Original Article
Paternally Inherited Inactivating Mutations of the GNAS1 Gene in Progressive Osseous Heteroplasia
N Engl J Med 2002; 346:99-106January 10, 2002
- Abstract
Background
Progressive osseous heteroplasia (POH), an autosomal dominant disorder, is characterized by extensive dermal ossification during childhood, followed by disabling and widespread heterotopic ossification of skeletal muscle and deep connective tissue. Occasional reports of mild heterotopic ossification in Albright's hereditary osteodystrophy (AHO) and a recent report of two patients with AHO who had atypically extensive heterotopic ossification suggested a common genetic basis for the two disorders. AHO is caused by heterozygous inactivating mutations in the GNAS1 gene that result in decreased expression or function of the alpha subunit of the stimulatory G protein (Gsα) of adenylyl cyclase.
Methods
We tested the hypothesis that GNAS1 mutations cause POH, using the polymerase chain reaction to amplify GNAS1 exons and exon–intron boundaries in 18 patients with sporadic or familial POH.
Results
Heterozygous inactivating GNAS1 mutations were identified in 13 of the 18 probands with POH. The defective allele in POH is inherited exclusively from fathers, a result consistent with a model of imprinting for GNAS1. Direct evidence that the same mutation can cause either POH or AHO was observed within a single family, in which the phenotype correlated with the parental origin of the mutant allele.
Conclusions
Paternally inherited inactivating GNAS1 mutations cause POH. This finding extends the range of phenotypes derived from haploinsufficiency of GNAS1, provides evidence that imprinting is a regulatory mechanism for GNAS1 expression, and suggests that Gsα is a critical negative regulator of osteogenic commitment in nonosseous connective tissues.
Media in This Article
Figure 2
Pedigrees of Six Families with Progressive Osseous Heteroplasia (POH).Figure 3
Heterozygous Mutations in Patients with Progressive Osseous Hyperplasia (POH).Article Activity
- Article
Bone formation is a highly regulated process that generally restricts ossification to the skeleton, yet the molecular control of bone-cell differentiation is not well understood. Progressive osseous heteroplasia (POH; number 166350 in Mendelian Inheritance in Man [MIM], a catalogue of inherited diseases1) is a rare disorder characterized by dermal ossification during childhood (Figure 1AFigure 1
Classic Clinical and Radiographic Appearance of Progressive Osseous Heteroplasia (POH) in Three Children.), with progressive and extensive formation of heterotopic bone within deeper tissues (Figure 1B and Figure 1C).2-6 POH first appears during infancy with the eruption of islands of heterotopic bone in the reticular dermis and subcutaneous fat. Over time, these ossified areas coalesce into plaques that may invade fascia, skeletal muscle, tendons, and ligaments, resulting in ankylosis of affected joints and focal retardation of the growth of involved limbs.2,3,6,7 Progression of dermal ossification into deep connective tissues is the defining feature of POH.2,8 POH is not associated with trauma, infection, or metabolic abnormalities and is distinct from fibrodysplasia ossificans progressiva (MIM number 135100).8 POH may be either sporadic or inherited as an autosomal dominant trait.2,6 The lack of large, multigenerational families or a naturally occurring animal model has impeded gene identification. Reports of dermal and subcutaneous ossification in patients with Albright's hereditary osteodystrophy (AHO),9 a complex disorder characterized by developmental defects and dysmorphologies, suggested the possibility of a common molecular basis for POH and AHO.5 AHO-specific dysmorphologies are often associated with resistance to parathyroid hormone and with resistance to other hormones (in which case the disorder is referred to as pseudohypoparathyroidism type 1a). When AHO occurs without hormone resistance in families with pseudohypoparathyroidism type 1a, the disorder is described as pseudopseudohypoparathyroidism.
AHO is caused by heterozygous inactivating mutations in GNAS1, the gene for guanine nucleotide-binding protein (G protein) alpha stimulating activity polypeptide 1, that result in decreased expression or function of the alpha subunit of the stimulatory G protein (Gsα) of adenylyl cyclase.9 Although heterotopic ossification in patients with AHO is milder and more superficial than that in patients with POH, the recent description10 of inactivating GNAS1 mutations, decreased Gsα activity, or both in two patients with features of both AHO and severe progressive heterotopic ossification provided a further rationale to investigate GNAS1 as a candidate gene for POH.
Methods
Subjects
We evaluated subjects from 18 unrelated kindreds with familial POH (6 cases) or sporadic POH (12 cases). The protocol was approved by the investigational review boards of the Children's Hospital of Philadelphia and the University of Pennsylvania, and written informed consent was obtained from the subjects or their parents. Patients from Families 3,6 5, 12, and 13,2 8,3 11,11 16,12 and 1813 have been previously described in case reports.
Polymerase-Chain-Reaction Amplification and Sequencing of Genomic DNA
Genomic DNA was isolated directly from blood or from Epstein–Barr virus–transformed lymphocyte lines with the use of DNA blood-isolation reagents (QIAamp, Qiagen, Valencia, Calif.); it was amplified with the use of oligonucleotide primers flanking exons 2 to 13 of the human GNAS1 gene14 under previously reported polymerase-chain-reaction (PCR) conditions.15 For exon 1, the primer pair 5'ATGGGCTGCCTCGGGAACAGTA (forward; beginning at the initiator codon) and 5'CCCTTACCCAGCAGCAGCAGGC (reverse) was used for 40 cycles: 1 minute at 94°C, 40 seconds at 70°C, and 1 minute at 72°C. Each PCR reaction contained 200 ng of genomic DNA, each primer at a concentration of 0.4 μM, 0.08 mM deoxynucleoside triphosphates (Pharmacia, Piscataway, N.J.), 1.5 mM magnesium chloride, and 1.25 U of Taq polymerase (Life Technologies, Gaithersburg, Md.). Products were sequenced by the DNA Sequencing Core Facility of the University of Pennsylvania School of Veterinary Medicine.
