Original Article
Changes in Mitochondrial DNA as a Marker of Nucleoside Toxicity in HIV-Infected Patients
N Engl J Med 2002; 346:811-820March 14, 2002
- Abstract
Background
Nucleoside analogues can induce toxic effects on mitochondria by inhibiting the human DNA polymerase γ. The toxic effects can range from increased serum lactate levels to potentially fatal lactic acidosis. We studied changes in mitochondrial DNA relative to nuclear DNA in the peripheral-blood cells of patients with symptomatic, nucleoside-induced hyperlactatemia.
Methods
Total DNA was extracted from blood cells. A nuclear gene and a mitochondrial gene were quantified by real-time polymerase chain reaction. Three groups were studied: 24 controls not infected with the human immunodeficiency virus (HIV), 47 HIV-infected asymptomatic patients who had never been treated with antiretroviral drugs, and 8 HIV-infected patients who were receiving antiretroviral drugs and had symptomatic hyperlactatemia. The patients in the last group were studied longitudinally before, during, and after antiretroviral therapy.
Results
Symptomatic hyperlactatemia was associated with marked reductions in the ratios of mitochondrial to nuclear DNA, which, during therapy, averaged 68 percent lower than those of non–HIV-infected controls and 43 percent lower than those of HIV-infected asymptomatic patients never treated with antiretroviral drugs. After the discontinuation of antiretroviral therapy, there was a statistically significant increase in the ratio of mitochondrial to nuclear DNA (P=0.02). In the patients followed longitudinally, the decline in mitochondrial DNA preceded the increase in venous lactate levels.
Conclusions
Mitochondrial DNA levels are significantly decreased in patients with symptomatic, nucleoside-related hyperlactatemia, an effect that resolves on the discontinuation of therapy.
Media in This Article
Figure 4
Longitudinal Analysis of Venous Lactate Levels (Open Circles), mtDNA:nDNA Ratios (Solid Circles), and Antiretroviral-Drug Regimens (Bars) over Time in the Patients with Symptoms of Mitochondrial Toxicity.Figure 2
Levels of Agreement between Duplicate Measurements of the Nuclear Gene for the Human Polymerase γ Accessory Subunit (Panel A), the Mitochondrial Gene Human Cytochrome-c Oxidase Subunit I (Panel B), and the Ratio of Mitochondrial to Nuclear DNA (Panel C) Derived from Them.Article Activity
- Article
Nucleoside analogues that inhibit reverse transcriptase remain a cornerstone of antiretroviral therapy for human immunodeficiency virus (HIV) infection. These agents inhibit HIV replication but can also inhibit the human DNA polymerase γ1,2 and thereby replication of mitochondrial DNA, leading to depletion of mitochondrial DNA and drug toxicity.3-6 Mitochondrial toxicity is at least partially responsible for adverse effects such as lactic acidosis, hepatic steatosis, myopathy, cardiomyopathy, peripheral neuropathy,7 pancreatitis, and possibly the lipodystrophy syndrome.5,6,8-12 Treatment of other conditions, such as hepatitis or cancer, with nucleoside analogues can also result in mitochondrial toxicity.13,14
Early studies on zidovudine-induced myopathy found a decrease in total mitochondrial DNA in muscle-biopsy specimens.15-17 In vitro studies of various anti-HIV nucleoside analogues have also shown that they can cause a reduction in the mitochondrial content of human lymphoblastoid cells,18 CEM cells,19 and HepG2 cells.20 Mitochondrial toxicity leads to decreased oxidative phosphorylation, intracellular accumulation of lipids, and increases in lactic acid.3,21 Patients with hyperlactatemia due to mitochondrial toxicity may present with symptoms such as fatigue, shortness of breath, weight loss, lipid abnormalities, and hepatic steatosis. The syndrome of hyperlactatemia is now well known among HIV-infected patients receiving antiretroviral therapy, particularly in those receiving stavudine (d4T, or Zerit).22-25 Its presentation, severity, and frequency are distinct from those of lactic acidosis, which is a rare, acute, and potentially fatal adverse effect of nucleoside analogues.26-29 Whether chronic hyperlactatemia is a risk factor for progressive liver damage29 or lactic acidosis30 remains uncertain.
The gold standard for the diagnosis of nucleoside-related mitochondrial toxic effects is muscle or liver biopsy; however, biopsy is not practical for routine screening and monitoring. Random measurements of venous lactate have been used to monitor for mitochondrial damage,31,32 but the clinical usefulness of this method remains unclear. Lack of specificity is a problem, as is technical and physiologic variability.30
We describe a novel polymerase-chain-reaction (PCR) assay for mitochondrial DNA performed on samples of venous blood. We applied it to three groups of subjects: normal volunteers not infected with HIV, HIV-infected asymptomatic patients never treated with antiretroviral drugs, and HIV-infected patients with symptomatic, nucleoside-related hyperlactatemia. Finally, in the group of patients with hyperlactatemia, we quantified ratios of mitochondrial to nuclear DNA longitudinally before, during, and after the discontinuation of therapy.
Methods
Sample Collection and DNA Extraction
Samples consisted of buffy coats of peripheral venous blood that were collected in acid citrate dextrose and stored at –70°C until used. Plasma viral loads were measured by the Amplicor Ultra-Sensitive HIV-1 Monitor assay (Roche Molecular Systems, Branchburg, N.J.). Total DNA was extracted from 200 μl of sample with the QIAamp DNA Blood Mini kit (Qiagen, Mississauga, Ont., Canada). For the standard curves, similar samples were collected from 24 non–HIV-infected male volunteers, and the DNA was extracted and pooled. The nuclear-genome–equivalent content of the HIV-negative DNA pool was determined by calibration with the kit's control human DNA of known nuclear-genome–equivalent concentration (Roche Applied Science, Laval, Que.).
This study was approved by the research-ethics board of the University of British Columbia and Providence Health Care. All patients in the study provided written informed consent.
Quantitative Real-Time PCR
For each DNA extract, the nuclear gene for the human polymerase γ accessory subunit (ASPOLG) and the mitochondrial gene human cytochrome-c oxidase subunit I (CCOI) were quantified separately by real-time quantitative PCR (with the use of a Roche LightCycler). For the CCOI gene, the CCOI1F 5'TTCGCCGACCGTTGACTATT3' and CCOI2R 5'AAGATTATTACAAATGCATGGGC3' primers were used for the PCR amplification. The oligonucleotides 3'fluorescein–labeled CCOIPR1 5'GCCAGCCAGGCAACCTTCTAGG-F3' and 5'LC Red640–labeled CCOIPR2 5'L-AACGACCACATCTACAACGTTATCGTCAC-P3', the 3' end of the latter blocked with a phosphate molecule, were used as hybridization probes. For the nuclear DNA ASPOLG gene, the ASPG3F 5'GAGCTGTTGACGGAAAGGAG3' and ASPG4R 5'CAGAAGAGAATCCCGGCTAAG3' primers were used for the PCR, and the oligonucleotides 3'fluorescein–labeled ASPGPR1 5'GAGGCGCTGTTAGAGATCTGTCAGAGA-F3' and 5'LC Red640–labeled, 3'phosphate-blocked ASPGPR2 5'L-GGCATTTCCTAAGTGGAAGCAAGCA-P3' were used as hybridization probes.
The real-time PCR reactions were performed in duplicate for each gene with the LightCycler FastStart DNA Master Hybridization Probes kit (Roche Applied Science). The PCR reactions contained 5 mM magnesium chloride, 1.0 μM of each primer, 0.2 μM 3'fluorescein probe, 0.4 μM 5'LC Red640 probe, and 4 μl of a 1:10 dilution of the DNA extract in elution buffer. The PCR amplification consisted of a single denaturation–enzyme-activation step of 10 minutes at 95°C, followed by 45 cycles of 0 seconds at 95°C, 10 seconds at 60°C, and 5 seconds at 72°C, with a temperature-transition rate of 20°C per second. A single fluorescence acquisition was performed at the end of each annealing step. A standard curve of 30, 300, 3000, and 30,000 nuclear-genome equivalents was included in each run, and the same nuclear-genome equivalent values were used for both the nuclear (ASPOLG) and the mitochondrial (CCOI) gene quantifications.
The data were analyzed by using the second-derivative maximum of each amplification reaction and relating it to its respective standard curve. If a sample had an ASPOLG measurement above 15,000 or below 150 genome equivalents, the assay was repeated at a higher or lower dilution of the extract, respectively, to fall within a DNA concentration range that yielded a constant ratio of mitochondrial to nuclear DNA. The results from the quantitative PCR were expressed as the ratio of the mean mitochondrial DNA value of duplicate measurements to the mean nuclear DNA value of duplicate measurements for a given extract (mtDNA:nDNA). The mtDNA:nDNA ratio was arbitrarily set around 1.0 by the fact that the same nuclear-genome equivalent values were used to generate both standard curves.
Venous Lactate Measurement
Specimens of venous blood for measurement of lactate were collected in sodium fluoride–potassium oxalate tubes, with the use of a normal tourniquet and no specific instructions to the patient other than the avoidance of fist clenching or hand pumping. The laboratory's normal reference range for lactate is 0.7 to 2.1 mmol per liter.
Plasma Drug Levels
The concentrations of protease inhibitors (indinavir, ritonavir, saquinavir, nelfinavir, and lopinavir) and nonnucleoside reverse-transcriptase inhibitors (nevirapine, delavirdine, and efavirenz) were determined in the stored plasma samples that were collected for viral-load testing by high-performance liquid chromatography (HP 1100, Agilent, Palo Alto, Calif.) coupled with tandem mass spectrometry (API-2000 LC/MS/MS System, AB/MDS-Sciex, Foster City, Calif.). In brief, the antiretroviral drugs were extracted with acetonitrile and the precipitated plasma proteins were separated by centrifugation (16,000×g) followed by filtration (Ultrafree-MC Filters, Millipore, Bedford, Mass.). The drugs in the filtrate were partially separated by high-performance liquid chromatography (Zorbax XDB C-18 column, Agilent) and quantified by standard methods on the mass spectrometer. The samples were collected in acid citrate dextrose anticoagulant, which diluted the blood somewhat. The time at which the last doses of antiretroviral drugs were administered was unknown. Qualitative plasma drug levels were used to establish whether the patients were taking antiretroviral drugs.
Longitudinal mtDNA:nDNA Analysis
Blood samples from the eight HIV-infected patients with symptomatic hyperlactatemia who were receiving antiretroviral drugs, which were collected before, during, and after the discontinuation of antiretroviral therapy (between 6 and 17 samples per patient, covering a period of 22 to 28 months), were assayed to determine the mtDNA:nDNA ratios. All samples collected at least one month after the initiation of the antiretroviral regimen but before discontinuation of therapy (three to six samples per patient) were used to calculate the mean mtDNA:nDNA ratio during therapy. All samples collected after the discontinuation of therapy, with no limitations on time but before the initiation of a new regimen, were used to calculate the mean mtDNA:nDNA ratio when the patient was not receiving therapy. Data from Patient 1 were excluded from this analysis because there were no samples available after the discontinuation of treatment and before the start of a new regimen. All samples collected both when the patient was not receiving therapy (zero to three per patient) and after the new stavudine-free regimens were started (zero to nine per patient) were included in the calculation of the mean mtDNA:nDNA ratio when the patient was not receiving stavudine. Group means were calculated by using one mean value for each patient.
Statistical Analysis
To study the level of agreement between duplicate measurements of mitochondrial and nuclear DNA, scatter diagrams (showing the line of equality) were first constructed and Pearson's correlation coefficients were calculated. The coefficient of determination, as defined by the proportion of the variation in the value of the dependent variable (second measurement) that is explained by its linear relation with the independent variable (first measurement), was also calculated. To assess the degree of agreement between measurements, a plot of the difference between the measurements as compared with their mean value was constructed.33 This plot allowed us to investigate the relation between the measurement error and the true value. Although the true value is unknown, the mean of the two measurements provides a reasonable estimate. These plots are useful in identifying homoscedastic or heteroscedastic patterns between the differences and their mean. Limits of agreement (mean difference ±2 SD) were also included in these plots.
