Original Article
Expression of p53 and Prognosis in Children with Malignant Gliomas
N Engl J Med 2002; 346:420-427February 7, 2002
- Abstract
Background
The prognosis of children with high-grade gliomas is uncertain, even when clinical and histologic findings are considered. We investigated whether mutations in the TP53 gene or the degree of expression of p53 protein in high-grade gliomas is associated with progression-free survival in children with these tumors.
Methods
Paraffin-embedded specimens of malignant gliomas from children treated in the Children's Cancer Group study CCG-945 were assessed by mutational analysis of TP53 (121 specimens) and immunohistochemical analysis of p53 (115 specimens). For mutational studies, areas of tissue that contained malignant glioma were isolated by microdissection, and the DNA was subjected to polymerase-chain-reaction–based amplification and sequencing of TP53 exons 5, 6, 7, and 8. Immunohistochemical analysis was performed with the use of a microwave-enhanced antigen retrieval and an antibody that bound both wild-type and mutant p53.
Results
We found a significant association between overexpression of p53 and outcome; this association was independent of histologic features, age, sex, the extent of resection, and tumor location. The rate (±SE) of progression-free survival at five years was 44±6 percent in the group of 74 patients whose tumors had low levels of expression of p53 and 17±6 percent in the group of 41 patients whose tumors had overexpression of p53 (P<0.001). A nonsignificant association was observed between mutations in TP53 and outcome.
Conclusions
Overexpression of p53 in malignant gliomas during childhood is strongly associated with an adverse outcome, independently of clinical prognostic factors and histologic findings.
Media in This Article
Figure 2
Relation of Mutations in TP53 and Overexpression of p53 to Outcome in Children with High-Grade Gliomas.Figure 1
Immunohistochemical Analysis of p53 and the Rate of Progression-free Survival According to the Levels of p53 Expression.Article Activity
- Article
High-grade astrocytomas are the largest group of primary central nervous system tumors and generally have a poor prognosis.1-4 However, many studies have found that a young age is a favorable prognostic factor,3-7 suggesting that malignant gliomas in children might differ biologically from similar lesions in older patients.8
High-grade gliomas in adults arise through several distinct molecular pathways of tumorigenesis. So-called primary malignant gliomas, which typically affect older patients and have a histologic grade of IV (i.e., glioblastoma multiforme)9 at diagnosis, commonly show amplification of the epidermal growth factor receptor gene (EGFR),10-15 which encodes a tyrosine kinase involved in cell replication. In contrast, secondary malignant gliomas that evolve from low-grade lesions generally affect young adults and often have mutations in TP53, which encodes the p53 protein, but rarely have amplification of EGFR.10-15 To date, these features have not been linked to the prognosis of gliomas in adults, nor have other characteristic mutational events in high-grade astrocytomas.16-23
As compared with the extensive characterization of the molecular alterations in high-grade gliomas in adults,10,14,16,23 there is limited information on the molecular abnormalities in pediatric gliomas.24-29 In our previous studies of malignant gliomas from children, we found that overexpression of p53 and mutations in TP53 were associated with adverse outcomes,25 but the small size of the cohort did not allow us to assess whether the prognostic significance of these changes was independent of the histologic features of the tumor.
To investigate the clinical significance of these molecular changes more conclusively, we analyzed data on the multiinstitutional cohort of the Children's Cancer Group (CCG) study CCG-945, a large group of uniformly treated children with high-grade gliomas.30 We examined mutations in TP53, overexpression of p53, or both and evaluated the association of these changes with outcome.
Methods
Population
CCG-945 included 231 children with non–brain-stem malignant gliomas who were treated with surgery, radiotherapy of the involved field, and one of two regimens of chemotherapy. A total of 172 patients who were between 18 months and 21 years of age at diagnosis and had intracranial malignant gliomas were randomly assigned to receive adjuvant therapy with either prednisone, lomustine, and vincristine or the “eight-drugs-in-one-day” regimen.30,31 This regimen incorporated seven agents with some activity against pediatric brain tumors: lomustine, vincristine, hydroxyurea, procarbazine, cisplatin, cytosine arabinoside, and dacarbazine; methylprednisolone was added to reduce cerebral edema. The goal of this approach was to circumvent resistance to individual agents by exposing the tumor to multiple agents, albeit at a low dose intensity. Fifty-nine children younger than 18 months of age or with malignant gliomas of the spinal cord were nonrandomly assigned to the eight-drug regimen.
The study enrolled patients from 60 institutions between April 1985 and May 1990. The protocol required that each institution provide histopathological confirmation of the presence of a high-grade astrocytoma (i.e., a glioblastoma multiforme, an anaplastic astrocytoma, or another eligible grade III glioma, such as an anaplastic mixed glioma). The outcomes were among the best reported for patients with these tumors, with an overall rate (±SE) of survival at five years of 36±6 percent, with no significant difference between the two treatment groups.30
For the present study, tissue collection was initiated by the Pediatric Branch of the Cooperative Human Tissue Network in the context of a CCG biology study, CCG-B975, which was approved by the institutional review board of Children's Hospital of Pittsburgh. Specimens were coded by the Cooperative Human Tissue Network to mask clinical, histologic, and outcome data from the investigators. The material provided for analysis was reexamined by two neuropathologists to confirm that adequate amounts of tissue were available for the planned studies.
Analysis for Mutations in TP53
Paraffin-embedded tumor specimens were used for all analyses. Slides were reviewed, and blocks that contained malignant glioma were sectioned at a thickness of 4 μm. Sections were stained with hematoxylin and eosin to confirm that characteristic tissue had been obtained; adjacent sections were subjected to immunohistochemical staining for p53 or microdissection-based analysis for TP53 mutations. Exons 5, 6, 7, and 8 were examined specifically because they encompass most TP53 mutations detected in astrocytic32 and nonastrocytic33 tumors.
For mutational analysis, tissue specimens from regions with the highest degree of anaplasia were removed directly from tumor sections with the use of microdissection techniques as described.25,34-36 Individual exons were amplified by the polymerase chain reaction (PCR) with the use of the following primer pairs: exon 5, GCAGTACTCCCCTGCCTCAA (sense) and GCCCCAGCTGCTCACCATCGC (antisense); exon 6, GGGTCCCCAGGCCTCTGATT (sense) and CCTCCCAGAGACCCCAGTT (antisense); exon 7, CTTGCCACAGGTCTCCCCAAG (sense) and GCAGGCCAGTGTGCAGGGTGG (antisense); and exon 8, TTTTCCTATCCTGAGTAGTGG (sense) and GGTCTCCTCCACCGCTTCTTG (antisense), as reported.25,36 The PCR products were isolated and directly sequenced by dideoxy chain termination with the use of 35S-labeled deoxyadenosine triphosphate (dATP) as previously described.25,36 Sequences were read from autoradiograms of 6 percent polyacrylamide gels.
