Original Article
Nephrolithiasis and Osteoporosis Associated with Hypophosphatemia Caused by Mutations in the Type 2a Sodium–Phosphate Cotransporter
N Engl J Med 2002; 347:983-991September 26, 2002
- Abstract
Background
Epidemiologic studies suggest that genetic factors confer a predisposition to the formation of renal calcium stones or bone demineralization. Low serum phosphate concentrations due to a decrease in renal phosphate reabsorption have been reported in some patients with these conditions, suggesting that genetic factors leading to a decrease in renal phosphate reabsorption may contribute to them. We hypothesized that mutations in the gene coding for the main renal sodium–phosphate cotransporter (NPT2a) may be present in patients with these disorders.
Methods
We studied 20 patients with urolithiasis or bone demineralization and persistent idiopathic hypophosphatemia associated with a decrease in maximal renal phosphate reabsorption. The coding region of the gene for NPT2a was sequenced in all patients. The functional consequences of the mutations identified were analyzed by expressing the mutated RNA in Xenopus laevis oocytes.
Results
Two patients, one with recurrent urolithiasis and one with bone demineralization, were heterozygous for two distinct mutations. One mutation resulted in the substitution of phenylalanine for alanine at position 48, and the other in a substitution of methionine for valine at position 147. Phosphate-induced current and sodium-dependent phosphate uptake were impaired in oocytes expressing the mutant NPT2a. Coinjection of oocytes with wild-type and mutant RNA indicated that the mutant protein had altered function.
Conclusions
Heterozygous mutations in the NPT2a gene may be responsible for hypophosphatemia and urinary phosphate loss in persons with urolithiasis or bone demineralization.
Media in This Article
Figure 4
Effect of the Coexpression of Wild-Type and Mutant NPT2a RNA on Phosphate-Induced Current.Figure 3
Phosphate-Induced Current and Phosphate Uptake in Xenopus laevis Oocytes Injected with Wild-Type or Mutant NPT2a RNA.Article Activity
- Article
Epidemiologic studies have shown that both the formation of renal calcium stones1-6 and bone demineralization7-11 exhibit familial aggregation — findings that are compatible with the presence of genetic factors in these disorders. However, the search for gene variants that confer a predisposition to these common disorders has generally had negative results. Both disorders are likely to be genetically heterogeneous, in which case a variety of biologic abnormalities may contribute to the clinical phenotype in individual patients. For example, low serum phosphate concentrations due to a decrease in renal phosphate reabsorption have been reported in some patients with urolithiasis12-17 or bone demineralization,14,15,18 suggesting that genetic factors leading to a decrease in renal phosphate reabsorption can contribute to these diseases.
Since an evaluation of candidate genes can be useful in identifying loci involved in a subgroup of patients, we have been using this approach to identify genetic abnormalities in patients who have urolithiasis or bone demineralization associated with hypophosphatemia and low renal phosphate reabsorption. The gene coding for the type 2a sodium–phosphate cotransporter (NPT2a), which resides in the apical membrane of renal proximal tubular cells, is a likely candidate for these diseases.19,20 Indeed, the kidney is principally responsible for phosphate homeostasis, and it regulates serum phosphate by modulating urinary phosphate excretion.19 Phosphate is filtered by the glomerulus and subsequently reabsorbed in the proximal tubule, in which the rate-limiting step is the uptake of phosphate through NPT2a.19,20
Methods
Patients
We evaluated 20 unrelated patients at Hôpital Bichat in Paris, using a protocol described previously.17,21 In accordance with the national guidelines for research on human subjects, written, informed consent was obtained from all patients. Specimens were obtained from the patients on two or more days. All the patients had persistent hypophosphatemia; low maximal renal phosphate reabsorption, normalized according to the glomerular filtration rate; normal ionized serum calcium concentrations; and normal plasma parathyroid hormone concentrations. Maximal renal phosphate reabsorption, normalized according to the glomerular filtration rate, was determined with the use of the nomogram described by Walton and Bijvoët.22
Detection of Mutations
We used intronic primers to amplify the 13 exons of the NPT2a gene. The 190-bp region upstream of exon 1 was also sequenced. Exons 3 and 5 were amplified with the use of the following primers: exon 3, 5'CCGCCTGTTCCTCCCCGCCTC (upper primer), 5'CCATGAGCATAGTGGGCAGAG (lower primer); exon 5, 5'AGGAGACCTGGGAGGGGTTCC (upper primer), 5'AAGCTCTTCCCCACCCTGG (lower primer). Amplification was performed for 35 cycles at an annealing temperature of 60°C. The sequence of other primers is available as Supplementary Appendix 1 with the full text of this article at http://www.nejm.org. The PCR products were sequenced with the use of the BigDye Terminator Cycle Sequencing Ready Reaction kit (Perkin–Elmer) on an ABI PRISM 3100 sequencer (Applied Biosystems). We analyzed both strands of DNA using Sequencing Analysis (Applied Biosystems) and Clustal W (Infobiogen) software programs.
Expression of NPT2a in Xenopus laevis Oocytes
Wild-type complementary DNA (cDNA) encoding human NPT2a (kindly provided by Drs. J. Biber and H. Mürer, Physiology Institute, University of Zurich, Zurich) was introduced into the RNA expression vector pSP64T23,24 between the XhoI and NotI sites. Mutant cDNA was obtained from the wild-type construct with the use of the Quick Change Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer's instructions. All constructs were verified by sequencing. RNA was synthesized with the use of the Riboprobe in Vitro Transcription System kit (Promega) with SP6 RNA polymerase. Three independent RNA preparations were obtained for each construct, each from a different plasmid preparation. Purified RNA was quantified by absorption at 260 nm, and the quality was verified by calculating the ratio of readings at 260 and 280 nm (A260/A280). The homogeneity and quantification of all preparations used for oocyte injection were controlled by agarose-gel electrophoresis.
Defolliculated oocytes (stage V or VI) from X. laevis were obtained with the use of standard procedures and injected 24 hours later with the indicated amount of wild-type or mutant RNA in 50 nl of water or with water alone. Oocytes were incubated at 18°C in modified Barth's solution (5 mM HEPES–sodium hydroxide [pH 7.5] containing 85 mM sodium chloride, 1 mM potassium chloride, 1 mM calcium chloride, 1 mM magnesium chloride, and penicillin–streptomycin). Phosphate uptake was measured and voltage-clamp analysis performed three days after the injection.
