Original Article
Osteoprotegerin Deficiency and Juvenile Paget's Disease
N Engl J Med 2002; 347:175-184July 18, 2002
- Abstract
Background
Juvenile Paget's disease, an autosomal recessive osteopathy, is characterized by rapidly remodeling woven bone, osteopenia, fractures, and progressive skeletal deformity. The molecular basis is not known. Osteoprotegerin deficiency could explain juvenile Paget's disease because osteoprotegerin suppresses bone turnover by functioning as a decoy receptor for osteoclast differentiation factor (also called RANK ligand).
Methods
We evaluated two apparently unrelated Navajo patients with juvenile Paget's disease for defects in the gene encoding osteoprotegerin (TNFRSF11B) using polymerase-chain-reaction (PCR) amplification followed by direct sequencing and Southern blotting of genomic DNA. Genetic markers near TNFRSF11B were evaluated by both a PCR method that involved sequence-tagged site-content mapping of a deletion of TNFRSF11B and PCR spanning the DNA break points.
Results
Both patients had a homozygous deletion of TNFRSF11B, with identical break points, on chromosome 8q24.2. The defect spans approximately 100 kb, but neighboring genes are intact. We found that serum levels of osteoprotegerin and soluble osteoclast differentiation factor were undetectable and markedly increased, respectively.
Conclusions
Juvenile Paget's disease can result from osteoprotegerin deficiency caused by homozygous deletion of TNFRSF11B.
Media in This Article
Figure 3
The TNFRSF11B DeletionFigure 4
Serum Levels of Osteoprotegerin and Soluble Osteoclast Differentiation Factor in Patient 1, His Parents, and Age-Matched Controls.Article Activity
- Article
Juvenile Paget's disease, also called hyperostosis corticalis deformans juvenilis or hereditary hyperphosphatasia (number 239000 in Mendelian Inheritance in Man [MIM]),1 is a rare, autosomal recessive osteopathy of unknown cause that presents in infancy or early childhood with pain from debilitating fractures and deformities due to a markedly accelerated rate of bone remodeling throughout the skeleton.2-4 The disorder is distinct from the more common condition that sometimes clusters in families, Paget's disease of bone (MIM number 167250), which is typically manifested by focal increases in the rate of bone turnover in middle-aged or elderly people.5,6 In patients with juvenile Paget's disease, the continual rapid formation and degradation of osseous tissue impair growth, modeling, and remodeling of the entire skeleton.2-4 Patients have elevated biochemical markers of bone turnover as well as histopathological evidence of weak and disorganized woven bone.2-4 Approximately 40 cases of juvenile Paget's disease have been reported worldwide.3 Unless it is treated with drugs that block osteoclast-mediated skeletal resorption, the disease can be fatal.7-10
In healthy persons, osteoprotegerin (MIM number 602643) suppresses the coupled process of skeletal turnover, functioning as a decoy receptor for osteoclast differentiation factor (MIM number 602642), or receptor activator of nuclear factor-κB (RANK) ligand.11-14 Osteoclast differentiation factor promotes bone resorption by enhancing the formation and activation of osteoclasts when it binds to RANK (MIM number 603499) on hematopoietic osteoclast progenitor cells as well as on mature osteoclasts.13-15
We describe homozygous deletion of the gene on chromosome 8q24.2 that encodes osteoprotegerin, member 11B of the superfamily of tumor necrosis factor receptors (TNFRSF11B), in two Navajo patients with juvenile Paget's disease.
Methods
We used a candidate-gene approach to explore the genetic basis of juvenile Paget's disease. Recently, excessive RANK activity due to tandem duplications of distinctive lengths within exon 1 of TNFRSF11A, encoding the signal peptide of RANK, was identified as the cause of three rare autosomal dominant disorders involving rapid skeletal remodeling: familial expansile osteolysis (MIM number 174810), early-onset Paget's disease of bone in Japan (MIM number 602080), and a newly characterized condition called expansile skeletal hyperphosphatasia.16-18 However, because we found no mutation of TNFRSF11A in the proband, osteoprotegerin deficiency as a result of the impaired expression of TNFRSF11B became a candidate pathogenesis for juvenile Paget's disease. The fact that osteoprotegerin-knockout mice reportedly have osteoporosis as a result of accelerated rates of remodeling19,20 increased our interest in TNFRSF11B as the potential cause of juvenile Paget's disease.
Patients
Patient 1
Patient 1, the Navajo proband (Family 1) who was referred to us at one year of age because of bone deformities and failure to thrive due to juvenile Paget's disease, appeared well until the age of five months, when he was found to have a misshapen skull and thorax. Chest radiography for pneumonia at the age of seven months revealed skeletal abnormalities interpreted as juvenile Paget's disease. The child had been treated for streptococcal pneumonia with meningitis at the age of 10 months. He was small (below the 3rd percentile for length and in the 5th percentile for weight), deaf, tachypneic, and weak and had a disproportionately large head (75th percentile for circumference), short humeri, laterally bowed femora, anteriorly curved tibiae, markedly delayed gross motor skills, and poor muscle tone (Figure 1AFigure 1
Features of Two Navajo Patients with Juvenile Paget's Disease.). Radiographic findings typical of juvenile Paget's disease included widened, osteopenic long bones with coarse trabeculae and indistinct corticomedullary junctions (Figure 1B).2-4 Measurements of biochemical variables of mineral homeostasis were remarkable only for hypercalciuria (401 mg of calcium per gram of creatinine). Markers of skeletal turnover included a striking elevation in serum alkaline phosphatase activity (2716 U per liter; normal range, 133 to 347), resulting from increased amounts of the alkaline phosphatase isoform emanating from bone, which reflected increased formation of osseous tissue, and excessive urinary excretion of deoxypyridinoline (173 nmol per millimole of creatinine; normal range, 2 to 41), which reflected enhanced resorption of osseous tissue. Substantial clinical and radiographic improvement followed daily subcutaneous injections of synthetic salmon calcitonin given to inhibit bone resorption. However, therapy was not administered consistently in the ensuing years. The child was still below the 3rd percentile for height and weight and had active bone disease when he was seen at the age of seven years in the spring of 2002. His healthy-appearing parents had normal serum alkaline phosphatase activity and unremarkable findings on skeletal radiography. His family history was negative for consanguinity, which is proscribed by Navajo tradition.21 Patient 2
In July 2001, we were contacted by a 26-year-old Navajo woman with juvenile Paget's disease (Family 2) who was seemingly unrelated to Patient 1 and who was deaf, severely deformed, and incapacitated (Figure 1C and Figure 1D). In 1979, she was described as Case 1 by Dunn and colleagues22 after she and another unrelated Navajo child with juvenile Paget's disease benefited from injections of synthetic human calcitonin. However, antiresorptive therapy had not been given for two decades. Her serum alkaline phosphatase activity was 838 IU per liter (normal range, 36 to 136). Sequential radiographic studies documented worsening osteopenia and profound skeletal deformities that caused chronic, severe pain. She died from pneumonia and heart failure in October 2001. Her parents were healthy and appeared well.
Genetic Studies
DNA was extracted from blood leukocytes after informed written consent had been obtained from the parents of Patient 1 and from Patient 2. To rule out a defect involving the gene that encodes RANK in the proband, we used the polymerase-chain-reaction (PCR) method to amplify TNFRSF11A and then sequenced exon 1 using published methods.16 When this analysis proved unrevealing (data not shown), we analyzed DNA from Patient 1 and his parents and sequenced TNFRSF11B, which encodes osteoprotegerin. PCR primers were designed with use of complementary DNA (GenBank accession number NM 002546) and the genomic DNA sequences (GenBank accession numbers AB008821 and AB008822) to amplify each of the five coding exons and adjacent splice sites of TNFRSF11B.11
Exon 1 was amplified with use of the primers 5'TGATCAAAGGCAGGCGATAC3' and 5'TGGGAGGTTGGGAGACCAGG3', exon 2 with use of 5'TCATGCTAAGATGATGCCACT3' and 5'CTATCTGACTTTGCATGATCC3', exon 3 with use of 5'CTGCTGGGAAACGATTTGAGG3' and 5'CTACAAAATCGTACAAAGACG3', exon 4 with use of 5'GACTCTCAGAAATCCAATTG3' and 5'GGTGTCTTTGATTTCTGATTG3', and exon 5 with use of 5'GCTTGTTTTATGATGGCATTGG3' and 5'GATATCACTGAAAGCCTCAAG3'. The TNFRSF11B exons were amplified with the use of approximately 12 ng of DNA in a 39-μl reaction. Sequential PCR conditions included denaturation at 95°C for 2 minutes, followed by 35 cycles at 95°C for 30 seconds, annealing at 55°C for 30 seconds and 72°C for 1 minute, and extension at 72°C for 5 minutes.