RNA Isolation and Reverse Transcriptase–PCR Analysis
The total RNA from lymphoblastoid cell lines was isolated with use of Trizol reagent (Life Technologies), and poly(A)+ RNA was isolated with use of Micro-FastTrack reagents (Invitrogen, Carlsbad, Calif.). First-strand complementary DNA (cDNA) was synthesized from 1 μg of total RNA with the use of 12.5 μg of oligo-dT primer per milliliter and 1 mg of RNasin (Promega, Madison, Wis.) per milliliter, 5 U of SuperScript II reverse transcriptase (Life Technologies) per milliliter, 5 mM magnesium chloride, 10 mM dithiothreitol, and 1 mM deoxynucleoside triphosphates (Pharmacia) in a final volume of 10 μl at 42°C for 1 hour, followed by heat inactivation at 95°C for 10 minutes. First-strand cDNA (5 μl) was amplified by PCR with 1.5 mM magnesium chloride, 2.5 units of Amplitaq (Perkin–Elmer, Norwalk, Conn.), and 50 ng of each forward and reverse primer in a final volume of 20 μl for 40 cycles: one minute at 94°C, one minute at 53° to 72°C (optimized for each primer pair), and two minutes at 72°C. The products were gel-purified and sequenced as above. Primer pairs to amplify GNAS1 cDNA were designed with MacVector (Accelrys, San Diego, Calif.).
The GenBank accession numbers are AH002748 for GNAS1 human genomic DNA and NM_000516 for GNAS1 human cDNA.
Results
Inheritance Patterns in Families with POH
Subjects with POH from 18 unrelated families were examined (Figure 2Figure 2
Pedigrees of Six Families with Progressive Osseous Heteroplasia (POH).). In four families (Families 1, 2, 3, and 4), children inherited POH from an affected father, a finding consistent with autosomal dominant inheritance. Two additional families (Families 5 and 18) had affected siblings with no affected parent. The severity and distribution of heterotopic ossification varied among affected members in each family; at least one affected person in each family had severe progressive heterotopic ossification during childhood, whereas other affected family members had dermal and subcutaneous ossification later in life, with slower progression to deeper tissues. The remaining 12 families each had only one member with POH. Affected persons had no primary skeletal or developmental defects and no laboratory or clinical evidence of hormone resistance.Identification of GNAS1 Mutations in Subjects with POH
Subjects with POH were screened for mutations in GNAS1 by PCR amplification and DNA sequencing of exons 1 to 13, all splice junctions, and some small introns. Heterozygous mutations were identified in 13 of 18 families: in 12 families, affected persons had small insertions, deletions, or tandem duplications that resulted in frame shifts predicted to cause premature termination of translation of the messenger RNA (mRNA) and loss of protein function (Figure 3Figure 3
Heterozygous Mutations in Patients with Progressive Osseous Hyperplasia (POH). and Table 1Table 1
GNAS1 Mutations and mRNA Expression in Patients with Progressive Osseous Heteroplasia (POH).). In one family, Family 14, a single-nucleotide, G-to-C mutation altered the invariant AG dinucleotide of the intron 12 acceptor splice site (Figure 3). Mutation of the conserved AG dinucleotide to AC results in the use of a downstream AG as the acceptor site and production of a frame-shifted mRNA (data not shown).No GNAS1 mutation was identified in 2 of 6 familial cases (Figure 2; Families 3 and 4) and 3 of 12 sporadic cases. Large deletions or rearrangements of the GNAS1 gene of these subjects were excluded by Southern blot analysis of genomic DNA.
Nonpenetrant GNAS1 Mutations in Families with POH
In four kindreds with POH, we examined genomic DNA from phenotypically normal parents of affected children for GNAS1 mutations. The clinically unaffected father in Family 5 (Figure 2) had the same single-nucleotide deletion in exon 10 as his three affected daughters, indicating the absence of penetrance of this mutation in the father. Similarly, the unaffected father in Family 18 (Subject I-1 in Figure 2) carried the same deletion in exon 7 that was identified in his five affected daughters. In both Family 5 and Family 18, the unaffected mother and the unaffected siblings did not have the mutation. By contrast, the single affected person in Family 6 (pedigree not shown) and Subject II-1 in Family 1 (Figure 2 and Table 1) presumably had new mutations, because none of their parents carried that mutation, although gonadal mosaicism in a parent is possible. With the exception of the unaffected fathers in Families 5 and 18, all affected subjects who were tested in families with inheritance of POH, but none of the unaffected subjects who were tested in such families, shared the same GNAS1 mutation.
Expression of GNAS1 mRNA in POH
According to reverse-transcriptase–PCR amplification of GNAS1 mRNA from 10 subjects with identified mutations, only 2 (from Families 2 and 14) had expression of both normal and mutant GNAS1 transcripts (Table 1). Both subjects had a mutation near the 3' end of the gene: one was a frame shift in exon 13, and the other was an altered intron 12 acceptor splice site. The remaining eight subjects had only the normal mRNA sequence. This result indicated that mRNA from the mutant GNAS1 allele was not synthesized or was rapidly degraded, probably through nonsense-mediated decay,16 a cellular mechanism causing the rapid turnover of mRNA that contains nonsense and frame-shift mutations.
