 12 Indicating the Break Points of t(5;12)(q33;p13).). More than 95 percent of the normal control cells had two fused signals.Identification of the ETV6-PDGFRB Fusion Transcript
RT-PCR to detect the ETV6-PDGFRB fusion gene was performed on bone marrow, blood, or both from all patients. Before treatment, products of the expected size were detected in RNA from Patients 1, 2, and 3 by both single-step (395-bp) and hemi-nested (174-bp) RT-PCR techniques (data not shown). These products were not detected in the RNA of Patient 4, in whom an unknown gene at 12q13 is presumably fused to PDGFRB.
Analysis of in Vitro Sensitivity to Imatinib
Mononuclear cells from Patients 2 and 4 were shown to be sensitive to in vitro treatment with imatinib. The survival of normal mononuclear cells was virtually unaffected by culture with 1 μm of imatinib for at least 2 weeks, whereas only 40 percent of cells from Patient 4 were viable by that time, and 100 percent of cells from Patient 2 were dead by the 12th day of culture. The average sensitivity to imatinib of cells from a patient with Ph-positive chronic myelogenous leukemia was intermediate between those of the two patients with PDGFRB abnormalities (Figure 3Figure 3
Viability of Mononuclear Cells on Exposure to Imatinib.).Clinical Outcome
Patients 1, 2, and 3 began treatment with imatinib at a dose of 400 mg daily; Patient 2 was treated within the Novartis STIB2225 study. In Patients 2 and 3, the blood count normalized (with resolution of eosinophilia) within one week. After 12 weeks, 30 of 30 cells in metaphase from Patient 2 and 50 of 50 cells in metaphase from Patient 3 were cytogenetically normal. As of this writing, and after 15 months of therapy in Patient 2 and 12 months of therapy in Patient 3, the appearance of bone marrow aspirate is normal, with eosinophils and their precursors comprising less than 5 percent of nucleated cells. Fluorescence in situ hybridization of bone marrow cells obtained from Patient 2 after nine months of therapy showed that 27 of 200 cells (14 percent) had one fused signal. Peripheral-blood cells obtained after six months of therapy (from both patients) and after nine months of therapy (from Patient 2) tested negative by single-step RT-PCR and positive by the heminested technique. Cells from Patient 2 were negative by both techniques at 12 months.
In Patient 1, the white-cell count normalized within four weeks after the start of treatment, although the platelet count was low, at 68,000 per cubic millimeter. The blood count and bone marrow morphology were normal by 12 weeks. The proportion of cells in metaphase containing a t(5;12)(q31–q33;p13) translocation gradually decreased, and cells from Patient 1 became cytogenetically normal at nine months. He continues to receive imatinib at a dose of 400 mg daily without side effects 13 months after the start of therapy.
Within five days after imatinib treatment began in Patient 4 in the Novartis STIB2225 study, the white-cell count and the eosinophil count had normalized. The skin lesions became flatter and less erythematous, and the ulcerated areas began to granulate; autologous and cadaveric skin grafts were applied to the right wrist, right lower leg, anterior chest wall, and back in order to speed recovery. After four weeks of treatment, cytogenetic analysis of 50 cells in metaphase showed that 100 percent had the 46,XY karyotype, with no evidence of the t(5;12) abnormality. However, the thrombocytosis persisted, and bone marrow aspirate obtained after eight weeks of therapy remained hypercellular, although the eosinophilic component had decreased to 6 percent. The dose of imatinib was therefore gradually increased to 800 mg daily, and the appearance of the bone marrow at 20 weeks was normal. Skin biopsies after 20 weeks of treatment showed xanthomatized cells within the middle dermis. There were no atypical histiocytes or eosinophils. After 15 months of imatinib treatment, the patient is well and free of side effects (Figure 1B). Fluorescence in situ hybridization analysis of bone marrow cells obtained at 12 months showed two fused signals in more than 95 percent of cells — equivalent to the proportion in normal control cells.
Discussion
We have used imatinib mesylate to treat four patients with chromosomal rearrangements involving PDGFRB. All had prompt responses, with normalization of the blood count, disappearance of eosinophilia, resolution of cytogenetic abnormalities, a decrease in or disappearance of fusion transcripts, and in one case, healing of long-standing skin lesions.
The platelet-derived growth factor (PDGF) family includes at least five dimeric forms (PDGF AA, PDGF AB, PDGF BB, PDGF CC, and PDGF DD).11-14 The PDGF dimers activate the receptors specific for PDGF-α (PDGFRA) and PDGF-β (PDGFRB), thereby stimulating the proliferation and migration of mesenchymal cells. PDGFRA and PDGFRB belong to type III–receptor tyrosine kinase families and are characterized by five immunoglobulin-like domains in the extracellular region, a transmembrane domain, an ATP-binding site, and a hydrophilic kinase insert domain in the intracellular portion.15,16 Ligand binding to these receptors results in dimerization of the subunits of the receptor, followed by the activation of the tyrosine kinase domain and autophosphorylation. The resulting phosphotyrosines act as docking sites for intracellular signaling proteins,11,17 and signaling through PDGFRB plays an important part in mitogenesis, cytoskeletal rearrangements, and chemotaxis.
The PDGFRB fusion proteins that result from the various chromosomal translocations can no longer be activated by PDGF, since they do not contain the ligand-binding domain. Instead, the fusion proteins are constitutively active and can transform interleukin-3–dependent cell lines into growth factor–independent cell lines. Furthermore, the ETV6-PDGFRB and RAB5-PDGFRB fusion proteins induce myeloproliferative diseases in mice.6,18,19 It is likely that the partner genes encode a specific dimerization motif that enables the fusion protein to self-associate, mimicking the normal process of receptor activation after ligand binding.
Imatinib is a tyrosine kinase inhibitor that shows specificity at the submicromolar level for ABL, PDGFR, and KIT kinases. It inhibits ligand-stimulated PDGFR tyrosine phosphorylation at a 50 percent inhibitory concentration (IC50) of 0.3 μmol per liter, which is similar to the IC50 for ABL.20 The IC50 of imatinib for the proliferation of cell lines expressing ETV6-ABL is 0.35 μmol per liter, and the IC50 for the proliferation of cell lines expressing ETV6-PDGFRB is 0.15 μmol per liter, indicating that the potency of the drug against ABL and PDGFRB is equivalent.21 Furthermore, the ability of imatinib to inhibit the growth of cell lines transformed by RAB5-PDGFRB and to reverse the leukemic phenotype in a mouse model of ETV6-PDGFRB transformation suggested that this agent might be effective in the treatment of patients with PDGFRB rearrangements.22,23
The four patients with myeloproliferative diseases described here all had a t(5;12) translocation and involvement of the PDGFRB gene. The phenotypes of their diseases were similar in some ways but also had important differences. Patients 1, 2, and 3 presented with peripheral-blood leukocytosis, eosinophilia, an appearance of bone marrow compatible with myeloproliferative diseases, and the well-described ETV6-PDGFRB fusion gene. Patient 4 was more unusual, in that he presented at the age of six years with cutaneous involvement, peripheral-blood eosinophilia, myelodysplasia, and myeloproliferation. This patient was described previously, when the eosinophilia was thought to be reactive because the eosinophils apparently lacked the t(5;12) translocation.24 Over the course of the next 14 years, disfiguring skin disease that was unresponsive to hydroxyurea and interferon alfa was the predominant feature in Patient 4. We remain uncertain whether the cutaneous infiltrates were reactive or were in fact a manifestation of the myeloproliferative disease. However, the strong and rapid response to imatinib suggests a direct relation between the PDGFRB oncoprotein and the mechanism responsible for the cutaneous infiltration. Although Patient 4 has no ETV6 rearrangement and the PDGFRB partner gene has not been identified, it is likely that an activated PDGFRB oncoprotein is responsible for the clinical phenotype.
We have recently reviewed the clinical features of Ph-negative myeloproliferative diseases with translocations of 5q31–35.3 The literature includes 34 patients with the classic t(5;12)(q31–33;p13) translocation, although in some cases, involvement of PDGFRB, ETV6 (TEL), or both was not demonstrated. The majority of patients were male and had peripheral-blood eosinophilia, monocytosis, and splenomegaly. A number of patients had progression to blastic transformation, and the two-year survival rate among the 18 patients who could be evaluated was only 55 percent. An additional 20 patients with reciprocal translocations involving 5q31–q35 but not 12p13 were also described. The phenotypes in this group were more diverse, but certain similarities persisted; all 11 patients who could be evaluated had peripheral-blood eosinophilia. In our series, Patients 1, 2, and 3 had the typical features of the t(5;12) myeloproliferative diseases.
Eosinophilia is a prominent but not invariable feature of transformation induced by the PDGFRB oncoprotein. A number of genes that are important in the proliferation and differentiation of eosinophils are found in the same 5q31–q35 chromosomal region, including interleukin-3, interleukin-4, interleukin-5, and interleukin-13 and granulocyte–macrophage colony-stimulating factor. It is possible that these genes are dysregulated in the translocation process. Furthermore, studies of linkage disequilibrium in a family with familial eosinophilia confirmed the importance of 5q31–q35 in this rare condition25; there were no mutations in the genes for interleukin-3, interleukin-5, and granulocyte–macrophage colony-stimulating factor, but the PDGFRB gene was not studied. Thus, activation of PDGFRB could underlie the eosinophilia in the patients described here, but the precise mechanism remains unknown. Recently, Gleich et al. reported that four of five patients with hypereosinophilic syndrome and normal findings on cytogenetic analysis had a prompt response to imatinib with resolution of peripheral-blood eosinophilia.26 The PDGFRB gene was not studied. The absence of a response in the fifth patient was associated with an elevated interleukin-5 level, perhaps suggesting an alternative mechanism of eosinophilia in this patient. Interleukin-5 levels were considerably elevated in Patient 4 in our series (data not shown), but this elevation did not interfere with the response to imatinib.
