Original Article
Brief Report
Octreotide Therapy for Tumor-Induced Osteomalacia
N Engl J Med 2001; 345:1883-1888December 27, 2001
- Article
Tumor-induced osteomalacia (also known as oncogenic osteomalacia)1 is a rare disorder characterized by phosphaturia, hypophosphatemia, and osteomalacia mimicking the clinical phenotype of either X-linked2 or autosomal dominant3 hereditary hypophosphatemic rickets. Tumor-induced osteomalacia develops because of tumors that are predominantly of benign mesenchymal origin4 but that may occasionally be malignant, as was recently reported.5 Surgical removal of the tumor relieves all symptoms. Hemangiopericytoma is the most dominant histologic entity in tumor-induced osteomalacia.4,6 Paraneoplastic secretion by the tumor of an unknown factor or factors — termed “phosphatonins” — causing renal tubular phosphate wasting has been proposed as the pathogenic mechanism.7
We describe an adult man who had hypophosphatemic osteomalacia for several years before an octreotide scan revealed a mesenchymal tumor in his left thigh. Moreover, subcutaneous administration of octreotide, a synthetic somatostatin analogue, abolished renal tubular phosphate wasting before subsequent surgical removal of the tumor.
Case Report
A 50-year-old man presented with chronic pain of the spine, ribs, femurs, and tibias. The clinical examination was otherwise normal. There was no family history of metabolic bone disease.
The initial evaluation in July 1997 revealed elevated urinary phosphorus excretion, low serum phosphorus levels, and elevated serum alkaline phosphatase and osteocalcin levels. The serum values for calcium, parathyroid hormone, 25-hydroxyvitamin D3, and calcitonin were normal; the serum value for 1,25-dihydroxyvitamin D3 was inappropriately low (6.9 pg per milliliter; normal range, 35 to 80). The diagnostic evaluation at this time provided no evidence of tumor. Multiple rib fractures were identified. A bone scan with technetium-99m–labeled 2,3-dicarboxypropane-1,1-diphosphonate showed a pattern of focal, late-phase enhancement in the spine and ribs; this was suggestive of metabolic bone disease. The patient was given the diagnosis of idiopathic hypophosphatemic osteomalacia with renal phosphate wasting. Continuous oral supplementation with phosphate and 1,25-dihydroxyvitamin D3 (1.25 μg per day) was initiated. Three years after the initial diagnosis, progressive metabolic bone disease prompted another extensive evaluation.
Methods
Assays
Serum, plasma, and urinary constituents were measured by standard techniques. Hormone measurements were performed with the use of commercial immunoassay kits. Assays of serum parathyroid hormone, 25-hydroxyvitamin D3, 1,25-dihydroxyvitamin D3, and calcitonin were performed with commercial kits (DPC Biermann, Bad Nauheim, Germany), as were those for osteocalcin (Diagnostic Systems Laboratories, Sinsheim, Germany) and urinary type I collagen C-telopeptides (Beckmann Coulter, Krefeld, Germany). For calculation of renal clearance of phosphate, serum and urinary concentrations of phosphorus were determined together with the excreted urinary volume during two one-hour collection periods (Table 1Table 1
Laboratory Findings in a Patient with Renal Tubular Phosphate Wasting and Vitamin D–Resistant Osteomalacia before and 10 Days after Octreotide Therapy and 18 Months after Surgical Removal of the Tumor.).Values for the threshold for renal tubular reabsorption of phosphate were derived from the nomogram provided by Walton and Bijvoet.8 The excreted urinary volume was quantified during a two-hour collection period in the morning, and urinary phosphate and creatinine levels were determined.
Imaging Studies and Octreotide Therapy
We performed nuclear magnetic resonance, angiographic, and scintigraphic studies using octreotide labeled with indium-111 as a tracer according to standard techniques. Before surgery, unlabeled octreotide (Sandostatin, Novartis Pharma, Nuremburg, Germany) was administered subcutaneously at a dose of 50 μg three times a day for five days and then at a dose of 100 μg three times a day for eight days.