For the patients with mitochondrial toxic effects, we assessed the relation between the mtDNA:nDNA ratio and the CD4 cell counts by first calculating the Spearman correlation between the repeated measurements of the mtDNA:nDNA ratio and the CD4 cell count for each of the eight patients, and then testing the hypothesis that the mean of the patient-specific correlations was zero by the Wilcoxon signed-rank test. A similar approach was followed with the other clinical tests. For the comparison of subgroups that contained multiple observations per patient, the mean for each patient was calculated while the patient was receiving therapy, after therapy was discontinued, and while the patient was not receiving therapy or was receiving a new stavudine-free regimen. The means of these values (i.e., the means of the individual patients' means) were then compared by the Wilcoxon signed-rank test.
Results
Mitochondrial DNA Assay
The mitochondrial DNA assay made use of real-time PCR to quantify the mitochondrial DNA content of blood cells in relation to their nuclear DNA content. The standard curves for both the mitochondrial gene (CCOI) and a nuclear gene (ASPOLG) were generated by serial dilution of the male HIV-negative DNA pool and showed linearity over the range studied (Figure 1Figure 1
Typical Real-Time Polymerase-Chain-Reaction Standard Curves Generated for the Nuclear Gene for the Human Polymerase γ Accessory Subunit and the Mitochondrial Gene Human Cytochrome-c Oxidase Subunit I with Use of Serial Dilutions of the Pooled DNA Extracts from HIV-Negative Male Volunteers.). The level of agreement of the duplicate measurements performed for this study is illustrated in Figure 2Figure 2Levels of Agreement between Duplicate Measurements of the Nuclear Gene for the Human Polymerase γ Accessory Subunit (Panel A), the Mitochondrial Gene Human Cytochrome-c Oxidase Subunit I (Panel B), and the Ratio of Mitochondrial to Nuclear DNA (Panel C) Derived from Them.. For the nuclear and the mitochondrial gene, respectively, 96 percent and 98 percent of the differences between duplicate measurements were less than 2 SD from the mean difference, with Pearson's correlation coefficients of 0.94 and 0.99 and coefficients of determination of 89 percent and 97 percent, respectively. For the mtDNA:nDNA ratio (Figure 2C), the level of agreement was highest at lower values of the ratio, and overall, 92 percent of duplicate measurements were less than 2 SD from the mean, with a Pearson's correlation coefficient of 0.72 and a coefficient of determination of 52 percent.Population Comparison
The assay was applied to three groups of men: 24 non–HIV-infected controls, 47 HIV-infected, asymptomatic patients never treated with antiretroviral drugs, and 8 HIV-infected patients with symptomatic hyperlactatemia who were treated with antiretroviral drugs. Figure 3Figure 3
Ratio of Mitochondrial to Nuclear DNA in the Three Groups of Subjects. presents the mtDNA:nDNA ratios obtained for the non–HIV-infected and HIV-infected control groups. The mean mtDNA:nDNA ratio among the non–HIV-infected controls was significantly higher than that among the HIV-infected asymptomatic patients never treated with antiretroviral drugs (P<0.001). Among the eight HIV-infected patients with symptomatic hyperlactatemia, the mean mtDNA:nDNA ratio of the last sample collected before antiretroviral therapy was discontinued was 0.28±0.06. This value was 22 percent of the value in the non–HIV-infected subjects (1.28±0.38) and 39 percent of the value in the HIV-infected asymptomatic patients never treated with antiretroviral drugs (0.72±0.19), and it was significantly lower than the value in either of these control groups (P<0.001).Characteristics of the Patients
The eight patients receiving antiretroviral therapy (Table 1Table 1
Characteristics of the Eight HIV-Infected Male Patients with Symptomatic Mitochondrial Toxic Effects and Their Antiretroviral Regimens.) had mitochondrial toxic effects characterized by varying degrees of progressive hyperlactatemia (Figure 4Figure 4Longitudinal Analysis of Venous Lactate Levels (Open Circles), mtDNA:nDNA Ratios (Solid Circles), and Antiretroviral-Drug Regimens (Bars) over Time in the Patients with Symptoms of Mitochondrial Toxicity.), fatigue, rapid weight loss, and a reduced anaerobic threshold during exercise testing.25 Their antiretroviral regimens varied from first-line to salvage therapy, and all were receiving stavudine. Antiretroviral therapy was interrupted in all eight patients as a result of the development of symptomatic hyperlactatemia. In all cases, lactate decreased and symptoms resolved on the discontinuation of antiretroviral therapy.Longitudinal mtDNA:nDNA Ratios
Longitudinal measurements of mtDNA:nDNA ratios in samples collected before, during, and after antiretroviral therapy are presented in Figure 4. Among the eight patients with symptomatic hyperlactatemia, the mean mtDNA:nDNA ratio during therapy (0.41±0.08) was significantly lower than that among both the non–HIV-infected subjects (P<0.001) and the HIV-infected, asymptomatic patients who had never received antiretroviral therapy (P<0.001). The mean mtDNA:nDNA ratio during therapy was also significantly lower than both the mean mtDNA:nDNA ratio when the patients were receiving no therapy (0.74±0.13, P=0.02) and the mean mtDNA:nDNA ratio when the patients were not receiving stavudine (0.69±0.06, P=0.008). The mean mtDNA:nDNA ratio obtained for the HIV-infected, asymptomatic patients who had never received antiretroviral therapy was not significantly different from the mean mtDNA:nDNA ratio when the patients were receiving no therapy (P=0.43) or the mean mtDNA:nDNA ratio when the patients were not receiving stavudine (P=0.26).
The results of several laboratory tests were investigated to explore their possible relation with the mtDNA:nDNA ratio. Among the HIV-infected, asymptomatic patients who had never received antiretroviral therapy, CD4 cell counts were not significantly correlated with the mtDNA:nDNA ratio (Spearman's rho=0.08; P=0.59; mean CD4 cell count, 233±162 per cubic millimeter; range, 10 to 830). For the eight HIV-infected patients with symptomatic hyperlactatemia receiving antiretroviral therapy, there were also no significant correlations between the mtDNA:nDNA ratio and CD4 cell count (P=1.00; mean CD4 cell count, 191±146 per cubic millimeter; range, 10 to 620), platelet count (P=0.29), white-cell count (P=0.31), alanine aminotransferase level (P=0.25), aspartate aminotransferase level (P=0.08), albumin level (P=0.20), or the international normalized ratio (P=0.24).
Mitochondrial DNA and Lactate Levels
In Patients 1, 4, and 8 (Figure 4), the decrease in the mtDNA:nDNA ratio clearly preceded the development of hyperlactatemia (earlier data on lactate levels were unavailable for the other five patients). Similarly, in Patients 4, 6, and 8, the time required for the mtDNA:nDNA ratio to rebound was similar to or shorter than that needed for the hyperlactatemia to resolve (i.e., to reach the range of 0.5 to 2.1 mmol per liter). A weak correlation (Spearman's rho =–0.32, P=0.02) was observed between the lactate levels and the mtDNA:nDNA ratio.
On the basis of the limited mtDNA:nDNA data available from the eight HIV-infected patients with symptomatic hyperlactatemia who were receiving antiretroviral therapy, the maximal in vivo half-life of mitochondrial DNA was estimated to range from 4.5 weeks (Patient 3) to 8 weeks (Patient 4). The maximal in vivo doubling time of mitochondrial DNA was estimated to range from 4 weeks (Patient 5) to 16 weeks (Patient 1). Short lapses in therapy (as occurred in the cases of Patients 3, 4, and 7), as well as extremely low circulating drug levels (as in Patients 4, 6, and 7), were also associated with increasing levels of mitochondrial DNA. For these patients, the maximal time before lactate levels returned to the normal range after the discontinuation of antiretroviral treatment varied from 4 weeks (Patient 8) to 28 weeks (Patient 5).
Discussion
The assay we used to determine the mtDNA:nDNA ratio can be performed on peripheral blood collected fresh or previously frozen. The assay was most reliable in the low range of mtDNA:nDNA values (Figure 2C), which is the clinically relevant range. Mitochondrial DNA was significantly depleted in HIV-infected patients with symptomatic hyperlactatemia who were receiving antiretroviral therapy. The decrease in mitochondrial DNA preceded the rise in venous lactate levels, an observation that is consistent with the view that hyperlactatemia is a consequence of depletion of mitochondrial DNA, and it was reversible in all the patients we studied. Mitochondrial DNA:nDNA ratios were significantly lower in HIV-infected, asymptomatic patients who had never received antiretroviral therapy than in non–HIV-infected controls (P<0.001), a difference that was not explained by the lower CD4 counts in the former group. This finding is consistent with the results of recent in vitro studies in which HIV-infected cells had signs of mitochondrial necrosis.34 Furthermore, a mitochondria-controlled mechanism of cell death has been postulated in HIV infection.35-38
In inherited mitochondrial diseases, severe symptoms tend to occur when the levels of mitochondrial DNA reach approximately 20 percent of normal, which is similar to the level of depletion observed in HIV-infected patients with symptomatic hyperlactatemia who are receiving antiretroviral therapy. The in vivo doubling times of mitochondrial DNA estimated from this relatively small data set are similar to the time of approximately 35 days observed for cultured cells in which mitochondrial DNA had been depleted by ethidium bromide treatment.39
The fact that the mtDNA:nDNA ratios measured while the patients were not receiving antiretroviral therapy were similar to those observed once the patients resumed nucleoside-containing therapy without stavudine points toward a possible association between stavudine and mitochondrial toxicity.22-25,32 Lactate levels remained normal after the resumption of therapy without stavudine. In vitro, the triphosphated form of stavudine is incorporated into DNA more readily than other currently used nucleoside analogues and exerts the greatest inhibition on the human polymerase γ.2 This may explain the apparent association between mitochondrial toxicity and stavudine. Further studies are needed to establish the relative mitochondrial toxicity in vivo of various nucleoside analogues.
The frequency of lactic acidosis in patients treated with nucleoside analogues has been retrospectively estimated to lie between 1 and 2 cases per 1000 person-years.26 Another study with a broadened case definition of hyperlactatemia estimated the incidence at 20.9 cases per 1000 person-years of treatment.22 We found that approximately 20 percent of patients receiving antiretroviral therapy had elevated lactate levels in random venous samples.32 A validated quantitative mitochondrial DNA assay could be a useful tool to monitor and evaluate mitochondrial toxicity among HIV-infected patients receiving antiretroviral therapy, as well as among patients with other diseases, such as hepatitis and cancer, which are also treated with nucleoside analogues.
Supported by the British Columbia Centre for Excellence in HIV/AIDS and by a Joint Research Scholarship from the British Columbia Health Research Foundation and St. Paul's Hospital Foundation (to Dr. Côté).
A patent application relating to the assay used in this study has been filed by the University of British Columbia. The patent includes the names of Drs. Côté, O'Shaughnessy, and Montaner.
We are indebted to Shawna Langridge for technical assistance, to the patients, and to the volunteers who donated blood for this study.
Source Information
From the British Columbia Centre for Excellence in HIV/AIDS (H.C.F.C., Z.L.B., K.J.P.C., C.S.A., B.W., L.T., M.H., P.R.H., M.V.O., J.S.G.M.) and the Canadian HIV Trials Network (H.W.), University of British Columbia, St. Paul's Hospital, Providence Health Care, Vancouver, B.C., Canada.