Variable Expression of GNAS1 Mutations and Parental Inheritance Patterns
The same 4-bp deletion found in Families 1, 9, 11, and 18 has been identified as the basis for GNAS1 haploinsufficiency in several patients with AHO.17 The 348delC frame-shift mutation identified in two subjects with POH from Families 6 and 12 (Table 1) has also been reported in a patient with AHO.18 Thus, the identical mutations in GNAS1 can result in widely varying clinical phenotypes. All other GNAS1 mutations identified in patients with POH are unique.
Direct evidence of variable expression of the same GNAS1 mutation was observed within a single family, and the phenotype correlated with the parental origin of the mutant allele (Family 18 in Figure 2). The proband (Subject II-8) had classic features of POH (severe cutaneous and subcutaneous ossification and progressive heterotopic ossification of skeletal muscle). Four of her five sisters had a milder POH phenotype. The proband and her affected siblings had a 4-bp frame-shift deletion in GNAS1 exon 7. The clinically unaffected father (Subject I-1) carried the mutation, but the unaffected mother did not, indicating inheritance of the mutant GNAS1 allele from a father with a nonpenetrant mutation. Nonpenetrance was also evident in Subject I-1 in Family 5. In both cases of fathers with nonpenetrant mutations, the parental origin of the mutated allele could not be determined. In Family 18, three children of the proband's sisters (Subjects III-3, III-7, and III-10 in Figure 2) exhibited features of AHO, including traces of subcutaneous ossification. Subcutaneous ossification was also noted in a fourth child (Subject III-6), who died suddenly at five months of age.13 The two children available for examination (Subjects III-3 and III-7) carried the GNAS1 mutation. The findings in this family support the hypothesis that the parental origin of the mutant GNAS1 allele determines whether POH or AHO will develop in a child.
Discussion
G proteins are members of a superfamily of guanosine triphosphate–binding proteins.19 All members of this superfamily bind guanine nucleotides with high affinity and specificity, possess intrinsic guanosine triphosphatase activity, and function as molecular switches: they are “on” in the guanosine triphosphate–bound conformation and “off” after hydrolysis of guanosine triphosphate to guanosine diphosphate. The most clearly defined function of G proteins is in signal transduction. A large variety of extracellular first messengers, such as peptide and glycoprotein hormones, neurotransmitters, growth factors, chemotactic agents, and sensory signals, regulate cellular activity or function by binding to cell-surface receptors that are associated with G proteins. The G proteins act as timing switches to regulate the generation of intracellular second messengers, including cyclic AMP.
During the past decade, G proteins have been the focus of intense investigation, with particular interest in the investigation of Gs, the stimulatory G protein of adenylyl cyclase, as a basis for human disease.19 At least three disorders with features of dysregulated osteogenesis are associated with somatic or germ-line mutations in GNAS1, the gene that encodes Gsα, the alpha subunit of Gs. McCune–Albright syndrome is caused by postzygotic mutations that activate Gsα and cause constitutive (hormone-independent) activation of adenylyl cyclase,20 whereas AHO9 and platelike osteoma cutis21 are caused by inactivating germ-line GNAS1 mutations. We determined that another disorder of osteogenesis, POH, is due to inactivating mutations in the same gene.
Phenotypic expression of genetic disorders caused by single-gene mutations can be highly variable, most notably in autosomal dominant conditions.22 Many of these disorders vary, either in the severity of a solitary abnormality or in the characteristic set of seemingly unrelated abnormalities, or in both. Inactivating mutations in GNAS1 have both these effects in AHO. Affected subjects have a wide range of developmental and somatic defects of variable severity, including subcutaneous ossification, skeletal dysmorphology, obesity, mental retardation, and hormone resistance. By contrast, patients with POH have a single characteristic disease manifestation (progressive heterotopic ossification) that can vary in its degree of severity.
In addition to variable expression in POH, we observed nonpenetrance (i.e., the complete failure of disease expression in some carriers of a gene mutation) in two families. Carriers of nonpenetrant GNAS1 mutations could have new mutations with a mosaic distribution that excludes cells that would express disease characteristics. Alternatively, nonpenetrance or variable expression could be due to influences from other genetic loci, epigenetic modifications, or environmental factors.
For several human genetic disorders, expression of the disease phenotype is influenced by whether the disease has been inherited from the father or the mother. Recent studies showing that maternal and paternal alleles of some genes do not function identically have helped clarify this phenomenon, known as imprinting.23 A consistent difference between AHO and POH is the parental origin of the mutant GNAS1 allele. This is illustrated by Family 18, in which paternal inheritance of the mutant GNAS1 allele resulted in POH, and maternal inheritance resulted in AHO.
