Original Article
Detection of APC Mutations in Fecal DNA from Patients with Colorectal Tumors
N Engl J Med 2002; 346:311-320January 31, 2002
- Abstract
Background
Noninvasive methods for detecting colorectal tumors have the potential to reduce morbidity and mortality from this disease. The mutations in the adenomatous polyposis coli (APC) gene that initiate colorectal tumors theoretically provide an optimal marker for detecting colorectal tumors. The purpose of our study was to determine the feasibility of detecting APC mutations in fecal DNA with the use of newly developed methods.
Methods
We purified DNA from routinely collected stool samples and screened for APC mutations with the use of a novel approach called digital protein truncation. Many different mutations could potentially be identified in a sensitive and specific manner with this technique.
Results
Stool samples from 28 patients with nonmetastatic colorectal cancers, 18 patients with adenomas that were at least 1 cm in diameter, and 28 control patients without neoplastic disease were studied. APC mutations were identified in 26 of the 46 patients with neoplasia (57 percent; 95 percent confidence interval, 41 to 71 percent) and in none of the 28 control patients (0 percent; 95 percent confidence interval, 0 to 12 percent; P<0.001). In the patients with positive tests, mutant APC genes made up 0.4 to 14.1 percent of all APC genes in the stool.
Conclusions APC
mutations can be detected in fecal DNA from patients with relatively early colorectal tumors. This feasibility study suggests a new approach for the early detection of colorectal neoplasms.
Media in This Article
Figure 3
Mutations Producing Truncated Polypeptides in the Digital-Protein-Truncation Test.Figure 2
Examples of the Results of the Digital-Protein-Truncation Test in Six Patients with Truncating Mutations in APC.Article Activity
- Article
Several strategies for the early detection of colorectal tumors have been devised. Colonoscopy, sigmoidoscopy, and barium enemas are highly specific and sensitive tests for neoplasia,1-4 but they are invasive and limited by the availability of experts in the procedures and patient compliance.5,6 Testing for occult blood in the stool has been shown in some studies to reduce the incidence of and morbidity and mortality from colorectal cancer.7-11 These fecal occult-blood tests are noninvasive and extremely useful but not sufficiently sensitive or specific for neoplasia.12-15 Furthermore, some fecal occult-blood tests require patients to change their diet before testing or require multiple tests, potentially reducing compliance.5,16,17 There is thus a need to develop new screening tests that overcome these obstacles.
One of the most promising classes of new diagnostic markers consists of mutations in oncogenes and tumor-suppressor genes.18 Because these mutations are directly responsible for neoplastic growth, they have clear advantages over indirect markers such as fecal occult blood. Several groups have reported that mutations in cancer-related genes can be detected in the stool of patients with colorectal cancer.19-33 However, the sensitivities and specificities of these approaches have been limited by technical impediments or the low frequencies of detectable mutations in any specific gene.
The intent of our study was to develop a test based on a single gene that would facilitate the detection of colorectal tumors at an early stage of disease. The optimal gene for such studies is the adenomatous polyposis coli (APC) gene,34,35 since mutations in this gene generally initiate colorectal neoplasia.36 Other mutations are present only in the later stages of colorectal neoplasia, such as those in p53, 37 or may be present in non-neoplastic, hyperproliferative cells, such as those in c-Ki-ras.38-40 However, the detection of mutations in APC presents extraordinarily difficult technical challenges. Unlike mutations in c-Ki-ras, which have been used for most previous studies because mutations are clustered at two codons, mutations in APC can occur virtually anywhere within the first 1600 codons of the gene.41 Moreover, the type of mutation (base substitutions or insertions or deletions of diverse length) varies widely among tumors. Although such APC mutations can be detected relatively easily in tumors, where they are present in every neoplastic cell, they are much harder to detect in fecal DNA, where they may be present in less than 1 in 100 APC genes in the sample. We describe an approach that allowed us to detect such mutations in fecal DNA from patients with adenomas and cancer in a precise, specific, and quantitative fashion.
Methods
Patients
A total of 74 stool samples were analyzed to determine their APC status. They were obtained from 28 patients with Dukes' stage B2 colon cancer, 28 control patients with no known colorectal tumor, and 18 patients with adenomas that were at least 1 cm in diameter. Of these 74 samples, 68 were derived from a group of 315 patients who were sequentially evaluated at the M.D. Anderson Cancer Center in Houston or surrounding hospitals between 1997 and 2000 for suspected colorectal neoplasia. Of these 315 patients, 77 had cancer: 30 had Dukes' stage B2 (T3N0M0) disease, 5 had in situ lesions, 6 had Dukes' stage A, 5 had Dukes' stage B1, 20 had Dukes' stage C, 9 had Dukes' stage D, and 2 had cancers of unknown or other classes. We chose to analyze the patients with Dukes' stage B2 cancer because this was the most common type; moreover, the effect of screening in such cases should be considerable, because they are likely to be surgically curable. We excluded 2 of the 30 patients with Dukes' stage B2 because other colonic lesions were found at colonoscopy or surgery that could have complicated the analysis. For comparison with the patients with cancer, we selected 28 control patients from among the 55 patients who proved to be tumor-free on colonoscopy. These controls were matched to the patients with cancer with regard to the reasons for initial colonoscopy and then matched as well as possible for sex and age.
In this group of 315 subjects, 12 had single adenomas that were at least 1 cm in diameter, which have a high risk of progression to cancer.42,43 We also examined stool samples from six patients from the Lahey Clinic (Burlington, Mass.) who had adenomas that were at least 1 cm in diameter. These 6 constituted all those found to have such tumors among 172 patients examined by colonoscopy between September 2000 and June 2001.
Stool samples were collected before colonoscopy from 19 of the 46 patients with neoplasia and before surgery in the remainder. All stool samples from the control patients were collected before colonoscopy. All stool samples were stored at –20°C immediately after collection and transferred to storage at –80°C within 48 hours after collection. None of the patients had familial adenomatous polyposis or hereditary nonpolyposis colon cancer. The work was carried out in accordance with the institutional review board at each participating institution. Oral or written informed consent, as mandated by the institutional review board, was obtained from all patients.
Purification of DNA
DNA was purified with the use of modifications of procedures described by Ahlquist et al.30 All stool samples were thawed at room temperature and homogenized with an Exactor stool shaker (Exact Laboratories, Maynard, Mass.). After homogenization, a 4-g stool equivalent of each sample was subjected to two centrifugations (5 minutes at 2536×g and 10 minutes at 16,500×g) to remove large and small particulate matter, respectively. Supernatants were incubated with 20 μl of RNase (0.5 mg per milliliter) for 1 hour at 37°C, followed by precipitation with 1/10 volume of 3 mol of sodium acetate per liter and an equal volume of isopropanol. The crude DNA was dissolved in 10 ml of TRIS–EDTA (0.01 mol of TRIS per liter [pH 7.4] and 0.001 mol of EDTA per liter). Hybrid capture of APC genes was performed by adding 300 μl of sample to an equal volume of 6 M guanidine isothiocyanate solution (Invitrogen, Carlsbad, Calif.) containing 20 pmol of two biotinylated sequence-specific oligonucleotides (5'CAGATAGCCCTGGACAAACCATGCCACCAAGCAGAAG-3' and 5'TTCCAGCAGTGTCACAGCACCCTAGAACCAAATCCAG3'; Midland Certified Reagent Company, Midland, Tex.). After a 12-hour incubation at 25°C, streptavidin-coated magnetic beads were added to the solution, and the tubes were incubated for an additional hour at room temperature. The bead–hybrid-capture complexes were then washed four times with 1× buffer and wash solution (1 mol of sodium chloride per liter, 0.01 mol of TRIS–hydrochloric acid per liter [pH 7.2], 0.001 mol of EDTA per liter, and 0.1 percent Tween 20), and the sequence-specific captured DNA was eluted into 40 μl of low TRIS–EDTA (1 mmol of TRIS per liter [pH 7.4] and 0.1 mol of EDTA per liter), prewarmed to 85°C, for four minutes. The concentration of amplifiable APC templates in captured DNA was determined with the use of limiting dilution, with the use of primers F1 and R1, as defined below, for the polymerase chain reaction (PCR).