To support the observations obtained from study of the PCR amplifications and DNA-product sequencing, we performed Southern blotting of genomic DNA using DNA from the proband, his parents, a healthy sister, and an unrelated control subject (Clontech). The DNA was digested with EcoRI restriction enzyme and hybridized with a TNFRSF11B probe11 devised by PCR amplification of exon 2 with use of primers described above; normal human genomic DNA (Clontech) was used as a template, tagged with phosphorus-32 by random-primer labeling, and subjected to standard Southern blotting with ExpressHyb solution (Clontech). Before the probe was applied, the gels were stained with ethidium bromide to ensure that there were approximately equal amounts of DNA from each family member. The same procedures were then applied to DNA samples from Family 2.
To characterize the deletion of TNFRSF11B in both Navajo patients, we used a high-resolution integrated physical map of 8q22–q24 that was derived from sequence-tagged site-content mapping involving yeast artificial chromosomes and the complete genomic sequence of TNFRSF11B (GenBank accession number NT_023811) according to both published23 and newly designed PCR primers.
We used long-range PCR to amplify, and thereby define, the TNFRSF11B -deletion break points. We used the +7.6-kb forward primer and the –66.7-kb reverse primer (see below). The 39-μl reaction used the TaqPlus Long PCR System (Stratagene) and contained approximately 12 ng of DNA from each patient. The DNA was subjected to denaturation at 95°C for 1 minute, followed by 35 cycles at 95°C for 1 minute, annealing at 55°C for 30 seconds and 72°C for 14 minutes, and extension at 72°C for 10 minutes. The PCR products were isolated and sequenced.
Serum Levels of Osteoprotegerin and Osteoclast Differentiation Factor
Enzyme immunoassay kits (BioNet) were used to quantitate osteoprotegerin and free osteoclast differentiation factor in serum from Patient 1 and his parents. In two separate dedicated assay runs, performed as specified by the manufacturer (Biomedica Gruppe), we compared the osteoprotegerin and osteoclast differentiation factor values with those of six healthy children and six healthy adults chosen randomly as non-Navajo, age-matched controls.
Genetic Heterogeneity in Juvenile Paget's Disease
Finally, we examined TNFRSF11B using leukocyte DNA and assayed levels of osteoprotegerin and soluble osteoclast differentiation factor in serum from two young women, one from a nonconsanguineous American family (Patient 3)3 and one from an unrelated Albanian family (Patient 4). Both were referred to us for the treatment of relatively mild juvenile Paget's disease.
Results
Genetic Studies
No PCR products (amplicons) representing any of the five exons of TNFRSF11B were formed from DNA from Patients 1 and 2 (Figure 2AFigure 2
Genetic Studies of Juvenile Paget's Disease in Patient 1, Patient 2, and a Control Subject.). Conversely, TNFRSF11B amplicons were formed from the DNA from an unrelated healthy control subject and from both patients' parents (data not shown). Exon 2 of the gene for transforming growth factor β1, used as a control, amplified in all subjects (data not shown). The findings indicated that both patients had a homozygous deletion of TNFRSF11B, which spans approximately 30 kb.11 The observations were consistent with the mothers' and fathers' being heterozygotes, with one intact TNFRSF11B allele.Southern blots with a probe for exon 2 of TNFRSF11B showed no hybridization signal for the two patients (Figure 2B). However, hybridization occurred in samples from all other family members and non-Navajo controls. These observations evidenced homozygous deletion of TNFRSF11B in the patients.
To define the extent of the TNFRSF11B deletion, we initially analyzed 30 sequence-tagged site markers spanning approximately 1 megabase — 1 million bp — of genomic DNA encompassing TNFRSF11B.23 On PCR assay, all of these sequence-tagged sites were amplified. However, the markers closest to TNFRSF11B were approximately 100 kb upstream (D8S47) and 200 kb downstream (D8S48). Hence, additional sequence-tagged sites closer to TNFRSF11B were devised. Using these new markers, we mapped the deletion break points of both patients between 50 and 70 kb upstream and between exon 5 and 10 kb downstream of TNFRSF11B (Figure 3AFigure 3
The TNFRSF11B Deletion).Subsequently, to identify sequence-tagged site markers closer to the TNFRSF11B break points, we screened the DNA sequence surrounding each break point to exclude any repetitive elements with use of RepeatMasker.24 Avoiding all repetitive elements, we made 11 additional sequence-tagged sites (Figure 3A). They identified the deletion break points 56.7 to 66.7 kb upstream and 3.2 to 7.6 kb downstream of TNFRSF11B (Figure 3B). The following were the key primer pairs for mapping the deletion break points: +7.6 kb, CCTGTCCAATTTTCAGTTGG forward primer and CTCTTGCCTTTTGGTATGCC reverse primer; +3.2 kb, CCAAAGGAGCAGCCAGGGAGACCAATC forward primer and GAGGCTCTAACCTGGGTAAC reverse primer; –56.7 kb, GATGGCTTAACTATAAGCTGG forward primer and CCCTATCCGTCTATCCAATC reverse primer; and –66.7 kb, CTGCCTGTATTTCCTGCAAAC forward primer and CCAAGCTGTCTGATGGGAAC reverse primer. However, these regions contain substantial numbers of repetitive DNA elements that precluded further delineation of the break points with the use of analysis of sequence-tagged sites.
Finally, long-range PCR involving primers on either side of the deletion amplified a unique 4440-bp product in both patients. When these amplicons were sequenced and compared with control genomic DNA, identical chromosomal deletion break points were revealed in Patients 1 and 2. The novel recombinant sequence was 5'AGGCATGAGCCACCACGCCCTGAGATAAGTGTTATTAGCT3'.
Upstream (toward the 5' end), the sequence rift occurs at the junction of a long series of repetitive elements and a unique DNA sequence. Downstream (toward the 3' end), it occurs in a group of repetitive elements. In two control subjects, as expected, the long-range PCR could not amplify the interval of approximately 100 kb that is deleted in both patients. However, amplification of the sequence involving the DNA break points in the parents of each patient confirmed that they were all heterozygous carriers harboring the TNFRSF11B deletion on one chromosome (Figure 3B).
No other known gene neighboring TNFRSF11B was absent or had portions deleted. GenomeScan analysis of the deleted genomic DNA (GenBank accession number NT_023811) did indicate the existence of another potential gene in this region composed of four exons containing open-reading frames and appropriate dinucleotide splice signals bracketing the exons. However, analysis involving the Basic Local Alignment Search Tool (BLAST)25 failed to show any substantial similarities, suggesting that this hypothetical gene is not expressed.