Oocytes were washed at room temperature in a sodium-free solution (sodium-free uptake solution without phosphorus-32) and incubated either with the sodium-containing uptake solution (10 mM HEPES–TRIS [pH 7.5] containing 96 mM sodium chloride, 2 mM potassium chloride, 1.8 mM calcium chloride, 1 mM magnesium chloride, 0.1 mM potassium phosphate, and 10 μCi of [32P]orthophosphate per milliliter) or with the sodium-free uptake solution (with 100 mM choline chloride substituted for sodium chloride). After 30 minutes, the oocytes were washed five times with sodium-free solution and dissolved in 0.5 percent sodium dodecyl sulfate, and radioactivity was determined. Ten to 14 oocytes were studied in each experimental condition. Three independent experiments with the use of different preparations of RNA were performed.
Voltage-Clamp Experiments
Phosphate-induced currents were measured in two-electrode voltage-clamp experiments with the use of a current-voltage amplifier (Axoclamp-2A). Three days after the RNA injection, a –50 mV holding potential was imposed, during which current was recorded on a multi chart-recorder (Arc-en-Ciel). Oocytes were perfused with a sodium-containing solution (5 mM HEPES–sodium hydroxide [pH 7.5] containing 85 mM sodium chloride, 1 mM potassium chloride, 1 mM calcium chloride, and 1 mM magnesium chloride) before various concentrations of phosphate were added, as indicated.
Statistical Analysis
The results are presented as means ±SD. Statistical analyses were performed with the use of two-way analysis of variance and a protected-least-significant-difference Fisher's test, when allowed by F values, or repeated-measures analysis of variance.
Results
The 20 patients were 13 men and 7 women (mean age, 47±11 years) who had urolithiasis (14 patients, 10 of whom were men) or bone demineralization (6 patients, 3 of whom were men) associated with idiopathic hypophosphatemia (phosphate concentration, <2.48 mg per deciliter [0.80 mmol per liter]) and reduced maximal renal phosphate reabsorption, normalized according to the glomerular filtration rate (<0.70 mmol per liter). The glomerular filtration rate, determined by inulin clearance, was normal in all 20 patients (mean value, 90±14 ml per minute per 1.73 m2 of body-surface area). None of the patients had had rickets during childhood, and none had abnormal height as adults.
To determine whether NPT2a has a role in renal phosphate leak, we sequenced the 13 exons of the NPT2a gene and 190 nucleotides within the promoter region. Two distinct mutations were identified in two patients (Figure 1Figure 1
Sequence Analysis of DNA from Two Patients with Hypophosphatemia and Mutations in NPT2a.) in the heterozygous state.Patient 1, a 34-year-old man, had recurrent urolithiasis, a phosphate concentration of 1.58 mg per deciliter (0.51 mmol per liter), and maximal renal phosphate reabsorption, normalized according to the glomerular filtration rate, of 0.47 mmol per liter. He was heterozygous for two nucleotide substitutions: G→T at position 223 and C→T at position 224 (Figure 1A). The sequencing of cloned PCR products established that these substitutions corresponded to a two-base change on the same allele located in exon 3 and resulted in a substitution of phenylalanine for alanine at position 48 (A48F).
Patient 2 was a 64-year-old woman with idiopathic bone demineralization (bone mineral density at the lumbar spine, 0.639 g per square centimeter; at the femoral neck, 0.679 g per square centimeter); the phosphate concentration was 2.17 mg per deciliter (0.70 mmol per liter), and maximal renal phosphate reabsorption, normalized according to the glomerular filtration rate, was 0.58 mmol per liter. She had a single G→A transition at position 520 in exon 5 that resulted in a substitution of methionine for valine at position 147 (V147M) (Figure 1B). Her sole daughter had a spinal deformity and a history of arm fractures, with a low phosphate concentration (2.35 mg per deciliter [0.76 mmol per liter]) and low maximal renal phosphate reabsorption, normalized according to the glomerular filtration rate (0.67 mmol per liter). Her daughter had the same mutation. To exclude the possibility that the base changes identified in these patients represented common polymorphisms, exons 3 and 5 were amplified and sequenced from the genomic DNA of 120 subjects with normal maximal renal phosphate reabsorption, normalized according to the glomerular filtration rate. No nucleotide variants were detected in these subjects, with the exception of two previously described single-nucleotide polymorphisms.25,26
The NPT2a protein is thought to have an intracytoplasmic NH2 tail and eight transmembrane segments.20 The A48 residue is located in the NH2 terminal portion of the NPT2a protein,20 and the V147 residue is located in the second transmembrane segment.20 Amino acids A48 and V147 are conserved in humans, rats, rabbits, mice, opossums, and flounder (Figure 2Figure 2
Evolutionary Conservation of the A48 and V147 Residues.). The conservation of A48 and V147 residues across species and the absence of variants in control subjects support the hypothesis that the identified mutations may cause the defect in renal phosphate reabsorption observed in these patients.We tested this hypothesis further by comparing the function of wild-type and mutant NPT2a expressed in X. laevis oocytes. Injection of RNA into oocytes, as compared with cDNA transfection with the use of an expression vector, allows the expression of known amounts of RNA and the assessment of protein function with two independent and complementary methods: measurement of phosphate-induced currents by electrophysiological studies and quantification of phosphate uptake. NPT2a transports three sodium ions for one divalent phosphate ion.27 Hence, the uptake of phosphate results in a net movement of positive charges into the oocytes that can be recorded as an inward current in oocytes injected with NPT2a RNA.27 Accordingly, we injected oocytes with increasing concentrations of wild-type or mutant NPT2a RNA (Figure 3AFigure 3
Phosphate-Induced Current and Phosphate Uptake in Xenopus laevis Oocytes Injected with Wild-Type or Mutant NPT2a RNA.). The inward current was related to the amount of injected NPT2a RNA until it reached a plateau of 30 ng of wild-type or mutant RNA per oocyte. In the presence of a concentration of 1 mM phosphate, at all concentrations of RNA tested, the current induced by the mutant NPT2a was lower than that induced by the wild-type NPT2a (Figure 3A). In oocytes injected with 30 ng of mutant RNA, the current was 47 percent lower (in the case of V147M) and 65 percent lower (in the case of A48F) than the current in oocytes injected with 30 ng of wild-type RNA.We also tested the effect of increasing extracellular phosphate concentrations on phosphate-induced current in oocytes injected with 10 ng of wild-type or mutant NPT2a RNA (Figure 3B). The inward current increased with increasing concentrations of extracellular phosphate, reaching a plateau at 1 mM phosphate only in oocytes expressing wild-type NPT2a; the phosphate concentration at which the current was half the maximal value was 0.55 mM (Figure 3B). In oocytes expressing the mutant NPT2a, the phosphate-induced current was lower at all phosphate concentrations tested than that in oocytes expressing the wild-type transporter (Figure 3B). No plateau in phosphate-induced current was observed in oocytes expressing the mutant NPT2a over the range of phosphate concentrations tested, suggesting that the mutant transporters have a decreased affinity for phosphate.