Digital Protein Truncation
PCR
Each reaction mixture contained 1× PCR buffer (Invitrogen), 0.9 μM of oligonucleotides F1 and R1, and 0.015 U of high-fidelity platinum Taq DNA polymerase (Invitrogen) per microliter. A single PCR mix was prepared for each stool sample, and the mix was distributed to 144 wells (12 rows of 12 wells in two standard 96-well PCR plates); each well contained two to four APC templates distributed in a Poisson distribution. After an initial cycle of denaturation at 94°C for 2 minutes, amplifications were performed as follows: three cycles of denaturation at 94°C for 30 seconds, annealing at 67°C for 30 seconds, and extension at 70°C for 1 minute; three cycles of denaturation at 94°C for 30 seconds, annealing at 64°C for 30 seconds, and extension at 70°C for 1 minute; three cycles of denaturation at 94°C for 30 seconds, annealing at 61°C for 30 seconds, and extension at 70°C for 1 minute; and 50 cycles of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 70°C for 1 minute. One microliter of the reaction mixture was added to a 10-μl PCR reaction mixture of the same makeup as the one described above, except that primers F2 and R2 were used. After a 2-minute cycle of denaturation at 94°C, the reaction mixture was amplified for 15 cycles of 94°C for 30 seconds, 58°C for 30 seconds, and 70°C for 1 minute. The primer sequences were 5'GGTAATTTTGAAGCAGTCTGGGC3' in the case of F1, 5'ACGTCATGTGGATCAGCCTATTG3' in the case of R1, 5'GGATCCTAATACGACTCACTATAGGGAGACCACCATGA-TGATGATGATGATGATGATGATGATGATGTCTGGACAAAGCAGTAAAACCG3' in the case of F2, and 5'TTTTTTTTAACGTGATGACTTTGTTGGCATGGC3' in the case of R2.
In Vitro Transcription and Translation
In vitro transcription and translation of each of the PCR products were performed in 5-μl volumes in 96-well polypropylene PCR plates. The reaction mixture consisted of 4 μl of TnT T7 Quick for PCR DNA (Promega, Madison, Wis.), 0.25 μl of 35S-Promix (Amersham Pharmacia Biotech, Piscataway, N.J.), 0.25 μl of deionized water, and 0.5 μl of PCR products obtained with the use of the F2 and R2 primers. The wells were covered with mineral oil and incubated at 30°C for 90 minutes, and then the contents were diluted with Laemmli sample buffer and denatured at 95°C for 2 minutes. Proteins were separated on 10 to 20 percent TRIS–glycine gradient polyacrylamide gels (Invitrogen), then fixed in ethanol and dried before autoradiography.
Sequencing Studies
PCR products from wells yielding truncated peptides in the digital-protein-truncation assay were isolated and cloned with the use of the TOPO Cloning kit (Invitrogen). Sequencing reactions from cloned DNA were analyzed on a SCE-9610 96-well capillary electrophoresis system (SpectruMedix, State College, Pa.). In 19 cases, DNA was prepared from archived tumors, and APC fragments of approximately 200 bp were amplified and subjected to manual sequence analysis with ThermoSequinase (Amersham Pharmacia Biotech).
Statistical Analysis
All statistical analyses employed Fisher's exact test to compare proportions. All reported P values are two-sided.
Results
Development of the Digital-Protein-Truncation Assay
In order to detect APC mutations in fecal DNA we had to surmount two major technical obstacles. The first involved purification of DNA templates that were large enough to allow us to perform PCR on a substantial region of the APC gene. About 83 percent of the APC mutations in sporadic tumors occur between codons 1210 and 1581, an expanse of 1113 nucleotides.41 For our analysis, it was important to amplify this region within a single PCR product rather than in multiple overlapping PCR products. The DNA molecules to be assessed must therefore be considerably larger than 1100 nucleotides. However, stool contains numerous inhibitors of DNA polymerase, and long PCR products, such as those of 1100 bp, are particularly sensitive to such inhibitors. The method we developed captured APC genes on magnetic beads that were coated with oligonucleotides corresponding to the region between codons 1210 and 1581. This allowed amplification of DNA fragments of the required size and concentration from all 74 stool samples analyzed. Patients with colorectal cancer had a median of 4.3 copies of the APC gene per milligram of stool (Table 1Table 1
Characteristics of 46 Patients with Neoplasia.), and patients without colorectal neoplasia had a median of 2.3 copies of the APC gene per milligram of stool (Table 2Table 2
Characteristics of 28 Control Patients.).The second technical hurdle was identifying mutations within these PCR products. Virtually all APC mutations result in stop codons caused by nonsense substitutions or small, out-of-frame deletions or insertions.41 APC mutations can therefore be identified through in vitro transcription and translation of suitably engineered PCR products.44,45 This “in vitro synthesized protein,” or “protein-truncation,” test is the standard method for genetic diagnosis of familial adenomatous polyposis. However, it could not be used to evaluate fecal DNA samples, because of the preponderance of wild-type sequences in such samples. In particular, the sensitivity of the conventional method is limited to mutations that occur in more than 15 percent of template molecules, whereas mutant APC genes were expected to be present at much lower frequency in fecal DNA (Figure 1Figure 1
The Digital-Protein-Truncation Test.). We therefore developed a modification of the protein-truncation test, called digital protein truncation, which has considerably increased sensitivity (Figure 1). In brief, a small number of template molecules were included in each reaction, and the protein products of each reaction were separated by polyacrylamide-gel electrophoresis. To increase the specificity of the digital-protein-truncation test and to control for polymerase-generated errors, we considered the test result to be positive for a mutation only when a truncated protein product of the same size was identified at least twice among the 144 reactions carried out on each sample.Analysis of Data from Patients with Cancer and Control Patients
Mutations were identified in 26 of the 46 stool samples from patients with neoplasia (57 percent; 95 percent confidence interval, 41 to 71 percent) with use of the digital-protein-truncation assay. Representative positive results are shown in Figure 2Figure 2
Examples of the Results of the Digital-Protein-Truncation Test in Six Patients with Truncating Mutations in APC.. The average number of abnormal reactions in patients with positive results was 7.5 and ranged from 2 to 39 (of 144 total reactions carried out in each patient). No mutations were identified by the digital-protein-truncation assay in stools from the 28 control patients who did not have neoplastic disease (0 percent; 95 percent confidence interval, 0 to 12 percent; P<0.001). Positive results were obtained in 17 of the 28 patients with Dukes' stage B2 cancer (61 percent; 95 percent confidence interval, 41 to 79 percent) and 9 of the 18 patients who had adenomas that were at least 1 cm in diameter (50 percent; 95 percent confidence interval, 26 to 74 percent). In addition, 20 of 36 patients with neoplasms distal to the splenic flexure (56 percent; 95 percent confidence interval, 38 to 72 percent) had positive results, as did 6 of 10 patients with more proximal lesions (60 percent; 95 percent confidence interval, 26 to 88 percent). In the positive stool samples, 0.4 to 14.1 percent of all APC genes had mutations (Table 1).Confirmation of Mutations
To confirm that the abnormal polypeptides detected by the digital-protein-truncation assay represented APC mutations, we determined the sequence of corresponding PCR products. In each of the 26 patients with positive tests, we found a mutation that was predicted to result in a truncated polypeptide of exactly the size found in the digital-protein-truncation assay (Figure 3Figure 3
Mutations Producing Truncated Polypeptides in the Digital-Protein-Truncation Test.). The spectrum of mutations was broad (Figure 4Figure 4
Spectrum of APC Mutations Identified between Codons 1210 and 1581 in Fecal DNA. and Table 1) and closely resembled those in sporadic colorectal neoplasms.41 We next sought to confirm that mutations identified in the stool were also present in the patients' tumors. Although in the majority of patients, tumor material suitable for mutational analyses was not available, we were able to evaluate APC mutations in the tumors of seven patients who had positive results on the digital-protein-truncation assay. The mutations in these tumors were identical to those found in the stool (Figure 3). We also assessed the nature of APC mutations in tumors from 12 patients with negative results on the digital-protein-truncation assay. Tumors from 6 of these 12 patients had truncating mutations (at codons 1284, 1291, 1309, 1376, 1464, and 1488). Thus, 36 of the 46 patients with neoplasia (78 percent; 95 percent confidence interval, 65 to 89 percent) in our study were estimated to have mutations that could have been detected by the digital-protein-truncation assay (26 of the patients with positive test results plus 10 of the 20 patients with negative test results). This estimate of 78 percent is quite close to the value of 75 percent expected on the basis of previous studies.35,41
Discussion
Our results show that PCR-amplifiable DNA fragments of more than 1100 bp could be purified from the stools of all patients studied, regardless of the presence or absence of a colorectal tumor or colonic adenoma. The fraction of mutant APC molecules in the samples from patients with neoplasia ranged from 0.4 to 14.1 percent. Knowledge gained from our study should be helpful in the design of future studies. For example, any technique to assess mutant DNA molecules in fecal DNA must have the capacity to distinguish 1 mutant molecule from more than 250 wild-type molecules if a sensitivity comparable to the one achieved in this study is to be achieved. By increasing the number of copies of APC examined, further increases in sensitivity should be achievable. Furthermore, our study focused on relatively early-stage lesions. Because of the high potential for cure by surgical or endoscopic removal of these lesions, their detection by noninvasive methods such as the digital-protein-truncation assay has the capacity to reduce morbidity and mortality in the future.
