Original Article
Infection with GB Virus C and Reduced Mortality among HIV-Infected Patients
N Engl J Med 2001; 345:715-724September 6, 2001
- Abstract
Background
The flavivirus GB virus C (GBV-C, also designated hepatitis G virus) was identified in a search for hepatitis viruses, but no disease is currently known to be associated with it. We investigated the relation between coinfection with GBV-C and the long-term outcome in patients infected with the human immunodeficiency virus (HIV).
Methods
A total of 197 HIV-positive patients were followed prospectively beginning in 1993 or 1994. Of these patients, 33 (16.8 percent) tested positive for GBV-C RNA, 112 (56.9 percent) had detectable antibodies against the GBV-C envelope protein E2, and 52 (26.4 percent) had no marker of GBV-C infection and were considered unexposed. We assessed the relation between GBV-C infection and the progression of HIV disease. We also tested 169 GBV-C–positive plasma samples with a quantitative branched-chain DNA (bDNA) assay in order to investigate possible correlations between GBV-C viral load and both the CD4+ cell count and the HIV load.
Results
Among the patients who tested positive for GBV-C RNA, survival was significantly longer, and there was a slower progression to the acquired immunodeficiency syndrome (AIDS) (P<0.001 for both comparisons). Survival after the development of AIDS was also better among the GBV-C–positive patients. The association of GBV-C viremia with reduced mortality remained significant in analyses stratified according to age and CD4+ cell count. In an analysis restricted to the years after highly active antiretroviral therapy became available, the presence of GBV-C RNA remained predictive of longer survival (P=0.02). The HIV load was lower in the GBV-C–positive patients than in the GBV-C–negative patients. The GBV-C load correlated inversely with the HIV load (r=–0.33, P<0.001) but did not correlate with the CD4+ cell count.
Conclusions
Coinfection with GBV-C is associated with a reduced mortality rate in HIV-infected patients. GBV-C is not known to cause any disease, but it is possible that its presence leads to an inhibition of HIV replication. However, GBV-C infection could also be a marker for the presence of other factors that lead to a favorable HIV response.
Media in This Article
Figure 5
Correlation between the GBV-C Load and the HIV Load.Figure 4
Survival after the Diagnosis of AIDS and after Highly Active Antiretroviral Therapy Became Available.Article Activity
- Article
Patients infected with the human immunodeficiency virus (HIV) are often coinfected with other viruses, especially hepatitis viruses.1 Coinfection with the hepatitis B virus (HBV) or hepatitis C virus (HCV) appears to increase the mortality rate among HIV-infected patients.2,3 The course of HCV infection is accelerated in patients who are coinfected with HIV, as compared with the course in immunocompetent patients.4-9
In 1995, a new virus was identified that is related to the hepatitis C virus and was thought to be another hepatitis virus.10,11 It has been called both GB virus C (GBV-C)10 and hepatitis G virus (HGV).11 GBV-C and HGV are closely related isolates of the same virus, with more than 95 percent sequence homology.12 We use the name GBV-C, since it currently appears that the virus is not a cause of hepatitis.12-14 Whereas the presence of GBV-C RNA in serum or plasma indicates ongoing GBV-C infection, the presence of antibodies against the envelope protein E2 (anti-E2) indicates viral clearance.15
GBV-C is not known to cause any disease. We have studied the relation between GBV-C infection and the course of HIV infection. In a preliminary study of patients recruited in 1993 and 1994 and followed for up to three years, we found evidence of a beneficial effect of GBV-C on the course of HIV infection.16 This effect was subsequently confirmed by others.17-19
In the present study, we examined whether GBV-C viremia is beneficial (or is a marker for other beneficial factors) in HIV-infected patients and whether this beneficial effect, if any, continues to be important after the introduction of highly active antiretroviral therapy, which has led to declining morbidity and mortality associated with HIV infection.20,21 We also examine the correlation between the GBV-C load and the HIV load.
Methods
Patients
We prospectively enrolled 197 HIV-infected patients who attended our outpatient clinic between January 1993 and December 1994. A preliminary analysis of these patients and their GBV-C status was reported previously.16 The stage of disease was classified in accordance with the European modification of the staging system of the Centers for Disease Control and Prevention (CDC). The characteristics of the patients according to their GBV-C status at enrollment are summarized in Table 1Table 1
Characteristics of the Patients at Enrollment, According to GBV-C Status.. The last follow-up was defined as the last contact with the patient. The study was approved by the institutional review board of the Medizinische Hochschule Hannover, in Hannover, Germany.Cumulative survival and survival without progression to the acquired immunodeficiency syndrome (AIDS) were calculated from five different starting points to the date of the last follow-up: from the date of the first documented positive HIV test; from the date when a blood sample was drawn for GBV-C testing; from January 1, 1996 (when highly active antiretroviral therapy became available); from the day highly active antiretroviral therapy was initiated; and from the day AIDS was diagnosed.
The patients were divided into three groups: those who tested positive for GBV-C RNA, those who tested positive for anti-E2 antibodies (a GBV-C surface marker), and those without evidence of exposure to GBV-C.14 The physicians who examined the patients in the outpatient clinic were unaware of their GBV-C status until these data had been analyzed. Thus, decisions about antiretroviral therapy, including highly active antiretroviral therapy, were made without knowledge of GBV-C status. Highly active antiretroviral therapy became available for all patients in 1996.