Previous clinical and molecular studies9 have revealed that maternal transmission of GNAS1 mutations leads to the complete form of AHO, termed pseudohypoparathyroidism type 1a (MIM 103580), in which there is resistance to parathyroid hormone and other hormones whose receptors require Gsα to stimulate adenylyl cyclase. By contrast, paternal inheritance of a GNAS1 mutation causes a less severe form of AHO, termed pseudopseudohypoparathyroidism (MIM 300800), in which the somatic defects are accompanied by normal hormone responsiveness. As in pseudopseudohypoparathyroidism, paternal inheritance of a mutant GNAS1 allele in patients with POH is associated with a lack of hormone resistance, but the two clinical phenotypes are otherwise clearly distinguishable.8,9
Molecular studies of the GNAS1 gene show monoallelic transcript expression according to the parent of origin,24-27 a result consistent with parental imprinting. However, the manner of expression is far more complex than anticipated. In addition to a Gsα-specific exon 1, three unique, alternative first exons are spliced to exons 2 through 13 of GNAS1. One of the alternative exons encodes the neurosecretory protein NESP55 and is expressed exclusively from the maternal allele, whereas the other two alternative first exons are transcribed only from the paternal allele.24,25,28 Expression of the Gsα-specific exon 1 appears to be biallelic in most tissues that have been examined,24,25,29 although expression exclusively from the maternally derived allele has been documented in some tissues (e.g., murine renal cortex and adipose tissue30 and human pituitary31).
Given the complexity of transcript synthesis at the GNAS1 locus, it is not surprising that a wide variety of phenotypic effects results from GNAS1 mutations and that the phenotypes are influenced by the parent from whom the mutant allele is inherited. Hormone resistance (such as that in pseudohypoparathyroidism type 1a) is strongly correlated with mutations in the maternally derived allele, indicating that the maternal allele is critical (at least in some tissues) for cellular functions required for signal transduction. In contrast, severe, progressive heterotopic ossification, such as that found in POH, correlates with paternal inheritance of the GNAS1 mutation, suggesting that the paternal allele specifically influences progressive osteoblastic differentiation, proliferation of cells in soft connective tissues, or both.
Why paternal inheritance of a GNAS1 mutation should result in pseudopseudohypoparathyroidism in some families and POH in others is unclear. Other phenotypes that have been associated with GNAS1 inactivation (such as features of AHO — including mild dermal ossification — that occur in both pseudohypoparathyroidism type 1a and pseudopseudohypoparathyroidism) seem to be influenced by GNAS1 mutations in either the maternal or the paternal allele. Tissue and developmental specificity of imprinting at the GNAS1 locus is a plausible cause of the disparity among phenotypes. Overlapping patterns of variable expressivity (i.e., a range of phenotypic severity) by GNAS1 maternal, paternal, and biallelic transcripts may result in a complex set of phenotypes among patients with GNAS1-inactivating mutations.
Our findings expand the spectrum of phenotypic variability attributable to mutations in the GNAS1 gene and establishes GNAS1 as an important regulator of osteoblastic commitment in nonosteogenic connective tissues. Further investigation into imprinting effects and the regulation and function of the multiple transcripts of the GNAS1 locus will be required to understand the genotypic complexity and phenotypic variability associated with mutations at this locus.
Supported by grants from the Progressive Osseous Heteroplasia Association, the International Fibrodysplasia Ossificans Progressiva Association, the New Jersey Association of Student Councils, the Ian Cali Fund, the Roemex Fellowship, Shriners Hospitals for Children (85480, to Dr. Whyte), the National Institute of Arthritis and Musculoskeletal and Skin Diseases (R01-AR46831, to Dr. Shore, and R01-AR41916, to Dr. Kaplan), and the National Institute of Diabetes and Digestive and Kidney Diseases (R01-DK34281, to Dr. Levine) and by the Isaac and Rose Nassau Professorship of Orthopaedic Molecular Medicine.
We are indebted to R. Bufo, J.P. Chanoine, J.E. Clarkson, J.M. Connor, N. Esterly, J. Fairly, F. Gannon, L. Gordon, G. Lehine, G.D. MacEwen, T. Malpass, S.P. Robertson, S. Rosenfeld, E. Shinall Miller, and J.A. Urtizberea for valuable discussions and referrals of patients; to J.K. Fang of the University of Pennsylvania School of Veterinary Medicine DNA Sequencing Facility; and to F. Gardner, S. Roth, R. Elkinson, M. Vamvakis, and J. Peeper for encouragement and support. We dedicate this work to our patients with POH worldwide.
Source Information
From the Departments of Orthopaedic Surgery (E.M.S., J.A., M.L., M.X., F.S.K.), Genetics (E.M.S., M.A.Z.), and Medicine (F.S.K.), University of Pennsylvania School of Medicine, Philadelphia; the Ilyssa Center for Molecular and Cellular Endocrinology (S.J.B., M.A.L.) and the Departments of Medicine (S.J.B.) and Pediatrics (M.A.L.), Johns Hopkins University School of Medicine, Baltimore; Genetic Health Services, Victoria and Murdoch Children's Research Institute, Royal Children's Hospital, Melbourne, Australia (R.J.M.G.); and the Center for Metabolic Bone Disease and Molecular Research, Shriners Hospitals for Children, and the Division of Bone and Mineral Diseases, Washington University School of Medicine, St. Louis (M.P.W.).
Address reprint requests to Dr. Shore at the Department of Orthopaedic Surgery, University of Pennsylvania School of Medicine, 424 Stemmler Hall, 36th and Hamilton Walk, Philadelphia, PA 19104-6018, or at shore@mail.med.upenn.edu.
- References
References
1
McKusick VA, Francomano CA, Antonarakis SA, et al. Mendelian inheritance in man: a catalog of human genes and genetic disorders. 12th ed. Baltimore: Johns Hopkins University Press, 1998.