An important component of our study was the high specificity of the test: no APC alterations were identified in any of the 28 control samples from patients without neoplasia. Among the published studies of fecal-DNA mutations,19-33 few used more than three stool samples from normal subjects as controls. In one such study, c-Ki-ras mutations were identified in 7 percent of the controls.30 Nondysplastic aberrant crypt foci and small hyperplastic polyps, which occur relatively frequently in normal people but are not thought to be precursors of cancer, often contain c-Ki-ras mutations but not APC mutations,38-40 a finding further emphasizing the value of APC for stool-based testing.
In summary, it is possible to detect APC mutations in fecal DNA in patients with potentially curable colorectal tumors. It is important to emphasize, however, that our study does not demonstrate that the digital-protein-truncation test is a clinically useful screening test. It was of interest that five of the control patients in our study underwent colonoscopy because of a positive fecal occult-blood test, whereas in another six, the reason for undergoing colonoscopy was rectal bleeding, which precludes fecal occult-blood testing. Although this result points to the potential value of a more specific genetically based test for screening feces, further studies will be required to determine whether the digital-protein-truncation test is as sensitive and specific as the fecal occult-blood test in persons at average risk. Because the digital-protein-truncation test is based on the identification of abnormal proteins synthesized from mutant genes, the powerful new tools being developed for proteomics should be directly applicable to this approach in the future, further increasing its power.
Supported by the National Colorectal Cancer Research Alliance, by the Caroline Law Fund, by the University of Texas M.D. Anderson Cancer Center, by the Clayton Fund, and by grants (CA 62924, CA 43460, CA 57345, and GM 07184) from the National Institutes of Health.
Drs. Kinzler and Vogelstein are entitled to royalties on sales of products related to the use of stool DNA for the diagnosis of cancer. Dr. Kinzler owns stock in and serves as a consultant to Genzyme and Exact Sciences. Dr. Vogelstein owns stock in and has served as a consultant to Genzyme and Exact Sciences. Dr. Schoetz owns stock in Exact Sciences, and the recruitment of patients and collection of samples at the Lahey Clinic were funded in part by Exact Sciences.
We are indebted to Dr. Steven N. Goodman for statistical evaluation; to Ms. Pam Shaw, Ms. Ji-Lei Jiang, Ms. Janice Gorham, Mr. Carlo Rago, and Mr. Dipayan Chaudhuri for expert technical assistance; to Drs. F. Lyone Hochman, Michael F. Appel, and Atilla Ertan for assistance with sample accrual; and to Dr. Ie-Ming Shih for pathological consultation.
Source Information
From the Graduate Program in Human Genetics (G.T.), Howard Hughes Medical Institute (B.V.), and the Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins (G.T., K.W.K., B.V.), Johns Hopkins School of Medicine, Baltimore; Exact Sciences, Maynard, Mass. (A.S., K.B.); the Division of Cancer Prevention (B.L.), the Department of Epidemiology (C.J.), and the Division of Pathology and Laboratory Medicine (S.R.H.), University of Texas M.D. Anderson Cancer Center, Houston; the Department of Surgery, Central Hospital, Västerås, Center for Clinical Research, Uppsala University, Uppsala, Sweden (L.O.); and the Department of Colon-Rectal Surgery, Lahey Clinic, Burlington, Mass. (D.J.S.).
Address reprint requests to Dr. Vogelstein at the Sidney Kimmel Comprehensive Cancer Center, 1650 Orleans St., Baltimore, MD 21231, or at vogelbe@welch.jhu.edu.
- References
References
1
Newcomb PA ,Norfleet RG ,Storer BE ,Surawicz TS ,Marcus PM . Screening sigmoidoscopy and colorectal cancer mortality. J Natl Cancer Inst 1992;84:1572-1575
CrossRef | Web of Science | Medline2
Selby JV ,Friedman GD ,Quesenberry CP Jr ,Weiss NS . A case-control study of screening sigmoidoscopy and mortality from colorectal cancer. N Engl J Med 1992;326:653-657
Full Text | Web of Science | Medline3
Lieberman DA ,Weiss DG ,Bond JH ,Ahnen DJ ,Garewal H ,Chejfec G . Use of colonoscopy to screen asymptomatic adults for colorectal cancer. N Engl J Med 2000;343:162-168[Erratum, N Engl J Med 2000;343:1204.]
Full Text | Web of Science | Medline4
Imperiale TF ,Wagner DR ,Lin CY ,Larkin GN ,Rogge JD ,Ransohoff DF . Risk of advanced proximal neoplasms in asymptomatic adults according to the distal colorectal findings. N Engl J Med 2000;343:169-174
Full Text | Web of Science | Medline5
Trends in screening for colorectal cancer -- United States, 1997 and 1999. JAMA 2001;285:1570-1571
CrossRef | Web of Science6
Scotiniotis I ,Lewis JD ,Strom BL . Screening for colorectal cancer and other GI cancers. Curr Opin Oncol 1999;11:305-311
CrossRef | Medline7
Mandel JS ,Bond JH ,Church TR , et al. Reducing mortality from colorectal cancer by screening for fecal occult blood. N Engl J Med 1993;328:1365-1371[Erratum, N Engl J Med 1993;329:672.]