Expression of Somatostatin-Receptor Subtypes
Expression of messenger RNA (mRNA) for somatostatin-receptor subtypes in tumor samples was analyzed by the reverse-transcriptase–polymerase chain reaction (RT-PCR). Total RNA was extracted from tumor tissue by a modified single-step technique (Trizol, GIBCO, Life Technologies, Gaithersburg, Md.). RNA was reverse transcribed with use of oligo-dT12-18 primers with reverse transcriptase (Superscript, GIBCO, Life Technologies). For PCR reactions, the following oligonucleotides specific for human somatostatin receptor subtypes 1, 2, 3, 4, and 5 were used: somatostatin receptor subtype 1 (318-bp PCR product), sense primer, 5'ATGGTGGCCCTCAAGGCCGG3', antisense primer, 5'CGCGGTGGCGTAATAGTCAA3'; somatostatin receptor subtype 2 (318-bp PCR product), sense primer, 5'TCCTCTGGAATCCGAGTGGG3', antisense primer, 5'TTGTCCTGCTTACTGTCACT3'; somatostatin receptor subtype 3 (332-bp PCR product), sense primer, 5'TGCCACCCTGGGCAACGTGT3', antisense primer, 5'CAGGCAGAATATGCTGGTGA3'; somatostatin receptor subtype 4 (323-bp PCR product), sense primer, 5'GCGCGCGGCGACCTACCGGC3', antisense primer, 5'GCCTGGTGATTTTCTTCTCC3'; and somatostatin receptor subtype 5 (259-bp PCR product), sense primer, 5'CTGGTGGGGCCGGCGCCCTC3', antisense primer, 5'CCAGGCGGCACAGGACGGGG3'. The cycling conditions for the PCR reactions were 1 cycle at 94°C for 2 minutes and 28 cycles at 94°C for 30 seconds, 62°C for 30 seconds, and 72°C for 45 seconds. The identity of the PCR products was confirmed by sequencing (data not shown).
Expression of mRNA for Matrix Extracellular Phosphoglycoprotein and Fibroblast Growth Factor 23
Expression of mRNA for matrix extracellular phosphoglycoprotein and fibroblast growth factor 23 in tumor samples was analyzed by RT-PCR. The PCR conditions for matrix extracellular phosphoglycoprotein were as previously described.9
The following oligonucleotides were used for fibroblast growth factor 23: sense primer, 5'GGCGCACCCCATCAGACCATC3', and antisense primer, 5'GCCCGTTCCCCCAGCGTGCGTGTT3'. The cycling conditions for the PCR reactions were 1 cycle at 94°C for 2 minutes and 28 cycles at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 45 seconds. The identity of the PCR products was confirmed by sequencing (data not shown).
Results
Excessive osteomalacia with osteoidosis (an excess of nonmineralized organic bone matrix) was found in a bone-biopsy specimen derived from the iliac crest. Laboratory findings are summarized in Table 1. Findings consistent with the diagnosis of renal phosphate wasting included elevated renal phosphate clearance and low serum phosphorus levels despite ongoing oral phosphate therapy. The serum level of 1,25-dihydroxyvitamin D3 was at the lower end of the normal range despite oral supplementation. The threshold for renal tubular reabsorption of phosphate, which is largely independent of oral phosphate therapy, was significantly reduced. The serum levels of alkaline phosphatase, osteocalcin, and urinary type I collagen C-telopeptides were elevated.
Since we were unable to locate a tumor, an octreotide scan was performed that showed circumscript pooling of radioactive octreotide tracer in the left thigh (Figure 1AFigure 1
Imaging Studies in a Patient with Tumor-Induced Osteomalacia.). Magnetic resonance imaging and angiography revealed a well-vascularized mass of 5.5 by 4.5 by 3.0 cm within the laterodorsal section of the vastus lateralis muscle (Figure 1B).While the patient awaited surgical resection of the tumor, a trial of subcutaneous octreotide was initiated and continued for 13 days (50 μg three times a day on days 1 through 5 and 100 μg three times a day on days 6 through 13). Octreotide therapy led to normalization of serum phosphorus levels, phosphate clearance, and the threshold for renal tubular reabsorption of phosphate by day 10 (Table 1 and Figure 2Figure 2
Renal Phosphate Clearance and Values for Serum Phosphorus and Parathyroid Hormone in a Patient with Tumor-Induced Osteomalacia during the Initial Course of the Disease, during Octreotide Therapy before Surgical Removal of the Tumor, and after Surgical Removal of the Tumor.). Serum alkaline phosphatase and osteocalcin levels were reduced, whereas urinary excretion of type I collagen C-telopeptide and serum parathyroid hormone levels were transiently increased. Serum calcium levels as well as all other values remained unchanged (Table 1).Oral phosphate therapy was tapered as serum phosphorus levels became normal (Table 1 and Figure 2). The tumor was a hemangiopericytoma with slit-like vessels, pericytic tumor cells with elongated nuclei, crowding of the nuclear membrane, and dense chromatin surrounded by a small, elongated cytoplasmic region. Tumor cells stained positive for vimentin but were negative for smooth-muscle α-actin, desmin, keratin markers, CD34, CD31, S100 protein, and HMB-45. The proportion of cells with a proliferative phenotype was less than 10 percent. Mitotic figures, necrotic areas of the tumor, invasion of blood vessels, and cytologic atypia could not be found (data not shown).
Since removal of the tumor, phosphate metabolism has remained normal without further oral phosphate therapy (Figure 2).