The measurement of phosphate uptake in oocytes injected with 10 ng of wild-type or mutant RNA confirmed the impaired function of mutant NPT2a (Figure 3C). As expected, sodium-dependent phosphate uptake was lower in oocytes injected with vehicle (water) alone than in those injected with wild-type NPT2a (Figure 3C), and in the absence of sodium, phosphate uptake was low and was similar in oocytes whether they were injected with wild-type or mutant RNA or water (Figure 3C). These results indicate that the phosphate uptake observed was due to the expression of NPT2a. Phosphate uptake was significantly lower in oocytes injected with the RNA coding for the V147M or A48F mutation than in oocytes injected with the wild-type RNA (P<0.001).
In all experiments, both phosphate-induced current and sodium-dependent phosphate uptake were lower in oocytes expressing NPT2a with the A48F mutation than in those expressing the transporter with the V147M mutation (Figure 3). Since both patients were heterozygous for the mutations but had low maximal renal phosphate reabsorption, normalized according to the glomerular filtration rate, we assessed whether the mutant proteins could interfere with the wild-type product and diminish wild-type protein function by a dominant negative effect. In oocytes coinjected with 10 ng of wild-type RNA and 10 ng of mutant RNA, the phosphate-induced current was either similar to that in oocytes expressing 10 ng of wild-type NPT2a RNA alone (in the case of the V147M mutation) or significantly lower (in the case of the A48F mutation) and was reduced by 50 percent (in the case of the V147M mutation) and 65 percent (in the case of the A48F mutation) as compared with the current in oocytes injected with 20 ng of wild-type RNA alone (Figure 4Figure 4
Effect of the Coexpression of Wild-Type and Mutant NPT2a RNA on Phosphate-Induced Current.). These results indicate that the mutant proteins altered the function of the wild-type NPT2a through a dominant negative effect.To determine whether biologic data could help identify patients with mutations in the NPT2a gene, we compared the findings in the 2 patients who had mutations in the gene with those in the 18 patients who did not have mutations (Figure 5Figure 5
Laboratory Values in the 20 Patients with Hypophosphatemia and Reduced Maximal Renal Phosphate Reabsorption, According to Whether Mutations in NPT2a Were Identified.). None of the variables evaluated clearly distinguished patients with NPT2a mutations from those without mutations. The abnormalities observed for the patient with the A48F mutation were generally more pronounced than those observed for the patient with the V147M mutation.Discussion
Our findings suggest that NPT2a mutations identified in two patients caused an impairment in renal phosphate reabsorption, resulting in hypophosphatemia. A low serum phosphate concentration, in turn, would be expected to increase 1,25-dihydroxyvitamin D production,28,29 leading to hypercalciuria,16 as observed. This phenotype resembles that of heterozygous Npt2a-deficient mice (Npt2a+/–), which have increased urinary phosphate and calcium excretion, elevated plasma concentrations of 1,25-dihydroxyvitamin D,30 and urolithiasis.31 The functional defect of NPT2a is more severe with the A48F mutation than with the V147M mutation; this observation is consistent with the phenotype in our two patients, since the serum phosphorus concentration and the maximal capacity of the kidney to reabsorb phosphate were lower in the patient with the A48F mutation.
The findings in the daughter of the patient with the V147M mutation and the correlation between functional and biologic data support the hypothesis that the NPT2a mutations were responsible for the hypophosphatemia and loss of renal phosphate. The patients were heterozygous for the mutations, suggesting a dominant effect of the mutant allele. This is consistent with the observation of a dominant negative effect of the mutant proteins on the function of the wild-type transporter, leading to substantial renal phosphate losses in heterozygous patients. The underlying mechanism may involve either a competition between wild-type and mutant transporters for the interaction with a rate-limiting intracellular protein or a direct interaction between wild-type and mutant transporters, although there are conflicting data with regard to the existence of dimers of NPT2a.32,33
The reason why renal phosphate loss may lead to either the formation of calcium stones or bone demineralization is unknown, but it might be due to sex, environmental factors, or other genetic differences. Only 2 of our 20 patients with idiopathic renal phosphate loss had mutations in the NPT2a gene. Although it is possible that we did not detect all NPT2a mutations in our patients (e.g., mutations in introns or regulatory regions), other genes may be involved in the renal phosphate loss in these patients. In patients who have hereditary hypophosphatemic rickets with hypercalciuria, an autosomal recessive disorder, no mutation in the coding region of the NPT2a gene has been found.25,26 Similarly, mutations in the NPT2a gene have been ruled out in two additional forms of familial hypophosphatemia: X-linked hypophosphatemic rickets34 and autosomal dominant hereditary rickets.35 These disorders are associated with mutations in the phosphate-regulating gene with homologies to endopeptidases on the X chromosome (PHEX) and the gene encoding fibroblast growth factor 23 (FGF-23), respectively.34,35
Our study provides genetic evidence that heterozygous NPT2a mutations are involved in hypophosphatemia resulting from idiopathic renal phosphate loss and indicates that NPT2a plays a major part in phosphate homeostasis. The identification of functional variants of the NPT2a gene in patients with hypophosphatemia associated with urolithiasis or bone demineralization also provides genetic evidence that a defect in renal phosphate reabsorption may contribute to the pathogenesis of these two common disorders.
Supported by grants (CRC 940247 and CRIC 99228) from the Délégation Régionale à la Recherche Clinique, Assistance Publique–Hôpitaux de Paris.
We are indebted to Dr. Allan Hance for help during the preparation of the manuscript, to Dominique Henry for assistance with the sequencing, to Dr. Laurent Gouya for assistance with the directed mutagenesis, and to Dr. Boccon Gibod for referrals of patients with urolithiasis to the Service de Physiologie–Explorations Fonctionnelles.