Address reprint requests to Dr. Montaner at St. Paul's Hospital, 667-1081 Burrard St., Vancouver, BC V6Z 1Y6, Canada, or at jmontaner@hivnet.ubc.ca.
- References
References
1
Martin JL ,Brown CE ,Matthews-Davis N ,Reardon JE . Effects of antiviral nucleoside analogs on human DNA polymerases and mitochondrial DNA synthesis. Antimicrob Agents Chemother 1994;38:2743-2749
Web of Science | Medline2
Lim SE ,Copeland WC . Differential incorporation and removal of antiviral deoxynucleotides by human DNA polymerase γ. J Biol Chem 2001;276:23:616-623
Web of Science | Medline3
Lewis W ,Dalakas MC . Mitochondrial toxicity of antiviral drugs. Nat Med 1995;1:417-422
CrossRef | Web of Science | Medline4
Brinkman K ,ter Hofstede HJM ,Burger DM ,Smeitink JAM ,Koopmans PP . Adverse effects of reverse transcriptase inhibitors: mitochondrial toxicity as common pathway. AIDS 1998;12:1735-1744
CrossRef | Web of Science | Medline5
Kakuda TN . Pharmacology of nucleoside and nucleotide reverse transcriptase inhibitor-induced mitochondrial toxicity. Clin Ther 2000;22:685-708
CrossRef | Web of Science | Medline6
Carr A ,Cooper DA . Adverse effects of antiretroviral therapy. Lancet 2000;356:1423-1430
CrossRef | Web of Science | Medline7
Dalakas MC ,Semino-Mora C ,Leon-Monzon M . Mitochondrial alterations with mitochondrial DNA depletion in the nerves of AIDS patients with peripheral neuropathy induced by 2'3'-dideoxycytidine (ddC). Lab Invest 2001;81:1537-1544
Web of Science | Medline8
Brinkman K ,Smeitink JA ,Romijn JA ,Reiss P . Mitochondrial toxicity induced by nucleoside-analogue reverse-transcriptase inhibitors is a key factor in the pathogenesis of antiretroviral-therapy-related lipodystrophy. Lancet 1999;364:1112-1115
CrossRef | Web of Science9
Kakuda TN ,Brundage RC ,Anderson PL ,Fletcher CV . Nucleoside reverse transcriptase inhibitor-induced mitochondrial toxicity as an etiology for lipodystrophy. AIDS 1999;13:2311-2312
CrossRef | Web of Science | Medline10
Mallal SA ,John M ,Moore CB ,James IR ,McKinnon EJ . Contribution of nucleoside analogue reverse transcriptase inhibitors to subcutaneous fat wasting in patients with HIV infection. AIDS 2000;14:1309-1316
CrossRef | Web of Science | Medline11
Zaera MG ,Miro O ,Pedrol E , et al. Mitochondrial involvement in antiretroviral therapy-related lipodystrophy. AIDS 2001;15:1643-1651
CrossRef | Web of Science | Medline12
Shikuma CM ,Hu N ,Milne C , et al. Mitochondrial DNA decrease in subcutaneous adipose tissue of HIV-infected individuals with peripheral lipoatrophy. AIDS 2001;15:1801-1809
CrossRef | Web of Science | Medline13
McKenzie R ,Fried MW ,Sallie R , et al. Hepatic failure and lactic acidosis due to fialuridine (FIAU), an investigational nucleoside analogue for chronic hepatitis B. N Engl J Med 1995;333:1099-1105
Full Text | Web of Science | Medline14
Lafeuillade A ,Hittinger G ,Chadapaud S . Increased mitochondrial toxicity with ribavirin in HIV/HCV coinfection. Lancet 2001;357:280-281
CrossRef | Web of Science | Medline15
Dalakas MC ,Illa I ,Pezeshkpour GH ,Laukaitis JP ,Cohen B ,Griffin JL . Mitochondrial myopathy caused by long-term zidovudine therapy. N Engl J Med 1990;322:1098-1105
Full Text | Web of Science | Medline16
Arnaudo E ,Dalakas M ,Shanske S ,Moraes CT ,DiMauro S ,Schon EA . Depletion of muscle mitochondrial DNA in AIDS patients with zidovudine-induced myopathy. Lancet 1991;337:508-510
CrossRef | Web of Science | Medline17
Lewis W ,Gonzalez B ,Chomyn A ,Papoian T . Zidovudine induces molecular, biochemical, and ultrastructural changes in rat skeletal muscle mitochondria. J Clin Invest 1992;89:1354-1360
CrossRef | Web of Science | Medline18
Chen C-H ,Vazquez-Padua M ,Cheng Y-C . Effect of anti-human immunodeficiency virus nucleoside analogs on mitochondrial DNA and its implication for delayed toxicity. Mol Pharmacol 1991;39:625-628
Web of Science | Medline19
Medina DJ ,Tsai C-H ,Hsiung GD ,Cheng Y-C . Comparison of mitochondrial morphology, mitochondrial DNA content, and cell viability in cultured cells treated with three anti-human immunodeficiency virus dideoxynucleosides. Antimicrob Agents Chemother 1994;38:1824-1828
Web of Science | Medline20
Pan-Zhou X-R ,Cui L ,Zhou X-J ,Sommadossi J-P ,Darley-Usmar VM . Differential effects of antiretroviral nucleoside analogs on mitochondrial function in HepG2 cells. Antimicrob Agents Chemother 2000;44:496-503
CrossRef | Web of Science | Medline21
Sinnwell TM ,Sivakumar K ,Soueidan S , et al. Metabolic abnormalities in skeletal muscle of patients receiving zidovudine therapy observed by 31P in vivo magnetic resonance spectroscopy. J Clin Invest 1995;96:126-131
CrossRef | Web of Science | Medline22
Lonergan JT ,Behling C ,Pfander H ,Hassanein TI ,Mathews WC . Hyperlactatemia and hepatic abnormalities in 10 human immunodeficiency virus-infected patients receiving nucleoside analogue combination regimens. Clin Infect Dis 2000;31:162-166
CrossRef | Web of Science | Medline23
Gerard Y ,Maulin L ,Yazdanpanah Y , et al. Symptomatic hyperlactataemia: an emerging complication of antiretroviral therapy. AIDS 2000;14:2723-2730
CrossRef | Web of Science | Medline24
John M ,Moore CB ,James IR , et al. Chronic hyperlactatemia in HIV-infected patients taking antiretroviral therapy. AIDS 2001;15:717-723
CrossRef | Web of Science | Medline25
Delgado J ,Harris M ,Tesiorowski A ,Montaner JSG . Symptomatic elevations of lactic acid and their response to treatment manipulation in human immunodeficiency virus-infected persons: a case series. Clin Infect Dis 2001;33:2072-2074
CrossRef | Web of Science | Medline26
Fortgang IS ,Belitsos PC ,Chaisson RE ,Moore RD . Hepatomegaly and steatosis in HIV-infected patients receiving nucleoside analog antiretroviral therapy. Am J Gastroenterol 1995;90:1433-1436
Web of Science | Medline27
Megarbane B ,Brivet F ,Guerin JM ,Baud FJ . Acidose lactique et défaillance multiviscérale secondaire aux thérapeutiques antirétrovirales chez les patients infectés par le VIH. Presse Med 1999;28:2257-2264
Web of Science | Medline28
ter Hofstede HJ ,de Marie S ,Foudraine NA ,Danner SA ,Brinkman K . Clinical features and risk factors of lactic acidosis following long-term antiretroviral therapy: 4 fatal cases. Int J STD AIDS 2000;11:611-616
CrossRef | Web of Science | Medline29
Carr A ,Morey A ,Mallon P ,Williams D ,Thorburn DR . Fatal portal hypertension, liver failure, and mitochondrial dysfunction after HIV-1 nucleoside analogue-induced hepatitis and lactic acidaemia. Lancet 2001;357:1412-1414
CrossRef | Web of Science | Medline30
Brinkman K . Management of hyperlactatemia: no need for routine lactate measurements. AIDS 2001;15:795-797
CrossRef | Web of Science | Medline31
Benbrik E ,Chariot P ,Bonavaud S , et al. Cellular and mitochondrial toxicity of zidovudine (AZT), didanosine (ddI) and zalcitabine (ddC) on cultured human muscle cells. J Neurol Sci 1997;149:19-25
CrossRef | Web of Science | Medline32
Harris M ,Tesiorowski A ,Chan K , et al. Lactic acidosis complicating antiretroviral therapy: frequency and correlates. Antiviral Ther 2000;5:Suppl 2:31-31 abstract.33
Bland JM ,Altman DG . Statistical methods for assessing agreement between two methods of clinical measurement. Lancet 1986;1:307-310
CrossRef | Web of Science | Medline34
Plymale DR ,Tang DS ,Comardelle AM ,Fermin CD ,Lewis DE ,Garry RF . Both necrosis and apoptosis contribute to HIV-1-induced killing of CD4 cells. AIDS 1999;13:1827-1839
CrossRef | Web of Science | Medline35
Ferri KF ,Jacotot E ,Blanco J ,Este JA ,Kroemer G . Mitochondrial control of cell death induced by HIV-1-encoded proteins. Ann N Y Acad Sci 2000;926:149-164
CrossRef | Web of Science | Medline36
Moretti S ,Marcellini S ,Boschini A , et al. Apoptosis and apoptosis-associated perturbations of peripheral blood lymphocytes during HIV infection: comparison between AIDS patients and asymptomatic long-term non-progressors. Clin Exp Immunol 2000;122:364-373
CrossRef | Web of Science | Medline37
Joza N ,Susin SA ,Daugas E , et al. Essential role of the mitochondrial apoptosis-inducing factor in programmed cell death. Nature 2001;410:549-554
CrossRef | Web of Science | Medline38
Roggero R ,Robert-Hebmann V ,Harrington S , et al. Binding of human immunodeficiency virus type 1 gp120 to CXCR4 induces mitochondrial transmembrane depolarization and cytochrome c-mediated apoptosis independently of Fas signaling. J Virol 2001;75:7637-7650
CrossRef | Web of Science | Medline39
Moraes CT ,Kenyon L ,Hao H . Mechanisms of human mitochondrial DNA maintenance: the determining role of primary sequence and length over function. Mol Biol Cell 1999;10:3345-3356
Web of Science | Medline
- Citing Articles (189)
Citing Articles
1
Haleh Rezaee, Hossein Khalili, Jamshid Salamzadeh, Sirus Jafari, Alireza Abdollahi. (2012) Potential benefits of carnitine in HIV-positive patients. Future Virology 7:1, 73-83
CrossRef2
Peter Greaves. 2012. Musculoskeletal System. , 157-206.