2
Kaplan FS ,Craver R ,MacEwen GD , et al. Progressive osseous heteroplasia: a distinct developmental disorder of heterotopic ossification: two new case reports and follow-up of three previously reported cases. J Bone Joint Surg Am 1994;76:425-436
Web of Science | Medline3
Schmidt AH ,Vincent KA ,Aiona MD . Hemimelic progressive osseous heteroplasia: a case report. J Bone Joint Surg Am 1994;76:907-912
Web of Science | Medline4
Athanasou NA ,Benson MK ,Brenton BP ,Smith R . Progressive osseous heteroplasia: a case report. Bone 1994;15:471-475
CrossRef | Web of Science | Medline5
Kaplan FS . Skin and bones. Arch Dermatol 1996;132:815-818
CrossRef | Web of Science | Medline6
Urtizberea JA ,Testart H ,Cartault F ,Boccon-Gibod L ,Le Merrer M ,Kaplan FS . Progressive osseous heteroplasia: report of a family. J Bone Joint Surg Br 1998;80:768-771
CrossRef | Web of Science | Medline7
Rosenfeld SR ,Kaplan FS . Progressive osseous heteroplasia in male patients: two new case reports. Clin Orthop 1995;317:243-245
Web of Science | Medline8
Kaplan FS ,Shore EM . Progressive osseous heteroplasia. J Bone Miner Res 2000;15:2084-2094
CrossRef | Web of Science | Medline9
Jan de Beur SM, Levine MA. Pseudohypoparathyroidism: clinical, biochemical, and molecular features. In: Bilezikian JP, ed. The parathyroids: basic and clinical concepts. 2nd ed. San Diego, Calif.: Academic Press, 2001:807-25.
10
Eddy MC ,De Beur SM ,Yandow SM , et al. Deficiency of the α-subunit of the stimulatory G protein and severe extraskeletal ossification. J Bone Miner Res 2000;15:2074-2083
CrossRef | Web of Science | Medline11
Pisani V ,Cavallo L ,Lospalluti M ,Bufo R ,Bonifazi E . Primary osteoma cutis. Pediatr Dermatol News 1985;4:170-17512
Rodriguez-Jurado R ,Gonzalez-Crussi F ,Poznanski AK . Progressive osseous heteroplasia, uncommon cause of soft tissue ossification: a case report and review of the literature. Pediatr Pathol Lab Med 1995;15:813-827
Medline13
Gardner RJM ,Yun K ,Craw SM . Familial ectopic ossification. J Med Genet 1988;25:113-117
CrossRef | Web of Science | Medline14
Kozasa T ,Itoh H ,Tsukamoto T ,Kaziro Y . Isolation and characterization of the human Gs alpha gene. Proc Natl Acad Sci U S A 1988;85:2081-2085
CrossRef | Web of Science | Medline15
Miric A ,Vechio JD ,Levine MA . Heterogeneous mutations in the gene encoding the alpha-subunit of the stimulatory G protein of adenylyl cyclase in Albright hereditary osteodystrophy. J Clin Endocrinol Metab 1993;76:1560-1568
CrossRef | Web of Science | Medline16
Culbertson MR . RNA surveillance: unforeseen consequences for gene expression, inherited genetic disorders and cancer. Trends Genet 1999;15:74-80
CrossRef | Web of Science | Medline17
Weinstein LS, Gejman PV, de Mazancourt P, American N, Spiegel AM
CrossRef | Web of Science | Medline18
Shapira H ,Mouallem M ,Shapiro MS ,Weisman Y ,Farfel Z . Pseudohypoparathyroidism type Ia: two new heterozygous frameshift mutations in exons 5 and 10 of the Gs alpha gene. Hum Genet 1996;97:73-75
CrossRef | Web of Science | Medline19
Farfel Z ,Bourne HR ,Iiri T . The expanding spectrum of G protein diseases. N Engl J Med 1999;340:1012-1020
Full Text | Web of Science | Medline20
Whyte MP. Fibrous dysplasia. In: Favas MJ, ed. Primer on the metabolic bone diseases and disorders of mineral metabolism. Philadelphia: Lippincott Williams & Wilkins, 1999:384-6.
21
Yeh G ,Mathur S ,Wivel A , et al. GNAS1 mutation and Cbfa1 misexpression in a child with severe congenital platelike osteoma cutis. J Bone Miner Res 2000;15:2063-2073
CrossRef | Web of Science | Medline22
Nussbaum RL, McInnes RR, Willard HF. Thompson & Thompson genetics in medicine. 6th ed. Philadelphia: W.B. Saunders, 2001.