Source Information
From the Service de Physiologie–Explorations Fonctionnelles (D.P., V.H., F.B.-B., G.F.) and the Service de Biochimie B (B. Gérard, B. Grandchamp), Hôpital Bichat, Assistance Publique–Hôpitaux de Paris; INSERM Unité 426 and Institut Fédératif de Recherche 02 (D.P., V.H., O.D., C.S., G.F.) and INSERM Unité 409 (B. Grandchamp), Faculté de Médecine Xavier Bichat; and INSERM Unité 467, Faculté de Médecine, Necker (N.B., G.P., P.H.) — all in Paris.
Address reprint requests to Dr. Prié at INSERM Unité 426, Faculté de Médecine Xavier Bichat, 16 rue Henri Huchard, 75018 Paris, France, or at dprie@bichat.inserm.fr.
- References
References
1
Resnick M ,Pridgen DB ,Goodman HO . Genetic predisposition to formation of calcium oxalate renal calculi. N Engl J Med 1968;278:1313-1318
Full Text | Web of Science | Medline2
Pridgen DB ,Resnick M ,Goodman HO ,Boyce WH . Inheritance of calcium renal stones. Lancet 1968;1:537-538
CrossRef | Web of Science | Medline3
Ljunghall S ,Danielson BG ,Fellstrom B ,Holmgren K ,Johansson G ,Wikstrom B . Family history of renal stones in recurrent stone patients. Br J Urol 1985;57:370-374
CrossRef | Medline4
Coe FL ,Parks JH ,Moore ES . Familial idiopathic hypercalciuria. N Engl J Med 1979;300:337-340
Full Text | Web of Science | Medline5
Robertson WG ,Peacock M ,Baker M , et al. Studies on the prevalence and epidemiology of urinary stone disease in men in Leeds. Br J Urol 1983;55:595-598
CrossRef | Medline6
Polito C ,La Manna A ,Nappi B ,Villani J ,Di Toro R . Idiopathic hypercalciuria and hyperuricosuria: family prevalence of nephrolithiasis. Pediatr Nephrol 2000;14:1102-1104
CrossRef | Web of Science | Medline7
Lutz J ,Tesar R . Mother-daughter pairs: spinal and femoral bone densities and dietary intakes. Am J Clin Nutr 1990;52:872-877
Web of Science | Medline8
Hansen MA ,Hassager C ,Jensen SB ,Christiansen C . Is heritability a risk factor for postmenopausal osteoporosis? J Bone Miner Res 1992;7:1037-1043
CrossRef | Web of Science | Medline9
Arden NK ,Baker J ,Hogg C ,Baan K ,Spector TD . The heritability of bone mineral density, ultrasound of the calcaneus and hip axis length: a study of postmenopausal twins. J Bone Miner Res 1996;11:530-534
CrossRef | Web of Science | Medline10
Ferrari S ,Rizzoli R ,Slosman D ,Bonjour JP . Familial resemblance for bone mineral mass is expressed before puberty. J Clin Endocrinol Metab 1998;83:358-361
CrossRef | Web of Science | Medline11
Danielson ME ,Cauley JA ,Baker CE , et al. Familial resemblance of bone mineral density (BMD) and calcaneal ultrasound attenuation: the BMD in mothers and daughters study. J Bone Miner Res 1999;14:102-110
CrossRef | Web of Science | Medline12
Shen FH ,Ivey JL ,Sherrard DJ ,Nielsen RL ,Haussler MR ,Baylink DJ . Further evidence supporting the phosphate leak hypothesis of idiopathic hypercalciuria. Adv Exp Med Biol 1978;103:217-223
Medline13
Pabico RC ,McKenna BA ,Freeman RB . Renal threshold phosphate concentration in patients with idiopathic nephrolithiasis: correlations with tubular functions, serum parathyroid hormone and 1,25(OH)2D3. Proc Eur Dial Transplant Assoc 1983;20:450-454
Medline14
Tieder M ,Modai D ,Samuel R , et al. Hereditary hypophosphatemic rickets with hypercalciuria. N Engl J Med 1985;312:611-617
Full Text | Web of Science | Medline15
Tieder M ,Modai D ,Shaked U , et al. “Idiopathic“ hypercalciuria and hereditary hypophosphatemic rickets: two phenotypical expressions of a common genetic defect. N Engl J Med 1987;316:125-129
Full Text | Web of Science | Medline16
Williams CP ,Child DF ,Hudson PR , et al. Inappropriate phosphate excretion in idiopathic hypercalciuria: the key to a common cause and future treatment? J Clin Pathol 1996;49:881-888
CrossRef | Web of Science | Medline17
Prie D ,Ravery V ,Boccon-Gibod L ,Friedlander G . Frequency of renal phosphate leak among patients with calcium nephrolithiasis. Kidney Int 2001;60:272-276
CrossRef | Web of Science | Medline18
de Vernejoul MC ,Marie P ,Kuntz D ,Gueris J ,Miravet L ,Ryckewaert A . Nonosteomalacic osteopathy associated with chronic hypophosphatemia. Calcif Tissue Int 1982;34:219-223
CrossRef | Web of Science | Medline19
Suki WN, Lederer ED, Rouse D. Renal transport of calcium, magnesium, and phosphate. In: Brenner BM, ed. Brenner & Rector's the kidney. 6th ed. Vol. 1. Philadelphia: W.B. Saunders, 2000:520-74.