RT-PCR analysis of tumor-derived RNA samples showed predominant expression of somatostatin receptor subtype 2 mRNA and a faint positive reaction for somatostatin receptor subtype 5 mRNA, whereas subtypes 1, 3, and 4 were absent (Figure 3Figure 3
Expression of mRNA for Somatostatin Receptor Subtypes 1, 2, 3, 4, and 5 in a Tumor from a Patient with Tumor-Induced Osteomalacia.). The mRNA for matrix extracellular phosphoglycoprotein8 and fibroblast growth factor 23 was abundantly expressed (Figure 4Figure 4
The mRNA Expression of Secreted Tumor Factors.).Clinical and laboratory evaluations 3 and 18 months after surgery revealed normalization of bone and phosphate metabolism (Table 1 and Figure 2). Another bone biopsy as well as follow-up scintigraphic imaging 18 months after surgery demonstrated resolution of all signs of metabolic bone disease and osteomalacia (data not shown).
Discussion
Tumor-induced osteomalacia with tumors that are predominantly derived from the mesenchyme is a paraneoplastic syndrome of renal phosphate wasting due to secretion of phosphaturic factors, termed phosphatonins.1 Because the tumor caused no symptoms in our patient, diagnosis of the tumor was delayed for several years. We hypothesized that tumors secreting phosphatonins may express somatostatin receptors that regulate secretory activity, as has been shown in other endocrine tumors.10,11 We were able to detect a previously unrecognized tumor by scintigraphy using octreotide labeled with indium-111, as has been done in similar cases.10,11 In addition, we were able to achieve complete preoperative remission of renal phosphate wasting in our patient by octreotide therapy through a mechanism that most likely involved suppression of phosphatonin secretion.
The finding of somatostatin receptor subtype 2 expression in the tumor provides the molecular basis for the positive octreotide scan and the clinical response to octreotide therapy (Table 1 and Figure 2), because subtype 2 displays the highest affinity for octreotide of all five somatostatin-receptor isoforms.12
Phosphate metabolism in humans is regulated by hormonally modified intestinal uptake and renal excretion, through interaction with the vitamin D–parathyroid hormone–calcium endocrine system.13 1,25-Dihydroxyvitamin D3 stimulates intestinal uptake of phosphate and inhibits renal excretion,14 whereas parathyroid hormone is phosphaturic.15 Renal phosphate excretion is regulated mainly through the activity of the renal tubular type IIa sodium–inorganic phosphate cotransporter.16 Studies of hereditary and tumor-associated phosphate-wasting disorders suggest that several other factors must be involved in the regulation of phosphate metabolism. The present view holds that the product of the PHEX gene (phosphate-regulating gene with homologies to endopeptidases on the X chromosome) is an endopeptidase that cleaves secreted phosphaturic hormone–like substances — the phosphatonins.1,17 Thus, hypophosphatemic rickets may be caused by disorders of the sodium–inorganic phosphate cotransporter itself, of the phosphatonins as modifiers of renal phosphate transport, or of the endopeptidase PHEX, which cleaves phosphatonins. In support of this concept, inactivating mutations of the PHEX gene are associated with the clinical phenotype of X-linked hypophosphatemic rickets.2
The tumor-induced form of hypophosphatemic rickets (oncogenic osteomalacia) has recently been shown to be associated with overexpression of fibroblast growth factor type 23 in tumor cells, which indicates that fibroblast growth factor type 23 is one of the causative phosphatonins for this disease.18 We found ample expression of the phosphatonin fibroblast growth factor type 23 in our patient's tumor. Thus, the clinical response to octreotide therapy in this patient may suggest that secretion of fibroblast growth factor type 23 by the tumor can be modulated through the somatostatin-receptor signaling pathway. This protein has further been demonstrated to act as both a substrate for the endopeptidase PHEX and an inhibitor of phosphate transport in kidney cells.19 Moreover, in the autosomal dominant form of hypophosphatemic rickets, mutations in fibroblast growth factor type 23 have been identified that render the molecule resistant to cleavage by PHEX.3
The patient's laboratory values provided no evidence of major effects of octreotide therapy on glomerular filtration or renal perfusion through the growth hormone–insulin-like growth factor I axis (Table 1). In patients with acromegaly who were treated with octreotide, minor increases in serum parathyroid hormone levels within the normal range have previously been reported.20 We believe, however, that the main reason for the transient overt hyperparathyroidism in our patient was the normalization of serum phosphorus levels that led to a disinhibition of secretion of parathyroid hormone (Table 1 and Figure 2), despite unchanged serum calcium levels.
We conclude that octreotide imaging is a valuable diagnostic tool in patients with phosphate wasting but with no family history and with no clinically apparent tumor. Moreover, we propose that in patients in whom surgery cannot be performed for technical reasons or because of coexisting conditions, phosphate wasting may be relieved by treatment with somatostatin analogues, given that the tumor expresses somatostatin receptors, which can easily be evaluated by octreotide scanning.
This case suggests that regulation of phosphate metabolism involves secretory mechanisms that may be modulated by somatostatin receptors. Whether this holds true only under pathologic conditions or is relevant to phosphate metabolism in normal states remains to be elucidated.
We are indebted to the patient for his collaboration in this study; to the staff of the endocrine laboratory for the hormone assays; to Sandra Royer for expert technical assistance in the expression studies; and to Günter Delling, M.D., for histopathologic evaluation of bone-biopsy specimens.