CrossRef3
Ivanka Stankova, Kamelia Stanoeva, Anton Hinkov, Ivailo Alexiev, Petya Genova-Kalou, Radoslav Chayrov, Radka Argirova. (2011) Amino acid and peptide esters of abacavir: synthesis and activity against human immunodeficiency virus type 1 in cell culture. Medicinal Chemistry Research
CrossRef4
Francesc Vidal, Pere Domingo, Consuelo Viladés, Joaquim Peraire, Mireia Arnedo, José Alcamí, Manuel Leal, Francesc Villarroya, Josep Ma Gatell. (2011) Pharmacogenetics of the lipodystrophy syndrome associated with HIV infection and combination antiretroviral therapy. Expert Opinion on Drug Metabolism & Toxicology 7:11, 1365-1382
CrossRef5
Constanza Morén, Antoni Noguera-Julian, Núria Rovira, Ester Corrales, Glòria Garrabou, Sandra Hernández, Mireia Nicolás, Ester Tobías, Francesc Cardellach, Òscar Miró, Clàudia Fortuny. (2011) Mitochondrial Impact of Human Immunodeficiency Virus and Antiretrovirals on Infected Pediatric Patients With or Without Lipodystrophy. The Pediatric Infectious Disease Journal 30:11, 992-995
CrossRef6
ER Feeney, C Chazallon, N O'Brien, V Meiffrédy, RL Goodall, J-P Aboulker, DA Cooper, P Yeni, PWG Mallon, . (2011) Hyperlactataemia in HIV-infected subjects initiating antiretroviral therapy in a large randomized study (a substudy of the INITIO trial). HIV Medicine 12:10, 602-609
CrossRef7
P. E. Sax. (2011) Antiretroviral Therapy: Now "It Just Works". Clinical Infectious Diseases 53:6, 605-608
CrossRef8
André Hoerning, Halime Kalkavan, Christian Rehme, Julia Menke, Karl Worm, Henk S. P. Garritsen, Rainer Büscher, Peter F. Hoyer. (2011) Quantitative real-time ARMS-qPCR for mitochondrial DNA enables accurate detection of microchimerism in renal transplant recipients. Pediatric Transplantationno-no
CrossRef9
Brendan A I Payne, Ian J Wilson, Charlotte A Hateley, Rita Horvath, Mauro Santibanez-Koref, David C Samuels, D Ashley Price, Patrick F Chinnery. (2011) Mitochondrial aging is accelerated by anti-retroviral therapy through the clonal expansion of mtDNA mutations. Nature Genetics 43:8, 806-810
CrossRef10
Adrian Curran, Esteban Ribera. (2011) From old to new nucleoside reverse transcriptase inhibitors: changes in body fat composition, metabolic parameters and mitochondrial toxicity after the switch from thymidine analogs to tenofovir or abacavir. Expert Opinion on Drug Safety 10:3, 389-406
CrossRef11
Alexandra U Scherrer, Viktor von Wyl, Jürg Böni, Sabine Yerly, Thomas Klimkait, Philippe Bürgisser, Christian Garzoni, Bernard Hirschel, Matthias Cavassini, Manuel Battegay, Pietro L Vernazza, Enos Bernasconi, Bruno Ledergerber, Huldrych F Günthard. (2011) Viral Suppression Rates in Salvage Treatment With Raltegravir Improved With the Administration of Genotypic Partially Active or Inactive Nucleoside/Tide Reverse Transcriptase Inhibitors. JAIDS Journal of Acquired Immune Deficiency Syndromes 57:1, 24-31
CrossRef12
Adam Mor, Robert L. Wortmann, Hal J. Mitnick, Michael H. Pillinger. (2011) Drugs Causing Muscle Disease. Rheumatic Disease Clinics of North America 37:2, 219-231
CrossRef13
Patrick Yu-Wai-Man, Philip G. Griffiths, Patrick F. Chinnery. (2011) Mitochondrial optic neuropathies – Disease mechanisms and therapeutic strategies. Progress in Retinal and Eye Research 30:2, 81-114
CrossRef14
Giovanni Schifitto, Lijuan Deng, Tzu-min Yeh, Scott R. Evans, Thomas Ernst, Jianhui Zhong, David Clifford. (2011) Clinical, laboratory, and neuroimaging characteristics of fatigue in HIV-infected individuals. Journal of NeuroVirology 17:1, 17-25
CrossRef15
Glòria Garrabou, Sònia López, Constanza Morén, Esteban Martínez, Joan Fontdevila, Francesc Cardellach, Josep Maria Gatell, Òscar Miró. (2011) Mitochondrial damage in adipose tissue of untreated HIV-infected patients. AIDS 25:2, 165-170
CrossRef16
Laura Enomoto, Peter L. Anderson, Shaobing Li, Charles L. Edelstein, Adriana Weinberg. (2011) Effect of Nucleoside and Nucleotide Analog Reverse Transcriptase Inhibitors on Cell-Mediated Immune Functions. AIDS Research and Human Retroviruses 27:1, 47-55
CrossRef17
Miwako Honda, Michiyo Ishisaka, Naoki Ishizuka, Satoshi Kimura, Shinichi Oka, . (2011) Open-Label Randomized Multicenter Selection Study of Once Daily Antiretroviral Treatment Regimen Comparing Ritonavir-Boosted Atazanavir to Efavirenz with Fixed-Dose Abacavir and Lamivudine. Internal Medicine 50:7, 699-705
CrossRef18
L. Gil del Valle. 2011. Pathophysiological Implications of Altered Redox Balance in HIV/AIDS Infection: Diagnosis and Counteract Interventions. , 39-70.
CrossRef19
Mark A. Boyd, Andrew M. Hill. (2010) Clinical Management of Treatment-Experienced, HIV/AIDS Patients in the Combination Antiretroviral Therapy Era. PharmacoEconomics 28, 17-34
CrossRef20
Antoni Noguera, Constanza Morén, Núria Rovira, Emília Sànchez, Glòria Garrabou, Mireia Nicolàs, Carmen Muñoz-Almagro, Francesc Cardellach, Òscar Miró, Clàudia Fortuny. (2010) Evolution of Mitochondrial DNA Content After Planned Interruption of HAART in HIV-Infected Pediatric Patients. AIDS Research and Human Retroviruses 26:9, 1015-1018
CrossRef21
Marcello Pinti, Milena Nasi, Lara Gibellini, Erika Roat, Sara De Biasi, Linda Bertoncelli, Andrea Cossarizza. (2010) The Role of Mitochondria in HIV Infection and Its Treatment. Journal of Experimental & Clinical Medicine 2:4, 145-155
CrossRef22
Angela Pyle, David J. Burn, Charlotte Gordon, Catherine Swan, Patrick F. Chinnery, Simon V. Baudouin. (2010) Fall in circulating mononuclear cell mitochondrial DNA content in human sepsis. Intensive Care Medicine 36:6, 956-962
CrossRef23
Daniel M. Lugassy, Brenna M. Farmer, Lewis S. Nelson. (2010) Metabolic and Hepatobiliary Side Effects of Antiretroviral Therapy (ART). Emergency Medicine Clinics of North America 28:2, 409-419
CrossRef24
George Liamis, Haralampos J. Milionis, Moses Elisaf. (2010) Pharmacologically-Induced Metabolic Acidosis. Drug Safety 33:5, 371-391
CrossRef25
James J. Kohler, William Lewis. 2010. Cardiovascular Toxicities of Life-Saving Drugs: Antiviral Therapy. , 313-332.
CrossRef26
Christopher Vernon, Jennifer L. LeTourneau. (2010) Lactic Acidosis: Recognition, Kinetics, and Associated Prognosis. Critical Care Clinics 26:2, 255-283
CrossRef27
Marcello Pinti, Lara Gibellini, Giovanni Guaraldi, Gabriella Orlando, Timothy W Gant, Eugenia Morselli, Milena Nasi, Paolo Salomoni, Cristina Mussini, Andrea Cossarizza. (2010) Upregulation of nuclear-encoded mitochondrial LON protease in HAART-treated HIV-positive patients with lipodystrophy: implications for the pathogenesis of the disease. AIDS 24:6, 841-850
CrossRef28
Christian G. Noble, Yen-Liang Chen, Hongping Dong, Feng Gu, Siew Pheng Lim, Wouter Schul, Qing-Yin Wang, Pei-Yong Shi. (2010) Strategies for development of dengue virus inhibitors. Antiviral Research 85:3, 450-462
CrossRef29
Paul S Phillips, M Anthony Verity, Brian A Schick, Giorgirene D Vladutiu, Reijo Laaksonen, Matej Oresic, Raymond J Hohl, Theodore P Ciaraldi, Vikas P Sukhatme, Stewart H Lecker, Helene CF Cote, Henry Powell, William Davidson, Tanya Wolfson. (2010) Survey of muscle characteristics after statin-induced rhabdomyolysis. Clinical Lipidology 5:1, 17-27
CrossRef30
Wen Zeng, An-chun Cheng, Zheng-li Chen, Qi-hui Luo, Yu-bo Sun, Zhan Li, Feng-jun Bi. (2009) In vivo assessment of mitochondrial toxicity of metacavir in Rhesus monkeys after three months of intravenous administration. Acta Pharmacologica Sinica 30:12, 1666-1673
CrossRef31
Glòria Garrabou, Constanza Morén, Jose Miguel Gallego-Escuredo, Ana Milinkovic, Francesc Villarroya, Eugenia Negredo, Marta Giralt, Francesc Vidal, Enric Pedrol, Esteban Martínez, Francesc Cardellach, Josep Maria Gatell, Òscar Miró. (2009) Genetic and Functional Mitochondrial Assessment of HIV-Infected Patients Developing HAART-Related Hyperlactatemia. JAIDS Journal of Acquired Immune Deficiency Syndromes 52:4, 443-451
CrossRef32
I.W. Husstedt, D. Reichelt, E. Neuen-Jakob, K. Hahn, F. Kästner, R. Einsiedel, B. Vielhaber, G. Arendt, S. Evers. (2009) Hochaktive antiretrovirale Therapie bei Neuro-AIDS. Der Nervenarzt 80:10, 1133-1142
CrossRef33
Kenneth A. Lichtenstein. (2009) Antiretroviral treatment interruptions and risk of non-opportunistic diseases. Current HIV/AIDS Reports 6:2, 77-82
CrossRef34
Chen-Han Lin, Derek D. Sloan, Chung H. Dang, Thor Wagner, Albert J. E. Cabrera, Nicole H. Tobin, Lisa M. Frenkel, Keith R. Jerome. (2009) Assessment of mitochondrial toxicity by analysis of mitochondrial protein expression in mononuclear cells. Cytometry Part B: Clinical Cytometry 76B:3, 181-190
CrossRef35
P. Tebas, J. Zhang, R. Hafner, K. Tashima, A. Shevitz, K. Yarasheski, B. Berzins, S. Owens, J. Forand, S. Evans, R. Murphy. (2009) Peripheral and visceral fat changes following a treatment switch to a non-thymidine analogue or a nucleoside-sparing regimen in HIV-infected subjects with peripheral lipoatrophy: results of ACTG A5110. Journal of Antimicrobial Chemotherapy 63:5, 998-1005
CrossRef36
Marianne Harris, Hélène Côté, Claudia Ochoa, Clotilde Allavena, Eugenia Negredo, Anona Thorne, Pedro Cahn, Carlos Zala, Francois Raffi, Bonaventura Clotet, Joel Singer, Julio Montaner. (2009) A Randomized, Open-Label Study of a Nucleoside Analogue Reverse Transcriptase Inhibitor-Sparing Regimen in Antiretroviral-Naive HIV-Infected Patients. JAIDS Journal of Acquired Immune Deficiency Syndromes 50:3, 335-337
CrossRef37
Anne Maagaard, Dag Kvale. (2009) Long term adverse effects related to nucleoside reverse transcriptase inhibitors: Clinical impact of mitochondrial toxicity. Scandinavian Journal of Infectious Diseases 41:11-12, 808-817
CrossRef38
Thomas Klopstock. (2008) Drug-induced myopathies. Current Opinion in Internal Medicine 7:6, 620-625