Expression of p53
Tumor-containing sections were baked at 60°C for 30 minutes, deparaffinized in xylene, and rehydrated in graded concentrations of ethanol. Endogenous peroxidase activity was blocked by incubation in 0.3 percent hydrogen peroxide and methanol. Slides were rehydrated in phosphate-buffered saline. Microwave-enhanced antigen retrieval37 was performed by boiling the slides in 10 mM citrate buffer (pH 6.0). Nonspecific antibody binding was blocked by incubation with a protein-blocking reagent (Immunon, Pittsburgh) for 20 minutes. Sections were then incubated overnight at 4°C with anti-p53 antibody (DO-7, Dako, Carpinteria, Calif.) at a 1:300 dilution in common antibody diluent (BioGenex, San Ramon, Calif.). This antibody recognizes a determinant of wild-type and mutant p53 in formalin-fixed sections.38
Slides were rinsed in phosphate-buffered saline and incubated with a biotin-labeled secondary antibody, followed by a streptavidin–horseradish peroxidase conjugate. Bound antibody was revealed with the use of the substrate 3,3'-diaminobenzidine.39 Sections were counterstained with Mayer's hematoxylin, washed, dehydrated with graded concentrations of ethanol, cleared in xylene, mounted, and examined microscopically.
Positive and negative controls were included with each batch of sections to confirm the consistency of the analysis. Specimens were examined independently for immunoreactivity with the use of an antibody against a histologically verifiable internal positive control antigen (i.e., staining of the Ki-67 antigen by the MIB1 antibody [Immunotech, Westbrook, Me.] in mitotic figures in tumor), to identify cases in which a lack of immunoreactivity for p53 might indicate problems of tissue preservation, rather than a lack of protein expression. Such cases were excluded from the outcome analysis.
Sections were examined for p53 immunoreactivity by an observer who was unaware of the histologic diagnoses, outcomes, or clinical features. Only cells with dense nuclear staining were interpreted as positive. Tumors were categorized as expressing little or no p53 (a grade of 0 or 1), similar to normal brain, or as overexpressing p53, with staining observed in a sizable subgroup of cells (25 to 50 percent; grade 2), most cells (50 to 75 percent; grade 3), or nearly all cells (>75 percent; grade 4) in the high-power field in areas with maximal staining. Overexpression was therefore defined semiquantitatively, based on the percentage of p53-expressing cells in the tumor.
Central Pathological Review
Histopathological inclusion criteria for the CCG-945 clinical study were based solely on the pathological diagnosis made at each institution, but it has since been recognized that the classification of gliomas in children is extremely challenging and subject to differences of opinion even among skilled reviewers.40 To eliminate the possibility that results in the present study may have been influenced by diagnostic variations among the pathologists at each institution, all specimens in the current study were independently reviewed in a blinded fashion by a senior neuropathologist to ensure consistent classification based on contemporary guidelines from the World Health Organization.9 We then examined the association of overexpression of p53 and mutations in TP53 with outcome, using the diagnosis made by the reviewer in place of the diagnosis made at the institution and excluding cases believed to be discordant (e.g., not high-grade gliomas) or equivocal.
Statistical Analysis
For the outcome analysis, tumors were classified according to the presence or absence of overexpression of p53 or mutations in TP53. The primary end point was progression-free survival, defined as the time from study entry to disease progression. Comparisons of outcome were based on the log-rank test; estimates of survival, with standard errors, were calculated from the product-limit estimate.41 Because it was considered that expression of p53 and the status of TP53 might correlate with the histopathological diagnosis, an analysis of the association between those findings and outcome was performed with a stratified log-rank test,41 which adjusted for a variety of potential prognostic factors. Comparisons of the distribution of p53 expression and mutation status between different subgroups of patients were based on a two-sided Fisher's exact test and a χ2 test, as appropriate.42
Results
Characteristics of the Patients
Specimens from 148 of the 231 patients were available for analysis; 115 could be assessed for p53 expression, and 121 contained sufficient tissue for analysis of TP53 mutations. Twenty-four specimens that lacked immunoreactivity for internal positive control antigens (e.g., staining of cells with mitotic figures with use of the MIB1 antibody for staining of Ki-67 antigen) and 9 specimens that lacked sufficient tissue to permit reliable assessment were prospectively excluded from analysis of p53 expression, whereas 27 specimens that lacked sufficient tumor tissue to permit microdissection of foci with over 80 percent malignant glioma cells were excluded from mutational analysis. The rate of progression-free survival at five years in the group of patients whose specimens could be assessed for p53 immunoreactivity (35±4 percent) did not differ from that of the group of 92 children for whom specimens were not available or had insufficient tissue (35±5 percent) or the 24 with specimens that could not be assessed for p53 expression (42±10 percent, P=0.7).
Expression of p53 and Outcome
Of 115 assessable tumors, 74 showed little or no expression of p53, whereas 41 showed overexpression, with dense p53 immunoreactivity in more than 25 percent of cells (Figure 1AFigure 1
Immunohistochemical Analysis of p53 and the Rate of Progression-free Survival According to the Levels of p53 Expression.). A striking difference in outcome between these two groups was apparent. The rate of progression-free survival at five years was 44±6 percent in the group of 74 patients whose tumors expressed low levels of p53 and 17±6 percent in the 41 patients whose tumors overexpressed p53 (P<0.001) (Figure 1B). A strong inverse association between the level of expression of p53 and overall survival was also observed (Table 1Table 1
Rates of Progression-free and Overall Survival as a Function of p53 Status.).TP53 Mutations and Outcome
Of 121 assessable tumors, 40 (33.1 percent) had a mutation in exons 5 through 8 of TP53. The presence of such a mutation was associated with an adverse prognosis, although this association did not reach statistical significance (Table 1). Table 1 also shows that among the 88 patients with tumors that could be assessed for both expression of p53 and mutations in TP53, 41 with tumors that had neither overexpression of p53 nor a mutation in TP53 had a rate of progression-free survival at five years of 46±8 percent, whereas 13 with tumors that had both a mutation in TP53 and overexpression of p53 had a rate of progression-free survival at five years of only 8±7 percent (P=0.004) (Figure 2Figure 2
Relation of Mutations in TP53 and Overexpression of p53 to Outcome in Children with High-Grade Gliomas.). The outcome was intermediate in the 20 patients whose tumors overexpressed p53 but had no detectable mutations (Table 1 and Figure 1) (P for trend, <0.001).Although overexpression of p53 was more common in tumors classified as glioblastomas (58 percent) than in anaplastic astrocytomas (26 percent) or other eligible grade III gliomas (21 percent, P<0.002 according to the χ2 test), the association between overexpression of p53 and adverse outcome remained after stratification according to histologic subtypes (P=0.005) (Table 2Table 2
Rates of Progression-free and Overall Survival as a Function of the Level of Expression of p53, with Stratification According to the Histopathological Diagnosis Made at Each Institution.). Stratification for age, the extent of resection, the location of the tumor, and other variables did not diminish the association between overexpression of p53 and outcome (P<0.001, according to the stratified log-rank test) (Table 3Table 3
Progression-free Survival as a Function of the Level of Expression of p53, with Stratification According to Characteristics of the Patients.).Analysis Based on Central Review of the Histopathological Findings
Inclusion in the original clinical study was based on the histopathological diagnosis made at each institution, but the criteria for classifying pediatric malignant gliomas have since evolved and include additional guidelines for distinguishing aggressive-appearing low-grade gliomas from high-grade gliomas.9 Samples from all tumors we analyzed were independently reviewed by a senior pediatric neuropathologist, who was unaware of the clinical outcome or the results of p53 analysis, with the use of current guidelines from the World Health Organization9 to ensure both consistency and stringency in the classification process.