Serum Levels of Osteoprotegerin and Osteoclast Differentiation Factor
As anticipated from the molecular studies, osteoprotegerin was undetectable in serum samples from Patient 1 (Figure 4Figure 4
Serum Levels of Osteoprotegerin and Soluble Osteoclast Differentiation Factor in Patient 1, His Parents, and Age-Matched Controls.). His heterozygous parents had osteoprotegerin levels that were approximately half the normal level (Figure 4). Conversely, his serum level of soluble osteoclast differentiation factor was markedly elevated, whereas the levels were essentially undetectable (below the concentration of the lowest standard used in the assay) in his parents and in the controls (Figure 4B).Genetic Heterogeneity of Juvenile Paget's Disease
No defect in TNFRSF11B was found in either Patient 3 or Patient 4 (Figure 5Figure 5
Patient 4, a 15-Year-Old Girl with Mild Juvenile Paget's Disease.), both of whom had a relatively mild form of juvenile Paget's disease (data not shown). Furthermore, their serum levels of osteoprotegerin and soluble osteoclast differentiation factor were unremarkable (data not shown).Discussion
Our finding of homozygous deletion of TNFRSF11B, the gene encoding osteoprotegerin, in two Native Americans with juvenile Paget's disease provides both a cause and a mechanism for this remarkable osteopathy. Osteoprotegerin, a soluble member of the superfamily of tumor necrosis factor receptors, is normally secreted into marrow spaces by cells derived from mesenchyme. Osteoprotegerin acts as a decoy for osteoclast differentiation factor,13-15 which is “both necessary and sufficient for osteoclast development.”26 The serum levels of osteoprotegerin and soluble osteoclast differentiation factor in Patient 1 were consistent with the DNA-based findings. Homozygous deletion of TNFRSF11B precludes the biosynthesis of osteoprotegerin, thereby negating its action as a decoy receptor and causing high circulating (and presumably marrow space) levels of biologically active osteoclast differentiation factor, which in turn markedly accelerates the rate of bone turnover.19,20
Our observations demonstrate that osteoprotegerin is a critical regulator of postnatal skeletal development and homeostasis in humans. Mice that lack osteoprotegerin owing to the knockout of Tnfrsf11b reportedly have “osteoporosis,”19,20 but they actually have numerous osteoclasts and rapidly remodeling woven bone rather than a paucity of lamellar bone. Accordingly, these animals manifest juvenile Paget's disease. Although heterozygous mice with osteoprotegerin deficiency can be osteopenic,20 the findings on skeletal radiographs of the proband's heterozygous (carrier) parents, whose serum osteoprotegerin levels were approximately 50 percent of control values, were unremarkable.
Our findings complement studies of the role of osteoprotegerin among humoral and cellular factors related to atherosclerosis.27,28 Studies of Tnfrsf11b-knockout mice implicate osteoprotegerin deficiency in atherogenesis, because of the presence of renal-artery and aortic calcification in histopathological studies.19 However, no mineralization was seen in the media of the aorta or renal arteries of Patient 2 on computed tomographic examination of her abdomen at the age of 23 years (with the use of bone windows sensitive for calcification) or on a postmortem radiographic skeletal survey at the age of 26 years (Figure 2D). The proband had microscopic hematuria, nephrocalcinosis, and several tiny echogenic foci in his kidneys representing small calculi; these calculi probably arose from his hypercalciuria as a result of impaired skeletal growth29 and, perhaps, the calciuric effects of calcitonin therapy. Hence, osteoprotegerin deficiency does not appear to cause macroscopic ectopic mineralization, at least in childhood or early adulthood. Nevertheless, the literature on juvenile Paget's disease includes the report of “calcifying arteriopathy,” detected by renal sonography and confirmed by histopathological analysis of the internal elastic membrane of a temporal artery, in a six-year-old boy.30 Striking changes consistent with the presence of pseudoxanthoma elasticum (MIM numbers 177850 and 264800), including granular and coarse deposits of calcium in the membranes and intima of the muscular arteries and arterioles, were found at autopsy in all tissues from a 26-year-old man who had severe hypertension and juvenile Paget's disease.10 In addition, a girl who seemed to have a dominantly inherited form of juvenile Paget's disease had transient calcium deposits near collagen and elastin fibers in the mid-dermis basophilic matrix.31 However, in order to advance this hypothesis, we must first understand the molecular basis of disease in such patients.
We detected no splice-site or exon mutations in TNFRSF11B in two unrelated women (Patients 3 and 4) with relatively mild juvenile Paget's disease. Furthermore, their skeletal disease did not seem to result from the diminished expression of TNFRSF11B, because they had unremarkable serum levels of osteoprotegerin and soluble osteoclast differentiation factor. Hence, genes other than TNFRSF11B seem to be defective in these patients, reflecting genetic heterogeneity for juvenile Paget's disease.
Juvenile Paget's disease belongs among the disorders characterized by excessive signaling along the pathway involving osteoclast differentiation factor, RANK, and nuclear factor-κB and leading to increased osteoclast action and an accelerated rate of osseous-tissue turnover (Figure 6Figure 6
Osteopathies Reflecting Enhanced Signaling along the Pathway Involving Osteoclast Differentiation Factor and Receptor Activator of Nuclear Factor-κB (RANK).).13,32 Nevertheless, autosomal recessive juvenile Paget's disease has clinical and radiographic findings that are distinct from those of autosomal dominant familial expansile osteolysis, early-onset Paget's disease of bone in Japan, and expansile skeletal hyperphosphatasia, showing that additional factors modify the effects of this pathway when it is activated.16-18 We found that homozygous deletion of TNFRSF11B can lead to juvenile Paget's disease. Chromosome 8q24.2 contains TNFRSF11B, but it has not been reported as one of the several susceptibility loci for the adult form of Paget's disease of bone.1,33 In fact, the coding sequence of TNFRSF11B is not mutated in “garden variety” Paget's disease of bone.34 Hence, molecular studies distinguish Paget's disease of bone from juvenile Paget's disease.
The homozygous deletion of TNFRSF11B causing juvenile Paget's disease in our two Navajo patients most likely reflects a founder effect emerging in this “bottleneck” population, which had decreased to approximately 6000 people in 186835 and subsequently expanded to approximately 225,000 by 1990.36 Three patients with juvenile Paget's disease from apparently separate families have been identified since the 1960s. Although the prevalence of the deletion among Navajos is not known, it can now be assessed. Detection of carriers and prenatal diagnosis of juvenile Paget's disease in this population are also possible. Our observations bolster the rationale for the use of antiresorptive treatment for juvenile Paget's disease. Furthermore, if osteoprotegerin is not rejected as a foreign protein because of the complete deletion of TNFRSF11B, replacement therapy might be especially effective for patients who have juvenile Paget's disease as a result of the TNFRSF11B deletion.
Supported by grants (8580 and 8540) from Shriners Hospitals for Children, by grants (HD33013 and AR45968, to Drs. Whyte and Mumm) from the National Institutes of Health, and by the Clark and Mildred Cox Inherited Metabolic Bone Disease Research Fund.
We are indebted to the patients and their families for their contributions to medical knowledge; to the nursing and laboratory staff of the Center for Metabolic Bone Disease and Molecular Research, Shriners Hospitals for Children, St. Louis, for making this study possible; to Dr. John C. Mohs, Northern Navajo Medical Center, Shiprock, N.M., for his assistance; and to Ms. Becky Whitener, C.P.S., for expert secretarial help.
Source Information
From the Center for Metabolic Bone Disease and Molecular Research, Shriners Hospitals for Children (M.P. W., M.N.P., S.M.); the Division of Bone and Mineral Diseases, Washington University School of Medicine at Barnes–Jewish Hospital (M.P. W., S.E.O., P.M.F., J.L.J., S.M.); and Mallinckrodt Institute of Radiology, Washington University School of Medicine at St. Louis Children's Hospital (W.H.M.) — all in St. Louis.
Address reprint requests to Dr. Whyte at Shriners Hospitals for Children, 2001 S. Lindbergh Blvd., St. Louis, MO 63131, or at mwhyte@shrinenet.org.
- References
References
1
McKusick VA. Mendelian inheritance in man: catalogs of human genes and genetic disorders. 12th ed. Baltimore: Johns Hopkins University Press, 1998.
2
Cole DEC, Whyte MP. Hyperphosphatasia syndromes. In: Cohen MM Jr, Baum BJ, eds. Studies in stomatology and craniofacial biology. Amsterdam: IOS Press, 1996:245-72.