Laboratory Analysis
For the evaluation of the relations between the GBV-C load and the HIV load and between the GBV-C load and the CD4+ cell count, an additional 208 patients (resulting in a total of 405 patients) with known HIV infection were screened for the presence of GBV-C RNA by nested polymerase chain reaction (PCR). RNA was transcribed with 20 pmol of the antisense primer GBV-C1 (ATGCCACCCGCCCTCACCCGAA) and amplified with GBV-C1 and the sense primer GBV-C2 (AAAGGTGGTGGATGGGTGATG) with the use of the Titan One Tube RT [reverse-transcriptase] PCR System (Roche Diagnostics, Mannheim, Germany); it was then tested by nested PCR with a second set of primers (antisense primer GBV-C3 [CCCCACTGGTCYTTGYCAACTC] and sense primer GBV-C4 [AATCCCGGTCAYAYTGGTAGCCACT]). A total of 104 of the 405 patients screened were determined to be positive for GBV-C RNA. At least one plasma sample that had been obtained after enrollment (between 1996 and 1999) and stored at –80°C was available for quantification of GBV-C from 72 of the 104 GBV-C–positive patients. A total of 169 samples from these 72 patients were quantitatively analyzed by branched-chain DNA (bDNA) assay (Figure 1Figure 1
A GBV-C Branched-Chain DNA Prototype Assay.), and the results were compared with the CD4+ cell counts and the HIV loads (calculated at the same time) to determine whether a higher GBV-C load correlated with either a higher CD4+ cell count or a lower HIV load.The GBV-C load was determined with the use of a prototype GBV-C bDNA assay at the Bayer Reference Testing Laboratory in Mijdrecht, the Netherlands. The format is similar to that of the Bayer HCV bDNA 3.0 assay. The target-specific probes used to facilitate the capture and labeling of the GBV-C RNA are located in the relatively conserved sequences of the 5' untranslated region of the GBV-C genome.11 Through a series of hybridization events, multiple bDNA and alkaline phosphatase–labeled oligonucleotide molecules are bound to the target molecule of GBV-C RNA. The addition of an enzyme-triggerable substrate results in a signal that is proportional to the amount of target RNA added. The result of the quantification of a specimen is determined by interpolation from a standard curve, and the results are reported in copies per milliliter. The lower limit of detection for this prototype bDNA assay is 67,000 copies per milliliter.
CD4+ and CD8+ lymphocytes were measured by fluorescence-activated cell sorting (FACScalibur, Becton Dickinson, Heidelberg, Germany), and the HIV load was determined semiquantitatively by a commercial PCR assay (Amplicor HIV-1 Monitor, Roche Diagnostics, Basel, Switzerland).
Statistical Analysis
A chi-square or Fisher's exact test was used to analyze categorical variables. The group means were compared by Student's t-test or by the Mann–Whitney U test, Wilcoxon rank-sum test, or Kruskal–Wallis test, if appropriate. Cumulative survival and AIDS-free survival were assessed by Kaplan–Meier analysis. Equality of survival distributions was evaluated by the log-rank test. A Cox proportional-hazards regression model was used for the analysis of continuous variables such as age, CD4+ cell count, and HIV load, as well as for the estimation of hazard ratios by means of a multivariate model including categories of sex, age, CD4+ cell count, CD8+ cell count, known duration of HIV infection, HIV load, and GBV-C status (RNA-positive, anti-E2–positive, or without a marker of exposure to GBV-C). Patients who were lost to follow-up were included in the analyses, but the data were censored at the time of the last visit. P values lower than 0.05 were considered to indicate statistical significance, and all reported P values are two-sided. All statistical analyses were performed with the use of SPSS software (version 9.0, SPSS, Chicago). All the data were held at the Medizinische Hochschule Hannover.
Results
Survival and AIDS-free Survival
On the date on which the serum used to determine GBV-C status was obtained, the overall mean (±SD) duration of HIV infection was 4.0±3.3 years. The mean duration of HIV infection was 4.6±3.7 years among the 33 patients who tested positive for GBV-C RNA, 4.0±3.3 years among the 112 patients who tested positive for anti-E2, and 3.7±3.2 years among the 52 patients without a marker of GBV-C infection (the presumably unexposed group). The mean duration of follow-up after the determination of GBV-C status was 4.2±2.1 years in the GBV-C–positive group, 2.7±2.3 years in the anti-E2–positive group, and 1.6±1.9 years in the unexposed group. A total of 59 patients were lost to follow-up. Among those lost to follow-up, the mean interval between the date of the determination of the GBV-C status and the last follow-up was 2.9±1.9 years for the 12 patients in the GBV-C–positive group, 1.6±1.9 years for the 30 patients in the anti-E2–positive group, and 1.6±1.9 years for the 17 patients in the unexposed group.
The duration of survival from the date of the first positive HIV test (Figure 2AFigure 2
Survival According to GBV-C Status.) and from the date of testing for GBV-C (Figure 2B) was significantly longer among those with GBV-C viremia (P<0.001 for both comparisons with the unexposed group and with the anti-E2–positive group). Survival in both analyses was also significantly longer in the anti-E2–positive group than in the unexposed group (P=0.02 for the comparison of the duration of survival from the date of the first positive HIV test, and P=0.01 for the comparison of the duration of survival from the date of testing for GBV-C). The longer overall survival was due in part to a significantly longer survival without progression to AIDS both from the date of the first positive HIV test (P<0.001) (Figure 3AFigure 3
AIDS-free Survival According to GBV-C Status.) and from the date of testing for GBV-C (P=0.002) (Figure 3B). Even after the development of AIDS, the patients who tested positive for GBV-C RNA had a better prognosis than those who did not (P=0.007 for the comparison with patients who were negative for GBV-C RNA) (Figure 4AFigure 4Survival after the Diagnosis of AIDS and after Highly Active Antiretroviral Therapy Became Available.).The introduction of highly active antiretroviral therapy has improved the prognosis of HIV-infected patients dramatically.20,21 Since highly active antiretroviral therapy became available in 1996 there has been a slower progression to death in HIV-infected patients, but the patients coinfected with GBV-C still have a significantly better survival rate (P=0.02 for the comparison with patients who were negative for GBV-C RNA) (Figure 4B).
In 1996, 98 of the 197 patients were still alive and undergoing follow-up. Of these patients, 24 (24.5 percent) had died by March 2000. A higher risk of death was significantly associated with the absence of GBV-C RNA, since only 1 of 27 GBV-C–positive patients (3.7 percent) died, as compared with 17 of 56 anti-E2–positive patients (30.4 percent) and 6 of 15 unexposed patients (40.0 percent) (P=0.01 by the chi-square test).