Supported by Novartis Pharmaceuticals, Basel, Switzerland, and by the Leukaemia Research Fund, United Kingdom.
We are indebted to Dr. Bridget Wilkins for performing immunophenotyping studies in Patient 4 and to Dr. Elisabeth Buchdunger (Novartis Pharma, Basel, Switzerland) for providing imatinib for the laboratory studies.
Source Information
From the Department of Haematology, Faculty of Medicine, Imperial College, London (J.F.A., J.V.M., B.J.B., D.M., E.O., B.S., J.M.G.); the Department of Hematology, Centre Hospitalier Universitaire Angers, Angers, France (M.G.); the Skin Tumour Unit, St. John's Institute of Dermatology, St. Thomas' Hospital, London (R.R.-J.); Wessex Regional Genetics Laboratory, Salisbury District Hospital, Salisbury, United Kingdom (E.J.B., A.C., N.C.P.C.); the Department of Haematology, Great Ormond Street Hospital for Children, London (J.M.C.); the Department of Hematology, Centre Hospitalier Universitaire Bordeaux, Pessac, France (M.C., F.-X.M.); the Department of Haematology, St. George's Hospital, London (C.E.D.); and Novartis Oncology, Basel, Switzerland (S.D., Z.N., S.S.).
Address reprint requests to Prof. Apperley at the Department of Haematology, Faculty of Medicine, Imperial College of Science, Technology and Medicine, Hammersmith Hospital, Du Cane Rd., London W12 0NN, United Kingdom, or at j.apperley@ic.ac.uk.
- References
References
1
Keene P ,Mendelow B ,Pinto MR , et al. Abnormalities of chromosome 12p13 and malignant proliferation of eosinophils: a nonrandom association. Br J Haematol 1987;67:25-31
CrossRef | Web of Science | Medline2
Golub TR ,Barker GF ,Lovett M ,Gilliland DG . Fusion of PDGF receptor beta to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation. Cell 1994;77:307-316
CrossRef | Web of Science | Medline3
Steer EJ ,Cross NCP . Myeloproliferative disorders with translocations of chromosome 5q31-35: role of the platelet-derived growth factor receptor beta. Acta Haematol 2002;107:113-122
CrossRef | Web of Science | Medline4
Ross TS ,Bernard OA ,Berger R ,Gilliland DG . Fusion of Huntingtin interacting protein 1 to platelet-derived growth factor beta receptor (PDGFbetaR) in chronic myelomonocytic leukemia with t(5;7)(q33;q11.2). Blood 1998;91:4419-4426
Web of Science | Medline5
Kulkarni S ,Heath C ,Parker S , et al. Fusion of H4/D10S170 to the platelet-derived growth factor receptor beta in BCR-ABL-negative myeloproliferative disorders with a t(5;10)(q33;q21). Cancer Res 2000;60:3592-3598
Web of Science | Medline6
Magnusson MK ,Meade KE ,Brown KE , et al. Rabaptin-5 is a novel fusion partner to platelet-derived growth factor β receptor in chronic myelomonocytic leukemia. Blood 2001;98:2518-2525
CrossRef | Web of Science | Medline7
Druker BJ ,Tamura S ,Buchdunger E , et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med 1996;2:561-566
CrossRef | Web of Science | Medline8
Druker BJ ,Talpaz M ,Resta DJ , et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med 2001;344:1031-1037
Full Text | Web of Science | Medline9
Druker BJ ,Sawyers CL ,Kantarjian H , et al. Activity of a specific inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome. N Engl J Med 2001;344:1038-1042[Erratum, N Engl J Med 2001;345:232.]
Full Text | Web of Science | Medline10
Joensuu H ,Roberts PJ ,Sarlomo-Rikala M , et al. Effect of the tyrosine kinase inhibitor STI571 in a patient with a metastatic gastrointestinal stromal tumor. N Engl J Med 2001;344:1052-1056
Full Text | Web of Science | Medline11
Claesson-Welsh L . Platelet-derived growth factor receptor signals. J Biol Chem 1994;269:32023-32026
Web of Science | Medline12
Li X ,Ponten A ,Aase K , et al. PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor. Nat Cell Biol 2000;2:302-309
CrossRef | Web of Science | Medline13
Bergsten E ,Uutela M ,Li X , et al. PDGF-D is a specific, protease-activated ligand for the PDGF beta-receptor. Nat Cell Biol 2001;3:512-516
CrossRef | Web of Science | Medline14
LaRochelle WJ ,Jeffers M ,McDonald WF , et al. PDGF-D, a new protease-activated growth factor. Nat Cell Biol 2001;3:517-521
CrossRef | Web of Science | Medline15
Irusta PM ,DiMaio D . A single amino acid substitution in a WW-like domain of diverse members of the PDGF receptor subfamily of tyrosine kinases causes constitutive receptor activation. EMBO J 1998;17:6912-6923
CrossRef | Web of Science | Medline16
Reilly JT . Class III receptor tyrosine kinases: role in leukaemogenesis. Br J Haematol 2002;116:744-757
CrossRef | Web of Science | Medline17
Heldin CH ,Ostman A ,Ronnstrand L . Signal transduction via platelet-derived growth factor receptors. Biochim Biophys Acta 1998;1378:F79-F113
Web of Science | Medline18
Ritchie KA ,Aprikyan AA ,Bowen-Pope DF , et al. The Tel-PDGFRbeta fusion gene produces a chronic myeloproliferative syndrome in transgenic mice. Leukemia 1999;13:1790-1803
CrossRef | Web of Science | Medline19
Tomasson MH ,Sternberg DW ,Williams IR , et al. Fatal myeloproliferation, induced in mice by TEL/PDGFbetaR expression, depends on PDGFbetaR tyrosines 579/581. J Clin Invest 2000;105:423-432
CrossRef | Web of Science | Medline20
Buchdunger E ,Cioffi CL ,Law N , et al. Abl protein-tyrosine kinase inhibitor STI571 inhibits in vitro signal transduction mediated by c-kit and platelet-derived growth factor receptors. J Pharmacol Exp Ther 2000;295:139-145
Web of Science | Medline21
Carroll M ,Ohno-Jones S ,Tamura S , et al. CGP 57148, a tyrosine kinase inhibitor, inhibits the growth of cells expressing BCR-ABL, TEL-ABL, and TEL-PDGFR fusion proteins. Blood 1997;90:4947-4952
Web of Science | Medline22
Magnusson MK ,Meade KE ,Nakamura R ,Barrett J ,Dunbar CE . Molecular evidence for efficacy of STI-571 in chronic myelomonocytic leukemia (CMML) with a platelet-derived growth factorβ-receptor (PDGFβR) fusion oncogene. Blood 2001;98:631a-631a abstract.
CrossRef | Web of Science23
Tomasson MH ,Williams IR ,Hasserjian R , et al. TEL/PDGFbetaR induces hematologic malignancies in mice that respond to a specific tyrosine kinase inhibitor. Blood 1999;93:1707-1714
Web of Science | Medline24
Jani K ,Kempski HM ,Reeves BR . A case of myelodysplasia with eosinophilia having a translocation t(5;12)(q31;q13) restricted to myeloid cells but not involving eosinophils. Br J Haematol 1994;87:57-60
CrossRef | Web of Science | Medline25
Rioux JD ,Stone VA ,Daly MJ , et al. Familial eosinophilia maps to the cytokine gene cluster on human chromosomal region 5q31-q33. Am J Hum Genet 1998;63:1086-1094
CrossRef | Web of Science | Medline26
Gleich GJ ,Leiferman KM ,Pardanani A ,Tefferi A ,Butterfield JH . Treatment of hypereosinophilic syndrome with imatinib mesylate. Lancet 2002;359:1577-1579
CrossRef | Web of Science | Medline
- Citing Articles (223)
Citing Articles
1
Lorenzo Galluzzi, Laura Senovilla, Laurence Zitvogel, Guido Kroemer. (2012) The secret ally: immunostimulation by anticancer drugs. Nature Reviews Drug Discovery
CrossRef2
Hideki Muramatsu, Hideki Makishima, Jaroslaw P. Maciejewski. (2012) Chronic Myelomonocytic Leukemia and Atypical Chronic Myeloid Leukemia: Novel Pathogenetic Lesions. Seminars in Oncology 39:1, 67-73
CrossRef3
C Nishioka, T Ikezoe, J Yang, K Udaka, A Yokoyama. (2011) Imatinib causes epigenetic alterations of PTEN gene via upregulation of DNA methyltransferases and polycomb group proteins. Blood Cancer Journal 1:12, e48
CrossRef4
Bhuvan Kishore, David Marin. (2011) Current opinions and controversies in chronic myeloid leukaemia. Current Opinion in Oncology 23:6, 659-664
CrossRef5
John Anastasi. (2011) The myeloproliferative neoplasms including the eosinophilia-related myeloproliferations associated with tyrosine kinase mutations: changes and issues in classification and diagnosis criteria. Seminars in Diagnostic Pathology 28:4, 304-313
CrossRef6
Ailsa Holroyd, Nicholas C.P. Cross, Donald H. Macdonald. (2011) The two faces of myeloproliferative neoplasms: Molecular events underlying lymphoid transformation. Leukemia Research 35:10, 1279-1285
CrossRef7
Olatoyosi Odenike, John Anastasi, Michelle M. Le Beau. (2011) Myelodysplastic Syndromes. Clinics in Laboratory Medicine
CrossRef8
J. Köhler, M. Schuler. (2011) Personalisierte medikamentöse Therapie des fortgeschrittenen nichtkleinzelligen Lungenkarzinoms. Der Onkologe 17:8, 702-708
CrossRef9
Eswar Tipirneni, Amanpreet Buttar, Doreen Brettler, Patricia Miron, Venu Bathini. (2011) Chronic myeloproliferative disorder with ETV6-PDGFRβ fusion gene. Annals of Hematology
CrossRef10
Saskia Gueller, Sina Hehn, Verena Nowak, Sigal Gery, Hubert Serve, Christian H. Brandts, H. Phillip Koeffler. (2011) Adaptor protein Lnk binds to PDGF receptor and inhibits PDGF-dependent signaling. Experimental Hematology 39:5, 591-600
CrossRef11
Jonathan C. Strefford, Nicholas C. P. Cross. 2011. The Leukemia Genome. , 31-45.