Notwithstanding the elimination of 34 patients for whom the diagnosis could not be confirmed by central review, there was still a strong association between p53 status and outcome in the remaining patients. The rate of progression-free survival at five years was 32±7 percent in the group of 44 patients whose tumors did not overexpress p53 and 14±6 percent in the 37 whose tumors did overexpress p53 (P=0.01). This association was maintained in an analysis stratified according to the histologic features of the tumor (P=0.03). The 13 patients whose tumors showed both overexpression of p53 and mutations in TP53 had a rate of progression-free survival at five years of 8±7 percent, as compared with 32±9 percent in the 25 patients whose tumors lacked either feature, 33±19 percent in the 6 that had mutations but no overexpression, and 24±10 percent in the 17 that had p53 overexpression without TP53 mutations (P for trend=0.06).
Discussion
Because p53-dependent pathways influence the cytotoxic effects of conventional chemotherapy and radiotherapy,43-46 we investigated whether there is an association between the expression of p53 and outcome in children with malignant gliomas, as has been observed in several cancers that affect adults.47-51
We found increased expression of p53 in about 35 percent of high-grade gliomas in children and determined that this feature was an adverse prognostic factor in a cohort of children who were treated uniformly with surgery, radiotherapy, and chemotherapy. The frequency of TP53 mutations was greater than in previous series of gliomas in children52-54 and more in line with the frequency of such mutations in the secondary malignant gliomas that affect young adults.15,16,53 The true frequency of TP53 mutations in malignant gliomas in children may be even greater, because we did not examine all regions of the gene. Overexpression of p53, which is often used as a surrogate indicator of alterations in p53 functional status, may occur for reasons other than a mutation in TP53.51,55 Whatever the mechanism, however, this phenomenon was associated with an extremely adverse outcome. The frequency of overexpression of p53 increased significantly with increasing tumor grade (i.e., grade IV vs. grade III), suggesting that dysregulation of p53-mediated pathways might be an important step in the malignant progression of these tumors.
The strong association between overexpression of p53 and poor outcome contrasts with the lack of such an association in previous studies of malignant gliomas in adults.56,57 This discrepancy suggests that primary malignant gliomas in children and adults have different distributions of molecular lesions. One example is that pediatric glioblastomas infrequently show amplification of EGFR, 24,26,27 which is a common feature in primary glioblastomas in adults.10,12-15,17,18,21-23 Although the high frequency of overexpression of p53 in pediatric malignant gliomas resembles the pattern seen in secondary malignant gliomas in adults, which develop from previously low-grade gliomas, it is important to emphasize that low-grade gliomas in children rarely undergo spontaneous progression to malignant gliomas.1 Accordingly, malignant gliomas in children and secondary malignant gliomas in adults probably have different molecular defects. In addition, pediatric malignant gliomas may well consist of distinct molecular subgroups. As previously noted by our group, TP53 mutations are significantly less common in malignant gliomas in children younger than three years of age than in tumors in older children.25,58
Our study was distinguished by its large size and consistent management.30 This combination increased the chance of identifying molecular features that might have an overriding influence on prognosis. The fact that both chemotherapy and radiotherapy were used may have influenced the magnitude of the prognostic associations, because the efficacy of both types of treatment may have been affected by p53 status. The observation that the independent prognostic association between overexpression of p53 and outcome was apparent regardless of whether the histologic classification was performed by central review or by the institutional pathologist supports the view that p53 is a useful marker in both settings.
Although our observations indicate that p53 status is an important prognostic marker in pediatric malignant gliomas, it did not distinguish high-grade gliomas with a good prognosis from those with a poor prognosis. Instead, it distinguished children with high-grade gliomas who had an extremely unfavorable prognosis after treatment from those with a significantly more favorable, but still suboptimal, prognosis. For this reason, our observation does not support reduction of therapy in patients with a favorable p53 status. It shows, however, that the prognosis in children with malignant gliomas can be influenced by molecular changes in the tumor. We believe that molecular analyses should be included in prospective evaluations of novel treatments, particularly those that incorporate intensification of chemotherapy and radiotherapy.
Supported in part by grants from the Copeland Fund of the Pittsburgh Foundation (to Dr. Pollack), the National Institutes of Health (NS01810 and NS37704, to Dr. Pollack; CA21765, to Dr. Boyett; and CA13539, to the Children's Cancer Group), and the American Lebanese Syrian Associated Charities (to Dr. Boyett).
Source Information
From the Departments of Neurosurgery (I.F.P.) and Pathology (S.D.F., J.W., J.B., R.L.H.), University of Pittsburgh Medical Center and Children's Hospital of Pittsburgh, Pittsburgh; the Children's Oncology Group, Arcadia, Calif. (E.J.H.); the Department of Pathology, Ohio State University, Columbus (A.J.Y.); the Department of Biostatistics, St. Jude Children's Research Hospital, Memphis, Tenn. (J.M.B.); the Department of Pediatrics, New York University Medical Center, New York (J.L.F.); and the Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles (R.S.).
Address reprint requests to Dr. Pollack at the Department of Neurosurgery, Children's Hospital of Pittsburgh, 3705 Fifth Ave., Pittsburgh, PA 15213, or at pollaci@chplink.chp.edu.