23
Reik W ,Walter J . Genomic imprinting: parental influence on the genome. Nat Rev Genet 2001;2:21-32
CrossRef | Web of Science | Medline24
Hayward BE ,Moran V ,Strain L ,Bonthron DT . Bidirectional imprinting of a single gene: GNAS1 encodes maternally, paternally, and biallelically derived proteins. Proc Natl Acad Sci U S A 1998;95:15475-15480
CrossRef | Web of Science | Medline25
Hayward BE ,Kamiya M ,Strain L , et al. The human GNAS1 gene is imprinted and encodes distinct paternally and biallelically expressed G proteins. Proc Natl Acad Sci U S A 1998;95:10038-10043
CrossRef | Web of Science | Medline26
Hayward BE ,Bonthron DT . An imprinted antisense transcript at the human GNAS1 locus. Hum Mol Genet 2000;9:835-841
CrossRef | Web of Science | Medline27
Peters J ,Wroe SF ,Wells CA , et al. A cluster of oppositely imprinted transcripts at the Gnas locus in the distal imprinting region of mouse chromosome 2. Proc Natl Acad Sci U S A 1999;96:3830-3835
CrossRef | Web of Science | Medline28
Liu J ,Yu S ,Litman D ,Chen W ,Weinstein LS . Identification of a methylation imprint mark within the mouse Gnas locus. Mol Cell Biol 2000;20:5808-5817
CrossRef | Web of Science | Medline29
Campbell R ,Gosden CM ,Bonthron DT . Parental origin of transcription from the human GNAS1 gene. J Med Genet 1994;31:607-614
CrossRef | Web of Science | Medline30
Yu S ,Yu D ,Lee E , et al. Variable and tissue-specific hormone resistance in heterotrimeric Gs protein alpha-subunit (Gsalpha) knockout mice is due to tissue-specific imprinting of the Gsalpha gene. Proc Natl Acad Sci U S A 1998;95:8715-8720
CrossRef | Web of Science | Medline31
Hayward BE ,Barlier A ,Korbonits M , et al. Imprinting of theG(s)alpha gene GNAS1 in the pathogenesis of acromegaly. J Clin Invest 2001;107:R31-R36
CrossRef | Web of Science | Medline
- Citing Articles (59)
Citing Articles
1
Eileen M. Shore, Frederick S. Kaplan. 2012. Extraskeletal Bone Formation. , 821-840.
CrossRef2
Murat Bastepe, Harald Jüppner, Rajesh V. Thakker. 2012. Parathyroid Disorders. , 557-588.
CrossRef3
Robert J Pignolo, Meiqi Xu, Elizabeth Russell, Alec Richardson, Josef Kaplan, Paul C Billings, Frederick S Kaplan, Eileen M Shore. (2011) Heterozygous inactivation of Gnas in adipose-derived mesenchymal progenitor cells enhances osteoblast differentiation and promotes heterotopic ossification. Journal of Bone and Mineral Research 26:11, 2647-2655
CrossRef4
Eulalia T. Baselga. 2011. Calcification and Ossification in the Skin. , 95.1-95.13.
CrossRef5
Anusuya Ramasubramanian, Stacey Shiigi, Gordon K. Lee, Fan Yang. (2011) Non-viral Delivery of Inductive and Suppressive Genes to Adipose-Derived Stem Cells for Osteogenic Differentiation. Pharmaceutical Research 28:6, 1328-1337
CrossRef6
Christian Zeckey, Frank Hildebrand, Michael Frink, Christian Krettek. (2011) Heterotopic ossifications following implant surgery—epidemiology, therapeutical approaches and current concepts. Seminars in Immunopathology 33:3, 273-286
CrossRef7
Deborah Wenkert. 2011. PRIMARY DISORDERS OF BONE AND CONNECTIVE TISSUES. , 742-765.
CrossRef8
Eileen M. Shore. (2011) Fibrodysplasia ossificans progressiva: a human genetic disorder of extraskeletal bone formation, or-how does one tissue become another?. Wiley Interdisciplinary Reviews: Developmental Biologyn/a-n/a
CrossRef9
Yuquan Jiang, Hongtao Hu, Xiaojian Ye, Jun Peng, Hailong He, Guohua Xu, Jiangming Yu. (2010) Multilevel Myelopathy Associated With Pseudohypoparathyroidism Simulating Diffuse Skeletal Hyperostosis. Spine1
CrossRef10
Eileen M. Shore, Frederick S. Kaplan. (2010) Inherited human diseases of heterotopic bone formation. Nature Reviews Rheumatology 6:9, 518-527
CrossRef11
Gavin Kelsey. (2010) Imprinting on chromosome 20: Tissue-specific imprinting and imprinting mutations in the GNAS locus. American Journal of Medical Genetics Part C: Seminars in Medical Genetics 154C:3, 377-386