Cox proportional-hazards regression analysis revealed significant associations between survival and age (P=0.01), CD4+ cell count and CD8+ cell count (P<0.001 for the comparison with CD4+ and CD8+ cell counts as one variable), leukocyte count (P<0.001), lymphocyte count (P<0.001), and GBV-C–RNA status (P<0.001). The multivariate Cox regression analysis, however, revealed only three significant variables: CD4+ cell count (P<0.001), number of leukocytes (P=0.001), and GBV-C–RNA status (P=0.02). To control for the effects of age, we matched the GBV-C–positive patients with a subgroup of younger anti-E2–positive patients. Multiple regression analysis revealed only two significant variables: CD4+ cell count (P=0.002) and GBV-C–RNA status (P=0.01). With the inclusion in the model of the presumed duration of infection, P values were less than 0.001 for both the CD4+ cell count and the GBV-C–RNA status. In the Kaplan–Meier analysis of these age-matched patients, those with GBV-C RNA had a significantly better survival rate (P<0.001). We then matched each GBV-C–positive patient with an anti-E2–positive patient in the next higher category of CD4+ cell count, and the survival rate remained better in the GBV-C–positive group (P=0.04). The association between GBV-C and survival was further strengthened by Cox regression analyses both including and excluding the GBV-C status.
To analyze survival after highly active antiretroviral therapy became available, we performed a multivariate Cox regression analysis that included the CD4+ and CD8+ cell counts and the HIV load measured in 1996, as well as age, sex, and GBV-C status. Only the CD8+ cell count was still significantly associated with survival in this analysis (P<0.001), although a univariate Cox regression analysis had revealed significant associations between survival and GBV-C–RNA status (P=0.01), CD4+ cell count (P=0.03), CD8+ cell count (P=0.01), and HIV load (P=0.01).
Viral Load in Relation to GBV-C Status
The presence of GBV-C viremia was not only associated with higher CD4+ cell counts, as described previously,16 but also with a lower mean HIV load: 3.89±0.9 log copies per milliliter, as compared with 4.27±0.97 log copies per milliliter for anti-E2–positive patients and 4.59±0.7 log copies per milliliter for unexposed patients (P=0.03). When we analyzed the relations between the HIV viral load in 1996 and both the presence of GBV-C RNA and the number of antiretroviral drugs administered (one, two, or three) with the use of a partial correlation model, we found a stronger association between a low HIV load and the presence of GBV-C viremia (r=0.22, P=0.03) than between a low HIV load and the use of more antiretroviral drugs (r=0.14, P=0.1), a result that is evidence of a relation between GBV-C and HIV load.
Persistence of GBV-C Status
A total of 82 patients were retested for GBV-C RNA by PCR in 1998. According to these tests, none of the 45 previously anti-E2–positive patients who were retested had had a reactivation of, or superinfection with, GBV-C; 3 of the 13 previously unexposed patients who were retested had acquired GBV-C viremia. Two of the 24 previously GBV-C–positive patients no longer had GBV-C viremia; both these patients had received interferon because of coinfection with HCV.
GBV-C Load in Relation to HIV Load and CD4+ Cell Count
To analyze the relation between GBV-C and both the HIV load and the CD4+ cell count further, we analyzed a total of 169 plasma samples from 72 patients to determine the GBV-C load and to evaluate its correlation with the CD4+ cell count and the HIV load. All but 7 of the 169 plasma samples (162 samples or 95.9 percent) tested positive for GBV-C RNA by the bDNA assay. The GBV-C load ranged from 67,000 copies per milliliter of plasma to 143 million copies per milliliter, with a mean load of 45 million±36 million copies per milliliter (7.28±0.8 log copies per milliliter) for the 162 plasma samples with measurable GBV-C RNA.
A bivariate analysis found a significant inverse correlation between the GBV-C load and the HIV load (r=–0.33 [Pearson correlation], P<0.001) (Figure 5Figure 5
Correlation between the GBV-C Load and the HIV Load.) but no correlation between the GBV-C load and the CD4+ cell count (r=0.1, P=0.22). When we performed this analysis as a partial correlation, controlling for the receipt of highly active antiretroviral therapy and either the CD4+ cell count or the HIV load, we still found a significant correlation between the GBV-C load and the HIV load (r=–0.22, P=0.005) but no correlation between the GBV-C load and the CD4+ cell count (r=0.009, P=0.91).An investigation of the GBV-C load and the HIV load in patients who had started highly active antiretroviral therapy showed an increase in the GBV-C load but a decrease in the HIV load in all patients (data not shown). In contrast, the GBV-C load decreased and the HIV load increased in a patient who discontinued highly active antiretroviral therapy (data not shown).
Discussion
There is considerable debate about the importance of viral coinfection in patients with HIV.22 We attempted to analyze whether the presence of GBV-C infection influences the progression to AIDS or death in HIV-infected patients. In contrast to coinfections with HBV,2,3 HCV,23,24 or human T-cell lymphotropic virus type I,25 which have an adverse effect on the survival of HIV-infected patients, we found significantly improved survival in association with GBV-C viremia. GBV-C RNA was associated with better survival and slower progression to AIDS in the Kaplan–Meier analysis. Even after highly active antiretroviral therapy had become available in 1996, the presence of GBV-C viremia was associated with better survival. By contrast, coinfection with HCV is associated with poorer survival in patients receiving highly active antiretroviral therapy.25 Similarly, we observed better survival among GBV-C–positive patients even after the development of AIDS, whereas HCV coinfection increases the risk of death among patients in whom AIDS has developed.2
Although the effect of GBV-C infection is still widely debated,26,27 most studies of GBV-C in HIV-infected patients have revealed higher CD4+ cell counts in GBV-C–positive patients than in GBV-C–negative patients.28 Furthermore, most studies analyzing the survival of HIV-infected patients in relation to the presence or absence of GBV-C viremia showed longer overall and AIDS-free survival for GBV-C–positive patients16-19,29; the exception was one study that combined patients who tested positive for GBV-C RNA and those who tested positive for anti-E2 into one group.30
In our study, we found that GBV-C viremia was strongly correlated with longer survival even when known prognostic factors such as age, sex, CD4+ cell count, and CD8+ cell count were included in a multiple regression analysis. We hypothesized that if GBV-C has a beneficial effect on HIV infection, then the GBV-C load should correlate with either higher CD4+ cell counts, because of a mechanism such as the normalization of the half-life of CD4+ cells, or a lower HIV load, because of an inhibition of HIV replication. We found an inverse correlation between the GBV-C load and the HIV load but no correlation between the GBV-C load and the number of CD4+ cells. This finding suggests that GBV-C may impair HIV replication without causing any disease itself. Interestingly, the GBV-C load increased in all patients who started highly active antiretroviral therapy.