3
Golob DS ,McAlister WH ,Mills BG , et al. Juvenile Paget disease: life-long features of a mildly affected young woman. J Bone Miner Res 1996;11:132-142
CrossRef | Web of Science | Medline4
Caffey J . Familial hyperphosphatasemia with ateliosis and hypermetabolism of growing membranous bone: review of the clinical, radiographic and chemical features. Bull Hosp Joint Dis 1972;33:81-110
Medline5
Kanis JA. Pathophysiology and treatment of Paget's disease of bone. 2nd ed. Malden, Mass.: Blackwell Science, 1998.
6
Singer FR, Roodman GD. Paget's disease of bone. In: Bilezikian JP, Raisz LG, Rodan GA, eds. Principles of bone biology. 2nd ed. San Diego, Calif.: Academic Press, 2001:1249-58.
7
Cassinelli HR ,Mautalen CA ,Heinrich JJ ,Miglietta A ,Bergada C . Familial idiopathic hyperphosphatasia (FIH): response to long-term treatment with pamidronate (APD). Bone Miner 1992;19:175-184
CrossRef | Medline8
Thompson RC Jr ,Gaull GE ,Horowitz SJ ,Schenk RK . Hereditary hyperphosphatasia: studies of three siblings. Am J Med 1969;47:209-219
CrossRef | Web of Science | Medline9
Singer F ,Siris E ,Shane E ,Dempster D ,Lindsay R ,Parisien M . Hereditary hyperphosphatasia: 20 year follow-up and response to disodium etidronate. J Bone Miner Res 1994;9:733-738
CrossRef | Web of Science | Medline10
Mitsudo SM . Chronic idiopathic hyperphosphatasia associated with pseudoxanthoma elasticum. J Bone Joint Surg Am 1971;53:303-314
Web of Science | Medline11
Morinaga T ,Nakagawa N ,Yasuda H ,Tsuda E ,Higashio K . Cloning and characterization of the gene encoding human osteoprotegerin/osteoclastogenesis-inhibitory factor. Eur J Biochem 1998;254:685-691
CrossRef | Medline12
Bekker PJ ,Holloway D ,Nakanishi A ,Arrighi M ,Leese PT ,Dunstan CR . The effect of a single dose of osteoprotegerin in postmenopausal women. J Bone Miner Res 2001;16:348-360
CrossRef | Web of Science | Medline13
Hofbauer LC ,Heufelder AE . Role of receptor activator of nuclear factor-kappaB ligand and osteoprotegerin in bone cell biology. J Mol Med 2001;79:243-253
CrossRef | Web of Science | Medline14
Lories RJ ,Luyten FP . Osteoprotegerin and osteoprotegerin-ligand balance: a new paradigm in bone metabolism providing new therapeutic targets. Clin Rheumatol 2001;20:3-9
CrossRef | Web of Science | Medline15
Lacey DL ,Timms E ,Tan HL , et al. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 1998;93:165-176
CrossRef | Web of Science | Medline16
Hughes AE ,Ralston SH ,Marken J , et al. Mutations in TNFRSF11A, affecting the signal peptide of RANK, cause familial expansile osteolysis. Nat Genet 2000;24:45-48
CrossRef | Web of Science | Medline17
Whyte MP ,Mills BG ,Reinus WR , et al. Expansile skeletal hyperphosphatasia: a new familial metabolic bone disease. J Bone Miner Res 2000;15:2330-2344
CrossRef | Web of Science | Medline18
Whyte MP ,Hughes AE . Expansile skeletal hyperphosphatasia is caused by a 15-base pair tandem duplication in TNFRSF11A encoding RANK and is allelic to familial expansile osteolysis. J Bone Miner Res 2002;17:26-29
CrossRef | Web of Science | Medline19
Bucay N ,Sarosi I ,Dunstan CR , et al. Osteoprotegerin-deficient mice develop early onset osteoporosis and arterial calcification. Genes Dev 1998;12:1260-1268
CrossRef | Web of Science | Medline20
Mizuno A ,Amizuka N ,Irie K , et al. Severe osteoporosis in mice lacking osteoclastogenesis inhibitory factor/osteoprotegerin. Biochem Biophys Res Commun 1998;247:610-615
CrossRef | Web of Science | Medline21
Navajo Nation. Navajo nation code. 5th ed. New York: Lamb Studio, 1995:111.
22
Dunn V ,Condon VR ,Rallison ML . Familial hyperphosphatasemia: diagnosis in early infancy and response to human thyrocalcitonin therapy. AJR Am J Roentgenol 1979;132:541-545
Web of Science | Medline23
Hilton MJ ,Gutierrez L ,Zhang L , et al. An integrated physical map of 8q22-q24: use in positional cloning and deletion analysis of Langer-Giedion syndrome. Genomics 2001;71:192-199
CrossRef | Web of Science | Medline24
RepeatMasker Web server. (Accessed May 29, 2002, at http://repeatmasker.genome.washington.edu/cgi-bin/RepeatMasker.)
25
BLAST. (Accessed May 29, 2002, at http://www.ncbi.nlm.nih.gov/BLAST/.)
26
Khosla S . Minireview: the OPG/RANKL/RANK system. Endocrinology 2001;142:5050-5055
CrossRef | Web of Science | Medline27
Wallin R ,Wajih N ,Greenwood GT ,Sane DC . Arterial calcification: a review of mechanism, animal models, and the prospects for therapy. Med Res Rev 2001;21:274-301
CrossRef | Web of Science | Medline28
Tintut Y ,Demer LL . Recent advances in multifactorial regulation of vascular calcification. Curr Opin Lipidol 2001;12:555-560
CrossRef | Web of Science | Medline29
Chines A ,Petersen DJ ,Schranck FW ,Whyte MP . Hypercalciuria in children severely affected with osteogenesis imperfecta. J Pediatr 1991;119:51-57
CrossRef | Web of Science | Medline30
Silve C ,Grosse B ,Tau C , et al. Response to parathyroid hormone and 1,25-dihydroxyvitamin D3 of bone-derived cells isolated from normal children and children with abnormalities in skeletal development. J Clin Endocrinol Metab 1986;62:583-590
CrossRef | Web of Science | Medline31
Fretzin DF . Pseudoxanthoma elasticum in hyperphosphatasia. Arch Dermatol 1975;111:271-272
CrossRef | Web of Science | Medline32
Hofbauer LC ,Neubauer A ,Heufelder AE . Receptor activator of nuclear factor-kappaB ligand and osteoprotegerin: potential implications for the pathogenesis and treatment of malignant bone diseases. Cancer 2001;92:460-470
CrossRef | Web of Science | Medline33
Good DA ,Busfield F ,Fletcher BH , et al. Linkage of Paget disease of bone to a novel region on human chromosome 18q23. Am J Hum Genet 2002;70:517-525
CrossRef | Web of Science | Medline34
Wuyts W ,Van Wesenbeeck L ,Morales-Piga A , et al. Evaluation of the role of RANK and OPG genes in Paget's disease of bone. Bone 2001;28:104-107
CrossRef | Web of Science | Medline35
Gilpin L. The enduring Navaho. Austin: University of Texas Press, 1968:255-6.
36
1990 Census of population and housing: characteristics of American Indians by tribe and language. Washington, D.C.: Bureau of the Census, 1994.
- Citing Articles (121)
Citing Articles
1
Christa Maes, Henry M. Kronenberg. 2012. Postnatal Bone Growth: Growth Plate Biology, Bone Formation, and Remodeling. , 55-82.