Source Information
From the Division of Endocrinology, Metabolism, and Molecular Medicine, Medizinische Poliklinik (J.S., K.E., F.J.); and the Departments of Pathology (J.M.), Orthopedic Surgery (J.E., C.H., N.S.), Nuclear Medicine (E.W.), and Radiology (G.S., W.K.), University of Würzburg — both in Würzburg; the Division of Endocrinology of the Department of Internal Medicine I, University of Regensburg, Regensburg (K.-D.P.); and Tirschenreuth (H.R.) — all in Germany.
Address reprint requests to Dr. Jakob at the Division of Endocrinology, Metabolism, and Molecular Medicine, Medizinische Poliklinik, University of Würzburg, Klinikstr. 6-8, 97070 Würzburg, Germany, or at jakob.medpoli@mail.uni-wuerzburg.de.
- References
References
1
Econs MJ ,Drezner MK . Tumor-induced osteomalacia -- unveiling a new hormone. N Engl J Med 1994;330:1679-1681
Full Text | Web of Science | Medline2
The HYP Consortium
CrossRef | Web of Science | Medline3
The ADHR Consortium
CrossRef | Web of Science | Medline4
Kumar R . Tumor-induced osteomalacia and the regulation of phosphate homeostasis. Bone 2000;27:333-338
CrossRef | Web of Science | Medline5
Case Records of the Massachusetts General Hospital (Case 29-2001). N Engl J Med 2001;345:903-908
Full Text | Web of Science | Medline6
Park YK ,Unni KK ,Beabout JW ,Hodgson SF . Oncogenic osteomalacia: a clinicopathologic study of 17 bone lesions. J Korean Med Sci 1994;9:289-298
Medline7
Cai Q ,Hodgson SF ,Kao PC , et al. Inhibition of renal phosphate transport by a tumor product in a patient with oncogenic osteomalacia. N Engl J Med 1994;330:1645-1649
Full Text | Web of Science | Medline8
Walton RJ ,Bijvoet OL . Nomogram for derivation of renal threshold phosphate concentration. Lancet 1975;2:309-310
CrossRef | Web of Science | Medline9
Rowe PS ,de Zoysa PA ,Dong R , et al. MEPE, a new gene expressed in bone marrow and tumors causing osteomalacia. Genomics 2000;67:54-68
CrossRef | Web of Science | Medline10
Rhee Y ,Lee JD ,Shin KH ,Lee HC ,Huh KB ,Lim SK . Oncogenic osteomalacia associated with mesenchymal tumour detected by indium-111 octreotide scintigraphy. Clin Endocrinol (Oxf) 2001;54:551-554
CrossRef | Web of Science | Medline11
Nguyen BD ,Wang EA . Indium-111 pentetreotide scintigraphy of mesenchymal tumor with oncogenic osteomalacia. Clin Nucl Med 1999;24:130-131
CrossRef | Web of Science | Medline12
Lamberts SWJ ,van der Lely A-J ,de Herder WW ,Hofland LJ . Octreotide. N Engl J Med 1996;334:246-254
Full Text | Web of Science | Medline13
DiMeglio LA ,White KE ,Econs MJ . Disorders of phosphate metabolism. Endocrinol Metab Clin North Am 2000;29:591-609
CrossRef | Web of Science | Medline14
Brown AJ ,Dusso A ,Slatopolsky E . Vitamin D. Am J Physiol 1999;277:F157-F175
Web of Science | Medline15
Marx SJ . Hyperparathyroid and hypoparathyroid disorders. N Engl J Med 2000;343:1863-1875[Erratum, N Engl J Med 2001;344:696.]
Full Text | Web of Science | Medline16
Murer H ,Hernando N ,Forster I ,Biber J . Molecular aspects in the regulation of renal inorganic phosphate reabsorption: the type IIa sodium/inorganic phosphate co-transporter as the key player. Curr Opin Nephrol Hypertens 2001;10:555-561
CrossRef | Web of Science | Medline17
Kumar R. Phosphatonin — a new phosphaturetic hormone? (Lessons from tumour-induced osteomalacia and X-linked hypophosphataemia.) Nephrol Dial Transplant 1997;12:11-3.
18
Shimada T ,Mizutani S ,Muto T , et al. Cloning and characterization of FGF23 as a causative factor of tumor-induced osteomalacia. Proc Natl Acad Sci U S A 2001;98:6500-6505
CrossRef | Web of Science | Medline19
Bowe AE ,Finnegan R ,Jan de Beur SM , et al. FGF-23 inhibits renal tubular phosphate transport and is a PHEX substrate. Biochem Biophys Res Commun 2001;284:977-981
CrossRef | Web of Science | Medline20
Legovini P ,De Menis E ,Breda F , et al. Long-term effects of octreotide on markers of bone metabolism in acromegaly: evidence of increased serum parathormone concentrations. J Endocrinol Invest 1997;20:434-438
Web of Science | Medline
- Citing Articles (63)
Citing Articles
1
Ingrid A. Holm, Michael J. Econs, Thomas O. Carpenter. 2012. Familial Hypophosphatemia and Related Disorders. , 699-726.