- References
References
1
Pollack IF . Brain tumors in children. N Engl J Med 1994;331:1500-1507
Full Text | Web of Science | Medline2
Young JL Jr ,Miller RW . Incidence of malignant tumors in U.S. children. J Pediatr 1975;86:254-258
CrossRef | Web of Science | Medline3
Devaux BC ,O'Fallon JR ,Kelly PJ . Resection, biopsy, and survival in malignant glial neoplasms: a retrospective study of clinical parameters, therapy, and outcome. J Neurosurg 1993;78:767-775
CrossRef | Web of Science | Medline4
Nazzaro JM ,Neuwelt EA . The role of surgery in the management of supratentorial intermediate and high-grade astrocytomas in adults. J Neurosurg 1990;73:331-344
CrossRef | Web of Science | Medline5
Chandler KL ,Prados MD ,Malec M ,Wilson CB . Long-term survival in patients with glioblastoma multiforme. Neurosurgery 1993;32:716-720
CrossRef | Web of Science | Medline6
Salcman M ,Scholtz H ,Kaplan RS ,Kulik S . Long-term survival in patients with malignant astrocytoma. Neurosurgery 1994;34:213-220
CrossRef | Web of Science | Medline7
Salford LG ,Brun A ,Nirfalk S . Ten-year survival among patients with supratentorial astrocytomas grade III and IV. J Neurosurg 1988;69:506-509
CrossRef | Web of Science | Medline8
Campbell JW ,Pollack IF ,Martinez AJ ,Shultz BL . High-grade astrocytomas in children: radiologically complete resection is associated with an excellent long-term prognosis. Neurosurgery 1996;38:258-264
CrossRef | Web of Science | Medline9
Kleihues P, Burger PC, Scheithauer BW. Histological typing of tumours of the central nervous system. In: Sobin LH, ed. International histological classification of tumours. 2nd ed. Vol. 21. Geneva: Springer-Verlag, 1993:11-7.
10
Louis DN . A molecular genetic model of astrocytoma histopathology. Brain Pathol 1997;7:755-764
CrossRef | Web of Science | Medline11
He J ,Olson JJ ,James CD . Lack of p16INK4 or retinoblastoma protein (pRb), or amplification-associated overexpression of cdk4 is observed in distinct subsets of malignant glial tumors and cell lines. Cancer Res 1995;55:4833-4836
Web of Science | Medline12
von Deimling A ,von Ammon K ,Schoenfeld D ,Wiestler OD ,Seizinger BR ,Louis DN . Subsets of glioblastoma multiforme defined by molecular genetic analysis. Brain Pathol 1993;3:19-26
CrossRef | Web of Science | Medline13
Lang FF ,Miller DC ,Koslow M ,Newcomb EW . Pathways leading to glioblastoma multiforme: a molecular analysis of genetic alterations in 65 astrocytic tumors. J Neurosurg 1994;81:427-436
CrossRef | Web of Science | Medline14
Galanis E ,Buckner J ,Kimmel D , et al. Gene amplification as a prognostic factor in primary and secondary high-grade malignant gliomas. Int J Oncol 1998;13:717-724
Web of Science | Medline15
Watanabe K ,Tachibana O ,Sata K ,Yonekawa Y ,Kleihues P ,Ohgaki H . Overexpression of the EGF receptor and p53 mutations are mutually exclusive in the evolution of primary and secondary glioblastomas. Brain Pathol 1996;6:217-224
CrossRef | Web of Science | Medline16
Ichimura K ,Bolin MB ,Goike HM ,Schmidt EE ,Moshref A ,Collins VP . Deregulation of the p14ARF/MDM2/p53 pathway is a prerequisite for human astrocytic gliomas with G1-S transition control gene abnormalities. Cancer Res 2000;60:417-424
Web of Science | Medline17
James CD ,Carlbom E ,Dumanski JP , et al. Clonal genomic alterations in glioma malignancy stages. Cancer Res 1988;48:5546-5551
Web of Science | Medline18
Ichimura K ,Schmidt EE ,Miyakawa A ,Goike HM ,Collins VP . Distinct patterns of deletion on 10p and 10q suggest involvement of multiple tumor suppressor genes in the development of astrocytic gliomas of different malignancy grades. Genes Chromosomes Cancer 1998;22:9-15
CrossRef | Web of Science | Medline19
Fults D ,Pedone C . Deletion mapping of the long arm of chromosome 10 in glioblastoma multiforme. Genes Chromosomes Cancer 1993;7:173-177
CrossRef | Web of Science | Medline20
Rasheed BK ,McLendon RE ,Friedman HS , et al. Chromosome 10 deletion mapping in human gliomas: a common deletion region in 10q25. Oncogene 1995;10:2243-2246
Web of Science | Medline21
Liu W ,James CD ,Frederick L ,Alderete BE ,Jenkins RB . PTEN/MMAC1 mutations and EGFR amplification in glioblastomas. Cancer Res 1997;57:5254-5257
Web of Science | Medline22
Li J ,Yen C ,Liaw D , et al. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 1997;275:1943-1947
CrossRef | Web of Science | Medline23
Collins VP . Progression as exemplified by human astrocytic tumors. Semin Cancer Biol 1999;9:267-276
CrossRef | Web of Science | Medline24
Bredel M ,Pollack IF ,Hamilton RL ,James CD . Epidermal growth factor receptor expression and gene amplification in high-grade non-brainstem gliomas of childhood. Clin Cancer Res 1999;5:1786-1792
Web of Science | Medline25
Pollack IF ,Hamilton RL ,Finkelstein SD , et al. The relationship between TP53 mutations and overexpression of p53 and prognosis in malignant gliomas of childhood. Cancer Res 1997;57:304-309
Web of Science | Medline26
Raffel C ,Frederick L ,O'Fallon JR , et al. Analysis of oncogene and tumor suppressor gene alterations in pediatric malignant astrocytomas reveals reduced survival for patients with PTEN mutations. Clin Cancer Res 1999;5:4085-4090
Web of Science | Medline27
Sung T ,Miller DC ,Hayes RL ,Alonso M ,Yee H ,Newcomb EW . Preferential inactivation of the p53 tumor suppressor pathway and lack of EGFR amplification distinguish de novo high grade pediatric astrocytomas from de novo adult astrocytomas. Brain Pathol 2000;10:249-259
CrossRef | Web of Science | Medline28
Newcomb EW ,Alonso M ,Sung T ,Miller DC . Incidence of p14ARF gene deletion in high-grade adult and pediatric astrocytomas. Hum Pathol 2000;31:115-119
CrossRef | Web of Science | Medline29
Sure U ,Ruedi D ,Tachibana O , et al. Determination of p53 mutations, EGFR overexpression, and loss of p16 expression in pediatric glioblastomas. J Neuropathol Exp Neurol 1997;56:782-789
Web of Science | Medline30