20
Murer H ,Hernando N ,Forster I ,Biber J . Proximal tubular phosphate reabsorption: molecular mechanisms. Physiol Rev 2000;80:1373-1409
Web of Science | Medline21
Prie D ,Blanchet FB ,Essig M ,Jourdain JP ,Friedlander G . Dipyridamole decreases renal phosphate leak and augments serum phosphorus in patients with low renal phosphate threshold. J Am Soc Nephrol 1998;9:1264-1269
Web of Science | Medline22
Walton RJ ,Bijvoet OL . Nomogram for derivation of renal threshold phosphate concentration. Lancet 1975;2:309-310
CrossRef | Web of Science | Medline23
Krieg PA ,Melton DA . Functional messenger RNAs are produced by SP6 in vitro transcription of cloned cDNAs. Nucleic Acids Res 1984;12:7057-7070
CrossRef | Web of Science | Medline24
Melton DA ,Krieg PA ,Rebagliati MR ,Maniatis T ,Zinn K ,Green MR . Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res 1984;12:7035-7056
CrossRef | Web of Science | Medline25
Jones A ,Tzenova J ,Frappier D , et al. Hereditary hypophosphatemic rickets with hypercalciuria is not caused by mutations in the Na/Pi cotransporter NPT2 gene. J Am Soc Nephrol 2001;12:507-514
Web of Science | Medline26
van den Heuvel L ,Op de Koul K ,Knots E ,Knoers N ,Monnens L . Autosomal recessive hypophosphataemic rickets with hypercalciuria is not caused by mutations in the type II renal sodium/phosphate cotransporter gene. Nephrol Dial Transplant 2001;16:48-51
CrossRef | Web of Science | Medline27
Busch A ,Waldegger S ,Herzer T , et al. Electrophysiological analysis of Na+/Pi cotransport mediated by a transporter cloned from rat kidney and expressed in Xenopus oocytes. Proc Natl Acad Sci U S A 1994;91:8205-8208
CrossRef | Web of Science | Medline28
Gray RW ,Wilz DR ,Caldas AE ,Lemann J Jr . The importance of phosphate in regulating plasma 1,25-(OH)2-vitamin D levels in humans: studies in healthy subjects, in calcium-stone formers and in patients with primary hyperparathyroidism. J Clin Endocrinol Metab 1977;45:299-306
CrossRef | Web of Science | Medline29
Portale AA ,Halloran BP ,Morris RC Jr . Physiologic regulation of the serum concentration of 1,25-dihydroxyvitamin D by phosphorus in normal men. J Clin Invest 1989;83:1494-1499
CrossRef | Web of Science | Medline30
Beck L ,Karaplis AC ,Amizuka N ,Hewson AS ,Ozawa H ,Tenenhouse HS . Targeted inactivation of Npt2 in mice leads to severe renal phosphate wasting, hypercalciuria, and skeletal abnormalities. Proc Natl Acad Sci U S A 1998;95:5372-5377
CrossRef | Web of Science | Medline31
Chau H ,Tenenhouse HS . Renal phosphate wasting and hypercalciuria in Npt2 knockout mice are associated with nephrocalcinosis. J Am Soc Nephrol 2001;12:751A-751A abstract.32
Xiao Y ,Boyer CJ ,Vincent E , et al. Involvement of disulphide bonds in the renal sodium/phosphate co-transporter NaPi-2. Biochem J 1997;323:401-408
Web of Science | Medline33
Lambert G ,Forster IC ,Biber J ,Murer H . Cysteine residues and the structure of the rat renal proximal tubular type II sodium phosphate cotransporter (rat NaPi IIa). J Membr Biol 2000;176:133-141
CrossRef | Web of Science | Medline34
A gene (PEX) with homologies to endopeptidases is mutated in patients with X-linked hypophosphataemic rickets. Nat Genet 1995;11:130-136
CrossRef | Web of Science | Medline35
Autosomal dominant hypophosphataemic rickets is associated with mutations in FGF23. Nat Genet 2000;26:345-348
CrossRef | Web of Science | Medline
- Citing Articles (81)
Citing Articles
1
Daniella Magen, Israel Zelikovic. 2012. Hereditary Tubular Disorders of Mineral Handling. , 727-770.
CrossRef2
Sandra Habbig, Bodo Bernhard Beck, Bernd Hoppe. (2011) Nephrocalcinosis and urolithiasis in children. Kidney International
CrossRef3
Ken-Ichi Miyamoto, Sakiko Haito-Sugino, Shoji Kuwahara, Akiko Ohi, Kengo Nomura, Mikiko Ito, Masashi Kuwahata, Shinsuke Kido, Sawako Tatsumi, Ichiro Kaneko, Hiroko Segawa. (2011) Sodium-dependent phosphate cotransporters: Lessons from gene knockout and mutation studies. Journal of Pharmaceutical Sciences 100:9, 3719-3730
CrossRef4
Joanna Kenny, Melissa M. Lees, Susan Drury, Angela Barnicoat, William Hoff, Rodger Palmer, Deborah Morrogh, Jonathan J. Waters, Nicholas J. Lench, Detlef Bockenhauer. (2011) Sotos syndrome, infantile hypercalcemia, and nephrocalcinosis: a contiguous gene syndrome. Pediatric Nephrology 26:8, 1331-1334
CrossRef5
E. C. Lorenz, J. C. Lieske, T. J. Vrtiska, A. E. Krambeck, X. Li, E. J. Bergstralh, L. J. Melton, A. D. Rule. (2011) Clinical characteristics of potential kidney donors with asymptomatic kidney stones. Nephrology Dialysis Transplantation 26:8, 2695-2700
CrossRef6
Saharon Rosset, Shay Tzur, Doron M. Behar, Walter G. Wasser, Karl Skorecki. (2011) The population genetics of chronic kidney disease: insights from the MYH9–APOL1 locus. Nature Reviews Nephrology 7:6, 313-326
CrossRef7
Ian Forster, Nati Hernando, Victor Sorribas, Andreas Werner. (2011) Phosphate Transporters in Renal, Gastrointestinal, and Other Tissues. Advances in Chronic Kidney Disease 18:2, 63-76
CrossRef8
Khashayar Sakhaee, Naim M Maalouf, Rajiv Kumar, Andreas Pasch, Orson W Moe. (2011) Nephrolithiasis-associated bone disease: pathogenesis and treatment options. Kidney International 79:4, 393-403
CrossRef9
Demetrius Ellis. 2011. Regulation of Fluids and Electrolytes. , 116-156.