CrossRef2
Gabriele Lehmann. 2011. , 253-280.
CrossRef3
Catherine van der Rest, Etienne Cavalier, Jean-François Kaux, Jean-Marie Krzesinski, Roland Hustinx, Jean-Yves Reginster, Pierre Delanaye. (2011) Tumor-induced osteomalacia: The tumor may stay hidden!. Clinical Biochemistry 44:14-15, 1264-1266
CrossRef4
Jaishen Rajah, Kebashni Thandrayen, John M. Pettifor. (2011) Clinical practice. European Journal of Pediatrics 170:9, 1089-1096
CrossRef5
A. Tournier, T. Hanslik, R. de la Faille, S. Trad, A. Baglin, J. Prinseau, L. Moulonguet-Doleris. (2011) Ostéomalacie oncogénique : le FGF 23 ne fait pas tout. La Revue de Médecine Interne 32:9, e99-e101
CrossRef6
Kenya Kobayashi, Kazunari Nakao, Kensuke Kawai, Ken Ito, Seiji Hukumoto, Takahiro Asakage, Satoshi Oota, Ryo Motoi, Russell B. Smith. (2011) Tumor-induced osteomalacia originating from the temporal bone: A case report. Head & Neck 33:7, 1072-1075
CrossRef7
Saulo Mendoza-Ramírez, Omar Gutiérrez-Mijangos, Ana C. Sánchez-Silva, Felipe de Jesús Navarro-Córdoba, Mario Murguía-Pérez. (2011) Tumor mesenquimal fosfatúrico con rosetas gigantes: causa poco frecuente de osteomalacia oncogénica. Revista Española de Patología
CrossRef8
Josette William, William Laskin, Ritu Nayar, Denise de Frias. (2011) Diagnosis of phosphaturic mesenchymal tumor (mixed connective tissue type) by cytopathology. Diagnostic Cytopathologyn/a-n/a
CrossRef9
Athina Markou, Vassiliki Tsiama, Symeon Tournis, Labrini Papanastasiou, Vaios Tsiavos, Aikaterini Dassou, Vasiliki Vlachou, Eugenia Papaliodi, Niki Asimaki, George Zografos, George Piaditis. (2011) Coexistence of Tumor Induced Osteomalacia and Primary Hyperparathyroidism. Endocrine Practice 1:-1, 1-12
CrossRef10
Grace C. Chibesakunda, Carolyn S. Brecklin. (2010) Fibroblast Growth Factor, A Review. Kidney 19:6, 290-293
CrossRef11
Andreas F. Mavrogenis, Vasileios I. Sakellariou, Konstantinos Soultanis, Helen Mahera, Demetrios S. Korres, Panayiotis J. Papagelopoulos. (2010) A Nonphosphaturic Mesenchymal Tumor Mixed Connective Tissue Variant of the Sacrum. Orthopedics
CrossRef12
Steven W. Ing, O. Hans Iwenofu, Joel L. Mayerson, Nathan C. Hall. (2010) Tumor-induced Osteomalacia Localization by Whole-body Sestamibi Scan. The Endocrinologist 20:6, 267-270
CrossRef13
N. Ito, Y. Shimizu, H. Suzuki, T. Saito, T. Okamoto, M. Hori, M. Akahane, S. Fukumoto, T. Fujita. (2010) Clinical utility of systemic venous sampling of FGF23 for identifying tumours responsible for tumour-induced osteomalacia. Journal of Internal Medicine 268:4, 390-394
CrossRef14
Akira Ishii, Yasuo Imanishi, Keisuke Kobayashi, Jun Hashimoto, Takafumi Ueda, Akimitsu Miyauchi, Hajime M. Koyano, Hiroshi Kaji, Takatoshi Saito, Koichi Oba, Yasato Komatsu, Masafumi Kurajoh, Yuki Nagata, Hitoshi Goto, Kenichi Wakasa, Toshitsugu Sugimoto, Takami Miki, Masaaki Inaba, Yoshiki Nishizawa. (2010) The Levels of Somatostatin Receptors in Causative Tumors of Oncogenic Osteomalacia Are Insufficient for Their Agonist to Normalize Serum Phosphate Levels. Calcified Tissue International 86:6, 455-462
CrossRef15
Yong Mong Bee, Lai Peng Chan, Christopher H. K. Goh. (2010) A Man With Persistent, Enigmatic Bone Pain and Hypophosphatemia. The Endocrinologist 20:1, 33-37
CrossRef16
Victoria L. Woo, Regina Landesberg, Erik A. Imel, Steven R. Singer, Andrew L. Folpe, Michael J. Econs, Taeyun Kim, Lara R. Harik, Thomas P. Jacobs. (2009) Phosphaturic mesenchymal tumor, mixed connective tissue variant, of the mandible: report of a case and review of the literature. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology 108:6, 925-932
CrossRef17