CrossRef12
N. P. Burrows, C. R. Lovell. 2010. Disorders of Connective Tissue. , 1-70.
CrossRef13
M. Klaassens, E.W. Blom, J.J.P. Schrander, C. Ris-Stalpers, A.C. Nieuwenhuijzen Kruseman, M.A.M. van Steensel, C.T.R.M. Schrander-Stumpel. (2010) Unique skin changes in a case of Albright hereditary osteodystrophy caused by a rare GNAS1 mutation. British Journal of Dermatology 162:3, 690-694
CrossRef14
R.J. Schimmel, S.G.M.A. Pasmans, M. Xu, S.A.E. Stadhouders-Keet, E.M. Shore, F.S. Kaplan, N.M. Wulffraat. (2010) GNAS-associated disorders of cutaneous ossification: Two different clinical presentations. Bone 46:3, 868-872
CrossRef15
M. Goto,, H. Mabe,, G. Nishimura,, N. Katsumata,. (2010) Progressive Osseous Heteroplasia Caused by a Novel Nonsense Mutation in the GNAS1 Gene. Journal of Pediatric Endocrinology and Metabolism 23:3, 303-310
CrossRef16
R. Craig Albertson, William Cresko, H. William Detrich, John H. Postlethwait. (2009) Evolutionary mutant models for human disease. Trends in Genetics 25:2, 74-81
CrossRef17
Denisa Kacerovska, Jana Nemcova, Renata Pomahacova, Michal Michal, Dmitry V Kazakov. (2008) Cutaneous and Superficial Soft Tissue Lesions Associated With Albright Hereditary Osteodystrophy: Clinicopathological and Molecular Genetic Study of 4 Cases, Including a Novel Mutation of the GNAS Gene. The American Journal of Dermatopathology 30:5, 417-424
CrossRef18
Eileen M. Shore, Frederick S. Kaplan. (2008) Insights from a rare genetic disorder of extra-skeletal bone formation, fibrodysplasia ossificans progressiva (FOP). Bone 43:3, 427-433
CrossRef19
N.S. Adegbite, M. Xu, F.S. Kaplan, E.M. Shore, R.J. Pignolo. (2008) Diagnostic and mutational spectrum of progressive osseous heteroplasia (POH) and other forms of GNAS ‐based heterotopic ossification. American Journal of Medical Genetics Part A 146A:14, 1788-1796
CrossRef20
Kenji Kumagai, Katsuaki Motomura, Masayuki Egashira, Masato Tomita, Masahiko Suzuki, Masataka Uetani, Hiroyuki Shindo. (2008) A case of progressive osseous heteroplasia: a first case in Japan. Skeletal Radiology 37:6, 563-567
CrossRef21
ALLEN W. ROOT, FRANK B. DIAMOND. 2008. Disorders of Mineral Homeostasis in the Newborn, Infant, Child, and Adolescent. , 686-769.
CrossRef22
Agnès Linglart, Murat Bastepe, Harald Jüppner. (2007) Similar clinical and laboratory findings in patients with symptomatic autosomal dominant and sporadic pseudohypoparathyroidism type Ib despite different epigenetic changes at the GNAS locus. Clinical Endocrinology 67:6, 822-831
CrossRef23
Hayo Castrop, Mona Oppermann, Diane Mizel, Yuning Huang, Robert Faulhaber-Walter, Yvonne Weiss, Lee S. Weinstein, Min Chen, Stephane Germain, Huiyan Lu, Dan Ragland, Daniel M. Schimel, Jurgen Schnermann. (2007) Skeletal abnormalities and extra-skeletal ossification in mice with restricted Gsα deletion caused by a renin promoter-Cre transgene. Cell and Tissue Research 330:3, 487-501
CrossRef24
Susanne Kupitz, Stuart Enoch, Keith G Harding. (2007) Chronic ulcers, calcification and calcified fibrous tumours: phenotypic manifestations of a congenital disorder of heterotopic ossification. International Wound Journal 4:3, 273-280
CrossRef25
Inessa M. Gelfand, Rachel S. Hub, Eileen M. Shore, Frederick S. Kaplan, Linda A. DiMeglio. (2007) Progressive osseous heteroplasia-like heterotopic ossification in a male infant with pseudohypoparathyroidism type Ia: A case report. Bone 40:5, 1425-1428
CrossRef26
M. Michael Cohen Jr.. (2006) The new bone biology: Pathologic, molecular, and clinical correlates. American Journal of Medical Genetics Part A 140A:23, 2646-2706
CrossRef27
Andrea G Lania, Giovanna Mantovani, Anna Spada. (2006) Mechanisms of Disease: mutations of G proteins and G-protein-coupled receptors in endocrine diseases. Nature Clinical Practice Endocrinology & Metabolism 2:12, 681-693
CrossRef28
Sharon A Glick, Daniela Kroshinsky. (2006) Uniparental disomy and genomic imprinting in dermatology. Expert Review of Dermatology 1:5, 709-721
CrossRef29
G. W. M. Millington. (2006) Genomic imprinting and dermatological disease. Clinical and Experimental Dermatology 31:5, 681-688
CrossRef30
J. Gass, H. Firth, N. Burrows. (2006) Oral 10 Osteoma cutis: a manifestation of GNAS1 mutation. British Journal of Dermatology 0:0, 060612084858033-???
CrossRef31
J. Gass, H. Firth, N. Burrows. (2006) Osteoma cutis: a manifestation of GNAS1 mutation. Annales de Dermatologie et de Vénéréologie 133:6-7, 625
CrossRef32
Karine Bertaux, Odile Broux, Christophe Chauveau, Pierre Hardouin, Joseph Jeanfils, Jean-Christophe Devedjian. (2006) Runx2 regulates the expression of GNAS on SaOs-2 cells. Bone 38:6, 943-950
CrossRef33
Lee S. Weinstein, Min Chen, Tao Xie, Jie Liu. (2006) Genetic diseases associated with heterotrimeric G proteins. Trends in Pharmacological Sciences 27:5, 260-266
CrossRef34
H. Jüppner,, M. Bastepe,. (2006) Different Mutations Within or Upstream of the GNAS Locus Cause Distinct Forms of Pseudohypoparathyroidism. Journal of Pediatric Endocrinology and Metabolism 19:Supplement, 641-646
CrossRef35
Jia-Woei Hou. (2006) Progressive osseous heteroplasia controlled by intravenous administration of pamidronate. American Journal of Medical Genetics Part A 140A:8, 910-913
CrossRef36
Micheala A Aldred, Richard C Trembath. 2006. Activating and Inactivating Mutations in the GNAS1 Gene. .