Finlay JL ,Boyett JM ,Yates AJ , et al. Randomized phase III trial in childhood high-grade astrocytoma comparing vincristine, lomustine, and prednisone with the eight-drugs-in-1-day regimen. J Clin Oncol 1995;13:112-123
Web of Science | Medline31
Sposto R ,Ertel IJ ,Jenkin RDT , et al. The effectiveness of chemotherapy for treatment of high grade astrocytoma in children: results of a randomized trial: a report from the Children's Cancer Study Group. J Neurooncol 1989;7:165-177
CrossRef | Web of Science | Medline32
Fults D ,Brockmeyer D ,Tullous MW ,Pedone CA ,Cawthon RM . p53 Mutation and loss of heterozygosity on chromosomes 17 and 10 during human astrocytoma progression. Cancer Res 1992;52:674-679
Web of Science | Medline33
Hollstein M ,Sidransky D ,Vogelstein B ,Harris CC . p53 Mutations in human cancers. Science 1991;253:49-53
CrossRef | Web of Science | Medline34
Wu T-T ,Barnes L ,Bakker A ,Swalsky PA ,Finkelstein SD . K-ras-2 and p53 genotyping of intestinal-type adenocarcinoma of the nasal cavity and paranasal sinuses. Mod Pathol 1996;9:199-204
Web of Science | Medline35
Kim SH ,Godfrey T ,Jensen RH . Whole genome amplification and molecular genetic analysis of DNA from paraffin-embedded prostate adenocarcinoma tumor tissue. J Urol 1999;162:1512-1518
CrossRef | Web of Science | Medline36
Finkelstein SD ,Sayegh R ,Christensen S ,Swalsky PA . Genotypic classification of colorectal adenocarcinoma: biologic behavior correlates with K-ras-2 mutation type. Cancer 1993;71:3827-3838
CrossRef | Web of Science | Medline37
Shi SR ,Key ME ,Kalra KL . Antigen retrieval in formalin-fixed, paraffin-embedded tissues: an enhancement method for immunohistochemical staining based on microwave oven heating of tissue sections. J Histochem Cytochem 1991;39:741-748
CrossRef | Web of Science | Medline38
Vojtesek B ,Bartek J ,Midgley CA ,Lane DP . An immunochemical analysis of the human nuclear phosphoprotein p53: new monoclonal antibodies and epitope mapping using recombinant p53. J Immunol Methods 1992;151:237-244
CrossRef | Web of Science | Medline39
Hsu S ,Raine L ,Fanger H . Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem 1981;29:577-580
CrossRef | Web of Science | Medline40
Boyett JM ,Yates AJ ,Gilles FH , et al. When is a high-grade astrocytoma (HGA) not a HGA? Results of a central review of 226 cases of anaplastic astrocytoma (AA), glioblastoma multiforme (GBM), and other-HGA (Oth-HGA) by five neuropathologists. Prog Proc Am Soc Clin Oncol 1998;17:526a-526a abstract.41
Kalbfleisch JD, Prentice RL. The statistical analysis of failure time data. New York: John Wiley, 1980.
42
Dixon WJ, Massey FJ Jr. Introduction to statistical analysis. 3rd ed. New York: McGraw-Hill, 1969.
43
Brown JM ,Wouters BG . Apoptosis, p53, and tumor cell sensitivity to anticancer agents. Cancer Res 1999;59:1391-1399
Web of Science | Medline44
Rich T ,Allen RL ,Wyllie AH . Defying death after DNA damage. Nature 2000;407:777-783
CrossRef | Web of Science | Medline45
Kinzler KW ,Vogelstein B . Cancer therapy meets p53. N Engl J Med 1994;331:49-50
Full Text | Web of Science | Medline46
Lowe S ,Bodis S ,McClatchey A , et al. p53 Status and the efficacy of cancer therapy in vivo. Science 1994;266:807-810
CrossRef | Web of Science | Medline47
Rusch V ,Klimstra D ,Venkatraman E , et al. Aberrant p53 expression predicts clinical resistance to cisplatin-based chemotherapy in locally advanced non-small cell lung cancer. Cancer Res 1995;55:5038-5042
Web of Science | Medline48
Esrig D ,Elmajian D ,Groshen S , et al. Accumulation of nuclear p53 and tumor progression in bladder cancer. N Engl J Med 1994;331:1259-1264
Full Text | Web of Science | Medline49
Harris CC ,Hollstein M . Clinical implications of the p53 tumor-suppressor gene. N Engl J Med 1993;329:1318-1327
Full Text | Web of Science | Medline50
Goh H-S ,Yao J ,Smith DR . p53 Point mutation and survival in colorectal cancer patients. Cancer Res 1995;55:5217-5221
Web of Science | Medline51
Quinn DI ,Henshall SM ,Head DR , et al. Prognostic significance of p53 nuclear accumulation in localized prostate cancer treated with radical prostatectomy. Cancer Res 2000;60:1585-1594
Web of Science | Medline52
Litofsky NS ,Hinton D ,Raffel C . The lack of a role of p53 in astrocytomas in pediatric patients. Neurosurgery 1994;34:967-973
CrossRef | Web of Science | Medline53
Rasheed BKA ,McLendon RE ,Herndon JE , et al. Alterations of the TP53 gene in human gliomas. Cancer Res 1994;54:1324-1330
Web of Science | Medline54
Lang FF ,Miller DC ,Pisharody S ,Koslow M ,Newcomb EW . High frequency of p53 protein accumulation without p53 gene mutation in human juvenile pilocytic, low grade, and anaplastic astrocytomas. Oncogene 1994;9:949-954
Web of Science | Medline55
Giaccia AJ ,Kastan MB . The complexity of p53 modulation: emerging patterns from divergent signals. Genes Dev 1998;12:2973-2983
CrossRef | Web of Science | Medline56
Cunningham JM ,Kimmel DW ,Scheithauer BW ,O'Fallon JR ,Novotny PJ ,Jenkins RB . Analysis of proliferation markers and p53 expression in gliomas of astrocytic origin: relationships and prognostic value. J Neurosurg 1997;86:121-130
CrossRef | Web of Science | Medline57
Danks RA ,Chopra G ,Gonzales MF ,Orian JM ,Kaye AH . Aberrant p53 expression does not correlate with the prognosis in anaplastic astrocytoma. Neurosurgery 1995;37:246-254
CrossRef | Web of Science | Medline58
Pollack IF ,Finkelstein SD ,Burnham J , et al. Age and TP53 mutation frequency in childhood malignant gliomas: results in a multi-institutional cohort. Cancer Res 2001;61:2404-2407
Web of Science | Medline
- Citing Articles (69)
Citing Articles
1
Soumen Khatua, Zsila Sousan Sadighi, Michael L. Pearlman, Sunil Bochare, Tribhawan S. Vats. (2012) Brain Tumors in Children- Current Therapies and Newer Directions. The Indian Journal of Pediatrics
CrossRef2
Ian F. Pollack. 2012. Ataxia resulting from posterior fossa tumors of childhood and other mass lesions. , 161-173.