H.M. Findeisen, C.J. Auernhammer, K.G. Parhofer, K.A. Herrmann, C. Fougere, C. Weiler, R. Bartl, E. Koch. (2009) Erniedrigte Knochendichte und Knochenschmerzen. Der Internist 50:12, 1402-1407
CrossRef18
Emily G Farrow, Kenneth E White. (2009) Tumor-induced osteomalacia. Expert Review of Endocrinology & Metabolism 4:5, 435-442
CrossRef19
Murali Sundaram. (2009) Founders lecture 2007. Skeletal Radiology 38:9, 841-853
CrossRef20
Sascha Goebel, Jasmin Lienau, Ulrich Rammoser, Lothar Seefried, Karl Florian Wintgens, Jochen Seufert, Georg Duda, Franz Jakob, Regina Ebert. (2009) FGF23 is a putative marker for bone healing and regeneration. Journal of Orthopaedic Research 27:9, 1141-1146
CrossRef21
M Odette Gore, Brian J Welch, Weidong Geng, Wareef Kabbani, Naim M Maalouf, Joseph E Zerwekh, Orson W Moe, Khashayar Sakhaee. (2009) Renal phosphate wasting due to tumor-induced osteomalacia: a frequently delayed diagnosis. Kidney International 76:3, 342-347
CrossRef22
Kjell Öberg. (2009) Somatostatin analog octreotide LAR ® in gastro–entero–pancreatic tumors. Expert Review of Anticancer Therapy 9:5, 557-566
CrossRef23
Roberto Seijas, Oscar Ares, Judit Sierra, Manuel Pérez-Dominguez. (2009) Oncogenic osteomalacia: two case reports with surprisingly different outcomes. Archives of Orthopaedic and Trauma Surgery 129:4, 533-539
CrossRef24
K. Nawrot-Wawrzyniak, F. Varga, A. Nader, P. Roschger, S. Sieghart, E. Zwettler, K. M. Roetzer, S. Lang, R. Weinkamer, K. Klaushofer, N. Fratzl-Zelman. (2009) Effects of Tumor-Induced Osteomalacia on the Bone Mineralization Process. Calcified Tissue International 84:4, 313-323
CrossRef25
Birgit Harbeck, Harald Schöcklmann, Andreas Seekamp, Norbert Czech, Heiner Mönig. (2009) Tumor-Induced Osteomalacia. JCR: Journal of Clinical Rheumatology 15:1, 31-34
CrossRef26
Frieda. Feldman. 2009. Oncogenic Osteomalacia. , 668-677.
CrossRef27
Michèle Duet, Samar Kerkeni, Raja Sfar, Cécile Bazille, Frédéric Lioté, Philippe Orcel. (2008) Clinical Impact of Somatostatin Receptor Scintigraphy in the Management of Tumor-induced Osteomalacia. Clinical Nuclear Medicine 33:11, 752-756
CrossRef28
Helen Kenealy, Ian Holdaway, Andrew Grey. (2008) Occult nasal sinus tumours causing oncogenic osteomalacia. European Journal of Internal Medicine 19:7, 516-519
CrossRef29
F. Jakob, L. Seefried, R. Ebert. (2008) Pathophysiologie des Knochenstoffwechsels. Der Internist 49:10, 1159-1169
CrossRef30
Makoto Takahashi, Syuta Toru, Kiyohumi Ota, Hajime Izumiyama, Takanori Yokota, Hidehiro Mizusawa. (2008) Detection of the primary tumor site in tumor-induced osteomalacia by indium-111 octreotide scintigraphy: A case report. Rinsho Shinkeigaku 48:2, 120-124
CrossRef31
Tetsushi Nasu, Seigo Kurisu, Shohei Matsuno, Kunihiro Tatsumi, Tetsuhiro Kakimoto, Masato Kobayashi, Yoshio Nakano, Hisao Wakasaki, Hiroto Furuta, Masahiro Nishi, Hideyuki Sasaki, Hisanori Suzuki, Nobuaki Ito, Seiji Fukumoto, Kishio Nanjo. (2008) Tumor-Induced Hypophosphatemic Osteomalacia Diagnosed by the Combinatory Procedures of Magnetic Resonance Imaging and Venous Sampling for FGF23. Internal Medicine 47:10, 957-961
CrossRef32
S. Harish, E. Jurriaans, E. Jan, M. Sur, N. Colterjohn. (2008) Giant cell tumour of soft tissue causing oncogenic osteomalacia: report demonstrating the use of octreotide scintigraphy in tumour localization. Clinical Radiology 63:1, 101-107
CrossRef33
F. Jakob. (2007) Metabolische Knochenerkrankungen. Der Internist 48:10, 1101-1118
CrossRef34
Subroto Paul, Michael Kurtz, Steven J. Mentzer. (2007) Osteomalacia associated with a fibroblast growth factor–23 secreting chest wall tumor. The Journal of Thoracic and Cardiovascular Surgery 134:3, 803-805