CrossRef39
Muhammad A. Akhtar, Kathleen Mathieson, Brian Arey, John Post, Renee Prevette, Amy Hillier, Prahladbhai Patel, Lakshmi Jaya Ram, David H. Van Thiel, Abdul Nadir. (2008) Hepatic histopathology and clinical characteristics associated with antiretroviral therapy in HIV patients without viral hepatitis. European Journal of Gastroenterology & Hepatology 20:12, 1194-1204
CrossRef40
Weerawat Manosuthi, Wisit Prasithsirikul, Noppanath Chumpathat, Bussakorn Suntisuklappon, Chatiya Athichathanabadi, Sukanya Chimsuntorn, Somnuek Sungkanuparph. (2008) Risk factors for mortality in symptomatic hyperlactatemia among HIV-infected patients receiving antiretroviral therapy in a resource-limited setting. International Journal of Infectious Diseases 12:6, 582-586
CrossRef41
Thomas Klopstock. (2008) Drug-induced myopathies. Current Opinion in Neurology 21:5, 590-595
CrossRef42
Hélène C. F. Côté, Janet Raboud, Ari Bitnun, Ariane Alimenti, Deborah M. Money, Evelyn Maan, Adriana Costei, Izabelle Gadawski, Christina Diong, Stanley Read, Sandy Shen, P. Richard Harrigan, David R. Burdge, Susan M. King, John C. Forbes. (2008) Perinatal Exposure to Antiretroviral Therapy Is Associated with Increased Blood Mitochondrial DNA Levels and Decreased Mitochondrial Gene Expression in Infants. The Journal of Infectious Diseases 198:6, 851-859
CrossRef43
R. Scott Braithwaite, Joseph Conigliaro, Kathleen A. McGinnis, Stephen A. Maisto, Kendall Bryant, Amy C. Justice. (2008) Adjusting Alcohol Quantity for Mean Consumption and Intoxication Threshold Improves Prediction of Nonadherence in HIV Patients and HIV-Negative Controls. Alcoholism: Clinical and Experimental Research 32:9, 1645-1651
CrossRef44
B. Felipe, A. Blanco, N. Soriano-Sarabia, M. Á. Muñoz-Fernández, M. Genebat, A. Vallejo, M. Leal. (2008) Effect of the Substitution of One Nucleoside Analogue by One Non-nucleoside Reverse Transcriptase Inhibitor over Mitochondrial DNA Levels. Infection 36:3, 266-270
CrossRef45
Motoi Matsukura, Fanny FS Chu, May Au, Helen Lu, Jennifer Chen, Sonja Rietkerk, Rolando Barrios, John D Farley, Julio S Montaner, Valentina C Montessori, David C Walker, Hélène CF Côté. (2008) Liver ultrastructural morphology and mitochondrial DNA levels in HIV/hepatitis C virus coinfection: no evidence of mitochondrial damage with highly active antiretroviral therapy. AIDS 22:10, 1226-1229
CrossRef46
Joaquín Portilla. (2008) Tenofovir como estrategia para evitar o detener efectos adversos. Enfermedades Infecciosas y Microbiología Clínica 26, 19-24
CrossRef47
Corinne Saillan-Barreau, Oumaima Tabbakh, Jean-Pierre Chavoin, Louis Casteilla, Luc Pénicaud. (2008) Drug-Specific Effect of Nelfinavir and Stavudine on Primary Culture of Human Preadipocytes. JAIDS Journal of Acquired Immune Deficiency Syndromes 48:1, 20-25
CrossRef48
Leslie P. Wong, Philip J. Klemmer. (2008) Severe Lactic Acidosis Associated With Juice of the Mangosteen Fruit Garcinia mangostana. American Journal of Kidney Diseases 51:5, 829-833
CrossRef49
G. A. McComsey, V. Lo Re, III, M. O’Riordan, U. A. Walker, D. Lebrecht, E. Baron, K. Mounzer, I. Frank. (2008) Effect of Reducing the Dose of Stavudine on Body Composition, Bone Density, and Markers of Mitochondrial Toxicity in HIV‐Infected Subjects: A Randomized, Controlled Study. Clinical Infectious Diseases 46:8, 1290-1296
CrossRef50
Kenneth A. Lichtenstein. (2008) Human Immunodeficiency Virus–Associated Lipoatrophy: Letting the Genome Out of the Bottle. The Journal of Infectious Diseases 197:6, 784-786
CrossRef51
Vassilios A Sevastianos, Stephanos J Hadziyannis. (2008) Nonalcoholic fatty liver disease: from clinical recognition to treatment. Expert Review of Gastroenterology & Hepatology 2:1, 59-79
CrossRef52
Erin R. Scruggs, Amie J. Dirks Naylor. (2008) Mechanisms of Zidovudine-Induced Mitochondrial Toxicity and Myopathy. Pharmacology 82:2, 83-88
CrossRef53
Richard A. Murphy, Henry Sunpath, Daniel R. Kuritzkes, Francois Venter, Rajesh T. Gandhi. (2007) Antiretroviral Therapy–Associated Toxicities in the Resource‐Poor World: The Challenge of a Limited Formulary. The Journal of Infectious Diseases 196:s3, S449-S456
CrossRef54
J. Mallolas, J.L. Blanco, J. Pich, J.A. Arnaiz, J.M. Peña, D. Dalmau, E. de Lazzaria, A. Ochoa, F. Vidal, M.A. Ribas, F. Segura, E. Pedrol, J. Flores, A. Cruceta, S. Varea, J.M. Miró, E. Martínez, J.M. Gatell. (2007) A randomized trial comparing the efficacy and tolerability of two HAART strategies at two years in antiretroviral naive patients. Revista Clínica Española 207:9, 427-432
CrossRef55
Mark S Sulkowski, Shruti H Mehta, Michael S Torbenson, Yvonne Higgins, Sherilyn C Brinkley, Ruben Montes de Oca, Richard D Moore, Nezam H Afdhal, David L Thomas. (2007) Rapid fibrosis progression among HIV/hepatitis C virus-co-infected adults. AIDS 21:16, 2209-2216
CrossRef56
P. M. Songa, B. Castelnuovo, E. B. Mugasha, P. Ocama, A. Kambugu. (2007) Symptomatic Hyperlactatemia Associated with Nucleoside Analogue Reverse-Transcriptase Inhibitor Use in HIV-Infected Patients: A Report of 24 Cases in a Resource-Limited Setting (Uganda). Clinical Infectious Diseases 45:4, 514-517
CrossRef57
M. Wiener, Y. Guo, G. Patel, B. C. Fries. (2007) Lactic Acidosis after Treatment with Linezolid. Infection 35:4, 278-281
CrossRef58
Mamta K. Jain. (2007) Drug-Induced Liver Injury Associated with HIV Medications. Clinics in Liver Disease 11:3, 615-639
CrossRef59
Hélène CF Côté. (2007) Mechanisms of antiretroviral therapy-induced mitochondrial dysfunction. Current Opinion in HIV and AIDS 2:4, 253-260
CrossRef60
Michael T. Yin, Jay F. Dobkin, John T. Grbic. (2007) Epidemiology, pathogenesis, and management of human immunodeficiency virus infection in patients with periodontal disease. Periodontology 2000 44:1, 55-81
CrossRef61
E. Chang, R. Sekhar, S. Patel, A. Balasubramanyam. (2007) Dysregulated Energy Expenditure in HIV-Infected Patients: A Mechanistic Review. Clinical Infectious Diseases 44:11, 1509-1517
CrossRef62
B. Amellal, C. Allavena, E. André-Garnier, V. Ferré, M.A. Valantin, J.F. Delfraissy, A. Lafeuillade, M. Bonmarchand, V. Calvez, F. Raffi. (2007) Constant mitochondrial DNA levels in blood leukocytes of patients enrolled in a NRTI-free therapeutic trial (BIKS-2 study). Journal of Infection 54:6, 603-608
CrossRef63
Evan Wood, Julio S.G Montaner. (2007) When To Initiate HIV Antiretroviral Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 45:2, 131-132
CrossRef64
B A Schick, R Laaksonen, J J Frohlich, H Päivä, T Lehtimäki, K H Humphries, H C F Côté. (2007) Decreased Skeletal Muscle Mitochondrial DNA in Patients Treated with High-Dose Simvastatin. Clinical Pharmacology & Therapeutics 81:5, 650-653
CrossRef65
M. Crespo, S. Sauleda, J. I. Esteban, A. Juarez, E. Ribera, A. L. Andreu, V. Falco, J. Quer, I. Ocaña, I. Ruiz, M. Buti, A. Pahissa, R. Esteban, J. Guardia. (2007) Peginterferon alpha-2b plus ribavirin vs interferon alpha-2b plus ribavirin for chronic hepatitis C in HIV-coinfected patients. Journal of Viral Hepatitis 14:4, 228-238
CrossRef66
A Calmy, K Petoumenos, C Lewden, M Law, F Bocquentin, K Hesse, D Cooper, A Carr, F Bonnet, . (2007) Combination antiretroviral therapy without a nucleoside reverse transcriptase inhibitor: experience from 334 patients in three cohorts. HIV Medicine 8:3, 171-180
CrossRef67
Xinwen Wang, Hong Chai, Qizhi Yao, Changyi Chen. (2007) Molecular Mechanisms of HIV Protease Inhibitor-Induced Endothelial Dysfunction. JAIDS Journal of Acquired Immune Deficiency Syndromes 44:5, 493-499
CrossRef68
James J. Kohler, William Lewis. (2007) A brief overview of mechanisms of mitochondrial toxicity from NRTIs. Environmental and Molecular Mutagenesis 48:3-4, 166-172
CrossRef69
Carmen de Mendoza, Luz Martin-Carbonero, Pablo Barreiro, Michel de Baar, Natalia Zahonero, Sonia Rodriguez-Novoa, José Miguel Benito, Juan González-Lahoz, Vincent Soriano. (2007) Mitochondrial DNA depletion in HIV-infected patients with chronic hepatitis C and effect of pegylated interferon plus ribavirin therapy. AIDS 21:5, 583-588
CrossRef70
Erika Santos Corraliza, Aurelio Fuertes Martín. (2007) Tratamiento antirretroviral y toxicidad mitocondrial. Medicina Clínica 128:8, 311-316
CrossRef71
Geneviève Chêne, Bahia Amellal, Gaëlle Pédrono, Karine Gourlain, Corinne Rancinan, Valérie Journot, Laurent Cotte, Pierre Palmer, Nathalie De Castro, Vincent Calvez, Jean-Michel Molina. (2007) Changes in the Peripheral Blood mtDNA Levels in Naive Patients Treated by Different Nucleoside Reverse Transcriptase Inhibitor Combinations and Their Association with Subsequent Lipodystrophy. AIDS Research and Human Retroviruses 23:1, 54-61
CrossRef72
Margaret A Fischl, Ann C Collier, A Lisa Mukherjee, Judith E Feinberg, Lisa M Demeter, Pablo Tebas, Marina Giuliano, Marjorie Dehlinger, Kevin Garren, Barbara Brizz, Roland Bassett. (2007) Randomized open-label trial of two simplified, class-sparing regimens following a first suppressive three or four-drug regimen. AIDS 21:3, 325-333
CrossRef73
Jintanat Ananworanich, Bernard Hirschel. (2007) Intermittent therapy for the treatment of chronic HIV infection. AIDS 21:2, 123-134
CrossRef74
Steen B. Haugaard, Ove Andersen, Sten Madsbad, Johan Iversen, Flemming Dela. (2007) Glucose production, oxidation and disposal correlate with plasma lactate levels in HIV-infected patients on HAART. Journal of Infection 54:1, 89-97
CrossRef75
François-Guillaume Debray, Eric Drouin, Denise Herzog, Anne Lortie, Marie Lambert, Laurent Garel, Grant. A. Mitchell, Jacques L. Michaud. (2006) Recurrent pancreatitis in mitochondrial cytopathy. American Journal of Medical Genetics Part A 140A:21, 2330-2335