CrossRef3
Anita Villani, David Malkin, Uri Tabori. (2011) Syndromes Predisposing to Pediatric Central Nervous System Tumors: Lessons Learned and New Promises. Current Neurology and Neuroscience Reports
CrossRef4
T. J. MacDonald, D. Aguilera, C. M. Kramm. (2011) Treatment of high-grade glioma in children and adolescents. Neuro-Oncology 13:10, 1049-1058
CrossRef5
José Javier Otero, David Rowitch, Scott Vandenberg. (2011) OLIG2 is differentially expressed in pediatric astrocytic and in ependymal neoplasms. Journal of Neuro-Oncology 104:2, 423-438
CrossRef6
Ian F. Pollack. (2011) Multidisciplinary management of childhood brain tumors: a review of outcomes, recent advances, and challenges. Journal of Neurosurgery: Pediatrics 8:2, 135-148
CrossRef7
Ian F. Pollack, Regina I. Jakacki. (2011) Childhood brain tumors: epidemiology, current management and future directions. Nature Reviews Neurology 7:9, 495-506
CrossRef8
David A. Hinkle, Steven J. Mullett, Bethann E. Gabris, Ronald L. Hamilton. (2011) DJ-1 expression in glioblastomas shows positive correlation with p53 expression and negative correlation with epidermal growth factor receptor amplification. Neuropathology 31:1, 29-37
CrossRef9
, Ian F. Pollack, Ronald L. Hamilton, Robert W. Sobol, Marina N. Nikiforova, Maureen A. Lyons-Weiler, William A. LaFramboise, Peter C. Burger, Daniel J. Brat, Marc K. Rosenblum, Emiko J. Holmes, Tianni Zhou, Regina I. Jakacki. (2011) IDH1 mutations are common in malignant gliomas arising in adolescents: a report from the Children’s Oncology Group. Child's Nervous System 27:1, 87-94
CrossRef10
Ian F. Pollack, Ronald L. Hamilton, Robert W. Sobol, Marina N. Nikiforova, Yuri E. Nikiforov, Maureen A. Lyons-Weiler, William A. LaFramboise, Peter C. Burger, Daniel J. Brat, Marc K. Rosenblum, Floyd H. Gilles, Allan J. Yates, Tianni Zhou, Kenneth J. Cohen, Jonathan L. Finlay, Regina I. Jakacki. (2010) Mismatch repair deficiency is an uncommon mechanism of alkylator resistance in pediatric malignant gliomas: A report from the children's oncology group. Pediatric Blood & Cancer 55:6, 1066-1071
CrossRef11
Arti Srivastava, Ayushi Jain, Prerana Jha, Vaishali Suri, Mehar Chand Sharma, Supriya Mallick, Tarun Puri, Deepak Kumar Gupta, Aditya Gupta, Chitra Sarkar. (2010) MGMT gene promoter methylation in pediatric glioblastomas. Child's Nervous System 26:11, 1613-1618
CrossRef12
S. Sharma, A. Free, Y. Mei, S.C. Peiper, Z. Wang, J.K. Cowell. (2010) Distinct molecular signatures in pediatric infratentorial glioblastomas defined by aCGH. Experimental and Molecular Pathology 89:2, 169-174
CrossRef13
Ian F. Pollack. 2010. Low- and High-Grade Glioma. , 7-23.
CrossRef14
Manila Antonelli, Francesca Romana Buttarelli, Antonietta Arcella, Sumihito Nobusawa, Vittoria Donofrio, Hiroko Oghaki, Felice Giangaspero. (2010) Prognostic significance of histological grading, p53 status, YKL-40 expression, and IDH1 mutations in pediatric high-grade gliomas. Journal of Neuro-Oncology 99:2, 209-215
CrossRef15
, Ian F. Pollack, Ronald L. Hamilton, Peter C. Burger, Daniel J. Brat, Marc K. Rosenblum, Geoffrey H. Murdoch, Marina N. Nikiforova, Emiko J. Holmes, Tianni Zhou, Kenneth J. Cohen, Regina I. Jakacki. (2010) Akt activation is a common event in pediatric malignant gliomas and a potential adverse prognostic marker: a report from the Children’s Oncology Group. Journal of Neuro-Oncology 99:2, 155-163
CrossRef16
Christopher Dunham. (2010) Pediatric brain tumors: a histologic and genetic update on commonly encountered entities. Seminars in Diagnostic Pathology 27:3, 147-159
CrossRef17
M. J. Dougherty, M. Santi, M. S. Brose, C. Ma, A. C. Resnick, A. J. Sievert, P. B. Storm, J. A. Biegel. (2010) Activating mutations in BRAF characterize a spectrum of pediatric low-grade gliomas. Neuro-Oncology 12:7, 621-630
CrossRef18
Craig Horbinski, Ronald L. Hamilton, Yuri Nikiforov, Ian F. Pollack. (2010) Association of molecular alterations, including BRAF, with biology and outcome in pilocytic astrocytomas. Acta Neuropathologica 119:5, 641-649
CrossRef19
Roger J. Packer, Tobey MacDonald, Gilbert Vezina. (2010) Central Nervous System Tumors. Hematology/Oncology Clinics of North America 24:1, 87-108
CrossRef20
Johannes E.A. Wolff, Pablo Hernaiz Driever, Bernhard Erdlenbruch, Rolf D. Kortmann, Stefan Rutkowski, Torsten Pietsch, Crystal Parker, Monica Warmuth Metz, Astrid Gnekow, Christof M. Kramm. (2010) Intensive chemotherapy improves survival in pediatric high-grade glioma after gross total resection: results of the HIT-GBM-C protocol. Cancer 116:3, 705-712
CrossRef21
Jessie Zhong, Andre Paul, Stewart J. Kellie, Geraldine M. O'Neill. (2010) Mesenchymal Migration as a Therapeutic Target in Glioblastoma. Journal of Oncology 2010, 1-17
CrossRef22
Kristophe J. Karami, Janet Poulik, Raja Rabah, Joshua Krass, Sandeep Sood. (2010) Simultaneous choroid plexus carcinoma and pilocytic astrocytoma in a pediatric patient. Journal of Neurosurgery: Pediatrics 5:1, 104-112
CrossRef23
Angela J. Sievert, Eric M. Jackson, Xiaowu Gai, Hakon Hakonarson, Alexander R. Judkins, Adam C. Resnick, Leslie N. Sutton, Phillip B. Storm, Tamim H. Shaikh, Jaclyn A. Biegel. (2009) Duplication of 7q34 in Pediatric Low-Grade Astrocytomas Detected by High-Density Single-Nucleotide Polymorphism-Based Genotype Arrays Results in a Novel BRAF Fusion Gene. Brain Pathology 19:3, 449-458