CrossRef35
Andrew Robertson, Robert Mansberg, Victor Mansberg, Hans Van der Wall, Michael Hooper. (2007) Tumor-Induced Osteomalacia: A Case of Diagnostic Dilemma. Clinical Nuclear Medicine 32:8, 631-634
CrossRef36
Mala Kaul, Miriam Silverberg, Edward F. DiCarlo, Robert Schneider, Anne R. Bass, Doruk Erkan. (2007) Tumor-induced osteomalacia. Clinical Rheumatology 26:9, 1575-1579
CrossRef37
Eric Hesse, Eckart Moessinger, Herbert Rosenthal, Florian Laenger, Georg Brabant, Thorsten Petrich, Klaus F Gratz, Leonard Bastian. (2007) Oncogenic Osteomalacia: Exact Tumor Localization by Co-Registration of Positron Emission and Computed Tomography. Journal of Bone and Mineral Research 22:1, 158-162
CrossRef38
Michèle Duet, Jacques Pouchot, Frédéric Lioté, Marc Faraggi. (2007) Role for positron emission tomography in skeletal diseases. Joint Bone Spine 74:1, 14-23
CrossRef39
Marianne S. Elston, Inge J. Stewart, Roderick Clifton-Bligh, John V. Conaglen. (2007) A case of oncogenic osteomalacia with preoperative secondary hyperparathyroidism: Description of the biochemical response of FGF23 to octreotide therapy and surgery. Bone 40:1, 236-241
CrossRef40
Peter S.N. Rowe, Naoko Matsumoto, Oak D. Jo, Remi N.J. Shih, Jeannine Oconnor, Martine P. Roudier, Steve Bain, Shiguang Liu, Jody Harrison, Norimoto Yanagawa. (2006) Correction of the mineralization defect in hyp mice treated with protease inhibitors CA074 and pepstatin. Bone 39:4, 773-786
CrossRef41
Nobuyuki Koriyama, Kengo Nishimoto, Takuro Kodama, Mitsuhiro Nakazaki, Yuichi Kurono, Hiroki Yoshida, Chuwa Tei. (2006) Oncogenic Osteomalacia in a Case with a Maxillary Sinus Mesenchymal Tumor. The American Journal of the Medical Sciences 332:3, 142-147
CrossRef42
Franz Jakob, Regina Ebert, Jochen Seufert. (2006) Fgf23. AfCS-Nature Molecule Pages
CrossRef43
Regina Ebert, Norbert Schütze, Jerzy Adamski, Franz Jakob. (2006) Vitamin D signaling is modulated on multiple levels in health and disease. Molecular and Cellular Endocrinology 248:1-2, 149-159
CrossRef44
Ihsane Sahnoune, Zoubida Tazi-Mezalek, Lamia Essaadouni, Hicham Harmouche, Farid Ismael, Mohammed Adnaoui, Mohammed Aouni, Fouad Kettani, Abdelaziz Maaouni. (2006) Ostéomalacie hypophosphatémique oncogénique secondaire à un hémangiome : un diagnostic clinique facile. Revue du Rhumatisme 73:1, 116-119
CrossRef45
Katsunobu Yoshioka, Rie Nagata, Mami Ueda, Toshimasa Yamaguchi, Yoshio Konishi, Masayuki Hosoi, Takeshi Inoue, Kazuhiro Yamanaka, Yoshiyasu Iwai, Toshihiko Sato. (2006) Phosphaturic Mesenchymal Tumor with Symptoms Related to Osteomalacia that Appeared One Year after Tumorectomy. Internal Medicine 45:20, 1157-1160
CrossRef46
Ihsane Sahnoune, Zoubida Tazi-Mezalek, Lamia Essaadouni, Hicham Harmouche, Farid Ismael, Mohammed Adnaoui, Mohammed Aouni, Fouad Kettani, Abdelaziz Maaouni. (2006) Oncogenic osteomalacia in a patient with hemangioma: a clinical diagnosis. Joint Bone Spine 73:1, 115-118
CrossRef47
Carrie L. Heike, Michael L. Cunningham, Robert D. Steiner, Deborah Wenkert, Robin L. Hornung, Joseph S. Gruss, Francis H. Gannon, William H. McAlister, Steven Mumm, Michael P. Whyte. (2005) Skeletal changes in epidermal nevus syndrome: Does focal bone disease harbor clues concerning pathogenesis?. American Journal of Medical Genetics Part A 139A:2, 67-77
CrossRef48
F. Jakob. (2005) Primäre und sekundäre Osteoporose. Der Internist 46:S01, S24-S30
CrossRef49
William H. Hoffman, Harald W. Jueppner, Barry R. DeYoung, M. Sue O'Dorisio, Keena S. Given. (2005) Elevated fibroblast growth factor-23 in hypophosphatemic linear nevus sebaceous syndrome. American Journal of Medical Genetics Part A 134A:3, 233-236