CrossRef2
Emma Persson, Ulf H. Lerner. (2011) The neuropeptide VIP regulates the expression of osteoclastogenic factors in osteoblasts. Journal of Cellular Biochemistry 112:12, 3732-3741
CrossRef3
E. Tsourdi, T. D. Rachner, M. Rauner, C. Hamann, L. C. Hofbauer. (2011) Denosumab for bone diseases: translating bone biology into targeted therapy. European Journal of Endocrinology 165:6, 833-840
CrossRef4
Stuart H. Ralston, Omar M. E. Albagha. (2011) Genetic determinants of Paget's disease of bone. Annals of the New York Academy of Sciences 1240:1, 53-60
CrossRef5
D. J. Mellis, C. Itzstein, M. H. Helfrich, J. C. Crockett. (2011) The skeleton: a multi-functional complex organ. The role of key signalling pathways in osteoclast differentiation and in bone resorption. Journal of Endocrinology 211:2, 131-143
CrossRef6
Tatsuo Suda, Fumiaki Takahashi, Naoyuki Takahashi. (2011) Bone Effects of Vitamin D - Discrepancies between in vivo and in vitro studies -. Archives of Biochemistry and Biophysics
CrossRef7
Jinhu Xiong, Melda Onal, Robert L Jilka, Robert S Weinstein, Stavros C Manolagas, Charles A O'Brien. (2011) Matrix-embedded cells control osteoclast formation. Nature Medicine 17:10, 1235-1241
CrossRef8
Pui Yan Jenny Chung, Wim Van Hul,. (2011) Paget's Disease of Bone: Evidence for Complex Pathogenetic Interactions. Seminars in Arthritis and Rheumatism
CrossRef9
Emmet E. McGrath. (2011) OPG/RANKL/RANK Pathway as a Therapeutic Target in Cancer. Journal of Thoracic Oncology 6:9, 1468-1473
CrossRef10
JIAN-QING JIANG, SHAN LIN, PENG-CHENG XU, ZHEN-FENG ZHENG, JUN-YA JIA. (2011) Serum osteoprotegerin measurement for early diagnosis of chronic kidney disease-mineral and bone disorder. Nephrology 16:6, 588-594
CrossRef11
Judit Donáth, Gyula Poór. (2011) A Paget-kór aktuális kérdései. Orvosi Hetilap 152:33, 1337-1346
CrossRef12
Michael P Whyte, William G Totty, Deborah V Novack, Xiafang Zhang, Deborah Wenkert, Steven Mumm. (2011) Camurati-engelmann disease: Unique variant featuring a novel mutation in TGFβ1 encoding transforming growth factor beta 1 and a missense change in TNFSF11 encoding RANK ligand. Journal of Bone and Mineral Research 26:5, 920-933
CrossRef13
Kazuo Okamoto, Hiroshi Takayanagi. (2011) Osteoclasts in arthritis and Th17 cell development. International Immunopharmacology 11:5, 543-548
CrossRef14
Jeong-Dan Cha, Hyung Jun Kim, In-Ho Cha. (2011) Genetic alterations in oral squamous cell carcinoma progression detected by combining array-based comparative genomic hybridization and multiplex ligation-dependent probe amplification. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology 111:5, 594-607
CrossRef15
Daniel Schramek, Verena Sigl, Josef M. Penninger. (2011) RANKL and RANK in sex hormone-induced breast cancer and breast cancer metastasis. Trends in Endocrinology & Metabolism 22:5, 188-194
CrossRef16
D. Schramek, J. M. Penninger. (2011) The Many Roles of RANKL-RANK Signaling in Bone, Breast and Cancer. IBMS BoneKEy 8:5, 237-256
CrossRef17
Kazuo Okamoto, Hiroshi Takayanagi. 2011. Osteoclasts and Interleukin-17-Producing Helper T Cells in Rheumatoid. , 75-89.
CrossRef18
J. C. Crockett, D. J. Mellis, D. I. Scott, M. H. Helfrich. (2011) New knowledge on critical osteoclast formation and activation pathways from study of rare genetic diseases of osteoclasts: focus on the RANK/RANKL axis. Osteoporosis International 22:1, 1-20
CrossRef19
Kazuo Okamoto, Hiroshi Takayanagi. (2011) Regulation of bone by the adaptive immune system in arthritis. Arthritis Research & Therapy 13:3, 219
CrossRef20
Beatriz Castaneda, Yohann Simon, Jaime Jacques, Estelle Hess, Yong-Wong Choi, Claudine Blin-Wakkach, Christopher Mueller, Ariane Berdal, Frédéric Lézot. (2011) Bone resorption control of tooth eruption and root morphogenesis: Involvement of the receptor activator of NF-κB (RANK). Journal of Cellular Physiology 226:1, 74-85
CrossRef21
Pui Yan Jenny Chung, Greet Beyens, Philip L Riches, Liesbeth Van Wesenbeeck, Fenna de Freitas, Karen Jennes, Anna Daroszewska, Erik Fransen, Steven Boonen, Piet Geusens, Filip Vanhoenacker, Leon Verbruggen, Jan Van Offel, Stefan Goemaere, Hans-Georg Zmierczak, René Westhovens, Marcel Karperien, Socrates Papapoulos, Stuart H Ralston, Jean-Pierre Devogelaer, Wim Van Hul. (2010) Genetic variation in the TNFRSF11A gene encoding RANK is associated with susceptibility to Paget's disease of bone. Journal of Bone and Mineral Research 25:12, 2592-2605
CrossRef22
Stergios A. Polyzos, Athanasios D. Anastasilakis, Ioannis Litsas, Zoe Efstathiadou, Marina Kita, Georgios Arsos, Efstratios Moralidis, Athanasios Papatheodorou, Evangelos Terpos. (2010) Profound hypocalcemia following effective response to zoledronic acid treatment in a patient with juvenile Paget’s disease. Journal of Bone and Mineral Metabolism 28:6, 706-712
CrossRef23
Wen-Feng Li, Shu-Xun Hou, Bin Yu, Dan Jin, Claude Férec, Jian-Min Chen. (2010) Genetics of osteoporosis: perspectives for personalized medicine. Personalized Medicine 7:6, 655-668
CrossRef24
Michael P Whyte, Deborah Wenkert, William H McAlister, Deborah V Novack, Angie R Nenninger, Xiafang Zhang, Margaret Huskey, Steven Mumm. (2010) Dysosteosclerosis presents as an “Osteoclast-Poor” form of osteopetrosis: Comprehensive investigation of a 3-year-old girl and literature review. Journal of Bone and Mineral Research 25:11, 2527-2539
CrossRef25
Michael P Whyte, Lydia G Kempa, William H McAlister, Fan Zhang, Steven Mumm, Deborah Wenkert. (2010) Elevated serum lactate dehydrogenase isoenzymes and aspartate transaminase distinguish Albers-Schönberg disease (Chloride Channel 7 Deficiency Osteopetrosis) among the sclerosing bone disorders. Journal of Bone and Mineral Research 25:11, 2515-2526
CrossRef26
Shigeki Aoki, Masashi Honma, Yoshiaki Kariya, Yuko Nakamichi, Tadashi Ninomiya, Naoyuki Takahashi, Nobuyuki Udagawa, Hiroshi Suzuki. (2010) Function of OPG as a traffic regulator for RANKL is crucial for controlled osteoclastogenesis. Journal of Bone and Mineral Research 25:9, 1907-1921
CrossRef27
Satsuki Shoji, Masako Tabuchi, Ken Miyazawa, Takahiro Yabumoto, Miyuki Tanaka, Manami Kadota, Hatsuhiko Maeda, Shigemi Goto. (2010) Bisphosphonate Inhibits Bone Turnover in OPG−/− Mice Via a Depressive Effect on Both Osteoclasts and Osteoblasts. Calcified Tissue International 87:2, 181-192
CrossRef28
Falchetti Alberto, Marini Francesca, Masi Laura, Amedei Antonietta, Brandi Maria Luisa. (2010) Genetic aspects of the Paget’s disease of bone: concerns on the introduction of DNA-based tests in the clinical practice. Advantages and disadvantages of its application. European Journal of Clinical Investigation 40:7, 655-667
CrossRef29
Francisco Bandeira, Viviane Assunção, Erik Trovão Diniz, Cynthia Salgado Lucena, Luiz Griz. (2010) Characteristics of Paget’s disease of bone in the city of Recife, Brazil. Rheumatology International 30:8, 1055-1061
CrossRef30
Charles A. O'Brien. (2010) Control of RANKL gene expression. Bone 46:4, 911-919
CrossRef31
(2010) From the Editor's Desk. Matrix Biology 29:2, 87-88
CrossRef32
P. Y. J. Chung, W. Van Hul. (2010) The Role of Genes in the Pathogenesis of Paget's Disease of Bone. IBMS BoneKEy 7:3, 124-133
CrossRef33
E. Michael Lewiecki, John P. Bilezikian, Andrew J. Laster, Paul D. Miller, Robert R. Recker, R. Graham G. Russell, Michael P. Whyte. (2010) 2009 Santa Fe Bone Symposium. Journal of Clinical Densitometry 13:1, 1-9
CrossRef34
Ling Ling, Sadasivam Murali, Gary S. Stein, Andre J. van Wijnen, Simon M. Cool. (2010) Glycosaminoglycans modulate RANKL-induced osteoclastogenesis. Journal of Cellular Biochemistryn/a-n/a
CrossRef35
Hideo Masuki, Minqi Li, Tomoka Hasegawa, Reiko Suzuki, Guo Ying, Liu Zhusheng, Kimimitsu Oda, Tsuneyuki Yamamoto, Masamitsu Kawanami, Norio Amizuka. (2010) Immunolocalization of DMP1 and sclerostin in the epiphyseal trabecule and diaphyseal cortical bone of osteoprotegerin deficient mice. Biomedical Research 31:5, 307-318
CrossRef36
Benjamin D. Solomon, Eileen Lange, Jay Shubrook, F. John Service, Gail Herman, Rajaram J. Karne, Phillip Gorden, Maximilian Muenke, Constantine A. Stratakis. (2010) Deletion of 8q24 in an adult with mild dysmorphic features, developmental delay, and ketotic hypoglycemia. American Journal of Medical Genetics Part An/a-n/a
CrossRef37
Adrienne M. Flanagan, Roberto Tirabosco, Panagiotis D. Gikas. 2010. Osteoclast-rich Lesions of Bone. , 211-224.