CrossRef12
Roberta Maggio, Nadia Peragine, Maria Stefania Propris, Antonella Vitale, Loredana Elia, Elisabetta Calabrese, Irene Della Starza, Stefania Intoppa, Maria Laura Milani, Anna Guarini, Robin Foà. (2011) Immunocompetent cell functions in Ph+ acute lymphoblastic leukemia patients on prolonged Imatinib maintenance treatment. Cancer Immunology, Immunotherapy 60:4, 599-607
CrossRef13
Suzita M. Noor, Richard Bell, Alister C. Ward. (2011) Shooting the messenger: Targeting signal transduction pathways in leukemia and related disorders. Critical Reviews in Oncology/Hematology 78:1, 33-44
CrossRef14
Min Liu, Jingjing Xu, Hong Deng. (2011) Tangled fibroblasts in tumor-stroma interactions. International Journal of Cancern/a-n/a
CrossRef15
Nobuyasu Awano, Tomiko Ryu, Naoki Yoshimura, Masakazu Takazoe, Shigehiro Kitamura, Masanori Tanaka. (2011) Successful Treatment of Ulcerative Colitis Associated with Hypereosinophilic Syndrome/Chronic Eosinophilic Leukemia. Internal Medicine 50:16, 1741-1745
CrossRef16
J. R. -Y. Wang, C. -C. Yen, J. -P. Gau, L. -T. Hsiao, C. -Y. Liu, J. -T. Pai, C. -H. Tzeng, H. -W. Teng. (2010) A case of myeloid neoplasm associated with eosinophilia and KIAA1509-PDGFRβ responsive to combination treatment with imatinib mesylate and prednisolone. Journal of Clinical Pharmacy and Therapeutics 35:6, 733-736
CrossRef17
Mark E. Burkard, Prasad V. Jallepalli. (2010) Validating cancer drug targets through chemical genetics. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1806:2, 251-257
CrossRef18
Aref Al-Kali, Mohamad Cherry, Kristopher Kimmell, Jennifer Holter, William Kern, Bradley Gehrs, Howard Ozer, George Selby. (2010) A case of acute myeloid leukemia initially treated as chronic lymphocytic leukemia: what do we know about t(4;12)(q12;p13)?. Cancer Genetics and Cytogenetics 203:2, 348-351
CrossRef19
Ruben A. Mesa, Srdan Verstovsek. 2010. Philadelphia Chromosome-Negative Myeloproliferative Neoplasms. , 362-372.
CrossRef20
Paul W. Manley, Nikolaus Stiefl, Sandra W. Cowan-Jacob, Susan Kaufman, Jürgen Mestan, Markus Wartmann, Marion Wiesmann, Richard Woodman, Neil Gallagher. (2010) Structural resemblances and comparisons of the relative pharmacological properties of imatinib and nilotinib. Bioorganic & Medicinal Chemistry 18:19, 6977-6986
CrossRef21
Irene Colavita, Nicola Esposito, Rosanna Martinelli, Francesca Catanzano, Junia V. Melo, Fabrizio Pane, Margherita Ruoppolo, Francesco Salvatore. (2010) Gaining insights into the Bcr-Abl activity-independent mechanisms of resistance to imatinib mesylate in KCL22 cells: A comparative proteomic approach. Biochimica et Biophysica Acta (BBA) - Proteins & Proteomics 1804:10, 1974-1987
CrossRef22
C Nishioka, T Ikezoe, J Yang, A Yokoyama. (2010) Long-term exposure of leukemia cells to multi-targeted tyrosine kinase inhibitor induces activations of AKT, ERK and STAT5 signaling via epigenetic silencing of the PTEN gene. Leukemia 24:9, 1631-1640
CrossRef23
Jeffrey Bryan, Elias Jabbour, Hillary Prescott, Guillermo Garcia-Manero, Jean-Pierre Issa, Hagop Kantarjian. (2010) Current and Future Management Options for Myelodysplastic Syndromes. Drugs 70:11, 1381-1394
CrossRef24
Peter L. Greenberg. (2010) Current therapeutic approaches for patients with myelodysplastic syndromes. British Journal of Haematologyno-no
CrossRef25
Mark A. Dawson, Jayne E. Curry, Kelly Barber, Philip A. Beer, Brent Graham, John F. Lyons, Caroline J. Richardson, Mike A. Scott, Tomoko Smyth, Matthew S. Squires, Neil T. Thompson, Anthony R. Green, Nicola G. Wallis. (2010) AT9283, a potent inhibitor of the Aurora kinases and Jak2, has therapeutic potential in myeloproliferative disorders. British Journal of Haematologyno-no
CrossRef26
2010. Chronic Myeloid Leukaemias. , 261-300.
CrossRef27
2010. Myelodysplastic Syndromes. , 141-178.
CrossRef28
Arturo Loaiza-Bonilla, Steven D Gore, Hetty E Carraway. (2010) Novel approaches for myelodysplastic syndromes: beyond hypomethylating agents. Current Opinion in Hematology 17:2, 104-109
CrossRef29
Liliane Goetsch, Véronique Caussanel. (2010) Selection criteria for c-Met-targeted therapies: emerging evidence for biomarkers. Biomarkers in Medicine 4:1, 149-170
CrossRef30
Claire Hidalgo-Curtis, Jane F. Apperley, Anthony Stark, Michael Jeng, Jason Gotlib, Andrew Chase, Nicholas C. P. Cross, Francis H. Grand. (2010) Fusion of PDGFRB to two distinct loci at 3p21 and a third at 12q13 in imatinib-responsive myeloproliferative neoplasms. British Journal of Haematology 148:2, 268-273
CrossRef31
Konstantinos Anargyrou, Theodoros P. Vassilakopoulos, Maria K. Angelopoulou, Evangelos Terpos. (2010) Incorporating novel agents in the treatment of myelodysplastic syndromes. Leukemia Research 34:1, 6-17
CrossRef32
Petter Brandal, Manuel R. Teixeira, Sverre Heim. (2010) Genotypic and phenotypic classification of cancer: How should the impact of the two diagnostic approaches best be balanced?. Genes, Chromosomes and Cancern/a-n/a
CrossRef33
Karmen Stankov, Gordana Bogdanovic, Stevan Popovic. (2010) Tyrosine kinases in etiopathogenesis and therapy of malignant diseases: c-kit activating mutations. Medicinski pregled 63:5-6, 380-386
CrossRef34
Tamara Intermesoli, Federica Delaini, Sara Acerboni, Silvia Salmoiraghi, Orietta Spinelli, Vittoria Guerini, Alessandro M. Vannucchi, Silvia Mappa, Giuseppe Rossi, Valentina Rossi, Eros Di Bona, Simona Paratore, Alessandra Carobbio, Alessandro Rambaldi, Tiziano Barbui, Renato Bassan. (2009) A short low-dose imatinib trial allows rapid identification of responsive patients in hypereosinophilic syndromes. British Journal of Haematology 147:5, 681-685
CrossRef35
Karmen Stankov, Sunčica Stankov, Stevan Popović. (2009) Translational research in complex etiopathogenesis and therapy of hematological malignancies: the specific role of tyrosine kinases signaling and inhibition. Medical Oncology 26:4, 437-444
CrossRef36
Sara Galimberti, Maria I. Ferreri, Paolo Simi, Antonio Azzar
, Claudia Barat
CrossRef37
Nicholas Lydon. (2009) Attacking cancer at its foundation. Nature Medicine 15:10, 1153-1157
CrossRef38
Ayalew Tefferi, Juergen Thiele, James W. Vardiman. (2009) The 2008 World Health Organization classification system for myeloproliferative neoplasms. Cancer 115:17, 3842-3847
CrossRef39
Els Lierman, Jan Cools. (2009) Recent breakthroughs in the understanding and management of chronic eosinophilic leukemia. Expert Review of Anticancer Therapy 9:9, 1295-1304
CrossRef40
John Anastasi. (2009) The Myeloproliferative Neoplasms: Insights into Molecular Pathogenesis and Changes in WHO Classification and Criteria for Diagnosis. Hematology/Oncology Clinics of North America 23:4, 693-708
CrossRef41
A Pardanani, T Lasho, G Smith, C J Burns, E Fantino, A Tefferi. (2009) CYT387, a selective JAK1/JAK2 inhibitor: in vitro assessment of kinase selectivity and preclinical studies using cell lines and primary cells from polycythemia vera patients. Leukemia 23:8, 1441-1445
CrossRef42
Dragan Jevremovic, David S. Viswanatha. (2009) Molecular Diagnosis of Hematopoietic and Lymphoid Neoplasms. Hematology/Oncology Clinics of North America 23:4, 903-933
CrossRef43
N. Galldiks, R. Ullrich, M. Schroeter, G. R. Fink, L. W. Kracht. (2009) Imaging biological activity of a glioblastoma treated with an individual patient-tailored, experimental therapy regimen. Journal of Neuro-Oncology 93:3, 425-430
CrossRef44
Janna Paulsson, Tobias Sjöblom, Patrick Micke, Fredrik Pontén, Göran Landberg, Carl-Henrik Heldin, Jonas Bergh, Donal J. Brennan, Karin Jirström, Arne Östman. (2009) Prognostic Significance of Stromal Platelet-Derived Growth Factor β-Receptor Expression in Human Breast Cancer. The American Journal of Pathology 175:1, 334-341
CrossRef45
R. M. Stone. (2009) How I treat patients with myelodysplastic syndromes. Blood 113:25, 6296-6303
CrossRef46