CrossRef10
Michel Daudon, Hassan Bouzidi, Dominique Bazin. (2010) Composition and morphology of phosphate stones and their relation with etiology. Urological Research 38:6, 459-467
CrossRef11
Linda A. Russell. (2010) Osteoporosis and Osteomalacia. Rheumatic Disease Clinics of North America 36:4, 665-680
CrossRef12
Amir S. Alizadeh Naderi, Robert F. Reilly. (2010) Hereditary disorders of renal phosphate wasting. Nature Reviews Nephrology 6:11, 657-665
CrossRef13
(2010) Genetic Disorders of Renal Phosphate Transport. New England Journal of Medicine 363:18, 1774-1775
Full Text14
R. Marsell, K. B. Jonsson. (2010) The phosphate regulating hormone fibroblast growth factor-23. Acta Physiologica 200:2, 97-106
CrossRef15
Rochelle Cunningham, Rajatsubhra Biswas, Deborah Steplock, Shirish Shenolikar, Edward Weinman. (2010) Role of NHERF and scaffolding proteins in proximal tubule transport. Urological Research 38:4, 257-262
CrossRef16
Elaine M. Worcester, Fredric L. Coe. (2010) Evidence for altered renal tubule function in idiopathic calcium stone formers. Urological Research 38:4, 263-269
CrossRef17
Nati Hernando, Serge M. Gisler, Sonja C. Reining, Nadine Déliot, Paola Capuano, Jürg Biber, Heini Murer. (2010) NaPi-IIa interacting proteins and regulation of renal reabsorption of phosphate. Urological Research 38:4, 271-276
CrossRef18
Hwa Young Cho, Hyung Jin Choi, Hyun Jin Sun, Jae-Yeon Yang, Jee Hyun An, Sun Wook Cho, Sang Wan Kim, Seong Yeon Kim, Jung Eun Kim, Chan Soo Shin. (2010) Transgenic mice overexpressing secreted frizzled-related proteins (sFRP)4 under the control of serum amyloid P promoter exhibit low bone mass but did not result in disturbed phosphate homeostasis. Bone 47:2, 263-271
CrossRef19
Schwartz, Robert S., , Prié, Dominique, Friedlander, Gérard, . (2010) Genetic Disorders of Renal Phosphate Transport. New England Journal of Medicine 362:25, 2399-2409
Full Text20
Stefan Amatschek, Maria Haller, Rainer Oberbauer. (2010) Renal phosphate handling in human - what can we learn from hereditary hypophosphataemias?. European Journal of Clinical Investigation 40:6, 552-560
CrossRef21
Anna Köttgen, Cristian Pattaro, Carsten A Böger, Christian Fuchsberger, Matthias Olden, Nicole L Glazer, Afshin Parsa, Xiaoyi Gao, Qiong Yang, Albert V Smith, Jeffrey R O'Connell, Man Li, Helena Schmidt, Toshiko Tanaka, Aaron Isaacs, Shamika Ketkar, Shih-Jen Hwang, Andrew D Johnson, Abbas Dehghan, Alexander Teumer, Guillaume Paré, Elizabeth J Atkinson, Tanja Zeller, Kurt Lohman, Marilyn C Cornelis, Nicole M Probst-Hensch, Florian Kronenberg, Anke Tönjes, Caroline Hayward, Thor Aspelund, Gudny Eiriksdottir, Lenore J Launer, Tamara B Harris, Evadnie Rampersaud, Braxton D Mitchell, Dan E Arking, Eric Boerwinkle, Maksim Struchalin, Margherita Cavalieri, Andrew Singleton, Francesco Giallauria, Jeffrey Metter, Ian H de Boer, Talin Haritunians, Thomas Lumley, David Siscovick, Bruce M Psaty, M Carola Zillikens, Ben A Oostra, Mary Feitosa, Michael Province, Mariza de Andrade, Stephen T Turner, Arne Schillert, Andreas Ziegler, Philipp S Wild, Renate B Schnabel, Sandra Wilde, Thomas F Munzel, Tennille S Leak, Thomas Illig, Norman Klopp, Christa Meisinger, H-Erich Wichmann, Wolfgang Koenig, Lina Zgaga, Tatijana Zemunik, Ivana Kolcic, Cosetta Minelli, Frank B Hu, Åsa Johansson, Wilmar Igl, Ghazal Zaboli, Sarah H Wild, Alan F Wright, Harry Campbell, David Ellinghaus, Stefan Schreiber, Yurii S Aulchenko, Janine F Felix, Fernando Rivadeneira, Andre G Uitterlinden, Albert Hofman, Medea Imboden, Dorothea Nitsch, Anita Brandstätter, Barbara Kollerits, Lyudmyla Kedenko, Reedik Mägi, Michael Stumvoll, Peter Kovacs, Mladen Boban, Susan Campbell, Karlhans Endlich, Henry Völzke, Heyo K Kroemer, Matthias Nauck, Uwe Völker, Ozren Polasek, Veronique Vitart, Sunita Badola, Alexander N Parker, Paul M Ridker, Sharon L R Kardia, Stefan Blankenberg, Yongmei Liu, Gary C Curhan, Andre Franke, Thierry Rochat, Bernhard Paulweber, Inga Prokopenko, Wei Wang, Vilmundur Gudnason, Alan R Shuldiner, Josef Coresh, Reinhold Schmidt, Luigi Ferrucci, Michael G Shlipak, Cornelia M van Duijn, Ingrid Borecki, Bernhard K Krämer, Igor Rudan, Ulf Gyllensten, James F Wilson, Jacqueline C Witteman, Peter P Pramstaller, Rainer Rettig, Nick Hastie, Daniel I Chasman, W H Kao, Iris M Heid, Caroline S Fox. (2010) New loci associated with kidney function and chronic kidney disease. Nature Genetics 42:5, 376-384
CrossRef22
Emily G. Farrow, Kenneth E. White. (2010) Recent advances in renal phosphate handling. Nature Reviews Nephrology 6:4, 207-217
CrossRef23
Magen, Daniella, Berger, Liron, Coady, Michael J., Ilivitzki, Anat, Militianu, Daniela, Tieder, Martin, Selig, Sara, Lapointe, Jean Yves, Zelikovic, Israel, Skorecki, Karl, . (2010) A Loss-of-Function Mutation in NaPi-IIa and Renal Fanconi's Syndrome. New England Journal of Medicine 362:12, 1102-1109
Full Text24
Yun-Sok Ha, Dong-Un Tchey, Ho Won Kang, Yong-June Kim, Seok-Joong Yun, Sang-Cheol Lee, Wun-Jae Kim. (2010) Phosphaturia as a Promising Predictor of Recurrent Stone Formation in Patients with Urolithiasis. Korean Journal of Urology 51:1, 54
CrossRef25
Michael J. Stechman, Nellie Y. Loh, Rajesh V. Thakker. (2009) Genetic causes of hypercalciuric nephrolithiasis. Pediatric Nephrology 24:12, 2321-2332
CrossRef26
D. Prie, G. Friedlander. (2009) Genetic Causes of Renal Lithiasis. IBMS BoneKEy 6:10, 357-367
CrossRef27
Saeed R. Khan, Benjamin K. Canales. (2009) Genetic basis of renal cellular dysfunction and the formation of kidney stones. Urological Research 37:4, 169-180
CrossRef28
Hiroko Segawa, Fumito Aranami, Ichiro Kaneko, Yuka Tomoe, Ken-ichi Miyamoto. (2009) The roles of Na/Pi-II transporters in phosphate metabolism. Bone 45, S2-S7
CrossRef29
Andrea Tasca, Luca Dalle Carbonare, Filippo Nigro, Sandro Giannini. (2009) Bone Disease in Patients With Primary Hypercalciuria and Calcium Nephrolithiasis. Urology 74:1, 22-27
CrossRef30
Dominique Prié, Pablo Ureña Torres, Gérard Friedlander. (2009) Latest findings in phosphate homeostasis. Kidney International 75:9, 882-889
CrossRef31
M. Laroche, J. F. Boyer, H. Jahafar, J. Allard, I. Tack. (2009) Normal FGF23 Levels in Adult Idiopathic Phosphate Diabetes. Calcified Tissue International 84:2, 112-117
CrossRef32
Miyuki Kamimoto, Shinya Mizuno, Hiroyuki Ohnishi, Yoko Mizuno-Horikawa. (2009) Type 2a sodium-phosphate co-transporter serves as a histological predictor of renal dysfunction and tubular apical damage in the kidneys of septic mice. Biomedical Research 30:4, 251-258
CrossRef33
Pawel R Kiela, Fayez K Ghishan. (2009) Recent advances in the renal–skeletal–gut axis that controls phosphate homeostasis. Laboratory Investigation 89:1, 7-14
CrossRef34
Frieda. Feldman. 2009. Oncogenic Osteomalacia. , 668-677.