Full Text | Web of Science | Medline8
Kronborg O ,Fenger C ,Olsen J ,Jorgensen OD ,Sondergaard O . Randomised study of screening for colorectal cancer with faecal-occult-blood test. Lancet 1996;348:1467-1471
CrossRef | Web of Science | Medline9
Hardcastle JD ,Chamberlain JO ,Robinson MH , et al. Randomised controlled trial of faecal-occult-blood screening for colorectal cancer. Lancet 1996;348:1472-1477
CrossRef | Web of Science | Medline10
Towler B ,Irwig L ,Glasziou P ,Kewenter J ,Weller D ,Silagy C . A systematic review of the effects of screening for colorectal cancer using the faecal occult blood test, Hemoccult. BMJ 1998;317:559-565
CrossRef | Web of Science | Medline11
Mandel JS ,Church TR ,Bond JH , et al. The effect of fecal occult-blood screening on the incidence of colorectal cancer. N Engl J Med 2000;343:1603-1607
Full Text | Web of Science | Medline12
Allison JE ,Feldman R ,Tekawa IS . Hemoccult screening in detecting colorectal neoplasm: sensitivity, specificity, and predictive value: long-term follow-up in a large group practice setting. Ann Intern Med 1990;112:328-333
Web of Science | Medline13
Verne JE ,Aubrey R ,Love SB ,Talbot IC ,Northover JM . Population based randomized study of uptake and yield of screening by flexible sigmoidoscopy compared with screening by faecal occult blood testing. BMJ 1998;317:182-185
CrossRef | Web of Science | Medline14
Mandel JS ,Church TR ,Ederer F ,Bond JH . Colorectal cancer mortality: effectiveness of biennial screening for fecal occult blood. J Natl Cancer Inst 1999;91:434-437
CrossRef | Web of Science | Medline15
Rozen P ,Knaani J ,Samuel Z . Comparative screening with a sensitive guaiac and specific immunochemical occult blood test in an endoscopic study. Cancer 2000;89:46-52
CrossRef | Web of Science | Medline16
Ore L ,Hagoel L ,Lavi I ,Rennert G . Screening with faecal occult blood test (FOBT) for colorectal cancer: assessment of two methods that attempt to improve compliance. Eur J Cancer Prev 2001;10:251-256
CrossRef | Web of Science | Medline17
Shields HM ,Weiner MS ,Henry DR , et al. Factors that influence the decision to do an adequate evaluation of a patient with a positive stool for occult blood. Am J Gastroenterol 2001;96:196-203
CrossRef | Web of Science | Medline18
Vogelstein B, Kinzler KW, eds. The genetic basis of human cancer. New York: McGraw-Hill, 1998.
19
Sidransky D ,Tokino T ,Hamilton SR , et al. Identification of ras oncogene mutations in the stool of patients with curable colorectal tumors. Science 1992;256:102-105
CrossRef | Web of Science | Medline20
Smith-Ravin J ,England J ,Talbot IC ,Bodmer W . Detection of c-Ki-ras mutations in faecal samples from sporadic colorectal cancer patients. Gut 1995;36:81-86
CrossRef | Web of Science | Medline21
Hasegawa Y ,Takeda S ,Ichii S , et al. Detection of K-ras mutations in DNAs isolated from feces of patients with colorectal tumors by mutant-allele-specific amplification (MASA). Oncogene 1995;10:1441-1445
Web of Science | Medline22
Ulvik A ,Koornstra JJ ,Rokke O ,Halvorsen JF ,Haug K ,Ogreid D . Påvishing av aktivert protoonkogen (Ki-ras) i avføringsprøver: ny laboratorieanalyse for tidlig diagnostikk av kolorektal cancer. Tidsskr Nor Laegeforen 1995;115:3266-3270
Medline23
Ratto C ,Flamini G ,Sofo L , et al. Detection of oncogene mutation from neoplastic colonic cells exfoliated in feces. Dis Colon Rectum 1996;39:1238-1244
CrossRef | Web of Science | Medline24
Villa E ,Dugani A ,Rebecchi AM , et al. Identification of subjects at risk for colorectal carcinoma through a test based on K-ras determination in the stool. Gastroenterology 1996;110:1346-1353
CrossRef | Web of Science | Medline25
Eguchi S ,Kohara N ,Komuta K ,Kanematsu T . Mutations of the p53 gene in the stool of patients with resectable colorectal cancer. Cancer 1996;77:Suppl:1707-1710
Web of Science | Medline26
Kohata Y . Detection of K-ras point mutations in the stool of patients with colorectal tumors. Nippon Shokakibyo Gakkai Zasshi 1996;93:391-397
Medline27
Nollau P ,Moser C ,Weinland G ,Wagener C . Detection of K-ras mutations in stools of patients with colorectal cancer by mutant-enriched PCR. Int J Cancer 1996;66:332-336
CrossRef | Web of Science | Medline28
Deuter R ,Muller O . Detection of APC mutations in stool DNA of patients with colorectal cancer by HD-PCR. Hum Mutat 1998;11:84-89
CrossRef | Web of Science | Medline29
Puig P ,Urgell E ,Capella G , et al. Improved detection of K-ras codon 12 mutations in fecal exfoliated cells. Lab Invest 1999;79:617-618
Web of Science | Medline30
Ahlquist DA ,Skoletsky JE ,Boynton KA , et al. Colorectal cancer screening by detection of altered human DNA in stool: feasibility of a multitarget assay panel. Gastroenterology 2000;119:1219-1227
CrossRef | Web of Science | Medline31
Dong SM ,Traverso G ,Johnson C , et al. Detecting colorectal cancer in stool with the use of multiple genetic targets. J Natl Cancer Inst 2001;93:858-865
CrossRef | Web of Science | Medline32
Rengucci C ,Maiolo P ,Saragoni L ,Zoli W ,Amadori D ,Calistri D . Multiple detection of genetic alterations in tumors and stool. Clin Cancer Res 2001;7:590-593
Web of Science | Medline33
Doolittle BR ,Emanuel J ,Tuttle C ,Costa J . Detection of the mutated K-Ras biomarker in colorectal carcinoma. Exp Mol Pathol 2001;70:289-301
CrossRef | Web of Science | Medline34
Boland CR . Genetic pathways to colorectal cancer. Hosp Pract (Off Ed) 1997;32:79-84, 87
Web of Science35
Kinzler KW ,Vogelstein B . Lessons from hereditary colorectal cancer. Cell 1996;87:159-170
CrossRef | Web of Science | Medline36
Tsao J ,Shibata D . Further evidence that one of the earliest alterations in colorectal carcinogenesis involves APC. Am J Pathol 1994;145:531-534
Web of Science | Medline37
Baker SJ ,Preisinger AC ,Jessup JM , et al. p53 Gene mutations occur in combination with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer Res 1990;50:7717-7722
Web of Science | Medline38
Smith AJ ,Stern HS ,Penner M , et al. Somatic APC and K-ras codon 12 mutations in aberrant crypt foci from human colons. Cancer Res 1994;54:5527-5530
Web of Science | Medline39
Jen J ,Powell SM ,Papadopoulos N , et al. Molecular determinants of dysplasia in colorectal lesions. Cancer Res 1994;54:5523-5526
Web of Science | Medline40
Pretlow TP . Aberrant crypt foci and K-ras mutations: earliest recognized players or innocent bystanders in colon carcinogenesis? Gastroenterology 1995;108:600-603
CrossRef | Web of Science | Medline41
Laurent-Puig P ,Beroud C ,Soussi T . APC gene: database of germline and somatic mutations in human tumors and cell lines. Nucleic Acids Res 1998;26:269-270
CrossRef | Web of Science | Medline42
Stryker SJ ,Wolff BG ,Culp CE ,Libbe SD ,Ilstrup DM ,MacCarty RL . Natural history of untreated colonic polyps. Gastroenterology 1987;93:1009-1013
Web of Science | Medline43
Bond JH . Clinical relevance of the small colorectal polyp. Endoscopy 2001;33:454-457
CrossRef | Web of Science | Medline44
Powell SM ,Petersen GM ,Krush AJ , et al. Molecular diagnosis of familial adenomatous polyposis. N Engl J Med 1993;329:1982-1987
Full Text | Web of Science | Medline45