Nitin Jain, Jorge Cortes, Alfonso Quintás-Cardama, Taghi Manshouri, Raja Luthra, Guillermo Garcia-Manero, Hagop Kantarjian, Srdan Verstovsek. (2009) Imatinib has limited therapeutic activity for hypereosinophilic syndrome patients with unknown or negative PDGFRα mutation status. Leukemia Research 33:6, 837-839
CrossRef47
Srdan Verstovsek. (2009) Preclinical and clinical experience with dasatinib in philadelphia chromosome-negative leukemias and myeloid disorders. Leukemia Research 33:5, 617-623
CrossRef48
J.-V. Malfuson, T. Fagot, J. Konopacki, L. Mangouka, B. Souleau, T. de Revel. (2009) Hyperéosinophilies et affections hématologiques. La Revue de Médecine Interne 30:4, 322-330
CrossRef49
Peter Valent. (2009) Clinical impact of genetic and molecular markers in myelodysplastic syndromes (MDS). memo - Magazine of European Medical Oncology 2:S1, 13-17
CrossRef50
Ayalew Tefferi. (2009) Molecular drug targets in myeloproliferative neoplasms: mutant ABL1, JAK2, MPL, KIT, PDGFRA, PDGFRB and FGFR1. Journal of Cellular and Molecular Medicine 13:2, 215-237
CrossRef51
Christoph Walz, Claudia Haferlach, Annette Hänel, Georgia Metzgeroth, Philipp Erben, Darko Gosenca, Andreas Hochhaus, Nicholas C. P. Cross, Andreas Reiter. (2009) Identification of a MYO18A-PDGFRB fusion gene in an eosinophilia-associated atypical myeloproliferative neoplasm with a t(5;17)(q33-34;q11.2). Genes, Chromosomes and Cancer 48:2, 179-183
CrossRef52
Ayalew Tefferi, Ross L. Levine, Hagop Kantarjian. (2009) Oncogenic Signals as Treatment Targets in Classic Myeloproliferative Neoplasms. Biology of Blood and Marrow Transplantation 15:1, 114-119
CrossRef53
Edwina Dobbin, Ciaren Graham, Pamela M. Corrigan, Keith G. Thomas, Robin W. Freeburn, Helen Wheadon. (2009) Tel/PDGFRβ induces stem cell differentiation via the Ras/ERK and STAT5 signaling pathways. Experimental Hematology 37:1, 111-121.e3
CrossRef54
Shin-ichiro FUJII. (2009) Immunological evaluation for CML and its possibility for an immunotherapy. Japanese Journal of Clinical Immunology 32:4, 231-241
CrossRef55
Peter Valent, Rotraud Wieser. (2009) Update on genetic and molecular markers associated with myelodysplastic syndromes. Leukemia & Lymphoma 50:3, 341-348
CrossRef56
Sun Young Kim. (2009) Eosinophil disorders. Korean Journal of Pediatrics 52:6, 643
CrossRef57
B. J. Druker. (2008) Translation of the Philadelphia chromosome into therapy for CML. Blood 112:13, 4808-4817
CrossRef58
Georgia Metzgeroth, Christoph Walz, Philipp Erben, Helena Popp, Annette Schmitt-Graeff, Claudia Haferlach, Alice Fabarius, Susanne Schnittger, David Grimwade, Nicholas C. P. Cross, Rüdiger Hehlmann, Andreas Hochhaus, Andreas Reiter. (2008) Safety and efficacy of imatinib in chronic eosinophilic leukaemia and hypereosinophilic syndrome - a phase-II study. British Journal of Haematology 143:5, 707-715
CrossRef59
Jean-Emmanuel Kahn, Olivier Blétry, Loïc Guillevin. (2008) Hypereosinophilic syndromes. Best Practice & Research Clinical Rheumatology 22:5, 863-882
CrossRef60
Grace K. Dy, Alex A. Adjei. (2008) Systemic cancer therapy: Evolution over the last 60 years. Cancer 113:S7, 1857-1887
CrossRef61
Fröhling, Stefan, Döhner, Hartmut, . (2008) Chromosomal Abnormalities in Cancer. New England Journal of Medicine 359:7, 722-734
Full Text62
C Walz, N C P Cross, R A Van Etten, A Reiter. (2008) Comparison of mutated ABL1 and JAK2 as oncogenes and drug targets in myeloproliferative disorders. Leukemia 22:7, 1320-1334
CrossRef63
E. O. Hexner, C. Serdikoff, M. Jan, C. R. Swider, C. Robinson, S. Yang, T. Angeles, S. G. Emerson, M. Carroll, B. Ruggeri, P. Dobrzanski. (2008) Lestaurtinib (CEP701) is a JAK2 inhibitor that suppresses JAK2/STAT5 signaling and the proliferation of primary erythroid cells from patients with myeloproliferative disorders. Blood 111:12, 5663-5671
CrossRef64
J. Haroche, Z. Amoura, F. Charlotte, J. Salvatierra, B. Wechsler, C. Graux, N. Brousse, J.-C. Piette. (2008) Imatinib mesylate for platelet-derived growth factor receptor-beta-positive Erdheim-Chester histiocytosis. Blood 111:11, 5413-5415
CrossRef65
Ron H.N. van Schaik. (2008) CYP450 pharmacogenetics for personalizing cancer therapy. Drug Resistance Updates 11:3, 77-98
CrossRef66
Jair Bar, Amir Onn. (2008) Combined anti-proliferative and anti-angiogenic strategies for cancer. Expert Opinion on Pharmacotherapy 9:5, 701-715
CrossRef67
Noushin Heidary, Haley Naik, Susan Burgin. (2008) Chemotherapeutic agents and the skin: An update. Journal of the American Academy of Dermatology 58:4, 545-570
CrossRef68
Gerlinde Wernig, Michael G. Kharas, Rachel Okabe, Sandra A. Moore, Dena S. Leeman, Dana E. Cullen, Maricel Gozo, Elizabeth P. McDowell, Ross L. Levine, John Doukas, Chi Ching Mak, Glenn Noronha, Michael Martin, Yon D. Ko, Benjamin H. Lee, Richard M. Soll, Ayalew Tefferi, John D. Hood, D. Gary Gilliland. (2008) Efficacy of TG101348, a Selective JAK2 Inhibitor, in Treatment of a Murine Model of JAK2V617F-Induced Polycythemia Vera. Cancer Cell 13:4, 311-320
CrossRef69
S. Fitter, A. L. Dewar, P. Kostakis, L. B. To, T. P. Hughes, M. M. Roberts, K. Lynch, B. Vernon-Roberts, A. C. W. Zannettino. (2008) Long-term imatinib therapy promotes bone formation in CML patients. Blood 111:5, 2538-2547
CrossRef70
Ayalew Tefferi, Hagop Kantarjian. (2008) Long-term experience with imatinib therapy in chronic phase chronic myelogenous leukemia—Remarkable activity with room for improvement. American Journal of Hematology 83:3, 175-177
CrossRef71
Eva Hellström-Lindberg, Luca Malcovati. (2008) Supportive care, growth factors, and new therapies in myelodysplastic syndromes. Blood Reviews 22:2, 75-91
CrossRef72
Carine Robert, Àgota Apàti, Christine Chomienne, Béla Papp. (2008) All-trans-retinoic acid enhances apoptosis induction by tyrosine kinase inhibitors in the eosinophilic leukemia-derived EoL-1 cell line. Leukemia Research 32:2, 343-346
CrossRef73
Genevieve Gallagher, Douglas E. Horsman, Peter Tsang, Donna L. Forrest. (2008) Fusion of PRKG2 and SPTBN1 to the platelet-derived growth factor receptor beta gene (PDGFRB) in imatinib-responsive atypical myeloproliferative disorders. Cancer Genetics and Cytogenetics 181:1, 46-51
CrossRef74
Helene François, Paul Coppo, Jean-Philippe Hayman, Bruno Fouqueray, Béatrice Mougenot, Pierre Ronco. (2008) Partial Fanconi Syndrome Induced by Imatinib Therapy: A Novel Cause of Urinary Phosphate Loss. American Journal of Kidney Diseases 51:2, 298-301
CrossRef75
Animesh Pardanani, Ayalew Tefferi. (2008) Primary eosinophilic disorders: A concise review. Current Hematologic Malignancy Reports 3:1, 37-43
CrossRef76
Torsten Haferlach, Ulrike Bacher, Wolfgang Kern, Susanne Schnittger, Claudia Haferlach. (2008) The diagnosis of BCR/ABL-negative chronic myeloproliferative diseases (CMPD): a comprehensive approach based on morphology, cytogenetics, and molecular markers. Annals of Hematology 87:1, 1-10
CrossRef77
P Gorello, R La Starza, L Brandimarte, S M Trisolini, V Pierini, B Crescenzi, M Z Limongi, M Nanni, E Belloni, C Tapinassi, E Gerbino, M F Martelli, R Foà, G Meloni, P G Pelicci, C Mecucci. (2008) A PDGFRB-positive acute myeloid malignancy with a new t(5;12)(q33;p13.3) involving the ERC1 gene. Leukemia 22:1, 216-218
CrossRef78
Juyoung Shin, Myungshin Kim, Dae-Bum Kim, Ju-Ok Yeom, Hyo-Jin Lee, Seok-Goo Cho. (2008) Sustained Response to Low-Dose Imatinib Mesylate in a Patient with Chronic Myelomonocytic Leukemia with t(5;12)(q33;p13). Acta Haematologica 119:1, 57-59
CrossRef79
A Tefferi. (2008) The history of myeloproliferative disorders: before and after Dameshek. Leukemia 22:1, 3-13
CrossRef80
Francesco Onida, Miloslav Beran. (2008) Diagnosis and management of chronic myelomonocytic leukemia. Current Hematologic Malignancy Reports 3:1, 31-36
CrossRef81
Hideaki Yamasawa, Yukihiko Sugiyama, Masashi Bando, Shoji Ohno. (2008) Drug-Induced Pneumonitis Associated with Imatinib Mesylate in a Patient with Idiopathic Pulmonary Fibrosis. Respiration 75:3, 350-354
CrossRef82