The survival advantage of the anti-E2–positive patients as compared with the unexposed patients might be explained by the previous GBV-C viremia. Thus, patients who have cleared GBV-C probably still benefit from the previous GBV-C infection, which is further reflected by the higher CD4+ cell count in the anti-E2–positive patients than in the unexposed patients.
In addition to the clinical data suggesting an inhibitory effect of GBV-C on HIV replication, Xiang et al., in a study reported elsewhere in this issue of the Journal, found reduced HIV replication in cultured peripheral-blood mononuclear cells that were coinfected with GBV-C.29 Similarly, the inhibition of HIV replication in vitro was recently observed in a study of coinfection with human T-cell lymphotropic virus type II (HTLV-II), in which the coculture of HIV-infected CD4+ cells with HTLV-II–infected CD8+ cells led to a down-regulation of HIV replication.31
A dramatic reduction in the HIV load was also observed in patients with acute, symptomatic scrub-typhus infection,32 which in itself, however, leads to disease. Nevertheless, these data illustrate that coinfections can down-regulate HIV replication and, especially when the agent is an apparently harmless virus such as GBV-C, may thereby improve the outcome of HIV infection. In view of the benign course of GBV-C infection and its effect on HIV infection, our findings can lead to interesting speculations regarding potential therapeutic consequences.
In conclusion, GBV-C viremia is associated with a decrease in the mortality rate among HIV-infected patients, slower progression to AIDS, and longer survival once AIDS has developed. It is possible that GBV-C infection is a marker for the presence of other factors that result in the slower progression of HIV infection, but we think this effect probably results from an inhibition of HIV replication by GBV-C. The identification of mechanisms by which GBV-C inhibits HIV replication might lead to the development of new therapeutic approaches for HIV infection.
Supported by the Paul Blümel Stiftung.
We are indebted to Isabella Glomb, Sabine Becker, and Peter Magerstedt for excellent technical assistance; to Thomas F. Schulz, Melanie Brinkmann, and Heiner Wedemeyer for their encouraging discussions and critical reading of the manuscript; and to Hartmut Herrmann for statistical advice.
Source Information
From the Department of Gastroenterology and Hepatology (H.L.T., A.K.-B., S.H., J.O., M.P.M.) and the Department of Clinical Immunology (H.H., M.S., R.E.S.), Medizinische Hochschule Hannover, Hannover, Germany; and Bayer Diagnostics, Emeryville, Calif. (J.C.W., B.G., J.D., M.M.).
Address reprint requests to Dr. Tillmann at the Department of Gastroenterology and Hepatology, Medizinische Hochschule Hannover, Carl Neuberg Str. 1, 30623 Hannover, Germany, or at tillmann@tx-amb.mh-hannover.de.
- References
References
1
McNair AN ,Main J ,Thomas HC . Interactions of the human immunodeficiency virus and the hepatotropic viruses. Semin Liver Dis 1992;12:188-196
CrossRef | Web of Science | Medline2
Ockenga J ,Tillmann HL ,Trautwein C ,Stoll M ,Manns MP ,Schmidt RE . Hepatitis B and C in HIV-infected patients: prevalence and prognostic value. J Hepatol 1997;27:18-24
CrossRef | Web of Science | Medline3
Telfer P ,Sabin C ,Devereux H ,Scott F ,Dusheiko G ,Lee C . Progression of HCV-associated liver disease in a cohort of haemophilic patients. Br J Haematol 1994;87:555-561
CrossRef | Web of Science | Medline4
Fischer HP ,Willsch E ,Bierhoff E ,Pfeifer U . Histopathologic findings in chronic hepatitis C. J Hepatol 1996;24:Suppl:35-42
Web of Science | Medline5
Martin P ,Di Bisceglie AM ,Kassianides C ,Lisker-Melman M ,Hoofnagle JH . Rapidly progressive non-A, non-B hepatitis in patients with human immunodeficiency virus infection. Gastroenterology 1989;97:1559-1561
Web of Science | Medline6
Eyster ME ,Diamondstone LS ,Lien JM ,Ehmann WC ,Quan S ,Goedert JJ . Natural history of hepatitis C virus infection in multitransfused hemophiliacs: effect of coinfection with human immunodeficiency virus: the Multicenter Hemophilia Cohort Study. J Acquir Immune Defic Syndr 1993;6:602-610
Web of Science | Medline7
Soto B ,Sanchez-Quijano A ,Rodrigo L , et al. Human immunodeficiency virus infection modifies the natural history of chronic parenterally-acquired hepatitis C with an unusually rapid progression to cirrhosis. J Hepatol 1997;26:1-5
CrossRef | Web of Science | Medline8
Pol S ,Lamorthe B ,Thi NT , et al. Retrospective analysis of the impact of HIV infection and alcohol use on chronic hepatitis C in a large cohort of drug users. J Hepatol 1998;28:945-950