CrossRef37
A. Plagge, G. Kelsey. (2006) Imprinting the <i>Gnas</i> locus. Cytogenetic and Genome Research 113:1-4, 178-187
CrossRef38
M. Bastepe. (2005) Pseudohypoparathyroidism, Gs , and the GNAS Locus. International Bone and Mineral Society Knowledge Environment 2:12, 20-32
CrossRef39
P Schuetz, B Mueller, M Christ-Crain, W Dick, H Haas. (2005) Amino-bisphosphonates in heterotopic ossification: first experience in five consecutive cases. Spinal Cord 43:10, 604-610
CrossRef40
Steven A Lietman, Changlin Ding, David W Cooke, Michael A Levine. (2005) Reduction in Gs?? Induces Osteogenic Differentiation in Human Mesenchymal Stem Cells. Clinical Orthopaedics and Related Research &NA;:434, 231-238
CrossRef41
Chuanhui Dong, Wei-Dong Li, Frank Geller, Lei Lei, Ding Li, Olga Y. Gorlova, Johannes Hebebrand, Christopher I. Amos, Robert D. Nicholls, R. Arlen Price. (2005) Possible Genomic Imprinting of Three Human Obesity–Related Genetic Loci. The American Journal of Human Genetics 76:3, 427-437
CrossRef42
Murat Bastepe, Harald Jüppner. (2005) <i>GNAS</i> Locus and Pseudohypoparathyroidism. Hormone Research 63:2, 65-74
CrossRef43
Brian M Strem, Kevin C Hicok, Min Zhu, Isabella Wulur, Zeni Alfonso, Ronda E Schreiber, John K Fraser, Marc H Hedrick. (2005) Multipotential differentiation of adipose tissue-derived stem cells. The Keio Journal of Medicine 54:3, 132-141
CrossRef44
Harald Jüppner. (2005) Different Forms of Pseudohypoparathyroidism: Imprinted Disorders Caused by Different Coding and Non-coding Mutations in GNAS. Clinical Pediatric Endocrinology 14:Supplement23, S23_1-S23_8
CrossRef45
David Haig. (2004) GENOMIC IMPRINTING AND KINSHIP: How Good is the Evidence?. Annual Review of Genetics 38:1, 553-585
CrossRef46
Hana Raslova, Emiko Komura, Jean Pierre Le Couédic, Frederic Larbret, Najet Debili, Jean Feunteun, Olivier Danos, Olivier Albagli, William Vainchenker, Rémi Favier. (2004) FLI1 monoallelic expression combined with its hemizygous loss underlies Paris-Trousseau/Jacobsen thrombopenia. Journal of Clinical Investigation 114:1, 77-84
CrossRef47
Dana L. Madison, Michael Bliziotes. (2004) Severe Dystrophic Calcification Confounded by Secondary Hyperparathyroidism in a Patient With Thyroid Lymphoma and CREST Syndrome. The Endocrinologist 14:4, 195-198
CrossRef48
Chantal Job-Deslandre. (2004) Inherited ossifying diseases. Joint Bone Spine 71:2, 98-101
CrossRef49
Kevin C. Hicok, Tracey V. du Laney, Yang Sheng Zhou, Yuan-Di C. Halvorsen, Daron C. Hitt, Lyndon F. Cooper, Jeffrey M. Gimble. (2004) Human Adipose-Derived Adult Stem Cells Produce Osteoid in Vivo. Tissue Engineering 10:3-4, 371-380
CrossRef50
Allen M. Spiegel, Lee S. Weinstein. (2004) Inherited Diseases Involving G Proteins and G Protein–Coupled Receptors *. Annual Review of Medicine 55:1, 27-39
CrossRef51
I. Chan, T. Hamada, C. Hardman, J. A. McGrath, F. J. Child. (2004) Progressive osseous heteroplasia resulting from a new mutation in the GNAS1 gene. Clinical and Experimental Dermatology 29:1, 77-80
CrossRef52
Jo??l Zlotogora. (2003) Penetrance and expressivity in the molecular age. Genetics in Medicine 5:5, 347-352
CrossRef53
Russell A. Faust, Eileen M. Shore, Christopher E. Stevens, Meiqi Xu, Shefali Shah, C. Douglas Phillips, Frederick S. Kaplan. (2003) Progressive osseous heteroplasia in the face of a child. American Journal of Medical Genetics 118A:1, 71-75
CrossRef54
Jouni Uitto, Leena Pulkkinen, Franziska Ringpfeil. (2002) Progress in Molecular Genetics of Heritable Skin Diseases: The Paradigms of Epidermolysis Bullosa and Pseudoxanthoma Elasticum. Journal of Investigative Dermatology Symposium Proceedings 7:1, 6-16
CrossRef55
Micheala A. Aldred, Salim Aftimos, Christine Hall, Katie S. Waters, Rajesh V. Thakker, Richard C. Trembath, Louise Brueton. (2002) Constitutional deletion of chromosome 20q in two patients affected with albright hereditary osteodystrophy. American Journal of Medical Genetics 113:2, 167-172
CrossRef56
(2002) GNAS1 Mutations and Progressive Osseous Heteroplasia. New England Journal of Medicine 346:21, 1669-1671
Full Text57
Micheala Aldred. (2002) GNAS1 imprinting: the latest twist. Trends in Genetics 18:4, 181
CrossRef58
Micheala Aldred. (2002) GNAS1 imprinting: the latest twist. Trends in Molecular Medicine 8:4, 159-160
CrossRef59
Jüppner, Harald, . (2002) The Genetic Basis of Progressive Osseous Heteroplasia. New England Journal of Medicine 346:2, 128-130
Full Text
- Letters