Magda Melchert, Alan List. (2008) Targeted Therapies in Myelodysplastic Syndrome. Seminars in Hematology 45:1, 31-38
CrossRef83
Animesh Pardanani, Srdan Verstovsek. (2007) Hypereosinophilic Syndrome, Chronic Eosinophilic Leukemia, and Mast Cell Disease. The Cancer Journal 13:6, 384-391
CrossRef84
Yana Pikman, Ross L Levine. (2007) Advances in the molecular characterization of Philadelphia-negative chronic myeloproliferative disorders. Current Opinion in Oncology 19:6, 628-634
CrossRef85
R A Van Etten. (2007) Aberrant cytokine signaling in leukemia. Oncogene 26:47, 6738-6749
CrossRef86
Naomi Galili, Jan Cerny, Azra Raza. (2007) Current Treatment Options: Impact of Cytogenetics on the Course of Myelodysplasia. Current Treatment Options in Oncology 8:2, 117-128
CrossRef87
Yukitaka Katsura, Kazumi Suzukawa, Toru Nanmoku, Noriko Nemoto, Takayuki Machino, Naoshi Obara, Yasushi Okoshi, Harumi Yamamoto Mukai, Yuichi Hasegawa, Hiroshi Kojima, Yasushi Kawakami, Toshiro Nagasawa. (2007) Myelodysplastic syndrome accompanied by basophilia and eosinophilia with t(5;12)(q31;p13). Cancer Genetics and Cytogenetics 178:1, 85-88
CrossRef88
Pier Paolo Piccaluga, Michela Rondoni, Stefania Paolini, Gianantonio Rosti, Giovanni Martinelli, Michele Baccarani. (2007) Imatinib mesylate in the treatment of hematologic malignancies. Expert Opinion on Biological Therapy 7:10, 1597-1611
CrossRef89
Benjamin H. Lee, Zuzana Tothova, Ross L. Levine, Kristina Anderson, Natalija Buza-Vidas, Dana E. Cullen, Elizabeth P. McDowell, Jennifer Adelsperger, Stefan Fröhling, Brian J.P. Huntly, Miloslav Beran, Sten Eirik Jacobsen, D. Gary Gilliland. (2007) FLT3 Mutations Confer Enhanced Proliferation and Survival Properties to Multipotent Progenitors in a Murine Model of Chronic Myelomonocytic Leukemia. Cancer Cell 12:4, 367-380
CrossRef90
Brijesh Arora, Ayalew Tefferi. (2007) Advances in molecular diagnostics of myeloproliferative disorders. Expert Opinion on Medical Diagnostics 1:1, 65-80
CrossRef91
Ross L. Levine, Animesh Pardanani, Ayalew Tefferi, D. Gary Gilliland. (2007) Role of JAK2 in the pathogenesis and therapy of myeloproliferative disorders. Nature Reviews Cancer 7:9, 673-683
CrossRef92
Barbara J. Bain, Sarah H. Fletcher. (2007) Chronic Eosinophilic Leukemias and the Myeloproliferative Variant of the Hypereosinophilic Syndrome. Immunology and Allergy Clinics of North America 27:3, 377-388
CrossRef93
Barbara Crescenzi, Roberta La Starza, Chiara Nozzoli, Stefania Ciolli, Caterina Matteucci, Silvia Romoli, Luigi Rigacci, Paolo Gorello, Alberto Bosi, Massimo F. Martelli, Peter Marynen, Cristina Mecucci. (2007) Molecular cytogenetic findings in a four-way t(1;12;5;12)(p36;p13;q33;q24) underlying the ETV6-PDGFRB fusion gene in chronic myelomonocytic leukemia. Cancer Genetics and Cytogenetics 176:1, 67-71
CrossRef94
Deborah A. Thomas, Susan O’Brien, Jorge Cortes, Hagop Kantarjian. (2007) New approaches to the management of Philadelphia chromosome-positive acute lymphocytic leukemia. Current Hematologic Malignancy Reports 2:3, 183-189
CrossRef95
F. Fierro, T. Illmer, D. Jing, E. Schleyer, G. Ehninger, S. Boxberger, M. Bornhäuser. (2007) Inhibition of platelet-derived growth factor receptor? by imatinib mesylate suppresses proliferation and alters differentiation of human mesenchymal stem cells in vitro. Cell Proliferation 40:3, 355-366
CrossRef96
Daniel J. DeAngelo. (2007) Role of Imatinib-Sensitive Tyrosine Kinases in the Pathogenesis of Chronic Myeloproliferative Disorders. Seminars in Hematology 44, S17-S30
CrossRef97
Giovanni Martinelli. (2007) Atypical Chronic Myeloproliferative Disorders: Genes and Imatinib-Sensitive Targets. Seminars in Hematology 44, S1-S3
CrossRef98
Florian Heidel, Jorge Cortes, Frank G. Rücker, Walter Aulitzky, Laurie Letvak, Thomas Kindler, Christoph Huber, Hartmut Döhner, Hagop Kantarjian, Thomas Fischer. (2007) Results of a multicenter phase II trial for older patients with c-Kit-positive acute myeloid leukemia (AML) and high-risk myelodysplastic syndrome (HR-MDS) using low-dose Ara-C and Imatinib. Cancer 109:5, 907-914
CrossRef99
Ayalew Tefferi, James W Vardiman. (2007) The diagnostic interface between histology and molecular tests in myeloproliferative disorders. Current Opinion in Hematology 14:2, 115-122
CrossRef100
K Yalamanchili, D Liu, K Seiter. (2007) Myelofibrosis with a novel translocation, t(1;3)(q31;q23), and response to imatinib mesylate. Leukemia 21:3, 577-578
CrossRef101
R La Starza, R Rosati, G Roti, P Gorello, A Bardi, B Crescenzi, V Pierini, O Calabrese, M Baens, C Folens, J Cools, P Marynen, M F Martelli, C Mecucci, A Cuneo. (2007) A new NDE1/PDGFRB fusion transcript underlying chronic myelomonocytic leukaemia in Noonan Syndrome. Leukemia
CrossRef102
E T P Penserga, T Skorski. (2007) Fusion tyrosine kinases: a result and cause of genomic instability. Oncogene 26:1, 11-20
CrossRef103
Donald Macdonald, Nicholas C. Cross. (2007) Chronic Myeloproliferative Disorders: The Role of Tyrosine Kinases in Pathogenesis, Diagnosis and Therapy. Pathobiology 74:2, 81-88
CrossRef104
Nancy L. Lewis. (2007) The platelet-derived growth factor receptor as a therapeutic target. Current Oncology Reports 9:2, 89-95
CrossRef105
Bakul I. Dalal, Douglas E. Horsman, Hélène Bruyèrè, Donna L Forrest. (2007) Imatinib mesylate responsiveness in aggressive systemic mastocytosis: Novel association with a platelet derived growth factor receptor beta mutation. American Journal of Hematology 82:1, 77-79
CrossRef106
D. A. Thomas. (2007) Philadelphia Chromosome Positive Acute Lymphocytic Leukemia: A New Era of Challenges. Hematology 2007:1, 435-443
CrossRef107
K Tokita, K Maki, J Tadokoro, Y Nakamura, Y Arai, K Sasaki, M Eguchi-Ishimae, M Eguchi, K Mitani. (2007) Chronic idiopathic myelofibrosis expressing a novel type of TEL-PDGFRB chimaera responded to imatinib mesylate therapy. Leukemia 21:1, 190-192
CrossRef108
Wolf-K. Hofmann, Florian Nolte. (2007) Molecular Targets in Myelodysplastic Syndromes. Cancer Treatment Reviews 33, S42-S46
CrossRef109
Hideto KAMEDA. (2007) Imatinib mesylate as a novel therapeutic drug for systemic rheumatic diseases. Japanese Journal of Clinical Immunology 30:3, 165-173
CrossRef110
Francois Ghiringhelli, Cédric Ménard, Francois Martin, Laurence Zitvogel. (2006) The role of regulatory T cells in the control of natural killer cells: relevance during tumor progression. Immunological Reviews 214:1, 229-238
CrossRef111
Christopher A. Carter, Charles Chen, Cheryl Brink, Patrick Vincent, Yulia Y. Maxuitenko, Karen S. Gilbert, William R. Waud, Xiaomei Zhang. (2006) Sorafenib is efficacious and tolerated in combination with cytotoxic or cytostatic agents in preclinical models of human non-small cell lung carcinoma. Cancer Chemotherapy and Pharmacology 59:2, 183-195
CrossRef112
Alfonso Quintas-Cardama, Ahmed Aribi, Jorge Cortes, Francis J. Giles, Hagop Kantarjian, Srdan Verstovsek. (2006) Novel approaches in the treatment of systemic mastocytosis. Cancer 107:7, 1429-1439
CrossRef113
Ayalew Tefferi, Gary Gilliland. (2006) Classification of chronic myeloid disorders: From Dameshek towards a semi-molecular system. Best Practice & Research Clinical Haematology 19:3, 365-385
CrossRef114
Michelle A. Elliott. (2006) Chronic neutrophilic leukemia and chronic myelomonocytic leukemia: WHO defined. Best Practice & Research Clinical Haematology 19:3, 571-593
CrossRef115
Jason Gotlib, N.C.P. Cross, D. Gary Gilliland. (2006) Eosinophilic disorders: Molecular pathogenesis, new classification, and modern therapy. Best Practice & Research Clinical Haematology 19:3, 535-569
CrossRef116
R. H. Alvarez, H. M. Kantarjian, J. E. Cortes. (2006) Biology of Platelet-Derived Growth Factor and Its Involvement in Disease. Mayo Clinic Proceedings 81:9, 1241-1257
CrossRef117
Grant A McArthur. (2006) Dermatofibrosarcoma protuberans: a surgical disease with a molecular savior. Current Opinion in Oncology 18:4, 341-346