CrossRef | Web of Science | Medline9
Pol S ,Fontaine H ,Carnot F , et al. Predictive factors for development of cirrhosis in parenterally acquired chronic hepatitis C: a comparison between immunocompetent and immunocompromised patients. J Hepatol 1998;29:12-19
CrossRef | Web of Science | Medline10
Simons JN ,Leary TP ,Dawson GJ , et al. Isolation of novel virus-like sequences associated with human hepatitis. Nat Med 1995;1:564-569
CrossRef | Web of Science | Medline11
Linnen J ,Wages J Jr ,Zhang-Keck ZY , et al. Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent. Science 1996;271:505-508
CrossRef | Web of Science | Medline12
Alter HJ . The cloning and clinical implications of HGV and HGBV-C. N Engl J Med 1996;334:1536-1537
Full Text | Web of Science | Medline13
Rambusch EG ,Wedemeyer H ,Tillmann HL ,Heringlake S ,Manns MP . Die Bedeutung einer Koinfektion mit dem Hepatitis-G-Virus für die chronische Hepatitis C -- ein Review der Literatur. Z Gastroenterol 1998;36:41-53
Web of Science | Medline14
Tillmann HL ,Heringlake S ,Trautwein C , et al. Antibodies against the GB virus C envelope 2 protein before liver transplantation protect against GB virus C de novo infection. Hepatology 1998;28:379-384
CrossRef | Web of Science | Medline15
Dille BJ ,Surowy TK ,Gutierrez RA , et al. An ELISA for detection of antibodies to the E2 protein of GB virus C. J Infect Dis 1997;175:458-461
CrossRef | Web of Science | Medline16
Heringlake S ,Ockenga J ,Tillmann HL , et al. GB virus C/hepatitis G virus infection: a favorable prognostic factor in human immunodeficiency virus-infected patients? J Infect Dis 1998;177:1723-1726
CrossRef | Web of Science | Medline17
Toyoda H ,Fukuda Y ,Hayakawa T ,Takamatsu J ,Saito H . Effect of GB virus C/hepatitis G virus coinfection on the course of HIV infection in hemophilia patients in Japan. J Acquir Immune Defic Syndr Hum Retrovirol 1998;17:209-213
CrossRef | Medline18
Lefrere JJ ,Roudot-Thoraval F ,Morand-Joubert L , et al. Carriage of GB virus C/hepatitis G virus RNA is associated with a slower immunologic, virologic, and clinical progression of human immunodeficiency virus disease in coinfected persons. J Infect Dis 1999;179:783-789
CrossRef | Web of Science | Medline19
Yeo AET ,Matsumoto A ,Hisada M ,Shih JW ,Alter HJ ,Goedert JJ . Effect of hepatitis G virus infection on progression of HIV infection in patients with hemophilia: Multicenter Hemophilia Cohort Study. Ann Intern Med 2000;132:959-963
Web of Science | Medline20
Carpenter CC ,Fischl MA ,Hammer SM , et al. Antiretroviral therapy for HIV infection in 1998: updated recommendations of the International AIDS Society-USA Panel. JAMA 1998;280:78-86
CrossRef | Web of Science | Medline21
Palella FJ Jr ,Delaney KM ,Moorman AC , et al. Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection. N Engl J Med 1998;338:853-860
Full Text | Web of Science | Medline22
Sagnelli E ,Coppola N ,Scolastico C , et al. Virologic and clinical expressions of reciprocal inhibitory effect of hepatitis B, C, and delta viruses in patients with chronic hepatitis. Hepatology 2000;32:1106-1110
CrossRef | Web of Science | Medline23
Lesens O ,Deschenes M ,Steben M ,Belanger G ,Tsoukas CM . Hepatitis C virus is related to progressive liver disease in human immunodeficiency virus-positive hemophiliacs and should be treated as an opportunistic infection. J Infect Dis 1999;179:1254-1258
CrossRef | Web of Science | Medline24
Greub G ,Ledergerber B ,Battegay M , et al. Clinical progression, survival, and immune recovery during antiretroviral therapy in patients with HIV-1 and hepatitis C virus coinfection: the Swiss HIV Cohort Study. Lancet 2000;356:1800-1805
CrossRef | Web of Science | Medline25
Bartholomew C ,Blattner W ,Cleghorn F . Progression to AIDS in homosexual men co-infected with HIV and HTLV-I in Trinidad. Lancet 1987;2:1469-1469
CrossRef | Web of Science | Medline26
Sherlock S . The hepatic flaviviridae: summary. J Viral Hepat 1999;6:Suppl 1:1-5
CrossRef | Web of Science | Medline27
Wachtler M ,Hofmann A ,Muller G , et al. Prevalence of GB virus C/hepatitis G virus RNA and anti-E2 glycoprotein antibodies in homosexual men with HIV coinfection. Infection 2000;28:297-300
CrossRef | Web of Science | Medline28
Tillmann HL, Manns MP. GB virus-C infection in patients infected with the human immunodeficiency virus: evidence for a beneficial influence of GBV-C on HIV infection and discussion of possible mechanisms of their interactions. Antiviral Res (in press).