CrossRef35
Harald JÜppner, Anthony A. Portale. 2009. Endocrine Regulation of Phosphate Homeostasis. , 105-126.
CrossRef36
Armando Luis Negri. 2008. Molecular Genetics of Inherited Hypophosphataemias. .
CrossRef37
Máire E. Doyle, Suzanne M. Jan de Beur. (2008) The skeleton: Endocrine regulator of phosphate homeostasis. Current Osteoporosis Reports 6:4, 134-141
CrossRef38
Levi, Moshe, Breusegem, Sophia, . (2008) Renal Phosphate–Transporter Regulatory Proteins and Nephrolithiasis. New England Journal of Medicine 359:11, 1171-1173
Full Text39
Karim, Zoubida, Gérard, Bénédicte, Bakouh, Naziha, Alili, Rohia, Leroy, Christine, Beck, Laurent, Silve, Caroline, Planelles, Gabrielle, Urena-Torres, Pablo, Grandchamp, Bernard, Friedlander, Gérard, Prié, Dominique, . (2008) NHERF1 Mutations and Responsiveness of Renal Parathyroid Hormone. New England Journal of Medicine 359:11, 1128-1135
Full Text40
Murat Bastepe, Harald Jüppner. (2008) Inherited hypophosphatemic disorders in children and the evolving mechanisms of phosphate regulation. Reviews in Endocrine and Metabolic Disorders 9:2, 171-180
CrossRef41
Giuseppe Vezzoli, Laura Soldati, Giovanni Gambaro. (2008) Update on Primary Hypercalciuria From a Genetic Perspective. The Journal of Urology 179:5, 1676-1682
CrossRef42
Yoshiro Suzuki, Christopher P. Landowski, Matthias A. Hediger. (2008) Mechanisms and Regulation of Epithelial Ca 2+ Absorption in Health and Disease. Annual Review of Physiology 70:1, 257-271
CrossRef43
Elaine M. Worcester, Fredric L. Coe. (2008) New Insights Into the Pathogenesis of Idiopathic Hypercalciuria. Seminars in Nephrology 28:2, 120-132
CrossRef44
Nak-Won Choi. (2008) Kidney and Phosphate Metabolism. Electrolyte & Blood Pressure 6:2, 77
CrossRef45
O Devuyst, Y Pirson. (2007) Genetics of hypercalciuric stone forming diseases. Kidney International 72:9, 1065-1072
CrossRef46
Takehisa Yamamoto, Toshimi Michigami, Fumito Aranami, Hiroko Segawa, Kousei Yoh, Shigeo Nakajima, Ken-ichi Miyamoto, Keiichi Ozono. (2007) Hereditary hypophosphatemic rickets with hypercalciuria: a study for the phosphate transporter gene type IIc and osteoblastic function. Journal of Bone and Mineral Metabolism 25:6, 407-413
CrossRef47
F. Jakob. (2007) Metabolische Knochenerkrankungen. Der Internist 48:10, 1101-1118
CrossRef48
Tarak Srivastava, Uri S. Alon. (2007) Pathophysiology of hypercalciuria in children. Pediatric Nephrology 22:10, 1659-1673
CrossRef49
ARMANDO L NEGRI. (2007) Hereditary hypophosphatemias: New genes in the bone?kidney axis (Review Article). Nephrology 12:4, 317-320
CrossRef50
Michele Garabedian. (2007) Regulation of phosphate homeostasis in infants, children, and adolescents, and the role of phosphatonins in this process. Current Opinion in Pediatrics 19:4, 488-491
CrossRef51
L. David, B. Salle. (2007) Raquitismo. EMC - Pediatr??a 42:4, 1-25
CrossRef52
2007. U. , 222-228.
CrossRef53
I C Forster, N Hernando, J Biber, H Murer. (2006) Proximal tubular handling of phosphate: A molecular perspective. Kidney International 70:9, 1548-1559
CrossRef54
Ayse Corut, Abdurrahman Senyigit, Sibel Aylin Ugur, Sedat Altin, Ugur Ozcelik, Haluk Calisir, Zeki Yildirim, Ayhan Gocmen, Aslihan Tolun. (2006) Mutations in SLC34A2 Cause Pulmonary Alveolar Microlithiasis and Are Possibly Associated with Testicular Microlithiasis. The American Journal of Human Genetics 79:4, 650-656
CrossRef55
Ita P Heilberg, José R Weisinger. (2006) Bone disease in idiopathic hypercalciuria. Current Opinion in Nephrology and Hypertension 15:4, 394-402
CrossRef56
Clemens Bergwitz, Nicole M. Roslin, Martin Tieder, J.C. Loredo-Osti, Murat Bastepe, Hilal Abu-Zahra, Danielle Frappier, Kelly Burkett, Thomas O. Carpenter, Donald Anderson, Michèle Garabédian, Isabelle Sermet, T. Mary Fujiwara, Kenneth Morgan, Harriet S. Tenenhouse, Harald Jüppner. (2006) SLC34A3 Mutations in Patients with Hereditary Hypophosphatemic Rickets with Hypercalciuria Predict a Key Role for the Sodium-Phosphate Cotransporter NaPi-IIc in Maintaining Phosphate Homeostasis. The American Journal of Human Genetics 78:2, 179-192
CrossRef57
Bettina Lorenz-Depiereux, Anna Benet-Pages, Gertrud Eckstein, Yardena Tenenbaum-Rakover, Janine Wagenstaller, Dov Tiosano, Ruth Gershoni-Baruch, Norbert Albers, Peter Lichtner, Dirk Schnabel, Ze'ev Hochberg, Tim M. Strom. (2006) Hereditary Hypophosphatemic Rickets with Hypercalciuria Is Caused by Mutations in the Sodium-Phosphate Cotransporter Gene SLC34A3. The American Journal of Human Genetics 78:2, 193-201
CrossRef58
J-Y Lapointe, J Tessier, Y Paquette, B Wallendorff, M J Coady, V Pichette, A Bonnardeaux. (2006) NPT2a gene variation in calcium nephrolithiasis with renal phosphate leak. Kidney International 69:12, 2261
CrossRef59
Demetrius Ellis. 2006. Regulation of Fluids and Electrolytes in Infants and Children. , 109-152.