CrossRef118
Naomi Bruce Galili, Murtaza Mehdi, Muhammad Mumtaz, Patricia Miron, Bruce Woda, Samer Al-Homsi, Peter Westervelt, Azra Raza. (2006) Can molecular profiling of cytogenetic subgroups draw a roadmap for individualizing therapy in myelodysplastic syndromes?. Future Oncology 2:3, 407-415
CrossRef119
Ayalew Tefferi, Mrinal M. Patnaik, Animesh Pardanani. (2006) Eosinophilia: secondary, clonal and idiopathic. British Journal of Haematology 133:5, 468-492
CrossRef120
J Score, C Curtis, K Waghorn, M Stalder, M Jotterand, F H Grand, N C P Cross. (2006) Identification of a novel imatinib responsive KIF5B-PDGFRA fusion gene following screening for PDGFRA overexpression in patients with hypereosinophilia. Leukemia 20:5, 827-832
CrossRef121
H. Kameda, H. Ishigami, M. Suzuki, T. Abe, T. Takeuchi. (2006) Imatinib mesylate inhibits proliferation of rheumatoid synovial fibroblast-like cells and phosphorylation of Gab adapter proteins activated by platelet-derived growth factor. Clinical and Experimental Immunology 144:2, 335-341
CrossRef122
A. Tefferi, M. A. Elliott, A. Pardanani. (2006) Atypical Myeloproliferative Disorders: Diagnosis and Management. Mayo Clinic Proceedings 81:4, 553-563
CrossRef123
Michael A. Morgan, Christoph W. M. Reuter. (2006) Molecularly targeted therapies in myelodysplastic syndromes and acute myeloid leukemias. Annals of Hematology 85:3, 139-163
CrossRef124
Elias Jabbour, Francis J. Giles. (2006) New agents in myelodysplastic syndromes. Current Hematologic Malignancy Reports 1:1, 25-33
CrossRef125
Hagop Kantarjian, Miloslav Beran, Jorge Cortes, Susan O'Brien, Francis Giles, Sherry Pierce, Jianqin Shan, William Plunkett, Michael Keating, Elihu Estey. (2006) Long-term follow-up results of the combination of topotecan and cytarabine and other intensive chemotherapy regimens in myelodysplastic syndrome. Cancer 106:5, 1099-1109
CrossRef126
Sindhu Cherian, Adam Bagg. (2006) The genetics of the myelodysplastic syndromes: Classical cytogenetics and recent molecular insights. Hematology 11:1, 1-13
CrossRef127
K De Keersmaecker, J Cools. (2006) Chronic myeloproliferative disorders: a tyrosine kinase tale. Leukemia 20:2, 200-205
CrossRef128
Magda Elkabani, Alan F List. (2006) Management of Transfusion-Dependent Myelodysplastic Syndromes. American Journal of Cancer 5:2, 71-80
CrossRef129
Antonia M. S. Müller, Uwe M. Martens, Silke C. Hofmann, Leena Bruckner-Tuderman, Roland Mertelsmann, Michael Lübbert. (2006) Imatinib mesylate as a novel treatment option for hypereosinophilic syndrome: two case reports and a comprehensive review of the literature. Annals of Hematology 85:1, 1-16
CrossRef130
Nicholas M. Levinson, Olga Kuchment, Kui Shen, Matthew A. Young, Michael Koldobskiy, Martin Karplus, Philip A. Cole, John Kuriyan. (2006) A Src-Like Inactive Conformation in the Abl Tyrosine Kinase Domain. PLoS Biology 4:5, e144
CrossRef131
Staffan Welin, Marie Louise Fjällskog, Jan Saras, Barbro Eriksson, Eva T. Janson. (2006) Expression of Tyrosine Kinase Receptors in Malignant Midgut Carcinoid Tumors. Neuroendocrinology 84:1, 42-48
CrossRef132
Maria E. Nelson, David P. Steensma. (2006) JAK2 V617F in myeloid disorders: What do we know now, and where are we headed?. Leukemia & Lymphoma 47:2, 177-194
CrossRef133
Fumihiko Monma, Kazuhiro Nishii, Felipe Lorenzo, Eiji Usui, Yuichiro Ueda, Yasuyuki Watanabe, Keiki Kawakami, Koji Oka, Hidetsugu Mitani, Takao Sekine, Shigehisa Tamaki, Minoru Mizutani, Fumiharu Yagasaki, Noriko Doki, Syuichi Miyawaki, Naoyuki Katayama, Hiroshi Shiku. (2006) Molecular analysis of PDGFRalpha/beta genes in core binding factor leukemia with eosinophilia. European Journal of Haematology 76:1, 18-22
CrossRef134
D. P. Steensma, J. M. Bennett. (2006) The Myelodysplastic Syndromes: Diagnosis and Treatment. Mayo Clinic Proceedings 81:1, 104-130
CrossRef135
Jing Chen, Benjamin H Lee, Ifor R Williams, Jeffery L Kutok, Constantine S Mitsiades, Nicole Duclos, Sarah Cohen, Jennifer Adelsperger, Rachel Okabe, Allison Coburn, Sandra Moore, Brian J P Huntly, Doriano Fabbro, Kenneth C Anderson, James D Griffin, Dwight Gary Gilliland. (2005) FGFR3 as a therapeutic target of the small molecule inhibitor PKC412 in hematopoietic malignancies. Oncogene 24:56, 8259-8267
CrossRef136
Silke Appel, Stefan Balabanov, Tim H. Brümmendorf, Peter Brossart. (2005) Effects of Imatinib on Normal Hematopoiesis and Immune Activation. Stem Cells 23:8, 1082-1088
CrossRef137
Philip J Nivatpumin, Steven D Gore. (2005) Emerging drugs for the treatment of myelodysplastic syndrome. Expert Opinion on Emerging Drugs 10:3, 569-590
CrossRef138
Krause, Daniela S., Van Etten, Richard A., . (2005) Tyrosine Kinases as Targets for Cancer Therapy. New England Journal of Medicine 353:2, 172-187
Full Text139
A. Tefferi, D. G. Gilliland. (2005) The JAK2V617F Tyrosine Kinase Mutation in Myeloproliferative Disorders: Status Report and Immediate Implications for Disease Classification and Diagnosis. Mayo Clinic Proceedings 80:7, 947-958
CrossRef140
Jan Cools, Chantal Maertens, Peter Marynen. (2005) Resistance to tyrosine kinase inhibitors: Calling on extra forces. Drug Resistance Updates 8:3, 119-129
CrossRef141
STEFAN BALABANOV, SILKE APPEL, LOTHAR KANZ, PETER BROSSART, TIM H. BRÜMMENDORF. (2005) Effect of Tyrosine Kinase Inhibition Using Imatinib on Normal Lymphohematopoietic Cells. Annals of the New York Academy of Sciences 1044:1, 168-177
CrossRef142
D. P. Steensma, A. F. List. (2005) Genetic Testing in the Myelodysplastic Syndromes: Molecular Insights Into Hematologic Diversity. Mayo Clinic Proceedings 80:5, 681-698
CrossRef143
Ekatherine Asatiani, Edward P Gelmann. (2005) Targeted therapies for prostate cancer. Expert Opinion on Therapeutic Targets 9:2, 283-298
CrossRef144
Ross L. Levine, Martha Wadleigh, Jan Cools, Benjamin L. Ebert, Gerlinde Wernig, Brian J.P. Huntly, Titus J. Boggon, Iwona Wlodarska, Jennifer J. Clark, Sandra Moore, Jennifer Adelsperger, Sumin Koo, Jeffrey C. Lee, Stacey Gabriel, Thomas Mercher, Alan D’Andrea, Stefan Fröhling, Konstanze Döhner, Peter Marynen, Peter Vandenberghe, Ruben A. Mesa, Ayalew Tefferi, James D. Griffin, Michael J. Eck, William R. Sellers, Matthew Meyerson, Todd R. Golub, Stephanie J. Lee, D. Gary Gilliland. (2005) Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell 7:4, 387-397
CrossRef145
Robin L Jones, Ian R Judson. (2005) The development and application of imatinib. Expert Opinion on Drug Safety 4:2, 183-191
CrossRef146
Matthias Holdhoff, Karl-Anton Kreuzer, Christine Appelt, Regina Scholz, Il-Kang Na, Bert Hildebrandt, Hanno Riess, Andreas Jordan, Christian A. Schmidt, Richard A. Van Etten, Bernd Dörken, Philipp le Coutre. (2005) Imatinib mesylate radiosensitizes human glioblastoma cells through inhibition of platelet-derived growth factor receptor. Blood Cells, Molecules, and Diseases 34:2, 181-185
CrossRef147
David T Bowen. (2005) Chronic myelomonocytic leukemia: lost in classification?. Hematological Oncology 23:1, 26-33
CrossRef148
Raoul Tibes, Jonathan Trent, Razelle Kurzrock. (2005) TYROSINE KINASE INHIBITORS AND THE DAWN OF MOLECULAR CANCER THERAPEUTICS*. Annual Review of Pharmacology and Toxicology 45:1, 357-384
CrossRef149
Jennifer Clark, Jan Cools, D. Gary Gilliland. (2005) EGFR Inhibition in Non-Small Cell Lung Cancer: Resistance, Once Again, Rears Its Ugly Head. PLoS Medicine 2:3, e75
CrossRef150
A. Tefferi. (2005) Modern Diagnosis and Treatment of Primary Eosinophilia. Acta Haematologica 114:1, 52-60
CrossRef151
Jason Gotlib. (2005) Molecular Classification and Pathogenesis of Eosinophilic Disorders: 2005 Update. Acta Haematologica 114:1, 7-25
CrossRef152
Adedayo A. Onitilo, Ebenezer A. Kio, Avtar K. Singh, John Lazarchick. (2005) Cytogenetic remission with imatinib therapy in hypereosinophilic syndrome with trisomy 8 and resolution of severe cardiac dysfunction. Leukemia & Lymphoma 46:11, 1667-1670