29
Xiang J ,Wunschmann S ,Diekema DJ , et al. Effect of coinfection with GB virus C on survival among patients with HIV infection. N Engl J Med 2001;345:707-714
Full Text | Web of Science | Medline30
Sabin CA ,Devereux H ,Kinson Z , et al. Effect of coinfection with hepatitis G virus on HIV disease progression in hemophilic men. J Acquir Immune Defic Syndr Hum Retrovirol 1998;19:546-548
CrossRef | Medline31
Casoli C ,Vicenzi V ,Cimarelli A , et al. HTLV-II down-regulates HIV-1 replication in IL-2-stimulated primary PBMC of coinfected individuals through expression of MIP-1α. Blood 2000;95:2760-2769
Web of Science | Medline32
Watt G ,Kantipong P ,de Souza M , et al. HIV-1 suppression during acute scrub-typhus infection. Lancet 2000;356:475-479
CrossRef | Web of Science | Medline
- Citing Articles (123)
Citing Articles
1
Nirjal Bhattarai, Jack T. Stapleton. (2012) GB virus C: the good boy virus?. Trends in Microbiology
CrossRef2
Maria Teresa Maidana Giret, Esper Georges Kallas. (2012) GBV-C: State of the Art and Future Prospects. Current HIV/AIDS Reports
CrossRef3
Mark D. Berzsenyi, David J. Woollard, Catriona A. McLean, Scott Preiss, Victoria M. Perreau, Michael R. Beard, D. Scott Bowden, Benjamin C. Cowie, Shuo Li, Anne M. Mijch, Stuart K. Roberts. (2011) Down-regulation of intra-hepatic T-cell signaling associated with GB virus C in a HCV/HIV co-infected group with reduced liver disease. Journal of Hepatology 55:3, 536-544
CrossRef4
F. Maaref, B. Kilani, L. Ammari, A. Ben Othman, M. Zribi, C. Fendri, A. Masmoudi. (2011) Prévalence de l’hépatite G et des hépatites virales B et C dans la population VIH (+) de l’hôpital La Rabta, Tunis, Tunisie. Pathologie Biologie 59:4, 213-216
CrossRef5
Maria J. Gómara, Leticia Fernández, Teresa Pérez, Solveig Tenckhoff, Aurora Casanovas, Hans L. Tillmann, Isabel Haro. (2011) Diagnostic Value of Anti-GBV-C Antibodies in HIV-Infected Patients. Chemical Biology & Drug Design 78:2, 277-282
CrossRef6
Liisa K. Selin, Myriam F. Wlodarczyk, Anke R. Kraft, Siwei Nie, Laurie L. Kenney, Roberto Puzone, Franco Celada. (2011) Heterologous immunity: Immunopathology, autoimmunity and protection during viral infections. Autoimmunity 44:4, 328-347
CrossRef7
Markus Neibecker, Carolynne Schwarze-Zander, Jürgen K. Rockstroh, Ulrich Spengler, Jason T. Blackard. (2011) Evidence for extensive genotypic diversity and recombination of GB virus C (GBV-C) in Germany. Journal of Medical Virology 83:4, 685-694
CrossRef8
Marilyn J. Roossinck. (2011) The good viruses: viral mutualistic symbioses. Nature Reviews Microbiology 9:2, 99-108
CrossRef9
Wendy Bhanich Supapol, Robert S. Remis, Janet Raboud, Margaret Millson, Jordan Tappero, Rupert Kaul, Prasad Kulkarni, Michelle S. McConnell, A. Mock Philip, Janet M. McNicholl, Anuvat Roongpisuthipong, Tawee Chotpitayasunondh, Nathan Shaffer, Salvatore Butera. (2011) Prevalence and correlates of GB virus C infection in HIV-infected and HIV-uninfected pregnant women in Bangkok, Thailand. Journal of Medical Virology 83:1, 33-44
CrossRef10
E. L. Mohr, K. K. Murthy, J. H. McLinden, J. Xiang, J. T. Stapleton. (2011) The natural history of non-human GB virus C in captive chimpanzees. Journal of General Virology 92:1, 91-100
CrossRef11
Rosana Alcalde, Anna Nishiya, Jorge Casseb, Lilian Inocêncio, Luiz A.M. Fonseca, Alberto J.S. Duarte. (2010) Prevalence and distribution of the GBV-C/HGV among HIV-1-infected patients under anti-retroviral therapy. Virus Research 151:2, 148-152
CrossRef12
Suhong Zhang, Ying Zhang, Kathryn Chaloner, Jack T. Stapleton. (2010) A copula model for bivariate hybrid censored survival data with application to the MACS study. Lifetime Data Analysis 16:2, 231-249
CrossRef13
Maria Teresa Maidana-Giret, Tânia M Silva, Mariana M Sauer, Helena Tomiyama, José Eduardo Levi, Katia C Bassichetto, Anna Nishiya, Ricardo S Diaz, Ester C Sabino, Ricardo Palacios, Esper Georges Kallas. (2009) GB virus type C infection modulates T-cell activation independently of HIV-1 viral load. AIDS 23:17, 2277-2287
CrossRef14
Emma L. Mohr, Jack T. Stapleton. (2009) GB virus type C interactions with HIV: the role of envelope glycoproteins. Journal of Viral Hepatitis 16:11, 757-768
CrossRef15
Wei Zhang, Ying Zhang, Kathryn Chaloner, Jack T. Stapleton. (2009) Imputation methods for doubly censored HIV data. Journal of Statistical Computation and Simulation 79:10, 1245-1257
CrossRef16
Mark D Berzsenyi, D Scott Bowden, Stuart K Roberts, Peter A Revill. (2009) GB virus C genotype 2 predominance in a hepatitis C virus/HIV infected population associated with reduced liver disease. Journal of Gastroenterology and Hepatology 24:8, 1407-1410
CrossRef17
Herbert W. Virgin, E. John Wherry, Rafi Ahmed. (2009) Redefining Chronic Viral Infection. Cell 138:1, 30-50
CrossRef18
Dominique Pontier, Micheline Guiserix, David Fouchet, Frank Sauvage, Jean-Paul Gonzalez. (2009) Emergence of infectious diseases: when hidden pathogens break out. Comptes Rendus Biologies 332:6, 539-547
CrossRef19