CrossRef24
Sabine Mueller, Susan Chang. (2009) Pediatric brain tumors: Current treatment strategies and future therapeutic approaches. Neurotherapeutics 6:3, 570-586
CrossRef25
Wei-Ying Yue, Su-Huan Yu, Shi-Guang Zhao, Zhong-Ping Chen. (2009) Molecular markers relating to malignant progression in Grade II astrocytoma. Journal of Neurosurgery 110:4, 709-714
CrossRef26
Abdul-Zaher M. Khattab, Magdy I. Ahmed, Mohamed A. Fouad, Waleed A. Essa. (2009) Significance of p53 and CD31 in astrogliomas. Medical Oncology 26:1, 86-92
CrossRef27
V. Vladimirova, D. Denkhaus, N. Soerensen, S. Wagner, J. E. A. Wolff, T. Pietsch. (2008) Low level of microsatellite instability in paediatric malignant astrocytomas. Neuropathology and Applied Neurobiology 34:5, 547-554
CrossRef28
Takaaki Yanagisawa, Ute Bartels, Eric Bouffet. (2008) Role of Prognostic Factors in the Management of Pediatric Solid Tumors. Annals of the New York Academy of Sciences 1138:1, 32-42
CrossRef29
Shaker Abdullah, Ibrahim Qaddoumi, Eric Bouffet. (2008) Advances in the Management of Pediatric Central Nervous System Tumors. Annals of the New York Academy of Sciences 1138:1, 22-31
CrossRef30
Muh-Lii Liang, Jing Ma, Michael Ho, Lauren Solomon, Eric Bouffet, James T. Rutka, Cynthia Hawkins. (2008) Tyrosine kinase expression in pediatric high grade astrocytoma. Journal of Neuro-Oncology 87:3, 247-253
CrossRef31
Dorothee Wiewrodt, Georg Nagel, Nadine Dreimüller, Thomas Hundsberger, Axel Perneczky, Bernd Kaina. (2008) MGMT in primary and recurrent human glioblastomas after radiation and chemotherapy and comparison with p53 status and clinical outcome. International Journal of Cancer 122:6, 1391-1399
CrossRef32
Roger J. Packer, Tobey MacDonald, Gilbert Vezina. (2008) Central Nervous System Tumors. Pediatric Clinics of North America 55:1, 121-145
CrossRef33
Lewis C. Hou, Simon R. Bababeygy, Vahe Sarkissian, Paul G. Fisher, Hannes Vogel, Patrick Barnes, Stephen L. Huhn. (2008) Congenital Glioblastoma Multiforme: Case Report and Review of the Literature. Pediatric Neurosurgery 44:4, 304-312
CrossRef34
Friederike Blankenburg, Frank K. H. van Landeghem, Michail Plotkin, Günter Henze, Andreas von Deimling, Pablo Hernáiz Driever. (2007) Occurrence of a Spinal Anaplastic Pilocytic Astrocytoma and a Supratentorial PNET in an Adolescent. Journal of Pediatric Hematology/Oncology 29:12, 832-835
CrossRef35
Esther P. Jane, Daniel R. Premkumar, Ian F. Pollack. (2007) AG490 influences UCN-01-induced cytotoxicity in Glioma cells in a p53-dependent fashion, correlating with effects on BAX cleavage and BAD phosphorylation. Cancer Letters 257:1, 36-46
CrossRef36
Aaron J. Clark, Wagner G. Dos Santos, Jessica Mccready, Mike Y. Chen, Timothy E. Van Meter, Joy L. Ware, Sharon B. Wolber, Helen Fillmore, William C. Broaddus. (2007) Wilms tumor 1 expression in malignant gliomas and correlation of +KTS isoforms with p53 status. Journal of Neurosurgery 107:3, 586-592
CrossRef37
Darren R Hargrave, Stergios Zacharoulis. (2007) Pediatric CNS tumors: current treatment and future directions. Expert Review of Neurotherapeutics 7:8, 1029-1042
CrossRef38
Daniel J. Brat, Bahig M. Shehata, Amilcar A. Castellano-Sanchez, Cynthia Hawkins, Robert B. Yost, Claudia Greco, Claire Mazewski, Anna Janss, Hiroko Ohgaki, Arie Perry. (2007) Congenital Glioblastoma: A Clinicopathologic and Genetic Analysis. Brain Pathology 17:3, 276-281
CrossRef39
Sucheta J. Vaidya, Darren Hargrave, Frank Saran, Juliet Britton, Rubin Soomal, Eric Bouffet. (2007) Pattern of recurrence in paediatric malignant glioma: an institutional experience. Journal of Neuro-Oncology 83:3, 279-284
CrossRef40
Douglas J. Hyder, Lillian Sung, Ian F. Pollack, Floyd H. Gilles, Allen J. Yates, Richard L. Davis, James M. Boyett, Jonathan L. Finlay. (2007) Anaplastic mixed gliomas and anaplastic oligodendroglioma in children: results from the CCG 945 experience. Journal of Neuro-Oncology 83:1, 1-8
CrossRef41
Roberto Rivera-Luna, Marta Zapata-Tarrés, Aurora Medina-Sansón, Enrique López-Aguilar, Ana Niembro-Zúñiga, J. Amador Zarco, Alfonso Marhx-Bracho, Fernando Rueda-Franco, Leticia Bornstein-Quevedo. (2007) Long-term survival in children under 3 years of age with low-grade astrocytoma. Child's Nervous System 23:5, 543-547
CrossRef42
C. Haberler, I. Slavc, T. Czech, D. Prayer, C. Pirker, H. Budka, J. A. Hainfellner. (2007) Malignant predominantly minigemistocytic glioma in two infants: a distinctive glioma variant?. Neuropathology and Applied Neurobiology 33:2, 169-178
CrossRef43
Carla Fernandez, André Maues de Paula, Carole Colin, Benoît Quilichini, Corinne Bouvier-Labit, Nadine Girard, Didier Scavarda, Gabriel Lena, Dominique Figarella-Branger. (2006) Thalamic gliomas in children: an extensive clinical, neuroradiological and pathological study of 14 cases. Child's Nervous System 22:12, 1603-1610
CrossRef44
Ian F. Pollack, Ronald L. Hamilton, C. David James, Sydney D. Finkelstein, Judith Burnham, Allan J. Yates, Emiko J. Holmes, Tianni Zhou, Jonathan L. Finlay. (2006) Rarity of PTEN deletions and EGFR amplification in malignant gliomas of childhood: results from the Children’s Cancer Group 945 cohort. Journal of Neurosurgery: Pediatrics 105:5, 418-424