CrossRef50
J.L. Dupond, H. Mahammedi, D. Prié, F. Collin, H. Gil, O. Blagosklonov, B. Ricbourg, N. Meaux-Ruault, B. Kantelip. (2005) Oncogenic osteomalacia: Diagnostic importance of fibroblast growth factor 23 and F-18 fluorodeoxyglucose PET/CT SCAN for the diagnosis and follow-up in one case. Bone 36:3, 375-378
CrossRef51
Peter S.N. Rowe, Ian R. Garrett, Patricia M. Schwarz, David L. Carnes, Eileen M. Lafer, Gregory R. Mundy, Gloria E. Gutierrez. (2005) Surface plasmon resonance (SPR) confirms that MEPE binds to PHEX via the MEPE–ASARM motif: a model for impaired mineralization in X-linked rickets (HYP). Bone 36:1, 33-46
CrossRef52
Michèle Duet, Frédéric Lioté. (2004) Somatostatin and somatostatin analog scintigraphy: any benefits for rheumatology patients?. Joint Bone Spine 71:6, 530-535
CrossRef53
Despina Sitara, Mohammed S. Razzaque, Martina Hesse, Subbiah Yoganathan, Takashi Taguchi, Reinhold G. Erben, Harald J+APw-ppner, Beate Lanske. (2004) Homozygous ablation of fibroblast growth factor-23 results in hyperphosphatemia and impaired skeletogenesis, and reverses hypophosphatemia in Phex-deficient mice. Matrix Biology 23:7, 421-432
CrossRef54
I. Bernabéu Morón. (2004) Hipofosfatemia e hiperfosfatemia: concepto, fisiopatología, etiopatogenia, clínica, diagnóstico y tratamiento. Medicine - Programa de Formación Médica Continuada Acreditado 9:17, 1063-1069
CrossRef55
P.S.N Rowe, Y Kumagai, G Gutierrez, I.R Garrett, R Blacher, D Rosen, J Cundy, S Navvab, D Chen, M.K Drezner, L.D Quarles, G.R Mundy. (2004) MEPE has the properties of an osteoblastic phosphatonin and minhibin. Bone 34:2, 303-319
CrossRef56
Andrew L. Folpe, Julie C. Fanburg-Smith, Steven D. Billings, Michele Bisceglia, Franco Bertoni, Justin Y. Cho, Michael J. Econs, Carrie Y. Inwards, Suzanne M. Jan de Beur, Thomas Mentzel, Elizabeth Montgomery, Michal Michal, Markku Miettinen, Stacey E. Mills, John D. Reith, John X. O'Connell, Andrew E. Rosenberg, Brian P. Rubin, Donald E. Sweet, Tuyethoa N. Vinh, Lester E. Wold, Brett M. Wehrli, Kenneth E. White, Richard J. Zaino, Sharon W. Weiss. (2004) Most Osteomalacia-associated Mesenchymal Tumors Are a Single Histopathologic Entity. The American Journal of Surgical Pathology 28:1, 1-30
CrossRef57
Eberhard Ritz, Volker Haxsen, Martin Zeier. (2003) Disorders of phosphate metabolism—pathomechanisms and management of hypophosphataemic disorders. Best Practice & Research Clinical Endocrinology & Metabolism 17:4, 547-558
CrossRef58
(2003) Letters to the Editors: 2. Clinical Endocrinology 58:6, 796-797
CrossRef59
J. Pouchot, A. Grasland, F. Paycha, P. Vinceneux. (2003) Mais où donc est-elle cachée ?. La Revue de Médecine Interne 24, 250s-252s
CrossRef60
Carpenter, Thomas O., . (2003) Oncogenic Osteomalacia — A Complex Dance of Factors. New England Journal of Medicine 348:17, 1705-1708
Full Text61
Jonsson, Kenneth B., Zahradnik, Richard, Larsson, Tobias, White, Kenneth E., Sugimoto, Toshitsugu, Imanishi, Yasuo, Yamamoto, Takehisa, Hampson, Geeta, Koshiyama, Hiroyuki, Ljunggren, Östen, Oba, Koichi, Yang, In Myung, Miyauchi, Akimitsu, Econs, Michael J., Lavigne, Jeffrey, Jüppner, Harald, . (2003) Fibroblast Growth Factor 23 in Oncogenic Osteomalacia and X-Linked Hypophosphatemia. New England Journal of Medicine 348:17, 1656-1663
Full Text62
Seiji Fukumoto, Takeyoshi Yamashita. (2002) Fibroblast growth factor-23 is the phosphaturic factor in tumor-induced osteomalacia and may be phosphatonin. Current Opinion in Nephrology and Hypertension 11:4, 385-389
CrossRef63
(2002) Octreotide for Tumor-Induced Osteomalacia. New England Journal of Medicine 346:22, 1748-1749
Full Text
- Letters