Maren Moenkemeyer, Hans Heiken, Reinhold E. Schmidt, Torsten Witte. (2009) Higher risk of cytomegalovirus reactivation in human immunodeficiency virus–1–infected patients homozygous for MICA5.1. Human Immunology 70:3, 175-178
CrossRef20
Jack T Stapleton, Kathryn Chaloner, Jingyang Zhang, Donna Klinzman, Inara E Souza, Jinhua Xiang, Alan Landay, John Fahey, Richard Pollard, Ronald Mitsuyasu. (2009) GBV-C viremia is associated with reduced CD4 expansion in HIV-infected people receiving HAART and interleukin-2 therapy. AIDS 23:5, 605-610
CrossRef21
Dominique Pontier, David Fouchet, Narges Bahi-Jaber, Hervé Poulet, Micheline Guiserix, Eugenia Natoli, Frank Sauvage. (2009) When domestic cat (Felis silvestris catus) population structures interact with their viruses. Comptes Rendus Biologies 332:2-3, 321-328
CrossRef22
Giovana Lotici Baggio-Zappia, Celso Francisco Hernandes Granato. (2009) HIV-GB virus C co-infection: an overview. Clinical Chemistry and Laboratory Medicine 47:1, 12-19
CrossRef23
Esaki Muthu Shankar, Sunil Suhas Solomon, Ramachandran Vignesh, Kailapuri G. Murugavel, Muthu Sundaram, Suniti Solomon, Pachamuthu Balakrishnan, Nagalingeswaran Kumarasamy. (2008) GB virus infection: a silent anti-HIV panacea within?. Transactions of the Royal Society of Tropical Medicine and Hygiene 102:12, 1176-1180
CrossRef24
Lionel Piroth, Fabrice Carrat, Sylvie Larrat, Isabelle Goderel, Benoit Martha, Christopher Payan, Françoise Lunel-Fabiani, Firouze Bani-Sadr, Christian Perronne, Patrice Cacoub, Stanislas Pol, Patrice Morand. (2008) Prevalence and impact of GBV-C, SEN-V and HBV occult infections in HIV–HCV co-infected patients on HCV therapy. Journal of Hepatology 49:6, 892-898
CrossRef25
Soheila Hekmat, Minoo Mohraz, Rouhollah Vahabpour, Sara Jam, Golnaz Bahramali, Mohammad Banifazl, Arezoo Aghakhani, Ali Eslamifar, Fereidoun Mahboudi, Rozita Edalat, Amitis Ramezani. (2008) Frequency and genotype of GB virus C among Iranian patients infected with HIV. Journal of Medical Virology 80:11, 1941-1946
CrossRef26
Maren Moenkemeyer, Reinhold E. Schmidt, Heiner Wedemeyer, Hans L. Tillmann, Hans Heiken. (2008) GBV-C coinfection is negatively correlated to Fas expression and Fas-mediated apoptosis in HIV-1 infected patients. Journal of Medical Virology 80:11, 1933-1940
CrossRef27
Samuel Alizon. (2008) Decreased Overall Virulence in Coinfected Hosts Leads to the Persistence of Virulent Parasites. The American Naturalist 172:2, E67-E79
CrossRef28
Wendy Bhanich Supapol, Robert S. Remis, Janet Raboud, Margaret Millson, Jordan Tappero, Rupert Kaul, Prasad Kulkarni, Michelle S. McConnell, Philip A. Mock, Mary Culnane, Janet McNicholl, Anuvat Roongpisuthipong, Tawee Chotpitayasunondh, Nathan Shaffer, Salvatore Butera. (2008) Reduced Mother‐to‐Child Transmission of HIV Associated with Infant but not Maternal GB Virus C Infection. The Journal of Infectious Diseases 197:10, 1369-1377
CrossRef29
Per Björkman, Anders Widell. (2008) HIV and GB Virus C Infections Seen from the Perspective of the Vertically Coexposed Infant. The Journal of Infectious Diseases 197:10, 1358-1360
CrossRef30
Federico Martini, Alessandra Sacchi, Eleonora Lalle, Concetta Castilletti, Gianpiero D'Offizi, Isabella Abbate, Maria Rosaria Capobianchi. (2008) GB Virus Type C–Driven Protection in HIV/HCV Coinfection: Possible Role of Interferon Gamma and Dendritic Cell Activation. Gastroenterology 134:5, 1631-1633
CrossRef31
A SACCHI. (2008) GB-Virus Type C Effect on HIV Infection, Interferon System, and Dendritric Cells. Archives of Medical Research 39:3, 362-363
CrossRef32
Wei Zhang, Kathryn Chaloner, Mary Kathryn Cowles, Ying Zhang, Jack T. Stapleton. (2008) A Bayesian analysis of doubly censored data using a hierarchical Cox model. Statistics in Medicine 27:4, 529-542
CrossRef33
Ferdinando Dianzani, Gabriella Rozera, Isabella Abbate, Gianpiero D'Offizi, Amina Abdeddaim, Chrysoula Vlassi, Giorgio Antonucci, Pasquale Narciso, Federico Martini, Maria R. Capobianchi. (2008) Interferon May Prevent HIV Viral Rebound After HAART Interruption in HIV Patients. Journal of Interferon & Cytokine Research 28:1, 1-3
CrossRef34
Mark D. Berzsenyi, D. Scott Bowden, Heath A. Kelly, Kerrie M. Watson, Anne M. Mijch, Rachel A. Hammond, Suzanne M. Crowe, Stuart K. Roberts. (2007) Reduction in Hepatitis C–Related Liver Disease Associated With GB Virus C in Human Immunodeficiency Virus Coinfection. Gastroenterology 133:6, 1821-1830
CrossRef35
M MOLLAHOSEINI, A POURFATHOLLAH, M MOHRAZ, Z SOHEILI, S AMINI, M AGHAIEPOUR, S SAMIEE, M NIKOOGOFTAR, R MESHKANI. (2007) Evaluation of Circulating Natural Type 1 Interferon-producing Cells in HIV/GBV-C and HIV/HCV Coinfected Patients: A Preliminary Study. Archives of Medical Research 38:8, 868-875
CrossRef36
Per Bj??rkman, Leo Flamholc, Vilma Molnegren, Aline Marshall, Nuray G??ner, Anders Widell. (2007) Enhanced and resumed GB virus C replication in HIV-1-infected individuals receiving HAART. AIDS 21:12, 1641-1643
CrossRef37