CrossRef45
B.K. Kleinschmidt-DeMasters, Lynne Meltesen, Loris McGavran, Kevin O. Lillehei. (2006) Characterization of Glioblastomas in Young Adults. Brain Pathology 16:4, 273-286
CrossRef46
Mahmoud R. Hussein, Rabab M. H. El-Ghorori, Yasser G. Abd El-Rahman. (2006) Alterations of p53, BCL-2, and hMSH2 protein expression in the normal brain tissues, gliosis, and gliomas. International Journal of Experimental Pathology 87:4, 297-306
CrossRef47
Maura Massimino, Veronica Biassoni. (2006) Use of high-dose chemotherapy in front-line therapy of childhood malignant glioma. Expert Review of Anticancer Therapy 6:5, 709-717
CrossRef48
Patricia L. Robertson. (2006) Advances in treatment of pediatric brain tumors. NeuroRX 3:2, 276-291
CrossRef49
Maria Luisa Garre’, Armando Cama, Claudia Milanaccio, Lorenza Gandola, Maura Massimino, Sandro Dallorso. (2006) New concepts in the treatment of brain tumors in very young children. Expert Review of Neurotherapeutics 6:4, 489-500
CrossRef50
David T. TSE, Sydney D. Finkelstein, Pasquale Benedetto, Sander Dubovy, Joyce Schiffman, William J. Feuer. (2006) Microdissection Genotyping Analysis of the Effect of Intraarterial Cytoreductive Chemotherapy in the Treatment of Lacrimal Gland Adenoid Cystic Carcinoma. American Journal of Ophthalmology 141:1, 54-61.e1
CrossRef51
Alberto Broniscer. (2006) Past, Present, and Future Strategies in the Treatment of High-Grade Glioma in Children. Cancer Investigation 24:1, 77-81
CrossRef52
Patricia L. Robertson. (2006) Advances in treatment of pediatric brain tumors. Neurotherapeutics 3:2, 276
CrossRef53
Ian D. Kamaly-Asl, Navid Shams, Michael D. Taylor. (2006) Genetics of choroid plexus tumors. Neurosurgical FOCUS 20:1, 1-3
CrossRef54
Brian R. Rood, Tobey J. MacDonald. (2005) Pediatric High-grade Glioma: Molecular Genetic Clues for Innovative Therapeutic Approaches. Journal of Neuro-Oncology 75:3, 267-272
CrossRef55
Jonathan L. Finlay, Stergios Zacharoulis. (2005) The Treatment of High Grade Gliomas and Diffuse Intrinsic Pontine Tumors of Childhood and Adolescence: A Historical – and Futuristic – Perspective. Journal of Neuro-Oncology 75:3, 253-266
CrossRef56
Andrey Korshunov, Regina Sycheva, Sergey Gorelyshev, Andrey Golanov. (2005) Clinical utility of fluorescence in situ hybridization (FISH) in nonbrainstem glioblastomas of childhood. Modern Pathology 18:9, 1258-1263
CrossRef57
Christine E Fuller, Arie Perry. (2005) Molecular Diagnostics in Central Nervous System Tumors. Advances in Anatomic Pathology 12:4, 180-194
CrossRef58
Christian H. Rickert, Werner Paulus. (2005) Prognosis-related histomorphological and immunohistochemical markers in central nervous system tumors of childhood and adolescence. Acta Neuropathologica 109:1, 69-92
CrossRef59
Jaclyn A. Biegel, Ian F. Pollack. (2004) Molecular analysis of pediatric brain tumors. Current Oncology Reports 6:6, 445-452
CrossRef60
Deepak Mohan, Sydney D Finkelstein, Patricia A Swalsky, Eizaburo Sasatomi, Clayton Wiley, Ronald L Hamilton, Frank Lieberman, Marta E Couce. (2004) Microdissection genotyping of gliomas: therapeutic and prognostic considerations. Modern Pathology 17:11, 1346-1358
CrossRef61
F S Pardo, D W Hsu, R Zeheb, J T Efird, P G Okunieff, D M Malkin. (2004) Mutant, wild type, or overall p53 expression: freedom from clinical progression in tumours of astrocytic lineage. British Journal of Cancer
CrossRef62
Mary Kara Bucci, Amit Maity, Anna J. Janss, Jean B. Belasco, Michael J. Fisher, Zelig A. Tochner, Lucy Rorke, Leslie N. Sutton, Peter C. Phillips, Hui-Kuo G. Shu. (2004) Near complete surgical resection predicts a favorable outcome in pediatric patients with nonbrainstem, malignant gliomas. Cancer 101:4, 817-824
CrossRef63
William A Weiss, Anu Banerjee. (2004) Can mouse models for brain tumors inform treatment in pediatric patients?. Seminars in Cancer Biology 14:1, 71-77
CrossRef64
Maryam Fouladi, Daniel L. Hunt, Ian F. Pollack, Gregor Dueckers, Peter C. Burger, Laurence E. Becker, Allen J. Yates, Floyd H. Gilles, Richard L. Davis, James M. Boyett, Jonathan L. Finlay. (2003) Outcome of children with centrally reviewed low-grade gliomas treated with chemotherapy with or without radiotherapy on Children's Cancer Group high-grade glioma study CCG-945. Cancer 98:6, 1243-1252
CrossRef65
Qingguo Yuan, Kenichi Matsumoto, Yusaku Nakabeppu, Toru Iwaki. (2003) A comparative immunohistochemistry of O6-methylguanine-DNA methyltransferase and p53 in diffusely infiltrating astrocytomas. Neuropathology 23:3, 203-209
CrossRef66
Francis J. Giles, B. Nebiyou Bekele, Susan O'Brien, Jorge E. Cortes, Srdan Verstovsek, Maria Balerdi, Marwan Yared, Xian Zhou, Hagop M. Kantarjian, Michael J. Keating, Peter Thall, Maher Albitar. (2003) A prognostic model for survival in chronic lymphocytic leukaemia based on p53 expression. British Journal of Haematology 121:4, 578-585
CrossRef67
Mandeep S. Tamber, James T. Rutka. (2003) Pediatric supratentorial high-grade gliomas. Neurosurgical FOCUS 14:2, 1-8
CrossRef68
Patrick Y. Wen, Peter M. Black, Jay S. Loeffler. 2003. Malignant Gliomas. , 1038-1048.
CrossRef69
Frank Saran. (2002) Recent advances in paediatric neuro-oncology. Current Opinion in Neurology 15:6, 671-677
CrossRef