CrossRef76
Elisa Nemes, Enrico Lugli, Milena Nasi, Roberta Ferraresi, Marcello Pinti, Roberto Bugarini, Vanni Borghi, Francesca Prati, Roberto Esposito, Andrea Cossarizza, Cristina Mussini. (2006) Immunophenotype of HIV+ patients during CD4 cell-monitored treatment interruption: role of the IL-7/IL-7 receptor system. AIDS 20:16, 2021-2032
CrossRef77
Jean-Paul Duong Van Huyen, Dominique Batisse, Didier Heudes, Marie-France Belair, Christophe Piketty, Gustavo Gonzalez-Canali, Laurence Weiss, Michel D Kazatchkine, Patrick Bruneval. (2006) Alteration of cytochrome oxidase subunit I labeling is associated with severe mitochondriopathy in NRTI-related hepatotoxicity in HIV patients. Modern Pathology 19:10, 1277-1288
CrossRef78
Agustín Muñoz-Sanz, Francisco F. Rodríguez-Vidigal, Pere Domingo. (2006) Patogenia de la lipodistrofia y de las alteraciones metabólicas asociadas a la infección por el VIH. Medicina Clínica 127:12, 465-474
CrossRef79
M. Fu, T. B. Ng, Y. Jiang, Z. F. Pi, Z. K. Liu, L. Li, F. Liu. (2006) Compounds from rose (Rosa rugosa) flowers with human immunodeficiency virus type 1 reverse transcriptase inhibitory activity. Journal of Pharmacy and Pharmacology 58:9, 1275-1280
CrossRef80
Doris Höschele. (2006) Cell culture models for the investigation of NRTI-induced mitochondrial toxicity.. Toxicology in Vitro 20:5, 535-546
CrossRef81
Julio SG Montaner, Robert Hogg, Evan Wood, Thomas Kerr, Mark Tyndall, Adrian R Levy, P Richard Harrigan. (2006) The case for expanding access to highly active antiretroviral therapy to curb the growth of the HIV epidemic. The Lancet 368:9534, 531-536
CrossRef82
Catherine L. Cherry, David Nolan, Ian R. James, Elizabeth J. McKinnon, Simon A. Mallal, Michelle E. Gahan, Luxshimi Lal, Justin C. McArthur, Steven L. Wesselingh. (2006) Tissue-Specific Associations Between Mitochondrial DNA Levels and Current Treatment Status in HIV-Infected Individuals. JAIDS Journal of Acquired Immune Deficiency Syndromes 42:4, 435-440
CrossRef83
Hélène CF Côté, Zabrina L Brumme, Jennifer W Chan, Silvia Guillemi, Julio SG Montaner, P Richard Harrigan. (2006) HIV therapy, hepatitis C virus infection, antibiotics and obesity, a mitochondria killer mix?. AIDS 20:9, 1343-1345
CrossRef84
Steen B Haugaard. (2006) Toxic metabolic syndrome associated with HAART. Expert Opinion on Drug Metabolism & Toxicology 2:3, 429-445
CrossRef85
Víctor Julián Moreno-Cuerda, Montserrat Morales-Conejo, Rafael Rubio. (2006) Efectos secundarios potencialmente graves del tratamiento antirretroviral. Medicina Clínica 126:19, 744-749
CrossRef86
Evan Wood, Robert S Hogg, Benita Yip, David Moore, P Richard Harrigan, Julio SG Montaner. (2006) Impact of baseline viral load and adherence on survival of HIV-infected adults with baseline CD4 cell counts ≥ 200 cells/μl. AIDS 20:8, 1117-1123
CrossRef87
Marcello Pinti, Paolo Salomoni, Andrea Cossarizza. (2006) Anti-HIV drugs and the mitochondria. Biochimica et Biophysica Acta (BBA) - Bioenergetics 1757:5-6, 700-707
CrossRef88
David L Blazes, Catherine F Decker. (2006) Symptomatic hyperlactataemia precipitated by the addition of tetracycline to combination antiretroviral therapy. The Lancet Infectious Diseases 6:4, 249-252
CrossRef89
Denise Cassandrini, Maria Grazia Calevo, Alessandra Tessa, Giovanni Manfredi, Fabiana Fattori, Maria Chiara Meschini, Rosalba Carrozzo, Emmanuel Tonoli, Marina Pedemonte, Carlo Minetti, Federico Zara, Filippo M. Santorelli, Claudio Bruno. (2006) A new method for analysis of mitochondrial DNA point mutations and assess levels of heteroplasmy. Biochemical and Biophysical Research Communications 342:2, 387-393
CrossRef90
Rachael Jones, Brian Gazzard. (2006) HIV/AIDS pathogenesis and treatment options focusing on the viral entry inhibitors. Expert Review of Anti-infective Therapy 4:2, 303-312
CrossRef91
Christina M Wyatt, Paul E Klotman. (2006) Antiretroviral therapy and the kidney: balancing benefit and risk in patients with HIV infection. Expert Opinion on Drug Safety 5:2, 275-287
CrossRef92
Gloria Garrabou, Eduard Sanjurjo, Oscar Miro, Esteban Martinez, Ana B. Infante, Sonia Lopez, Francesc Cardellach, Josep M. Gatell, Jordi Casademont. (2006) Noninvasive Diagnosis of Mitochondrial Dysfunction in HAART‐Related Hyperlactatemia. Clinical Infectious Diseases 42:4, 584-585
CrossRef93
Vishal Patel, S Susan Hedayati. (2006) Lactic acidosis in an HIV-infected patient receiving highly active antiretroviral therapy. Nature Clinical Practice Nephrology 2:2, 109-114
CrossRef94
Michael M. Kim, Chad A. Glazer, Elizabeth Mambo, Aditi Chatterjee, Ming Zhao, David Sidransky, Joseph A. Califano. (2006) Head and neck cancer cell lines exhibit differential mitochondrial repair deficiency in response to 4NQO. Oral Oncology 42:2, 201-207
CrossRef95
V. Ciubotaru, Y. Poinsignon, C. Bellané-Chantelot, L. Saout, J.M. Mussini, V. Klein. (2006) Surdité, diabète et cancer : association fortuite ou lien étiopathogénique ?. La Revue de Médecine Interne 27:2, 159-160
CrossRef96
Christina M. Wyatt, Jonathan Winston. (2006) Renal disease in patients with HIV. Current Infectious Disease Reports 8:1, 76-81
CrossRef97
A Maagaard, M Holberg-Petersen, EA Kvittingen, L Sandvik, JN Bruun. (2006) Depletion of mitochondrial DNA copies/cell in peripheral blood mononuclear cells in HIV-1-infected treatment-naive patients. HIV Medicine 7:1, 53-58
CrossRef98
David J. Feola, Beth A. Garvy. (2005) Zidovudine plus sulfamethoxazole–trimethoprim adversely affects B lymphocyte maturation in bone marrow of normal mice. International Immunopharmacology 5:13-14, 1881-1894
CrossRef99
Matthias Banasch, Oliver Goetze, Ivo Hollborn, Bettina Hochdorfer, Kerem Bulut, Renate Schlottmann, Dirk Hagemann, Norbert H Brockmeyer, Wolfgang E Schmidt, Frank Schmitz. (2005) 13C-Methionine Breath Test Detects Distinct Hepatic Mitochondrial Dysfunction in HIV-Infected Patients With Normal Serum Lactate. JAIDS Journal of Acquired Immune Deficiency Syndromes 40:2, 149-154
CrossRef100
Cristina Mussini, Marcello Pinti, Roberto Bugarini, Vanni Borghi, Milena Nasi, Elisa Nemes, Leonarda Troiano, Giovanni Guaraldi, Andrea Bedini, Caroline Sabin, Roberto Esposito, Andrea Cossarizza. (2005) Effect of treatment interruption monitored by CD4 cell count on mitochondrial DNA content in HIV-infected patients: a prospective study. AIDS 19:15, 1627-1633
CrossRef101
Gary Kalkut. (2005) Antiretroviral therapy: an update for the non-AIDS specialist. Current Opinion in Oncology 17:5, 479-484
CrossRef102
Steen B. Haugaard, Ove Andersen, Steen B. Pedersen, Flemming Dela, Bjørn Richelsen, Jens Ole Nielsen, Sten Madsbad, Johan Iversen. (2005) Depleted skeletal muscle mitochondrial DNA, hyperlactatemia, and decreased oxidative capacity in HIV-infected patients on highly active antiretroviral therapy. Journal of Medical Virology 77:1, 29-38
CrossRef103
François-Jérôme Authier, Patrick Chariot, Romain K. Gherardi. (2005) Skeletal muscle involvement in human immunodeficiency virus (HIV)-infected patients in the era of highly active antiretroviral therapy (HAART). Muscle & Nerve 32:3, 247-260
CrossRef104
Kenneth A Lichtenstein. (2005) Redefining Lipodystrophy Syndrome. JAIDS Journal of Acquired Immune Deficiency Syndromes 39:4, 395-400
CrossRef105
Enric Pedrol, Mónica Ribell, Elisabet Deig, María del Carmen Villà, Òscar Miró, Glòria Garrabou, Anna Soler. (2005) Tratamiento de la hiperlactatemia sintomática y de la acidosis láctica en pacientes con infección por el virus de la inmunodeficiencia humana en tratamiento con inhibidores de la transcriptasa inversa análogos de los nucleósidos. Medicina Clínica 125:6, 201-204
CrossRef106
Evan Wood, Robert S Hogg, P Richard Harrigan, Julio SG Montaner. (2005) When to initiate antiretroviral therapy in HIV-1-infected adults: a review for clinicians and patients. The Lancet Infectious Diseases 5:7, 407-414
CrossRef107
Víctor J. Moreno-Cuerda, Rafael Rubio García. (2005) Acidosis láctica secundaria a tratamiento antirretroviral: ¿se puede hacer algo más?. Medicina Clínica 125:6, 213-214
CrossRef108
Maria Ristig, Henning Drechsler, William G. Powderly. (2005) Review: Hepatic Steatosis and HIV Infection. AIDS Patient Care and STDs 19:6, 356-365
CrossRef109
D. Torre, A. Pugliese. (2005) Pathogenic Mechanisms of Mitochondrial DNA Depletion in Patients with HIV-1 Infection. Clinical Infectious Diseases 40:6, 905-906
CrossRef110
Reto Nuesch, Jintanat Ananworanich, Sunee Sirivichayakul, Sasiwimol Ubolyam, Umaporn Siangphoe, Andrew Hill, David Cooper, Joep Lange, Praphan Phanuphak, Kiat Ruxrungtham. (2005) Development of HIV with Drug Resistance after CD4 Cell Count–Guided Structured Treatment Interruptions in Patients Treated with Highly Active Antiretroviral Therapy after Dual–Nucleoside Analogue Treatment. Clinical Infectious Diseases 40:5, 728-734
CrossRef111
J Bauerle, M Laguno, S Mauss, J Mallolas, J Murillas, R Miquel, G Schmutz, B Setzer, JM Gatell, UA Walker. (2005) Mitochondrial DNA depletion in liver tissue of patients infected with hepatitis C virus: contributing effect of HIV infection?. HIV Medicine 6:2, 135-139
CrossRef112
George N. Ioannou, Noel S. Weiss, Edward J. Boyko, Steven E. Kahn, Sum P. Lee. (2005) Contribution of metabolic factors to alanine aminotransferase activity in persons with other causes of liver disease. Gastroenterology 128:3, 627-635
CrossRef113
Judith C Shlay, Fehmida Visnegarwala, Glenn Bartsch, Jack Wang, Grace Peng, Wafaa M El-Sadr, Cynthia Gibert, Donald Kotler, Carl Grunfeld, Subhasree Raghavan. (2005) Body Composition and Metabolic Changes in Antiretroviral-Naive Patients Randomized to Didanosine and Stavudine vs. Abacavir and Lamivudine. JAIDS Journal of Acquired Immune Deficiency Syndromes 38:2, 147-155