CrossRef38
Apostolos I Gogakos, Moira S Cheung, JH Duncan Bassett, Graham R Williams. (2009) Bone signaling pathways and treatment of osteoporosis. Expert Review of Endocrinology & Metabolism 4:6, 639-650
CrossRef39
Brya Matthews, Tim Cundy. (2009) Paget’s disease of bone. Expert Review of Endocrinology & Metabolism 4:6, 651-668
CrossRef40
Riches, Philip L., McRorie, Euan, Fraser, William D., Determann, Catherine, Hof, Rob van't, Ralston, Stuart H., . (2009) Osteoporosis Associated with Neutralizing Autoantibodies against Osteoprotegerin. New England Journal of Medicine 361:15, 1459-1465
Full Text41
Tomoki Nakashima, Hiroshi Takayanagi. (2009) Osteoclasts and the immune system. Journal of Bone and Mineral Metabolism 27:5, 519-529
CrossRef42
Tomoki Nakashima, Hiroshi Takayanagi. (2009) Osteoimmunology: Crosstalk Between the Immune and Bone Systems. Journal of Clinical Immunology 29:5, 555-567
CrossRef43
Sylvie Giroux, François Rousseau. (2009) Genes and osteoporosis: time for a change in strategy. International Journal of Clinical Rheumatology 4:2, 221-233
CrossRef44
H. L. Wright, H. S. McCarthy, J. Middleton, M. J. Marshall. (2009) RANK, RANKL and osteoprotegerin in bone biology and disease. Current Reviews in Musculoskeletal Medicine 2:1, 56-64
CrossRef45
Sho Kanzaki, Yasunari Takada, Kaoru Ogawa, Koichi Matsuo. (2009) Bisphosphonate Therapy Ameliorates Hearing Loss in Mice Lacking Osteoprotegerin. Journal of Bone and Mineral Research 24:1, 43-49
CrossRef46
Kevin. Carter, Joel. Nielsen. 2009. Reflex Sympathetic Dystrophy, Migratory Osteoporosis, and Osteogenesis Imperfecta. , 622-641.
CrossRef47
Penny Reid, Ingunn Holen. (2009) Pathophysiological roles of osteoprotegerin (OPG). European Journal of Cell Biology 88:1, 1-17
CrossRef48
Stuart H. Ralston. (2008) Pathogenesis of Paget's disease of bone. Bone 43:5, 819-825
CrossRef49
Stuart H Ralston, Anne L Langston, Ian R Reid. (2008) Pathogenesis and management of Paget's disease of bone. The Lancet 372:9633, 155-163
CrossRef50
Francis H. Glorieux. (2008) Osteogenesis imperfecta. Best Practice & Research Clinical Rheumatology 22:1, 85-100
CrossRef51
Stuart H. Ralston. (2008) Juvenile Paget's disease, familial expansile osteolysis and other genetic osteolytic disorders. Best Practice & Research Clinical Rheumatology 22:1, 101-111
CrossRef52
Masakazu Kimura, Ken Miyazawa, Masako Tabuchi, Hatsuhiko Maeda, Yoichiro Kameyama, Shigemi Goto. (2008) Bisphosphonate Treatment Increases the Size of the Mandibular Condyle and Normalizes Growth of the Mandibular Ramus in Osteoprotegerin-Deficient Mice. Calcified Tissue International 82:2, 137-147
CrossRef53
ALLEN W. ROOT. 2008. Disorders of Bone Mineral Metabolism: Normal Homeostasis. , 74-126.
CrossRef54
ALLEN W. ROOT, FRANK B. DIAMOND. 2008. Disorders of Mineral Homeostasis in the Newborn, Infant, Child, and Adolescent. , 686-769.
CrossRef55
C.A. Allen, B.L. Hart, C.L. Taylor, C.L. Clericuzio. (2008) Bilateral Cavernous Internal Carotid Aneurysms in a Child with Juvenile Paget Disease and Osteoprotegerin Deficiency. American Journal of Neuroradiology 29:1, 7-8
CrossRef56
Brendan F. Boyce, Lianping Xing. (2007) The RANKL/RANK/OPG pathway. Current Osteoporosis Reports 5:3, 98-104
CrossRef57
Greet Beyens, Anna Daroszewska, Fenna de Freitas, Erik Fransen, Filip Vanhoenacker, Leon Verbruggen, Hans-Georg Zmierczak, René Westhovens, Jan Van Offel, Stuart H Ralston, Jean-Pierre Devogelaer, Wim Van Hul. (2007) Identification of Sex-Specific Associations Between Polymorphisms of the Osteoprotegerin Gene, TNFRSF11B, and Paget's Disease of Bone. Journal of Bone and Mineral Research 22:7, 1062-1071
CrossRef58
E. F. McCarthy, G. H. Sack. (2007) Hyperphosphatasia with massive osteoectasia: a 45-year follow-up. Skeletal Radiology 36:S1, 2-6
CrossRef59
Michael P Whyte, Panagiotis N Singhellakis, Michael B Petersen, Michael Davies, William G Totty, Steven Mumm. (2007) Juvenile Paget's Disease: The Second Reported, Oldest Patient Is Homozygous for the TNFRSF11B “Balkan” Mutation (966_969delTGACinsCTT), Which Elevates Circulating Immunoreactive Osteoprotegerin Levels. Journal of Bone and Mineral Research 22:6, 938-946
CrossRef60
G. Martini, L. Gennari, D. Merlotti, S. Salvadori, M.B. Franci, S. Campagna, A. Avanzati, V. De Paola, F. Valleggi, R. Nuti. (2007) Serum OPG and RANKL levels before and after intravenous bisphosphonate treatment in Paget's disease of bone. Bone 40:2, 457-463
CrossRef61
Steven L. Teitelbaum. (2007) Osteoclasts: What Do They Do and How Do They Do It?. The American Journal of Pathology 170:2, 427-435
CrossRef62
M. H. Helfrich, J. C. Crockett, L. J. Hocking, F. P. Coxon. (2007) The Pathogenesis of Osteoclast Diseases: Some Knowns, but Still Many Unknowns. International Bone and Mineral Society Knowledge Environment 4:2, 61-77
CrossRef63
J.M. Blair, Y. Zheng, C.R. Dunstan. (2007) RANK ligand. The International Journal of Biochemistry & Cell Biology 39:6, 1077-1081
CrossRef64
Nicholas G. Angelopoulos, Anastasia Goula, Eugenia Katounda, Grigorios Rombopoulos, Victoria Kaltzidou, Dimitrios Kaltsas, Sophia Malaktari, Vassilis Athanasiou, George Tolis. (2006) Circulating osteoprotegerin and receptor activator of NF-κB ligand system in patients with β-thalassemia major. Journal of Bone and Mineral Metabolism 25:1, 60-67
CrossRef65
Piranit N. Kantaputra, Chanin Limwongse, Ajchara Koolvisoot, Apichart Ausawamongkolkul, Somsiri Tayavitit. (2006) A newly recognized polyosteolysis/hyperostosis syndrome. American Journal of Medical Genetics Part A 140A:23, 2640-2645
CrossRef66
Gavin JA Lucas, Anna Daroszewska, Stuart H Ralston. (2006) Contribution of Genetic Factors to the Pathogenesis of Paget's Disease of Bone and Related Disorders. Journal of Bone and Mineral Research 21:S2, P31-P37
CrossRef67
Serge Ferrari. (2006) Single gene mutations and variations affecting bone turnover and strength: a selective 2006 update. BoneKEy-Osteovision 3:12, 11-29