CrossRef153
Bertrand Rochat. (2005) Role of Cytochrome P450 Activity in the Fate of Anticancer Agents and in Drug Resistance. Clinical Pharmacokinetics 44:4, 349-366
CrossRef154
LB Simon. (2005) A novel reciprocal translocation associated with chronic eosinophilic leukemia. Leukemia & Lymphoma 46:2, 299-302
CrossRef155
Natalie Serkova, L??szl?? G Boros. (2005) Detection of Resistance to Imatinib by Metabolic Profiling. American Journal of PharmacoGenomics 5:5, 293-302
CrossRef156
Ayalew Tefferi. (2005) Blood Eosinophilia: A New Paradigm in Disease Classification, Diagnosis, and Treatment. Mayo Clinic Proceedings 80:1, 75-83
CrossRef157
Mark A Pearson, Doriano Fabbro. (2004) Targeting protein kinases in cancer therapy: a success?. Expert Review of Anticancer Therapy 4:6, 1113-1124
CrossRef158
Henrik Daub, Katja Specht, Axel Ullrich. (2004) Strategies to overcome resistance to targeted protein kinase inhibitors. Nature Reviews Drug Discovery 3:12, 1001-1010
CrossRef159
Steven D. Gore. (2004) Inhibitors of signaling in myelodysplastic syndrome. Best Practice & Research Clinical Haematology 17:4, 613-622
CrossRef160
J. Gracia Colldeforns, D. Hernández Maraver, R. de Paz Arias, F. Hernández Navarro. (2004) Síndromes mieloproliferativos crónicos. Medicine - Programa de Formación Médica Continuada Acreditado 9:21, 1332-1346
CrossRef161
Nick J. Dibb, Stephen M. Dilworth, Clifford D. Mol. (2004) Opinion: Switching on kinases: oncogenic activation of BRAF and the PDGFR family. Nature Reviews Cancer 4:9, 718-727
CrossRef162
Mani Mohindru, Amit Verma. (2004) Kinase inhibitors translate lab discoveries into exciting new cures for cancers. The Indian Journal of Pediatrics 71:8, 713-718
CrossRef163
Azra Raza, Silvia Buonamici, Laurie Lisak, Sarah Tahir, Donglan Li, Mehnaz Imran, Nusrat Ijaz Chaudary, Hassan Pervaiz, J.Alejandro Gallegos, M.Imran Alvi, Muhammad Mumtaz, Sefer Gezer, Parameswaran Venugopal, Poluru Reddy, Naomi Galili, Anna Candoni, Jack Singer, Giuseppina Nucifora. (2004) Arsenic trioxide and thalidomide combination produces multi-lineage hematological responses in myelodysplastic syndromes patients, particularly in those with high pre-therapy EVI1 expression. Leukemia Research 28:8, 791-803
CrossRef164
W. R. Sperr, A. W. Hauswirth, S. Florian, L. Ohler, K. Geissler, P. Valent. (2004) Human leukaemic stem cells: a novel target of therapy. European Journal of Clinical Investigation 34:s2, 31-40
CrossRef165
Christophe Borg, Magali Terme, Julien Taïeb, Cédric Ménard, Caroline Flament, Caroline Robert, Koji Maruyama, Hiro Wakasugi, Eric Angevin, Kris Thielemans, Axel Le Cesne, Véronique Chung-Scott, Vladimir Lazar, Isabelle Tchou, Florent Crépineau, François Lemoine, Jacky Bernard, Jonhantan A. Fletcher, Ali Turhan, Jean-Yves Blay, Alain Spatz, Jean-François Emile, Michael C. Heinrich, Salah Mécheri, Thomas Tursz, Laurence Zitvogel. (2004) Novel mode of action of c-kit tyrosine kinase inhibitors leading to NK cell–dependent antitumor effects. Journal of Clinical Investigation 114:3, 379-388
CrossRef166
Arne Östman. (2004) PDGF receptors-mediators of autocrine tumor growth and regulators of tumor vasculature and stroma. Cytokine & Growth Factor Reviews 15:4, 275-286
CrossRef167
José Baselga, Joaquín Arribas. (2004) Treating cancer's kinase 'addiction'. Nature Medicine 10:8, 786-787
CrossRef168
Stefan Faderl, Hagop M. Kantarjian. (2004) Novel therapies for myelodysplastic syndromes. Cancer 101:2, 226-241
CrossRef169
D. Tan, W. Hwang, H. J. Ng, Y. T. Goh, P. Tan. (2004) Successful Treatment of Idiopathic Hypereosinophilic Syndrome with Imatinib Mesylate: A Case Report. International Journal of Hematology 80:1, 75-77
CrossRef170
F. Roufosse, E. Cogan, M. Goldman. (2004) Recent advances in pathogenesis and management of hypereosinophilic syndromes. Allergy 59:7, 673-689
CrossRef171
Jing Chen, Nathan R. Wall, Kerry Kocher, Nicole Duclos, Doriano Fabbro, Donna Neuberg, James D. Griffin, Yang Shi, D. Gary Gilliland. (2004) Stable expression of small interfering RNA sensitizes TEL-PDGFβR to inhibition with imatinib or rapamycin. Journal of Clinical Investigation 113:12, 1784-1791
CrossRef172
Carlos L. Arteaga, Jose Baselga. (2004) Tyrosine kinase inhibitors. Cancer Cell 5:6, 525-531
CrossRef173
C. Roux, A.-M. Boisseau-Garsaud, I. Saint-Cyr, R. Hélénon, D. Quist, C. Delaunay. (2004) Toxidermie lichénoïde à l’imatinib (Glivec®). Annales de Dermatologie et de Vénéréologie 131:6-7, 571-573
CrossRef174
Ayalew Tefferi, Animesh Pardanani. (2004) Imatinib Therapy in Clonal Eosinophilic Disorders, Including Systemic Mastocytosis. International Journal of Hematology 79:5, 441-447
CrossRef175
Jorge Cortes, Hagop Kantarjian. (2004) Beyond chronic myelogenous leukemia. Cancer 100:10, 2064-2078
CrossRef176
Anne Michele Safley, Siby Sebastian, Timothy S. Collins, Carlos A. Tirado, Timothy T. Stenzel, Jerald Z. Gong, Barbara K. Goodman. (2004) Molecular and cytogenetic characterization of a novel translocation t(4;22) involving the breakpoint cluster region and platelet-derived growth factor receptor-alpha genes in a patient with atypical chronic myeloid leukemia. Genes, Chromosomes and Cancer 40:1, 44-50
CrossRef177
E. Nadal, E. Olavarria. (2004) Imatinib mesylate (Gleevec/Glivec) a molecular-targeted therapy for chronic myeloid leukaemia and other malignancies. International Journal of Clinical Practice 58:5, 511-516
CrossRef178
Geoffrey W Krystal. (2004) Imatinib mesylate (STI571) for myeloid malignancies other than CML. Leukemia Research 28, 53-59
CrossRef179
Yuko Ishii, Yoshikazu Ito, Yuzuru Kuriyama, Tetsuzo Tauchi, Kazuma Ohyashiki. (2004) Successful treatment with imatinib mesylate of hypereosinophilic syndrome (chronic eosinophilic leukemia) with myelofibrosis. Leukemia Research 28, 79-80
CrossRef180
Brenda Wittman, John Horan, Joanna Baxter, John Goldberg, Raymond Felgar, Erin Baylor, Bean Cromwell, Nicholas Cross, John M Bennett. (2004) A 2-year-old with atypical CML with a t(5;12)(q33;p13) treated successfully with imatinib mesylate. Leukemia Research 28, 65-69
CrossRef181
Nicholas B Lydon, Brian J Druker. (2004) Lessons learned from the development of imatinib. Leukemia Research 28, 29-38
CrossRef182
Stephanie Blencke, Birgit Zech, Ola Engkvist, Zoltán Greff, László Őrfi, Zoltán Horváth, György Kéri, Axel Ullrich, Henrik Daub. (2004) Characterization of a Conserved Structural Determinant Controlling Protein Kinase Sensitivity to Selective Inhibitors. Chemistry & Biology 11:5, 691-701
CrossRef183
Animesh Pardanani, Ayalew Tefferi. (2004) Imatinib therapy for hypereosinophilic syndrome and eosinophilia-associated myeloproliferative disorders. Leukemia Research 28, 47-52
CrossRef184
Grant McArthur. (2004) Molecularly targeted treatment for dermatofibrosarcoma protuberans. Seminars in Oncology 31, 30-36
CrossRef185
Jonathan A Fletcher. (2004) Role of KIT and platelet-derived growth factor receptors as oncoproteins. Seminars in Oncology 31, 4-11
CrossRef186
Stephane Wong, Owen N. Witte. (2004) The BCR-ABL Story: Bench to Bedside and Back. Annual Review of Immunology 22:1, 247-306
CrossRef187
Pierre Fenaux. (2004) Myelodysplastic syndromes: from pathogenesis and prognosis to treatment. Seminars in Hematology 41, 6-12
CrossRef188
Richard M Stone, D.Gary Gilliland, Amy D Klion. (2004) Platelet-derived growth factor receptor inhibition to treat idiopathic hypereosinophilic syndrome. Seminars in Oncology 31, 12-17
CrossRef189
Farhad Ravandi, Hagop Kantarjian, Francis Giles, Jorge Cortes. (2004) New agents in acute myeloid leukemia and other myeloid disorders. Cancer 100:3, 441-454
CrossRef190
Alison M John, N.Shaun B Thomas, Ghulam J Mufti, Rose Ann Padua. (2004) Targeted therapies in myeloid leukemia. Seminars in Cancer Biology 14:1, 41-62
CrossRef191
Steven Coutré, Jason Gotlib. (2004) Targeted treatment of hypereosinophilic syndromes and chronic eosinophilic leukemias with imatinib mesylate. Seminars in Cancer Biology 14:1, 23-31