van der Luijt R ,Khan PM ,Vasen H , et al. Rapid detection of translation-terminating mutations at the adenomatous polyposis coli (APC) gene by direct protein truncation test. Genomics 1994;20:1-4
CrossRef | Web of Science | Medline
- Citing Articles (111)
Citing Articles
1
Rani Kanthan, Jenna-Lynn Senger, Selliah Chandra Kanthan. (2012) Fecal Molecular Markers for Colorectal Cancer Screening. Gastroenterology Research and Practice 2012, 1-15
CrossRef2
Benjamin P. Song, Surbhi Jain, Selena Y. Lin, Quan Chen, Timothy M. Block, Wei Song, Dean E. Brenner, Ying-Hsiu Su. (2012) Detection of Hypermethylated Vimentin in Urine of Patients with Colorectal Cancer. The Journal of Molecular Diagnostics
CrossRef3
Somaira Nowsheen, Khaled Aziz, Mihalis I. Panayiotidis, Alexandros G. Georgakilas. (2011) Molecular markers for cancer prognosis and treatment: have we struck gold?. Cancer Letters
CrossRef4
Jin He, Jonathan E. Efron. (2011) Screening for Colorectal Cancer. Advances in Surgery 45:1, 31-44
CrossRef5
Murugan Kalimutho, Giovanna Vecchio Blanco, Micaela Cretella, Elena Mannisi, Pierpaolo Sileri, Amanda Formosa, Francesco Pallone, Giorgio Federici, Sergio Bernardini. (2011) A simplified, non-invasive fecal-based DNA integrity assay and iFOBT for colorectal cancer detection. International Journal of Colorectal Disease 26:5, 583-592
CrossRef6
JinPing Zhang, ShaoBin Yang, YuanYuan Xie, XiangYu Chen, Ye Zhao, DeZhi He, JianSheng Li. (2011) Detection of methylated tissue factor pathway inhibitor 2 and human long DNA in fecal samples of patients with colorectal cancer in China. Cancer Epidemiology
CrossRef7
Yuji Toiyama, Yasuhiro Inoue, Hiromi Yasuda, Susumu Saigusa, Takeshi Yokoe, Yoshinaga Okugawa, Koji Tanaka, Chikao Miki, Masato Kusunoki. (2011) DPEP1, expressed in the early stages of colon carcinogenesis, affects cancer cell invasiveness. Journal of Gastroenterology 46:2, 153-163
CrossRef8
Theodore R Levin, Linda Rabeneck. 2010. Colorectal Cancer: Population Screening and Surveillance. , 311-323.
CrossRef9
Murugan Kalimutho, Giovanna Del Vecchio Blanco, Paolo Gravina, Micaela Cretella, Liliana Mannucci, Elena Mannisi, Amanda Formosa, Francesco Pallone, Giorgio Federici, Sergio Bernardini. (2010) Quantitative denaturing high performance liquid chromatography (Q-dHPLC) detection of APC long DNA in faeces from patients with colorectal cancer. Clinical Chemistry and Laboratory Medicine 48:9, 1303-1311
CrossRef10
Daniel Azuara, Francisco Rodriguez-Moranta, Javier de Oca, Antonio Soriano-Izquierdo, Josefina Mora, Jordi Guardiola, Sebastiano Biondo, Ignacio Blanco, Miguel Angel Peinado, Victor Moreno, Manel Esteller, Gabriel Capellá. (2010) Novel Methylation Panel for the Early Detection of Colorectal Tumors in Stool DNA. Clinical Colorectal Cancer 9:3, 168-176
CrossRef11
Reza Serizawa, Per Guldberg. 2010. DNA Biomarkers in the Diagnosis and Management of Cancer. , 165-184.
CrossRef12
T. Nagasaka, N. Tanaka, H. M. Cullings, D.-S. Sun, H. Sasamoto, T. Uchida, M. Koi, N. Nishida, Y. Naomoto, C. R. Boland, N. Matsubara, A. Goel. (2009) Analysis of Fecal DNA Methylation to Detect Gastrointestinal Neoplasia. JNCI Journal of the National Cancer Institute 101:18, 1244-1258
CrossRef13
A. Eickhoff, M. Bechtler, J. F. Riemann. (2009) Früherkennung des kolorektalen Karzinoms. best practice onkologie 4:4, 4-14
CrossRef14
R Mayor, L Casadomé, D Azuara, V Moreno, S J Clark, G Capellà, M A Peinado. (2009) Long-range epigenetic silencing at 2q14.2 affects most human colorectal cancers and may have application as a non-invasive biomarker of disease. British Journal of Cancer 100:10, 1534-1539
CrossRef15
Shan Lu, Yanek S. Y. Chiu, Andrew P. Smith, Dan Moore, Nancy M. Lee. (2009) Biomarkers Correlate With Colon Cancer and Risks. Diseases of the Colon & Rectum 52:4, 715-724
CrossRef16
Keishi Yamashita, Masahiko Watanabe. (2009) Clinical significance of tumor markers and an emerging perspective on colorectal cancer. Cancer Science 100:2, 195-199
CrossRef17
Hongzhi Zou, William R. Taylor, Jonathan J. Harrington, Fareeda Taher Nazer Hussain, Xiaoming Cao, Charles L. Loprinzi, Theodore R. Levine, Douglas K. Rex, Dennis Ahnen, Kandice L. Knigge, Peter Lance, Xuan Jiang, David I. Smith, David A. Ahlquist. (2009) High Detection Rates of Colorectal Neoplasia by Stool DNA Testing With a Novel Digital Melt Curve Assay. Gastroenterology 136:2, 459-470
CrossRef18
Alexandre Loktionov, Colin G Ferrett, Jeremy J S Gibson, Tatiana Bandaletova, Carine Dion, Andrew H Llewelyn, Hugo G G Lywood, Rupert C G Lywood, Bruce D George, Neil J Mortensen. (2009) A case-control study of colorectal cancer detection by quantification of DNA isolated from directly collected exfoliated colonocytes. International Journal of Cancern/a-n/a
CrossRef19
Y. Koga, M. Yasunaga, Y. Moriya, T. Akasu, S. Fujita, S. Yamamoto, H. Baba, Y. Matsumura. (2008) Detection of the DNA Point Mutation of Colorectal Cancer Cells Isolated from Feces Stored Under Different Conditions. Japanese Journal of Clinical Oncology 39:1, 62-69
CrossRef20
Ann G. Zauber, Theodore R. Levin, C Carl Jaffe, Barbara A. Galen, David F. Ransohoff, Martin L. Brown. (2008) Implications of New Colorectal Cancer Screening Technologies for Primary Care Practice. Medical Care 46:Supplement 1, S138-S146
CrossRef21
Yoshikatsu Koga, Masahiro Yasunaga, Yoshihiro Moriya, Takayuki Akasu, Shin Fujita, Seiichiro Yamamoto, Takahiro Kozu, Hideo Baba, Yasuhiro Matsumura. (2008) Detection of colorectal cancer cells from feces using quantitative real-time RT-PCR for colorectal cancer diagnosis. Cancer Science
CrossRef22
Charles J. Kahi, Douglas K. Rex, Thomas F. Imperiale. (2008) Screening, Surveillance, and Primary Prevention for Colorectal Cancer: A Review of the Recent Literature. Gastroenterology 135:2, 380-399
CrossRef23
Jürgen Stein, Stefan M. Loitsch, Yogesh Shastri. (2008) Nicht-invasive Diagnostik kolorektaler Tumore – Hat der Guaiac-Test ausgedient? / Non-invasive detection of colorectal cancer – do we still need the guaiac-based fecal occult blood test?. LaboratoriumsMedizin 32:3, 158-167
CrossRef24
Jürgen Stein, Stefan M. Loitsch, Yogesh Shastri. (2008) Non-invasive detection of colorectal cancer – do we still need the guaiac-based fecal occult blood test? 1. LaboratoriumsMedizin 32:3, ---
CrossRef25
V. E. Velculescu. (2008) Defining the blueprint of the cancer genome. Carcinogenesis 29:6, 1087-1091
CrossRef26
C. Hassan, A. Laghi, A. Zullo, F. Iafrate, S. Morini. (2008) Q&A on diagnosis, screening and follow-up of colorectal neoplasia. Digestive and Liver Disease 40:2, 85-96
CrossRef27
Yoshikatsu Koga, Masahiro Yasunaga, Satoshi Katayose, Yoshihiro Moriya, Takayuki Akasu, Shin Fujita, Seiichiro Yamamoto, Hideo Baba, Yasuhiro Matsumura. (2008) Improved Recovery of Exfoliated Colonocytes from Feces Using Newly Developed Immunomagnetic Beads. Gastroenterology Research and Practice 2008, 1-7
CrossRef28
Federico Sopeña, Angel Ferrandez, Angel Lanas. (2008) Noninvasive diagnostic modalities for early detection of colorectal cancer. Current Colorectal Cancer Reports 4:1, 24-33
CrossRef29
Paul T. Spellman, Joseph F. Costello, Joe W. Gray. 2008. Cancer Genomics. , 267-282.