CrossRef68
Shinjiro Takata, Jun Hashimoto, Kiyoshi Nakatsuka, Noriko Yoshimura, Kousei Yoh, Ikko Ohno, Hiroo Yabe, Satoshi Abe, Masao Fukunaga, Masaki Terada, Masaaki Zamma, Stuart H. Ralston, Hirotoshi Morii, Hideki Yoshikawa. (2006) Guidelines for diagnosis and management of Paget's disease of bone in Japan. Journal of Bone and Mineral Metabolism 24:5, 359-367
CrossRef69
Whyte, Michael P., . (2006) Paget's Disease of Bone. New England Journal of Medicine 355:6, 593-600
Full Text70
Sho Kanzaki, Masako Ito, Yasunari Takada, Kaoru Ogawa, Koichi Matsuo. (2006) Resorption of auditory ossicles and hearing loss in mice lacking osteoprotegerin. Bone 39:2, 414-419
CrossRef71
Peter H. Byers, Deborah Krakow, Mark E. Nunes, Melanie Pepin. (2006) Genetic evaluation of suspected osteogenesis imperfecta (OI). Genetics in Medicine 8:6, 383-388
CrossRef72
Laëtitia Michou, Corinne Collet, Jean-Louis Laplanche, Philippe Orcel, François Cornélis. (2006) Genetics of Paget’s disease of bone. Joint Bone Spine 73:3, 243-248
CrossRef73
Anna Daroszewska, Stuart H Ralston. (2006) Mechanisms of Disease: genetics of Paget's disease of bone and related disorders. Nature Clinical Practice Rheumatology 2:5, 270-277
CrossRef74
SG Sun, YS Lau, I Itonaga, A Sabokbar, NA Athanasou. (2006) Bone stromal cells in pagetic bone and Paget's sarcoma express RANKL and support human osteoclast formation. The Journal of Pathology 209:1, 114-120
CrossRef75
Matthew C. Walsh, Nacksung Kim, Yuho Kadono, Jaerang Rho, Soo Young Lee, Joseph Lorenzo, Yongwon Choi. (2006) OSTEOIMMUNOLOGY: Interplay Between the Immune System and Bone Metabolism. Annual Review of Immunology 24:1, 33-63
CrossRef76
Catherine Middleton-Hardie, Qing Zhu, Harry Cundy, Jian-ming Lin, Karen Callon, Pak Cheung Tong, Jiake Xu, Andrew Grey, Jill Cornish, Dorit Naot. (2006) Deletion of Aspartate 182 in OPG Causes Juvenile Paget' Disease by Impairing Both Protein Secretion and Binding to RANKL. Journal of Bone and Mineral Research 21:3, 438-445
CrossRef77
Michael R. McClung. (2006) Inhibition of RANKL as a treatment for osteoporosis: Preclinical and early clinical studies. Current Osteoporosis Reports 4:1, 28-33
CrossRef78
Sarju G. Mehta, Giles D.J. Watts, Barbara McGillivray, Steven Mumm, Sara Jane Hamilton, Sheena Ramdeen, Deborah Novack, Christine Briggs, Michael P. Whyte, Virginia E. Kimonis. (2006) Manifestations in a family with autosomal dominant bone fragility and limb-girdle myopathy. American Journal of Medical Genetics Part A 140A:4, 322-330
CrossRef79
Nobuyuki Udagawa, Midori Nakamura, Nobuaki Sato, Naoyuki Takahashi. (2006) The Mechanism of Coupling between Bone Resorption and Formation. Journal of Oral Biosciences 48:3, 185-197
CrossRef80
Teiji Wada, Tomoki Nakashima, Nishina Hiroshi, Josef M Penninger. (2006) RANKL–RANK signaling in osteoclastogenesis and bone disease. Trends in Molecular Medicine 12:1, 17-25
CrossRef81
Julie M Blair, Hong Zhou, Markus J Seibel, Colin R Dunstan. (2006) Mechanisms of Disease: roles of OPG, RANKL and RANK in the pathophysiology of skeletal metastasis. Nature Clinical Practice Oncology 3:1, 41-49
CrossRef82
Pirow J Bekker, Donna L Holloway, Amy S Rasmussen, Robyn Murphy, Steven W Martin, Philip T Leese, Gregory B Holmes, Colin R Dunstan, Alex M DePaoli. (2005) A Single-Dose Placebo-Controlled Study of AMG 162, a Fully Human Monoclonal Antibody to RANKL, in Postmenopausal Women. Journal of Bone and Mineral Research 20:12, 2274-2282
CrossRef83
Jackie A. Clowes, B. Lawrence Riggs, Sundeep Khosla. (2005) The role of the immune system in the pathophysiology of osteoporosis. Immunological Reviews 208:1, 207-227
CrossRef84
Sakae Tanaka, Kozo Nakamura, Naoyuki Takahasi, Tatsuo Suda. (2005) Role of RANKL in physiological and pathological bone resorption and therapeutics targeting the RANKL-RANK signaling system. Immunological Reviews 208:1, 30-49
CrossRef85
M. Tabuchi, K. Miyazawa, M. Kimura, H. Maeda, T. Kawai, Y. Kameyama, S. Goto. (2005) Enhancement of Crude Bone Morphogenetic Protein-Induced New Bone Formation and Normalization of Endochondral Ossification by Bisphosphonate Treatment in Osteoprotegerin-Deficient Mice. Calcified Tissue International 77:4, 239-249
CrossRef86
Cundy, Tim, Davidson, James, Rutland, Michael D., Stewart, Carolyn, DePaoli, Alex M., . (2005) Recombinant Osteoprotegerin for Juvenile Paget's Disease. New England Journal of Medicine 353:9, 918-923
Full Text87
Barbara Arko, Janez Preželj, Andreja Kocijančič, Radovan Komel, Janja Marc. (2005) Association of the osteoprotegerin gene polymorphisms with bone mineral density in postmenopausal women. Maturitas 51:3, 270-279
CrossRef88
K. Janssens, M.-C. de Vernejoul, F. de Freitas, F. Vanhoenacker, W. Van Hul. (2005) An intermediate form of juvenile Paget's disease caused by a truncating TNFRSF11B mutation. Bone 36:3, 542-548
CrossRef89
Hiroshi Takayanagi. (2005) Mechanistic insight into osteoclast differentiation in osteoimmunology. Journal of Molecular Medicine 83:3, 170-179
CrossRef90
Jordan S. Orange, Ofer Levy, Raif S. Geha. (2005) Human disease resulting from gene mutations that interfere with appropriate nuclear factor-kappaB activation. Immunological Reviews 203:1, 21-37
CrossRef91
G. David Roodman, Jolene J. Windle. (2005) Paget disease of bone. Journal of Clinical Investigation 115:2, 200-208
CrossRef92
J. M. Liu, H. Y. Zhao, G. Ning, Y. J. Zhao, Y. Chen, Zh. Zhang, L. H. Sun, M.-Y. Xu, J. L. Chen. (2005) Relationships Between the Changes of Serum Levels of OPG and RANKL with Age, Menopause, Bone Biochemical Markers and Bone Mineral Density in Chinese Women Aged 20-75. Calcified Tissue International 76:1, 1-6
CrossRef93
Norio Amizuka, Minqi Li, Makiko Nasu, Takeyasu Maeda, Junko Shimomura. (2005) Histological evaluation for “bone quality” on two mouse models with different bone remodeling. Journal of Bone and Mineral Metabolism 23:S1, 43-47