CrossRef192
Carl-Henrik Heldin. (2004) Development and possible clinical use of antagonists for PDGF and TGF-β. Upsala Journal of Medical Sciences 109:3, 165-178
CrossRef193
John M Goldman. (2004) Chronic myeloid leukemia—still a few questions. Experimental Hematology 32:1, 2-10
CrossRef194
Jamie Robyn, Pierre Noel, Iwona Wlodarska, Mamta Choksi, Patricia O'Neal, Diane Arthur, Cynthia Dunbar, Thomas Nutman, Amy Klion. (2004) Imatinib-Responsive Hypereosinophilia in a Patient with B Cell ALL. Leukemia & Lymphoma 45:12, 2497-2501
CrossRef195
Jan Cools, Elizabeth H. Stover, Iwona Wlodarska, Peter Marynen, D. Gary Gilliland. (2004) The FIP1L1-PDGFR?? kinase in hypereosinophilic syndrome and chronic eosinophilic leukemia. Current Opinion in Hematology 11:1, 51-57
CrossRef196
Pellegrino Musto, Antonietta Falcone, Grazia Sanpaolo, Carlo Bodenizza, Gianni Perla, Maria Marta Minervini, Nicola Cascavilla, Matteo Dell'olio, Antonio La Sala, Saverio Mantuano, Lorella Melillo, Michele Nobile, Potito Rosario Scalzulli, Michele Bisceglia, Angelo Michele Carella. (2004) Heterogeneity of Response to Imatinib-Mesylate (Glivec) in Patients with Hypereosinophilic Syndrome: Implications for Dosing and Pathogenesis. Leukemia & Lymphoma 45:6, 1219-1222
CrossRef197
Thomas B. Sneed, Hagop M. Kantarjian, Moshe Talpaz, Susan O'Brien, Mary Beth Rios, B. Nebiyou Bekele, Xian Zhou, Debra Resta, William Wierda, Stefan Faderl, Francis Giles, Jorge E. Cortes. (2004) The significance of myelosuppression during therapy with imatinib mesylate in patients with chronic myelogenous leukemia in chronic phase. Cancer 100:1, 116-121
CrossRef198
E. Anders Kolb, Qiulu Pan, Marc Ladanyi, Peter G. Steinherz. (2003) Imatinib mesylate in Philadelphia chromosome-positive leukemia of childhood. Cancer 98:12, 2643-2650
CrossRef199
John T Reilly. (2003) Receptor tyrosine kinases in normal and malignant haematopoiesis. Blood Reviews 17:4, 241-248
CrossRef200
John M Goldman. (2003) Myeloproliferative and myelodysplastic syndromes:. Hematology/Oncology Clinics of North America 17:5, 1261-1269
CrossRef201
Lynn Bonham, David W Leung, Thayer White, David Hollenback, Peter Klein, John Tulinsky, Michael Coon, Peter de Vries, Jack W Singer. (2003) Lysophosphatidic acid acyltransferase-β: a novel target for induction of tumour cell apoptosis. Expert Opinion on Therapeutic Targets 7:5, 643-661
CrossRef202
Xue-mei Sun, Ben Brady. (2003) New drug targeting treatment — Glivec. Chinese Journal of Cancer Research 15:3, 235-239
CrossRef203
Wolfgang R. Sperr, Alexander W. Hauswirth, Friedrich Wimazal, Paul Knöbl, Klaus Geissler, Peter Valent. (2003) Treatment concepts for elderly patients with acute myeloid leukemia. Wiener Klinische Wochenschrift 115:13-14, 505-514
CrossRef204
Peter Valent, Friedrich Wimazal, Ilse Schwarzinger, Wolfgang R. Sperr, Klaus Geissler. (2003) Pathogenesis, classification, and treatment of myelodysplastic syndromes (MDS). Wiener Klinische Wochenschrift 115:13-14, 515-536
CrossRef205
Aikaterini Barbouti, Tomas Ahlgren, Bertil Johansson, Mattias H
CrossRef206
Barbara J. Bain. (2003) Cytogenetic and molecular genetic aspects of eosinophilic leukaemias. British Journal of Haematology 122:2, 173-179
CrossRef207
Edward P. Gelmann. (2003) Searching for the gatekeeper oncogene of prostate cancer. Critical Reviews in Oncology/Hematology 46, 11-20
CrossRef208
Brian J Druker. (2003) Imatinib mesylate in the treatment of chronic myeloid leukaemia. Expert Opinion on Pharmacotherapy 4:6, 963-971
CrossRef209
Jorge Cortes, Francis Giles, Susan O'Brien, Deborah Thomas, Maher Albitar, Mary Beth Rios, Moshe Talpaz, Guillermo Garcia-Manero, Stefan Faderl, Laurie Letvak, August Salvado, Hagop Kantarjian. (2003) Results of imatinib mesylate therapy in patients with refractory or recurrent acute myeloid leukemia, high-risk myelodysplastic syndrome, and myeloproliferative disorders. Cancer 97:11, 2760-2766
CrossRef210
Michael Constantinescu, MD, Diana M. Veillon, MD, Mary Lowery Nordberg, PhD, Marjorie R. Fowler, MD, Deepti Shukla, MD, James Cotelingam, MD. (2003) case studies. Laboratory Medicine 34:6, 437-440
CrossRef211
Finella Brito-Babapulle. (2003) The eosinophilias, including the idiopathic hypereosinophilic syndrome. British Journal of Haematology 121:2, 203-223
CrossRef212
Renaud Capdeville, Sandra Silberman. (2003) Imatinib: A targeted clinical drug development. Seminars in Hematology 40, 15-20
CrossRef213
Renaud Capdeville, Sandra Silberman. (2003) Imatinib: A targeted clinical drug development. Seminars in Hematology 40:2, 15-20
CrossRef214
Lan Zhou, Naili An, Rex C. Haydon, Qixin Zhou, Hongwei Cheng, Ying Peng, Wei Jiang, Hue H. Luu, Pantila Vanichakarn, Jan Paul Szatkowski, Jae Yoon Park, Benjamin Breyer, Tong-Chuan He. (2003) Tyrosine kinase inhibitor STI-571/Gleevec down-regulates the β-catenin signaling activity. Cancer Letters 193:2, 161-170
CrossRef215
Cools, Jan, DeAngelo, Daniel J., Gotlib, Jason, Stover, Elizabeth H., Legare, Robert D., Cortes, Jorges, Kutok, Jeffrey, Clark, Jennifer, Galinsky, Ilene, Griffin, James D., Cross, Nicholas C.P., Tefferi, Ayalew, Malone, James, Alam, Rafeul, Schrier, Stanley L., Schmid, Janet, Rose, Michal, Vandenberghe, Peter, Verhoef, Gregor, Boogaerts, Marc, Wlodarska, Iwona, Kantarjian, Hagop, Marynen, Peter, Coutre, Steven E., Stone, Richard, Gilliland, D. Gary, . (2003) A Tyrosine Kinase Created by Fusion of the PDGFRA and FIP1L1 Genes as a Therapeutic Target of Imatinib in Idiopathic Hypereosinophilic Syndrome. New England Journal of Medicine 348:13, 1201-1214
Full Text216
O'Brien, Stephen G., Guilhot, François, Larson, Richard A., Gathmann, Insa, Baccarani, Michele, Cervantes, Francisco, Cornelissen, Jan J., Fischer, Thomas, Hochhaus, Andreas, Hughes, Timothy, Lechner, Klaus, Nielsen, Johan L., Rousselot, Philippe, Reiffers, Josy, Saglio, Giuseppe, Shepherd, John, Simonsson, Bengt, Gratwohl, Alois, Goldman, John M., Kantarjian, Hagop, Taylor, Kerry, Verhoef, Gregor, Bolton, Ann E., Capdeville, Renaud, Druker, Brian J., . (2003) Imatinib Compared with Interferon and Low-Dose Cytarabine for Newly Diagnosed Chronic-Phase Chronic Myeloid Leukemia. New England Journal of Medicine 348:11, 994-1004
Full Text217
Eduardo Olavarria, Charles Craddock. (2003) Stem cell transplantation for chronic myeloid leukemia: impact of imatinib mesylate. Current Opinion in Organ Transplantation 8:1, 125-130
CrossRef218
Carlo B Gambacorti-Passerini, Rosalind H Gunby, Rocco Piazza, Annamaria Galietta, Roberta Rostagno, Leonardo Scapozza. (2003) Molecular mechanisms of resistance to imatinib in Philadelphia-chromosome-positive leukaemias. The Lancet Oncology 4:2, 75-85
CrossRef219
A Douglas Laird, Julie M Cherrington. (2003) Small molecule tyrosine kinase inhibitors: clinical development of anticancer agents. Expert Opinion on Investigational Drugs 12:1, 51-64
CrossRef220
Tariq I Mughal, John M Goldman. (2003) Chronic Myeloid Leukemia. American Journal of Cancer 2:5, 305-311
CrossRef221
E. Joanna Baxter, Shashikant Kulkarni, Jose-Luis Vizmanos, Rina Jaju, Giovanni Martinelli, Nicoletta Testoni, George Hughes, Zoryana Salamanchuk, Maria Jose Calasanz, Idoya Lahortiga, Christopher F. Pocock, Raymond Dang, Carrie Fidler, James S. Wainscoat, Jacqueline Boultwood, Nicholas C. P. Cross. (2003) Novel translocations that disrupt the platelet-derived growth factor receptor beta (PDGFRB) gene in BCR-ABL-negative chronic myeloproliferative disorders. British Journal of Haematology 120:2, 251-256
CrossRef222
Joanne L. Yu, Brenda L. Coomber, R. S. Kerbel. (2002) A paradigm for therapy-induced microenvironmental changes in solid tumors leading to drug resistance. Differentiation 70:9-10, 599-609
CrossRef223
Schwartz, Robert, . (2002) A Molecular Star in the Wars against Cancer. New England Journal of Medicine 347:7, 462-463
Full Text