CrossRef30
D. Kim Turgeon, Dean E. Brenner. (2007) Fecal DNA-based detection of colorectal neoplasia. Current Colorectal Cancer Reports 3:4, 171-177
CrossRef31
Wei Zhang, Michael Bauer, Roland S. Croner, Jörg O. W. Pelz, Dimitri Lodygin, Heiko Hermeking, Michael Stürzl, Werner Hohenberger, Klaus E. Matzel. (2007) DNA Stool Test for Colorectal Cancer: Hypermethylation of the Secreted Frizzled-Related Protein-1 Gene. Diseases of the Colon & Rectum 50:10, 1618-1627
CrossRef32
Russell P. Kruzelock, William Short. (2007) Colorectal Cancer Therapeutics and the Challenges of Applied Pharmacogenomics. Current Problems in Cancer 31:5, 315-366
CrossRef33
Deborah A. Marshall, F. Reed Johnson, Kathryn A. Phillips, John K. Marshall, Lehana Thabane, Nathalie A. Kulin. (2007) Measuring Patient Preferences for Colorectal Cancer Screening Using a Choice-Format Survey. Value in Health 10:5, 415-430
CrossRef34
Gad Rennert, Dimitry Kislitsin, Dean E. Brenner, Hedy S. Rennert, Zeev Lev. (2007) Detecting K-ras mutations in stool from fecal occult blood test cards in multiphasic screening for colorectal cancer. Cancer Letters 253:2, 258-264
CrossRef35
Hongzhi Zou, Jonathan J. Harrington, Aravind Sugumar, Kristie K. Klatt, Thomas C. Smyrk, David A. Ahlquist. (2007) Detection of Colorectal Disease by Stool Defensin Assay: An Exploratory Study. Clinical Gastroenterology and Hepatology 5:7, 865-868
CrossRef36
Alexandre Loktionov. (2007) Cell exfoliation in the human colon: Myth, reality and implications for colorectal cancer screening. International Journal of Cancer 120:11, 2281-2289
CrossRef37
Wai K. Leung, Ka-Fai To, Ellen P. S. Man, Michael W. Y. Chan, Aric J. Hui, Simon S. M. Ng, James Y. W. Lau, Joseph J. Y. Sung. (2007) Detection of Hypermethylated DNA or Cyclooxygenase-2 Messenger RNA in Fecal Samples of Patients With Colorectal Cancer or Polyps. The American Journal of Gastroenterology 102:5, 1070-1076
CrossRef38
C. Lepage, J. Faivre. (2007) Dépistage du cancer colorectal par les tests moléculaires de détection de l’ADN tumoral dans les selles. Acta Endoscopica 37:2, 231-238
CrossRef39
Chih-Cheng Chien, Shu-Hung Chen, Chen-Chiung Liu, Chia-Long Lee, Ruey-Neng Yang, Shung-Haur Yang, Chi-Jung Huang. (2007) Correlation of K-ras codon 12 mutations in human feces and ages of patients with colorectal cancer (CRC). Translational Research 149:2, 96-102
CrossRef40
Frank Diehl, Luis A Diaz. (2007) Digital quantification of mutant DNA in cancer patients. Current Opinion in Oncology 19:1, 36-42
CrossRef41
Vladimir Baltić. (2007) Application of Genomics in Clinical Oncology. Journal of Medical Biochemistry 26:2, 79-93
CrossRef42
Elizabeth E Half, Patrick M Lynch. (2006) Mutated DNA in the stool—does it have a role in colorectal cancer screening?. Nature Clinical Practice Gastroenterology & Hepatology 3:11, 594-595
CrossRef43
(2006) Will Screening Colonoscopy Disappear and Transform Gastroenterology Practice? Threats to Clinical Practice and Recommendations to Reduce Their Impact: Report of a Consensus Conference Conducted by the AGA Institute Future Trends Committee. Gastroenterology 131:4, 1287-1312
CrossRef44
Mohini Chaurasia, Manish K. Chourasia, Nitin K. Jain, Aviral Jain, Vandana Soni, Yashwant Gupta, Sanjay K. Jain. (2006) Cross-linked guar gum microspheres: A viable approach for improved delivery of anticancer drugs for the treatment of colorectal cancer. AAPS PharmSciTech 7:3, E143-E151
CrossRef45
Young-Ho Kim, Zsolt Petko, Slavomir Dzieciatkowski, Li Lin, Mahan Ghiassi, Steve Stain, William C. Chapman, Mary Kay Washington, Joseph Willis, Sanford D. Markowitz, William M. Grady. (2006) CpG island methylation of genes accumulates during the adenoma progression step of the multistep pathogenesis of colorectal cancer. Genes, Chromosomes and Cancer 45:8, 781-789
CrossRef46
Sapna Syngal, Elena Stoffel, Daniel Chung, Christopher Willett, David Schoetz, Paul Schroy, Deepa Jagadeesh, Kathleen Morel, Michael Ross. (2006) Detection of stool DNA mutations before and after treatment of colorectal neoplasia. Cancer 106:2, 277-283
CrossRef47
Hisayuki Matsushita, Yasuhiro Matsumura, Yoshihiro Moriya, Takayuki Akasu, Shin Fujita, Seiichiro Yamamoto, Shigeki Onouchi, Norio Saito, Masanori Sugito, Masaaki Ito, Takahiro Kozu, Takashi Minowa, Sayuri Nomura, Hiroyuki Tsunoda, Tadao Kakizoe. (2005) A New Method for Isolating Colonocytes From Naturally Evacuated Feces and Its Clinical Application to Colorectal Cancer Diagnosis. Gastroenterology 129:6, 1918-1927
CrossRef48
Ulrike Haug, Hermann Brenner. (2005) New stool tests for colorectal cancer screening: A systematic review focusing on performance characteristics and practicalness. International Journal of Cancer 117:2, 169-176