CrossRef114
Leonardo Calza, Roberto Manfredi, Francesco Chiodo. (2005) Hyperlactataemia and lactic acidosis in HIV-infected patients receiving antiretroviral therapy. Clinical Nutrition 24:1, 5-15
CrossRef115
Eric Daugas, Jean-Philippe Rougier, Gary Hill. (2005) HAART-related nephropathies in HIV-infected patients. Kidney International 67:2, 393-403
CrossRef116
Grace A McComsey, Denise M Paulsen, J Tyler Lonergan, Siegrid M Hessenthaler, Charles L Hoppel, Vanessa C Williams, Robin L Fisher, Catherine L Cherry, Cathy White-Owen, Katherine A Thompson, Steve T Ross, Jaime E Hernandez, Lisa L Ross. (2005) Improvements in lipoatrophy, mitochondrial DNA levels and fat apoptosis after replacing stavudine with abacavir or zidovudine. AIDS 19:1, 15-23
CrossRef117
Jintanat Ananworanich, Bernard Hirschel. (2005) Interrupting highly active antiretroviral therapy in patients with HIV. Expert Review of Anti-infective Therapy 3:1, 51-60
CrossRef118
Catherine L. Cherry, Luxshimi Lal, Steven L. Wesselingh. (2005) Mitochondrial toxicity of nucleoside analogues: mechanism, monitoring and management. Sexual Health 2:1, 1
CrossRef119
Kees Brinkman. (2005) Lipoatrophy and mitochondrial DNA assays: see all, know all?. AIDS 19:1, 91-92
CrossRef120
Eug??nia Negredo, Jos?? Molt??, David Burger, Helene C??t??, Oscar Mir??, Josep Ribalta, Eva Mart??nez, Jordi Puig, Lidia Ruiz, Juliana Salazar, S??nia L??pez, Julio Montaner, Celestino Rey-Joly, Bonaventura Clotet. (2005) Lopinavir/Ritonavir Plus Nevirapine as a Nucleoside-Sparing Approach in Antiretroviral-Experienced Patients (NEKA Study). JAIDS Journal of Acquired Immune Deficiency Syndromes 38:1, 47-52
CrossRef121
James Dimmick. (2004) Conjugated Hyperbilirubinemia in Infancy (Mitochondrial DNA Depletion Syndrome, Liver). Pediatric and Developmental Pathology 7:6, 625-628
CrossRef122
??scar Mir??, S??nia L??pez, Marisa Rodr??guez de la Concepci??n, Esteban Mart??nez, Enric Pedrol, Gl??ria Garrabou, Marta Giralt, Francesc Cardellach, Josep M. Gatell, Francesc Vilarroya, Jordi Casademont. (2004) Upregulatory Mechanisms Compensate for Mitochondrial DNA Depletion in Asymptomatic Individuals Receiving Stavudine Plus Didanosine. JAIDS Journal of Acquired Immune Deficiency Syndromes 37:5, 1550-1555
CrossRef123
Paula Braitstein, Anita Palepu, Douglas Dieterich, Yves Benhamou, Julio SG Montaner. (2004) Special considerations in the initiation and management of antiretroviral therapy in individuals coinfected with HIV and hepatitis C. AIDS 18:17, 2221-2234
CrossRef124
A-M Bauer, T Sternfeld, S Horster, M Schunk, F-D Goebel, JR Bogner. (2004) Kinetics of lactate metabolism after submaximal ergometric exercise in HIV-infected patients. HIV Medicine 5:5, 371-376
CrossRef125
Grace McComsey, J Tyler Lonergan. (2004) Mitochondrial Dysfunction: Patient Monitoring and Toxicity Management. JAIDS Journal of Acquired Immune Deficiency Syndromes 37:Supplement 1, S30-S35
CrossRef126
Michelle L Collins, Nicole Sondel, Denise Cesar, Marc K Hellerstein. (2004) Effect of Nucleoside Reverse Transcriptase Inhibitors on Mitochondrial DNA Synthesis in Rats and Humans. JAIDS Journal of Acquired Immune Deficiency Syndromes 37:1, 1132-1139
CrossRef127
O. Miro, S. Lopez, E. Martinez, E. Pedrol, A. Milinkovic, E. Deig, G. Garrabou, J. Casademont, J. M. Gatell, F. Cardellach. (2004) Mitochondrial Effects of HIV Infection on the Peripheral Blood Mononuclear Cells of HIV-Infected Patients Who Were Never Treated with Antiretrovirals. Clinical Infectious Diseases 39:5, 710-716
CrossRef128
David Simpson, Lydia Estanislao, Scott Evans, Justin McArthur, Kendall Marcus, Melissa Truffa, Brendan Lucey, Robert Naismith, J Tyler Lonergan, David Clifford. (2004) HIV-associated neuromuscular weakness syndrome. AIDS 18:10, 1403-1412
CrossRef129
Franck Chiappini, Elina Teicher, Raphaël Saffroy, Patrick Pham, Bruno Falissard, Alain Barrier, Stephan Chevalier, Brigitte Debuire, Daniel Vittecoq, Antoinette Lemoine. (2004) Prospective evaluation of blood concentration of mitochondrial DNA as a marker of toxicity in 157 consecutively recruited untreated or HAART-treated HIV-positive patients. Laboratory Investigation 84:7, 908-914
CrossRef130
Charalambos Antoniades, Candice Macdonald, Alexander Knisely, Christopher Taylor, Suzanne Norris. (2004) Mitochondrial toxicity associated with HAART following liver transplantation in an HIV-infected recipient. Liver Transplantation 10:5, 699-702
CrossRef131
Andrew M. Tershakovec, Ian Frank, Daniel Rader. (2004) HIV-related lipodystrophy and related factors. Atherosclerosis 174:1, 1-10
CrossRef132
Julian W. Tang, Deenan Pillay. (2004) Transmission of HIV-1 drug resistance. Journal of Clinical Virology 30:1, 1-10
CrossRef133
Rao L Divi, Vernon E Walker, Nancy A Wade, Kunio Nagashima, Steven K Seilkop, Mary Ellen Adams, Carol J Nesel, J Patrick O'Neill, Elaine J Abrams, Miriam C Poirier. (2004) Mitochondrial damage and DNA depletion in cord blood and umbilical cord from infants exposed in utero to Combivir. AIDS 18:7, 1013-1021
CrossRef134
S. Pol, P. Lebra, A. Vallet-Pichard. (2004) HIV Infection and Hepatic Enzyme Abnormalities: Intricacies of the Pathogenic Mechanisms. Clinical Infectious Diseases 38:Supplement 2, S65-S72
CrossRef135
Peter L. Anderson, Thomas N. Kakuda, Kenneth A. Lichtenstein. (2004) The Cellular Pharmacology of Nucleoside‐ and Nucleotide‐Analogue Reverse‐Transcriptase Inhibitors and Its Relationship to Clinical Toxicities. Clinical Infectious Diseases 38:5, 743-753
CrossRef136
M. Bonacini. (2004) Liver Injury during Highly Active Antiretroviral Therapy: The Effect of Hepatitis C Coinfection. Clinical Infectious Diseases 38:Supplement 2, S104-S108
CrossRef137
J. S. G. Montaner, H. C. F. Cote, M. Harris, R. S. Hogg, B. Yip, P. R. Harrigan, M. V. O'Shaughnessy. (2004) Nucleoside-Related Mitochondrial Toxicity among HIV-Infected Patients Receiving Antiretroviral Therapy: Insights from the Evaluation of Venous Lactic Acid and Peripheral Blood Mitochondrial DNA. Clinical Infectious Diseases 38:Supplement 2, S73-S79
CrossRef138
Carmen de Mendoza, Anthony de Ronde, Karlijn Smolders, Francisco Blanco, Teresa Garcia-Benayas, Michel de Baar, Paloma Fernández-Casas, Juan González-Lahoz, Vincent Soriano. (2004) Changes in Mitochondrial DNA Copy Number in Blood Cells from HIV-Infected Patients Undergoing Antiretroviral Therapy. AIDS Research and Human Retroviruses 20:3, 271-273
CrossRef139
Evan Wood, Robert S. Hogg, Benita Yip, P. Richard Harrigan, Michael V. O'Shaughnessy, Julio S. G. Montaner. (2004) The Impact of Adherence on CD4 Cell Count Responses Among HIV-Infected Patients. JAIDS Journal of Acquired Immune Deficiency Syndromes 35:3, 261-268
CrossRef140
Stefano Bonora, Marta Boffito, Antonio D'Avolio, Mauro Sciandra, Anna Maria Caci, Francesca Conta, Alessandro Sinicco, Francesco G De Rosa, Giovanni Di Perri. (2004) Detection of stavudine concentrations in plasma of HIV-infected patients taking zidovudine. AIDS 18:3, 577-578
CrossRef141
Hadewych J.M. ter Hofstede, Hans L. Willems, Peter P. Koopmans. (2004) Serum l-lactate and pyruvate in HIV-infected patients with and without presumed NRTI-related adverse events compared to healthy volunteers. Journal of Clinical Virology 29:1, 44-50
CrossRef142
J. M. BARBOZA, H. MEDINA, M. DORIA, L. RIVERO, L. HERNANDEZ, N. V. JOSHI. (2004) USE OF ATOMIC FORCE MICROSCOPY TO REVEAL SPERM ULTRASTRUCTURE IN HIV-PATIENTS ON HIGHLY ACTIVE ANTIRETROVIRAL THERAPY. Systems Biology in Reproductive Medicine 50:2, 121-129
CrossRef143
P Reiss, M Casula, A De ronde, GJ Weverling, J Goudsmit, JMA Lange. (2004) Greater and more rapid depletion of mitochondrial DNA in blood of patients treated with dual (zidovudine+didanosine or zidovudine+zalcitabine) vs. single (zidovudine) nucleoside reverse transcriptase inhibitors. HIV Medicine 5:1, 11-14
CrossRef144
J. Emerit, M. Edeas, F. Bricaire. (2004) Neurodegenerative diseases and oxidative stress. Biomedicine & Pharmacotherapy 58:1, 39-46
CrossRef145
Andrea Cossarizza, Graeme Moyle. (2004) Antiretroviral nucleoside and nucleotide analogues and mitochondria. AIDS 18:2, 137-151
CrossRef146
Shafer, Robert W., Smeaton, Laura M., Robbins, Gregory K., De Gruttola, Victor, Snyder, Sally W., D'Aquila, Richard T., Johnson, Victoria A., Morse, Gene D., Nokta, Mostafa A., Martinez, Ana I., Gripshover, Barbara M., Kaul, Pamposh, Haubrich, Richard, Swingle, Mary, McCarty, S. Debra, Vella, Stefano, Hirsch, Martin S., Merigan, Thomas C., . (2003) Comparison of Four-Drug Regimens and Pairs of Sequential Three-Drug Regimens as Initial Therapy for HIV-1 Infection. New England Journal of Medicine 349:24, 2304-2315
Full Text147
Òscar Miró, Sònia López, Esteban Martínez, Benjamín Rodríguez-Santiago, José L. Blanco, Ana Milinkovic, Jose M. Miró, Virginia Nunes, Jordi Casademont, Josep M. Gatell, Francesc Cardellach. (2003) Short Communication: Reversible Mitochondrial Respiratory Chain Impairment During Symptomatic Hyperlactatemia Associated with Antiretroviral Therapy. AIDS Research and Human Retroviruses 19:11, 1027-1032
CrossRef148
J Tyler Lonergan, R Edward Barber, W Christopher Mathews. (2003) Safety and efficacy of switching to alternative nucleoside analogues following symptomatic hyperlactatemia and lactic acidosis. AIDS 17:17, 2495-2499
CrossRef149
Corsino Rey, Soledad Prieto, Alberto Medina, Carlos P??rez, Andr??s Concha, Sergio Men??ndez. (2003) Fatal lactic acidosis during antiretroviral therapy. Pediatric Critical Care Medicine 4:4, 485-487