CrossRef94
Nacksung Kim. (2005) Osteoporosis and Vascular Calcification: Lesson from OPG KO Mice. Journal of Korean Society of Endocrinology 20:6, 571
CrossRef95
Sandrine Theoleyre, Yohann Wittrant, Steeve Kwan Tat, Yannick Fortun, Francoise Redini, Dominique Heymann. (2004) The molecular triad OPG/RANK/RANKL: involvement in the orchestration of pathophysiological bone remodeling. Cytokine & Growth Factor Reviews 15:6, 457-475
CrossRef96
Sakamuri V. Reddy. (2004) Etiology of Paget's disease and osteoclast abnormalities. Journal of Cellular Biochemistry 93:4, 688-696
CrossRef97
R. Layfield, L. J. Hocking. (2004) SQSTM1 and Paget?s Disease of Bone. Calcified Tissue International 75:5, 347-357
CrossRef98
Anna Daroszewska, Lynne J Hocking, Fiona EA McGuigan, Bente Langdahl, Michael D Stone, Tim Cundy, Geoff C Nicholson, William D Fraser, Stuart H Ralston. (2004) Susceptibility to Paget's Disease of Bone Is Influenced by a Common Polymorphic Variant of Osteoprotegerin. Journal of Bone and Mineral Research 19:9, 1506-1511
CrossRef99
Pirow J Bekker, Donna L Holloway, Amy S Rasmussen, Robyn Murphy, Steven W Martin, Philip T Leese, Gregory B Holmes, Colin R Dunstan, Alex M DePaoli. (2004) A Single-Dose Placebo-Controlled Study of AMG 162, a Fully Human Monoclonal Antibody to RANKL, in Postmenopausal Women. Journal of Bone and Mineral Research 19:7, 1059-1066
CrossRef100
Cristina Tau, Carlos Mautalen, Cristina Casco, Verónica Alvarez, Marta Rubinstein. (2004) Chronic idiopathic hyperphosphatasia: normalization of bone turnover with cyclical intravenous pamidronate therapy. Bone 35:1, 210-216
CrossRef101
Nunziata Morabito, Agostino Gaudio, Antonino Lasco, Marco Atteritano, Maria Antonia Pizzoleo, Maria Cincotta, Mariangela La Rosa, Roberta Guarino, Anna Meo, Nicola Frisina. (2004) Osteoprotegerin and RANKL in the Pathogenesis of Thalassemia-Induced Osteoporosis: New Pieces of the Puzzle. Journal of Bone and Mineral Research 19:5, 722-727
CrossRef102
Tim Cundy, Lisa Wheadon, Alan King. (2004) Treatment of Idiopathic Hyperphosphatasia With Intensive Bisphosphonate Therapy. Journal of Bone and Mineral Research 19:5, 703-711
CrossRef103
Phil Salmon. (2004) Loss of Chaotic Trabecular Structure in OPG-Deficient Juvenile Paget's Disease Patients Indicates a Chaogenic Role for OPG in Nonlinear Pattern Formation of Trabecular Bone. Journal of Bone and Mineral Research 19:5, 695-702
CrossRef104
Frank Rauch, Francis H Glorieux. (2004) Osteogenesis imperfecta. The Lancet 363:9418, 1377-1385
CrossRef105
T. M. Doherty, L. A. Fitzpatrick, A. Shaheen, T. B. Rajavashisth, R. C. Detrano. (2004) Genetic Determinants of Arterial Calcification Associated With Atherosclerosis. Mayo Clinic Proceedings 79:2, 197-210
CrossRef106
MAJ Theodore J Choma, MAJ Timothy R Kuklo, MAJ Richard B Islinger, Mark D Murphey, H Thomas Temple. (2004) Paget???s Disease of Bone in Patients Younger Than 40 Years. Clinical Orthopaedics and Related Research 418, 202-204
CrossRef107
Tatsuo SUDA. (2004) Vitamin D and bone-How does vitamin D regulate bone formation and resorption?-. Proceedings of the Japan Academy, Series B 80:9, 407-421
CrossRef108
Belinda Chong, Madhuri Hegde, Matthew Fawkner, Scott Simonet, Hamilton Cassinelli, Mahmut Coker, John Kanis, Joerg Seidel, Cristina Tau, Beyhan Tüysüz, Bilgin Yüksel, Donald Love, Tim Cundy. (2003) Idiopathic Hyperphosphatasia and TNFRSF11B Mutations: Relationships Between Phenotype and Genotype. Journal of Bone and Mineral Research 18:12, 2095-2104
CrossRef109
Mickaël Rousière, Laëtitia Michou, François Cornélis, Philippe Orcel. (2003) Paget's disease of bone. Best Practice & Research Clinical Rheumatology 17:6, 1019-1041
CrossRef110
U KORNAK, S MUNDLOS. (2003) Genetic Disorders of the Skeleton: A Developmental Approach. The American Journal of Human Genetics 73:3, 447-474
CrossRef111
Miep H. Helfrich. (2003) Osteoclast diseases. Microscopy Research and Technique 61:6, 514-532
CrossRef112
Kiyoshi Nakatsuka, Yoshiki Nishizawa, Stuart H Ralston. (2003) Phenotypic Characterization of Early Onset Paget's Disease of Bone Caused by a 27-bp Duplication in the TNFRSF11A Gene. Journal of Bone and Mineral Research 18:8, 1381-1385
CrossRef113
Whyte, Michael P., Wenkert, Deborah, Clements, Karen L., McAlister, William H., Mumm, Steven, . (2003) Bisphosphonate-Induced Osteopetrosis. New England Journal of Medicine 349:5, 457-463
Full Text114
Manisha Harpavat, David J. Keljo. (2003) Perspectives on osteoporosis in pediatric inflammatory bowel disease. Current Gastroenterology Reports 5:3, 225-232
CrossRef115
William J. Boyle, W. Scott Simonet, David L. Lacey. (2003) Osteoclast differentiation and activation. Nature 423:6937, 337-342
CrossRef116
Norman H. Bell. (2003) RANK ligand and the regulation of skeletal remodeling. Journal of Clinical Investigation 111:8, 1120-1122
CrossRef117
L. Alvarez, P. Peris, N. Gua
abens, S. Vidal, I. Ros, F. Pons, X. Filella, A. Monegal, J. Mu
CrossRef118
C. Von Tirpitz, J. Klaus, M. Steinkamp, L. C. Hofbauer, W. Kratzer, R. Mason, B. O. Boehm, G. Adler, M. Reinshagen. (2003) Therapy of osteoporosis in patients with Crohn's disease: a randomized study comparing sodium fluoride and ibandronate. Alimentary Pharmacology and Therapeutics 17:6, 807-816
CrossRef119
(2002) Osteoprotegerin Deficiency and Juvenile Paget's Disease. New England Journal of Medicine 347:20, 1622-1623
Full Text120
Krane, Stephen M., . (2002) Genetic Control of Bone Remodeling — Insights from a Rare Disease. New England Journal of Medicine 347:3, 210-212
Full Text121
D. M. Black. (2001) Meeting Report from the 24th Annual Meeting of the American Society for Bone and Mineral Research. International Bone and Mineral Society Knowledge Environment 1:1, 2002065-0
CrossRef
- Letters