CrossRef60
Harriet S. Tenenhouse. (2005) REGULATION OF PHOSPHORUS HOMEOSTASIS BY THE TYPE IIA NA/PHOSPHATE COTRANSPORTER. Annual Review of Nutrition 25:1, 197-214
CrossRef61
Nati Hernando, Jurg Biber, Ian Forster, Heini Murer. (2005) Recent Advances in Renal Phosphate Transport. Therapeutic Apheresis and Dialysis 9:4, 323-327
CrossRef62
Dominique Prié, Laurent Beck, Pablo Urena, Gérard Friedlander. (2005) Recent findings in phosphate homeostasis. Current Opinion in Nephrology and Hypertension 14:4, 318-324
CrossRef63
F. Jakob. (2005) Primäre und sekundäre Osteoporose. Der Internist 46:S01, S24-S30
CrossRef64
G. Beraud, P. Perimenis, F.R.-L. Velayoudom, J.-L. Wemeau, M.-C.H.R. Vantyghem. (2005) Hypophosphorémies d’origine génétique : avancées physiopathogéniques récentes. Annales d'Endocrinologie 66:2, 109-116
CrossRef65
Yaacov Frishberg, Orit Topaz, Reuven Bergman, Doron Behar, Drora Fisher, Derek Gordon, Gabriele Richard, Eli Sprecher. (2005) Identification of a recurrent mutation in GALNT3 demonstrates that hyperostosis-hyperphosphatemia syndrome and familial tumoral calcinosis are allelic disorders. Journal of Molecular Medicine 83:1, 33-38
CrossRef66
Giovanni Gambaro, Giuseppe Vezzoli, Giorgio Casari, Luca Rampoldi, Angela D’Angelo, Loris Borghi. (2004) Genetics of hypercalciuria and calcium nephrolithiasis: From the rare monogenic to the common polygenic forms. American Journal of Kidney Diseases 44:6, 963-986
CrossRef67
Dominique Prié, Laurent Beck, Gérard Friedlander, Caroline Silve. (2004) Sodium-phosphate cotransporters, nephrolithiasis and bone demineralization. Current Opinion in Nephrology and Hypertension 13:6, 675-681
CrossRef68
Desa Bacic, Carsten A. Wagner, Nati Hernando, Brigitte Kaissling, Jurg Biber, Heini Murer. (2004) Novel aspects in regulated expression of the renal type IIa Na/Pi-cotransporter. Kidney International 66:s91, S5-S12
CrossRef69
Tom W. J. Huizinga, David S. Pisetsky, Robert P. Kimberly. (2004) Associations, populations, and the truth: Recommendations for genetic association studies inArthritis & Rheumatism. Arthritis & Rheumatism 50:7, 2066-2071
CrossRef70
Craig B Langman. (2004) The molecular basis of kidney stones. Current Opinion in Pediatrics 16:2, 188-193
CrossRef71
Eiji Takeda, Hironori Yamamoto, Kunitaka Nashiki, Tadatoshi Sato, Hidekazu Arai, Yutaka Taketani. (2004) Inorganic phosphate homeostasis and the role of dietary phosphorus. Journal of Cellular and Molecular Medicine 8:2, 191-200
CrossRef72
Lori A Brame, Kenneth E White, Michael J Econs. (2004) Renal phosphate wasting disorders: clinical features and pathogenesis. Seminars in Nephrology 24:1, 39-47
CrossRef73
Eiji Takeda, Yutaka Taketani, Naoki Sawada, Tadatoshi Sato, Hironori Yamamoto. (2004) The regulation and function of phosphate in the human body. BioFactors 21:1-4, 345-355
CrossRef74
Dominique Prié, Laurent Beck, Caroline Silve, Gérard Friedlander. (2004) Hypophosphatemia and Calcium Nephrolithiasis. Nephron Experimental Nephrology 98:2, e50-e54
CrossRef75
Leila V Virkki, Ian C Forster, Nati Hernando, JÜRg Biber, Heini Murer. (2003) Functional Characterization of Two Naturally Occurring Mutations in the Human Sodium-Phosphate Cotransporter Type IIa. Journal of Bone and Mineral Research 18:12, 2135-2141
CrossRef76
Eberhard Ritz, Volker Haxsen, Martin Zeier. (2003) Disorders of phosphate metabolism—pathomechanisms and management of hypophosphataemic disorders. Best Practice & Research Clinical Endocrinology & Metabolism 17:4, 547-558
CrossRef77
(2003) Nephrolithiasis, Osteoporosis, and Mutations in the Type 2a Sodium–Phosphate Cotransporter. New England Journal of Medicine 348:3, 264-265
Full Text78
Kronenberg, Henry M., . (2002) NPT2a — The Key to Phosphate Homeostasis. New England Journal of Medicine 347:13, 1022-1024
Full Text79
E. Seeman. (2001) Clinical and Basic Research Papers: December 2002 Selections. International Bone and Mineral Society Knowledge Environment 1:1, 2003080-0
CrossRef80
E. Seeman. (2001) Clinical Papers: October 2002 Selections. International Bone and Mineral Society Knowledge Environment 1:1, 2003078-0
CrossRef81
D. M. Black. (2001) Meeting Report from the 24th Annual Meeting of the American Society for Bone and Mineral Research. International Bone and Mineral Society Knowledge Environment 1:1, 2002065-0
CrossRef
- Letters