CrossRef150
Alice K. Pau. (2003) Antiretroviral therapy-associated serious and life-threatening toxicities. Current Infectious Disease Reports 5:5, 429-438
CrossRef151
ANTONI NOGUERA, CLAUDIA FORTUNY, EMILIA SANCHEZ, RAFAEL ARTUCH, MARIA ANTONIA VILASECA, CARMEN MU??OZ-ALMAGRO, JORDI POU, RAFAEL JIM??NEZ. (2003) Hyperlactatemia in human immunodeficiency virus-infected children receiving antiretroviral treatment. The Pediatric Infectious Disease Journal 22:9, 778-782
CrossRef152
ARIANE ALIMENTI, DAVID R. BURDGE, GINA S. OGILVIE, DEBORAH M. MONEY, JOHN C. FORBES. (2003) Lactic acidemia in human immunodeficiency virus-uninfected infants exposed to perinatal antiretroviral therapy. The Pediatric Infectious Disease Journal 22:9, 782-788
CrossRef153
Roberto Manfredi, Roberto Motta, Daniela Patrono, Leonardo Calza, Francesco Chiodo, Paola Boni. (2003) Frequency, risk factors and features of hyperlactatemia in a large number of patients undergoing antiretroviral therapy. AIDS 17:14, 2131-2133
CrossRef154
Stefano Vella. (2003) Future Treatment Perspectives. JAIDS Journal of Acquired Immune Deficiency Syndromes 34:Supplement 1, S95-S100
CrossRef155
Lynette A Gillis, Ronald J Sokol. (2003) Gastrointestinal manifestations of mitochondrial disease. Gastroenterology Clinics of North America 32:3, 789-817
CrossRef156
Rosa Polo, Susana Martinez, Pilar Madrigal, Miguel Gonzalez-Mu??oz. (2003) Factors Associated With Mitochondrial Dysfunction in Circulating Peripheral Blood Lymphocytes From HIV-Infected People. JAIDS Journal of Acquired Immune Deficiency Syndromes 34:1, 32-36
CrossRef157
Julio S. G. Montaner, H??l??ne C. F. C??t??, Marianne Harris, Robert S. Hogg, Benita Yip, Jennifer W. Chan, P. Richard Harrigan, Michael V. O'Shaughnessy. (2003) Mitochondrial Toxicity in the Era of HAART: Evaluating Venous Lactate and Peripheral Blood Mitochondrial DNA in HIV-Infected Patients Taking Antiretroviral Therapy. JAIDS Journal of Acquired Immune Deficiency Syndromes 34:Supplement 1, S85-S90
CrossRef158
Caroline Petit, Dominique Mathez, Cyrille Barthélémy, Thierry Leste-Lasserre, Robert K. Naviaux, Pierre Sonigo, Jacques Leibowitch. (2003) Quantitation of Blood Lymphocyte Mitochondrial DNA for the Monitoring of Antiretroviral Drug–Induced Mitochondrial DNA Depletion. JAIDS Journal of Acquired Immune Deficiency Syndromes 33:4, 461-469
CrossRef159
B??atrice Barret, Marc Tardieu, Pierre Rustin, Catherine Lacroix, Brigitte Chabrol, Isabelle Desguerre, Catherine Dollfus, Marie-Jeanne Mayaux, St??phane Blanche. (2003) Persistent mitochondrial dysfunction in HIV-1-exposed but uninfected infants. AIDS 17:12, 1769-1785
CrossRef160
Toshiyuki Miura, Mieko Goto, Noriaki Hosoya, Takashi Odawara, Yoshihiro Kitamura, Tetsuya Nakamura, Aikichi Iwamoto. (2003) Depletion of mitochondrial DNA in HIV-1-infected patients and its amelioration by antiretroviral therapy. Journal of Medical Virology 70:4, 497-505
CrossRef161
Vicenç Falcó, Manuel Crespo, Esteban Ribera. (2003) Lactic acidosis related to nucleoside therapy in HIV-infected patients. Expert Opinion on Pharmacotherapy 4:8, 1321-1329
CrossRef162
Ninad Desai, Mudit Mathur, Jeremy Weedon. (2003) Lactate levels in children with HIV/AIDS on highly active antiretroviral therapy. AIDS 17:10, 1565-1568
CrossRef163
K Gourlain, B Amellal, Z Ait Arkoub, N Dupin, C Katlama, V Calvez. (2003) Quantitative analysis of human mitochondrial DNA using a real-time PCR assay. HIV Medicine 4:3, 287-292
CrossRef164
Miriam C. Poirier, Rao L. Divi, Lena Al-Harthi, Ofelia A. Olivero, Vi Nguyen, Brettania Walker, Alan L. Landay, Vernon E. Walker, Manhattan Charurat, William A. Blattner. (2003) Long-Term Mitochondrial Toxicity in HIV-Uninfected Infants Born to HIV-Infected Mothers. JAIDS Journal of Acquired Immune Deficiency Syndromes 33:2, 175-183
CrossRef165
Andrew D. Badley, Thomas Roumier, Julian J. Lum, Guido Kroemer. (2003) Mitochondrion-mediated apoptosis in HIV-1 infection. Trends in Pharmacological Sciences 24:6, 298-305
CrossRef166
F. Bonnet, M. Bonarek, P. Morlat, P. Mercie, M. Dupon, M. C. Gemain, D. Malvy, N. Bernard, J. L. Pellegrin, J. Beylot. (2003) Risk Factors for Lactic Acidosis in HIV‐Infected Patients Treated with Nucleoside Reverse‐Transcriptase Inhibitors: A Case‐Control Study. Clinical Infectious Diseases 36:10, 1324-1328
CrossRef167
Greg Biesecker, Susan Karimi, John Desjardins, Dennis Meyer, Beth Abbott, Ray Bendele, Frank Richardson. (2003) Evaluation of mitochondrial DNA content and enzyme levels in tenofovir DF-treated rats, rhesus monkeys and woodchucks. Antiviral Research 58:3, 217-225
CrossRef168
Mona R Loutfy, Nancy L Sheehan, John E Goodhew, Sharon L Walmsley. (2003) Inclusion body myositis. AIDS 17:8, 1266-1267
CrossRef169
O. Lopez, D. Bonnefont-Rousselot, M. Edeas, J. Emerit, F. Bricaire. (2003) Could antioxidant supplementation reduce antiretroviral therapy-induced chronic stable hyperlactatemia?. Biomedicine & Pharmacotherapy 57:3-4, 113-116
CrossRef170
Emma L. Hammond, David Sayer, David Nolan, Ulrich A. Walker, Anthony de Ronde, Julio S.G. Montaner, Helene C.F. Cote, Michelle E. Gahan, Catherine L. Cherry, Steven L. Wesselingh, Peter Reiss, Simon Mallal. (2003) Assessment of precision and concordance of quantitative mitochondrial DNA assays: a collaborative international quality assurance study. Journal of Clinical Virology 27:1, 97-110
CrossRef171
David Novak, James H. Lewis. (2003) Drug-induced liver disease. Current Opinion in Gastroenterology 19:3, 203-215
CrossRef172
Theresa M Wardell, Elaine Ferguson, Patrick F Chinnery, Gillian M Borthwick, Robert W Taylor, Graham Jackson, Alan Craft, Robert N Lightowlers, Neil Howell, Douglass M Turnbull. (2003) Changes in the human mitochondrial genome after treatment of malignant disease. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 525:1-2, 19-27
CrossRef173
Bruce Shiramizu, Kelsey M. Shikuma, Lori Kamemoto, Mariana Gerschenson, Guliz Erdem, Marcello Pinti, Andrea Cossarizza, Cecilia Shikuma. (2003) Placenta and Cord Blood Mitochondrial DNA Toxicity in HIV-Infected Women Receiving Nucleoside Reverse Transcriptase Inhibitors During Pregnancy. JAIDS Journal of Acquired Immune Deficiency Syndromes 32:4, 370-374
CrossRef174
T. D. Langford, S. L. Letendre, G. J. Larrea, E. Masliah. (2003) Changing Patterns in the Neuropathogenesis of HIV During the HAART Era. Brain Pathology 13:2, 195-210
CrossRef175
François Becher, Alain G Pruvost, Dimitri D Schlemmer, Christophe A Créminon, Cecile M Goujard, Jean François Delfraissy, Henri C Benech, Jacques J Grassi. (2003) Significant levels of intracellular stavudine triphosphate are found in HIV-infected zidovudine-treated patients. AIDS 17:4, 555-561
CrossRef176
Andrea Cossarizza. (2003) Tests for mitochondrial function and DNA: potentials and pitfalls. Current Opinion in Infectious Diseases 16:1, 5-10
CrossRef177
Susanne Diehl, Pietro Vernazza, Andreas Trein, Eiko Schnaitmann, Bodo Grimbacher, Bernhard Setzer, Ulrich A Walker. (2003) Mitochondrial DNA and sperm quality in patients under antiretroviral therapy. AIDS 17:3, 450-451
CrossRef178
Apodaca, Aaron A., Rakita, Robert M., . (2003) Linezolid-Induced Lactic Acidosis. New England Journal of Medicine 348:1, 86-87
Full Text179
Kenneth A. Lichtenstein, Kathleen M. Delaney, Carl Armon, Douglas J. Ward, Anne C. Moorman, Kathleen C. Wood, Scott D. Holmberg. (2003) Incidence of and Risk Factors for Lipoatrophy (Abnormal Fat Loss) in Ambulatory HIV-1-Infected Patients. JAIDS Journal of Acquired Immune Deficiency Syndromes 32:1, 48-56
CrossRef180
Roger Paredes, Bonaventura Clotet. (2003) New antiretroviral drugs and approaches to HIV treatment. AIDS 17:Supplement 4, S85-S96
CrossRef181
Louis H. Weimer. (2003) Medication-induced peripheral neuropathy. Current Neurology and Neuroscience Reports 3:1, 86-92
CrossRef182
F Bonnet, M Bonarek, A Abridj, P Mercié, M Dupon, M.-C Gemain, D Malvy, N Bernard, J.-L Pellegrin, P Morlat, J Beylot. (2003) Acidose lactique sévère chez les patients infectés par le VIH traités par inhibiteurs nucléosidiques de la reverse transcriptase : 9 cas. La Revue de Médecine Interne 24:1, 11-16
CrossRef183
Julianna Lisziewicz, Andrea Foli, Mark Wainberg, Franco Lori. (2003) Hydroxyurea in the Treatment of HIV Infection. Drug Safety 26:9, 605-624
CrossRef184
Keith Henry, Alejo Erice, Henry H Balfour, Max Schmeling, Jessica Berthiaume, Ken Wallace. (2002) Lymphocyte mitochondrial biomarkers in asymptomatic HIV-1-infected individuals treated with nucleoside reverse transcriptase inhibitors. AIDS 16:18, 2485-2487
CrossRef185
Georg M.N. Behrens, Anne-Rose Boerner, Klaus Weber, Joerg van den Hoff, Johann Ockenga, Georg Brabant, Reinhold E. Schmidt. (2002) Impaired glucose phosphorylation and transport in skeletal muscle cause insulin resistance in HIV-1–infected patients with lipodystrophy. Journal of Clinical Investigation 110:9, 1319-1327
CrossRef186
Julia James, Alastair Carruthers, Jean Carruthers. (2002) HIV-Associated Facial Lipoatrophy. Dermatologic Surgery 28:11, 979-986
CrossRef187
Daniel Vittecoq, Claude Jardel, Cyrille Barthélémy, Lélia Escaut, Nathalie Cheminot, Sandrine Chapin, Damien Sternberg, Thierry Maisonobe, Anne Lombès. (2002) Mitochondrial Damage Associated With Long-Term Antiretroviral Treatment: Associated Alteration or Causal Disorder?. JAIDS Journal of Acquired Immune Deficiency Syndromes 31:3, 299-308
CrossRef188
(2002) Mitochondrial DNA and Nucleoside Toxicity. New England Journal of Medicine 347:3, 216-218
Full Text189
&NA;. (2002) Antiretrovirals: mitochondrial DNA levels a marker of toxicity. Reactions Weekly &NA;:894, 4
CrossRef
- Letters