CrossRef49
Nadine Kutzner, Ingrid Hoffmann, Christina Linke, Thomas Thienel, Marco Grzegorczyk, Wolfgang Urfer, Dirk Martin, Günther Winde, Thilo Traska, Gerd Hohlbach, Klaus-Michael Müller, Cornelius Kuhnen, Oliver Müller. (2005) Non-invasive detection of colorectal tumours by the combined application of molecular diagnosis and the faecal occult blood test. Cancer Letters 229:1, 33-41
CrossRef50
Hongzhi Zou, Julian R. Molina, Jonathan J. Harrington, Neal K. Osborn, Kristie K. Klatt, Yvonne Romero, Lawrence J. Burgart, David A. Ahlquist. (2005) Aberrant methylation of secreted frizzled-related protein genes in esophageal adenocarcinoma and Barrett's esophagus. International Journal of Cancer 116:4, 584-591
CrossRef51
Carol R. Regueiro. (2005) AGA Future Trends Committee Report: Colorectal Cancer: A Qualitative Review of Emerging Screening and Diagnostic Technologies. Gastroenterology 129:3, 1083-1103
CrossRef52
W.-D. Chen, Z. J. Han, J. Skoletsky, J. Olson, J. Sah, L. Myeroff, P. Platzer, S. Lu, D. Dawson, J. Willis, T. P. Pretlow, J. Lutterbaugh, L. Kasturi, J. K. V. Willson, J. S. Rao, A. Shuber, S. D. Markowitz. (2005) Detection in Fecal DNA of Colon Cancer-Specific Methylation of the Nonexpressed Vimentin Gene. JNCI Journal of the National Cancer Institute 97:15, 1124-1132
CrossRef53
D. Heresbach, S. Manfredi, J. F. Bretagne. (2005) Stratégies de dépistage du cancer colorectal: endoscopie versus autres modes d’exploration. Acta Endoscopica 35:4, 621-648
CrossRef54
J. Wedemeyer, N. P. Malek, M. P. Manns, M. J. Bahr. (2005) Molekulare Therapie in der Gastroenterologie und Hepatologie. Der Internist 46:8, 861-872
CrossRef55
Daniel L. Ouyang, Joseph J. Chen, Robert H. Getzenberg, Robert E. Schoen. (2005) Noninvasive Testing for Colorectal Cancer: A Review. The American Journal of Gastroenterology 100:6, 1393-1403
CrossRef56
L BAUM, A NG, W LEUNG. (2005) Developing the use of mismatch binding proteins for discovering rare somatic mutations. Molecular and Cellular Probes 19:3, 163-168
CrossRef57
Jaya Agrawal, Sapna Syngal. (2005) Colon cancer screening strategies. Current Opinion in Internal Medicine 4:2, 166-170
CrossRef58
R. Justin Davies, Richard Miller, Nicholas Coleman. (2005) Colorectal cancer screening: prospects for molecular stool analysis. Nature Reviews Cancer 5:3, 199-209
CrossRef59
Shinobu Yamada, Masakazu Yashiro, Kiyoshi Maeda, Yukio Nishiguchi, Kosei Hirakawa. (2005) A novel high-specificity approach for colorectal neoplasia: Detection of K-ras2 oncogene mutation in normal mucosa. International Journal of Cancer 113:6, 1015-1021
CrossRef60
Christopher S. Huang, Subodh K. Lal, Francis A. Farraye. (2005) Colorectal cancer screening in average risk individuals. Cancer Causes & Control 16:2, 171-188
CrossRef61
Konstanze Lenhard, Guido T. Bommer, Silke Asutay, Rolf Schauer, Thomas Brabletz, Burkhard Göke, Rolf Lamerz, Frank T. Kolligs. (2005) Analysis of promoter methylation in stool: A novel method for the detection of colorectal cancer. Clinical Gastroenterology and Hepatology 3:2, 142-149
CrossRef62
Neal K. Osborn, David A. Ahlquist. (2005) Stool screening for colorectal cancer: Molecular approaches. Gastroenterology 128:1, 192-206
CrossRef63
Jack S. Mandel. (2005) Screening of patients at average risk for colon cancer. Medical Clinics of North America 89:1, 43-59
CrossRef64
Sofia Lagerholm, Sara Lagerholm, Sudhir Dutta, Padmanabhan Nair. (2005) Non-invasive detection of c-myc p64, c-myc p67 and c-erbb-2 in colorectal cancer. Scandinavian Journal of Gastroenterology 40:11, 1343-1350
CrossRef65
Sapna Syngal, Prathap Bandipalliam, C. Richard Boland. (2005) Surveillance of patients at high risk for colorectal cancer. Medical Clinics of North America 89:1, 61-84
CrossRef66
Hemant K. Roy, Thomas C. Smyrk, Jennifer Koetsier, Thomas A. Victor, Ramesh K. Wali. (2005) The Transcriptional Repressor SNAIL Is Overexpressed in Human Colon Cancer. Digestive Diseases and Sciences 50:1, 42-46
CrossRef67
Martin Wagner, Guido Adler, Thomas Seufferlein. (2005) Kolorektale Karzinome: Neue Entwicklungen in der Tumorprävention und in der Diagnostik der Tumorausbreitung. Chirurgische Gastroenterologie 21:2, 109-116
CrossRef68
Imperiale, Thomas F., Ransohoff, David F., Itzkowitz, Steven H., Turnbull, Barry A., Ross, Michael E., . (2004) Fecal DNA versus Fecal Occult Blood for Colorectal-Cancer Screening in an Average-Risk Population. New England Journal of Medicine 351:26, 2704-2714
Full Text69
Sadanand Gite, Alex Garvin, Kenneth Rothschild. 2004. Protein Truncation Test (PTT). , 1089-1094.
CrossRef70
Beth Y. Karlan. (2004) The Colon Is a Pelvic Organ Too. Obstetrics & Gynecology 104:5, Part 1, 907-909
CrossRef71
Duncan Whitney, Joel Skoletsky, Kent Moore, Kevin Boynton, Lisa Kann, Randall Brand, Sapna Syngal, Michael Lawson, Anthony Shuber. (2004) Enhanced Retrieval of DNA from Human Fecal Samples Results in Improved Performance of Colorectal Cancer Screening Test. The Journal of Molecular Diagnostics 6:4, 386-395
CrossRef72
Rui Henrique, Carmen Jerónimo. (2004) Molecular Detection of Prostate Cancer: A Role for GSTP1 Hypermethylation. European Urology 46:5, 660-669
CrossRef73
Chanjuan Shi, Susan H Eshleman, Dana Jones, Noriyoshi Fukushima, Li Hua, Antony R Parker, Charles J Yeo, Ralph H Hruban, Michael G Goggins, James R Eshleman. (2004) LigAmp for sensitive detection of single-nucleotide differences. Nature Methods 1:2, 141-147
CrossRef74
Jane G. Zapka, Stephenie C. Lemon. (2004) Interventions for patients, providers, and health care organizations. Cancer 101:S5, 1165-1187
CrossRef75
Shannon Cowie, Snezana Drmanac, Donald Swanson, Kathleen Delgrosso, Steve Huang, Desirée du Sart, Radoje Drmanac, Saul Surrey, Paolo Fortina. (2004) Identification of APC gene mutations in colorectal cancer using universal microarray-based combinatorial sequencing-by-hybridization. Human Mutation 24:3, 261-271
CrossRef76
Shigeru Kanaoka, Ken-Ichi Yoshida, Naoyuki Miura, Haruhiko Sugimura, Masayoshi Kajimura. (2004) Potential usefulness of detecting cyclooxygenase 2 messenger RNA in feces for colorectal cancer screening. Gastroenterology 127:2, 422-427
CrossRef77
P D Hardt, S Mazurek, M Toepler, P Schlierbach, R G Bretzel, E Eigenbrodt, H U Kloer. (2004) Faecal tumour M2 pyruvate kinase: a new, sensitive screening tool for colorectal cancer. British Journal of Cancer
CrossRef78
K. S. Tagore, T. R. Levin, M. J. Lawson. (2004) The evolution to stool DNA testing for colorectal cancer. Alimentary Pharmacology and Therapeutics 19:12, 1225-1233
CrossRef79
Jacek Jassem, Ewa Jassem, Joanna Jak
bkiewicz-Banecka, Witold Rzyman, Andrzej Badzio, Rafa? Dziadziuszko, Gra?yna Kobierska-Gulida, Amelia Szymanowska, Marcin Skrzypski, Maciej ?ylicz. (2004) P53 and K-ras mutations are frequent events in microscopically negative surgical margins from patients with nonsmall cell lung carcinoma. Cancer 100:9, 1951-1960
CrossRef80
Claudia S. Cohen, R. Rand Allingham. (2004) The dawn of genetic testing for glaucoma. Current Opinion in Ophthalmology 15:2, 75-79
CrossRef81
Hannes M Müller, Michael Oberwalder, Heidi Fiegl, Maria Morandell, Georg Goebel, Matthias Zitt, Markus Mühlthaler, Dietmar Öfner, Raimund Margreiter, Martin Widschwendter. (2004) Methylation changes in faecal DNA: a marker for colorectal cancer screening?. The Lancet 363:9417, 1283-1285
CrossRef82
K SIKORA. (2004) Cancer screening. Medicine 32:3, 37-41
CrossRef83
Robert D Madoff, Sharon L Dykes. (2004) What's new in colon and rectal surgery. Journal of the American College of Surgeons 198:1, 91-104
CrossRef84
Kazuhiko Mori, Kazuhiko Aoyagi, Tetsuya Ueda, Inaho Danjoh, Yasuhiro Tsubosa, Kazuyoshi Yanagihara, Yoshihiro Matsuno, Mitsuru Sasako, Hiromi Sakamoto, Ken-ichi Mafune, Michio Kaminishi, Teruhiko Yoshida, Masaaki Terada, Hiroki Sasaki. (2004) Highly specific marker genes for detecting minimal gastric cancer cells in cytology negative peritoneal washings. Biochemical and Biophysical Research Communications 313:4, 931-937
CrossRef85
Barry M. Berger, Lauren Robison, Jonathan Glickman. (2003) Colon Cancer???Associated DNA Mutations: Marker Selection for the Detection of Proximal Colon Cancer. Diagnostic Molecular Pathology 12:4, 187-192
CrossRef86
Angel Ferrández, James A DiSario. (2003) Colorectal cancer: screening and surveillance for high-risk individuals. Expert Review of Anticancer Therapy 3:6, 851-862
CrossRef87
Paul G. Rothberg. (2003) Imatinib: resisting the resistance. Leukemia Research 27:11, 977-978
CrossRef88
Daniele Calistri, Claudia Rengucci, Renato Bocchini, Luca Saragoni, Wainer Zoli, Dino Amadori. (2003) Fecal multiple molecular tests to detect colorectal cancer in stool. Clinical Gastroenterology and Hepatology 1:5, 377-383
CrossRef89
Hannes M Müller, Martin Widschwendter. (2003) Methylated DNA as a possible screening marker for neoplastic disease in several body fluids. Expert Review of Molecular Diagnostics 3:4, 443-458
CrossRef90
Muin J. Khoury. (2003) Genetics and genomics in practice: The continuum from genetic disease to genetic information in health and disease. Genetics in Medicine 5:4, 261-268
CrossRef91
Theodore R. Levin. (2003) Does family history still matter in the era of screening colonoscopy?. Clinical Gastroenterology and Hepatology 1:2, 69-70
CrossRef92
ADRIAN M. JUBB, PHIL QUIRKE, ADAM J. OATES. (2003) DNA Methylation, a Biomarker for Colorectal Cancer. Annals of the New York Academy of Sciences 983:1, 251-267
CrossRef93
Heather DeGrendele, Edward Chu, Vinay K. Jain. (2003) Advances in the Use of Fecal DNA Screening for the Detection of Colorectal Cancer. Clinical Colorectal Cancer 2:4, 210-212
CrossRef94
Thomas J Gates. (2003) Concepts and Controversies in Cancer Screening. American Journal of Cancer 2:6, 395-402
CrossRef95
J. Jen, B. Vogelstein. (2003) RESPONSE: Tumor Location and Detection of K-Ras Mutations in Stool From Colorectal Cancer Patients. JNCI Journal of the National Cancer Institute 95:1, 73-73
CrossRef96
M. Frattini, D. Balestra, S. Pilotti, L. Bertario, M. A. Pierotti. (2003) Tumor Location and Detection of K-Ras Mutations in Stool From Colorectal Cancer Patients. JNCI Journal of the National Cancer Institute 95:1, 72-73
CrossRef97
James G Herman. (2002) Hypermethylation pathways to colorectal cancer. Gastroenterology Clinics of North America 31:4, 945-958
CrossRef98
Jaye L Viner, Asad Umar, Ernest T Hawk. (2002) Chemoprevention of colorectal cancer: problems, progress, and prospects. Gastroenterology Clinics of North America 31:4, 971-999
CrossRef99
Theodore R Levin. (2002) Flexible sigmoidoscopy for colorectal cancer screening: valid approach or short-sighted?. Gastroenterology Clinics of North America 31:4, 1015-1029
CrossRef100
Angel Ferrández, James A. DiSario. (2002) Hereditary colorectal cancer: Screening and management. Current Treatment Options in Oncology 3:6, 459-474
CrossRef101
David F Ransohoff. (2002) Screening colonoscopy in balance. Gastroenterology Clinics of North America 31:4, 1031-1044
CrossRef102
Bernard Levin, Robert A. Smith, Gabriel E. Feldman, Graham A. Colditz, Robert H. Fletcher, Marion Nadel, David A. Rothenberger, Paul S. Schroy, Sally W. Vernon, Richard Wender, . (2002) Promoting early detection tests for colorectal carcinoma and adenomatous polyps. Cancer 95:8, 1618-1628
CrossRef103
Elena Martinez Stoffel, Sapna Syngal. (2002) Colon cancer screening strategies. Current Opinion in Gastroenterology 18:5, 595-601
CrossRef104
Marco E Turini, Raymond N DuBois. (2002) Primary prevention: phytoprevention and chemoprevention of colorectal cancer. Hematology/Oncology Clinics of North America 16:4, 811-840
CrossRef105
(2002) Fecal DNA Tests for Colorectal Cancer. New England Journal of Medicine 346:24, 1912-1913
Full Text106
R Justin Davies, Alex Freeman, Lesley S Morris, Sheila Bingham, Stephen Dilworth, Ian Scott, Ronald A Laskey, Richard Miller, Nicholas Coleman. (2002) Analysis of minichromosome maintenance proteins as a novel method for detection of colorectal cancer in stool. The Lancet 359:9321, 1917-1919
CrossRef107
Sanford D Markowitz, Dawn M Dawson, Joseph Willis, James K.V Willson. (2002) Focus on colon cancer. Cancer Cell 1:3, 233-236
CrossRef108
Alison Kraus, Marcus Schuermann. (2002) Molecular detection of gene mutations and methylation abnormalities: applications in solid tumour diagnosis.. Expert Review of Molecular Diagnostics 2:2, 97-108
CrossRef109
(2002) Nature Reviews Cancer 2:3, 159-159
CrossRef110
David Sidransky. (2002) Emerging molecular markers of cancer. Nature Reviews Cancer 2:3, 210-219
CrossRef111
Schwartz, Robert S., . (2002) A Needle in a Haystack of Genes. New England Journal of Medicine 346:5, 302-304
Full Text
- Letters