Giuseppe Indolfi, Maria Moriondo, Luisa Galli, Chiara Azzari, Giovanni Maria Poggi, Massimo Resti, Maurizio de Martino. (2007) Mother-to-infant transmission of multiple blood-borne viral infections from multi-infected mothers. Journal of Medical Virology 79:6, 743-747
CrossRef38
A. Wahid Ansari, Hans Heiken, Maren Moenkemeyer, Reinhold E. Schmidt. (2007) Dichotomous effects of C–C chemokines in HIV-1 pathogenesis. Immunology Letters 110:1, 1-5
CrossRef39
Thomas M Kaufman, James H McLinden, Jinhua Xiang, Alfred M Engel, Jack T Stapleton. (2007) The GBV-C envelope glycoprotein E2 does not interact specifically with CD81. AIDS 21:8, 1045-1048
CrossRef40
Pierre Pradat, Nicolas Voirin, Hans Ludger Tillmann, Michèle Chevallier, Christian Trépo. (2007) Progression to cirrhosis in hepatitis C patients: an age-dependent process. Liver International 27:3, 335-339
CrossRef41
Kinan Rifai, Heiner Wedemeyer, Jens Rosenau, Jürgen Klempnauer, Christian P. Strassburg, Michael P. Manns, Hans L. Tillmann. (2007) Longer survival of liver transplant recipients with hepatitis virus coinfections. Clinical Transplantation 21:2, 258-264
CrossRef42
W.-H. Sheng, C.-C. Hung, R.-J. Wu, J.-T. Wang, P.-J. Chen, S.-C. Chang, J.-H. Kao. (2007) Clinical Impact of GB Virus C Viremia on Patients with HIV Type 1 Infection in the Era of Highly Active Antiretroviral Therapy. Clinical Infectious Diseases 44:4, 584-590
CrossRef43
R. Dodd. (2006) Other emerging viral pathogens. ISBT Science Series 1:1, 257-262
CrossRef44
Manfred Vogt, Barbara Klostermann, Siegmund Braun, Raymonde Busch, John Hess, Gert Frösner, Thomas Lang. (2006) Prevalence and clinical role of GBV-C infection after cardiac surgery in childhood: A study on 414 patients. Journal of Infection 53:1, 43-48
CrossRef45
Rosa Ryt-Hansen, Terese L. Katzenstein, Jan Gerstoft, Jesper Eugen-Olsen. (2006) No Influence of GB Virus C on Disease Progression in a Danish Cohort of HIV-Infected Men. AIDS Research and Human Retroviruses 22:6, 496-498
CrossRef46
Amadou A Sall, Olivier Ségéral, Jean-Marc Reynes, Sreyrath Lay, Vara Ouk, Chan Roeun Hak, Cheng Lay Keo, Robin R Lefait, Jean-François Delfraissy, Arnaud Fontanet. (2006) Immunosuppression and GB virus C-RNA detection among HIV-infected patients in Cambodia. AIDS 20:8, 1199-1201
CrossRef47
Manuel Battegay, Reto Nüesch, Bernard Hirschel, Gilbert R Kaufmann. (2006) Immunological recovery and antiretroviral therapy in HIV-1 infection. The Lancet Infectious Diseases 6:5, 280-287
CrossRef48
W Zhang, K Chaloner, HL Tillmann, CF Williams, JT Stapleton. (2006) Effect of early and late GB virus C viraemia on survival of HIV-infected individuals: a meta-analysis. HIV Medicine 7:3, 173-180
CrossRef49
JN Mehrishi, Tibor Bakács. (2006) HIV and GB virus C coinfection – Authors' reply. The Lancet Infectious Diseases 6:4, 188-189
CrossRef50
Diane Descamps, Florence Damond, Antoine Bénard, Sophie Matheron, Pauline Campa, Audrey Taieb, Réda Yahyaoui, Geneviève Chêne, Françoise Brun-Vézinet. (2006) No association between GB virus C infection and disease progression in HIV-2-infected patients from the French ANRS HIV-2 cohort. AIDS 20:7, 1076-1079
CrossRef51
H. L. Tillmann, J. Hadem, L. Leifeld, K. Zachou, A. Canbay, C. Eisenbach, I. Graziadei, J. Encke, H. Schmidt, W. Vogel, A. Schneider, U. Spengler, G. Gerken, G. N. Dalekos, H. Wedemeyer, M. P. Manns. (2006) Safety and efficacy of lamivudine in patients with severe acute or fulminant hepatitis B, a multicenter experience. Journal of Viral Hepatitis 13:4, 256-263
CrossRef52
Chengyao Li, Paul Collini, Kwabena Danso, Shirley Owusu-Ofori, Albert Dompreh, Daniel Candotti, Ohene Opare-Sem, Jean-Pierre Allain. (2006) GB virus C and HIV-1 RNA load in single virus and co-infected West African individuals. AIDS 20:3, 379-386
CrossRef53
IE Souza, W Zhang, RS Diaz, K Chaloner, D Klinzman, JT Stapleton. (2006) Effect of GB virus C on response to antiretroviral therapy in HIV-infected Brazilians*. HIV Medicine 7:1, 25-31
CrossRef54
Lenhard K Rudolph, Hans L Tillmann. (2005) Hepatitis C virus infection in the elderly. Aging Health 1:3, 409-417
CrossRef55
NAOMI L.C. LUBAN. (2005) Transfusion Safety: Where Are We Today?. Annals of the New York Academy of Sciences 1054:1, 325-341
CrossRef56
Hans L Tillmann, Thorsten Kaiser, Zoe Fox, Schlomo Staszewski, Francesco Antunes, Antonella d??Arminio Monforte, Pietro Vernazza, Andrew Hill, Ulrik B Dragsted, Jens D Lundgren. (2005) Impact of Coinfection With HIV-1 and GB Virus C in Patients Receiving a Ritonavir-Boosted HAART Regimen: A Substudy to the MaxCmin1 Trial. JAIDS Journal of Acquired Immune Deficiency Syndromes 40:3, 378-380
CrossRef57
Bernd Kupfer, Torsten Ruf, Bertfried Matz, Jacob Nattermann, Ulrich Spengler, Jürgen K. Rockstroh, Hans H. Brackmann, Johannes Blümel, Michael Tacke, Rolf Kaiser. (2005) Comparison of GB virus C, HIV, and HCV infection markers in hemophiliacs exposed to non-inactivated or inactivated factor concentrates. Journal of Clinical Virology 34:1, 42-47
CrossRef58
RUBEN R PLENTZ, HANS L TILLMANN, STEFAN KUBICKA, JORG S BLECK, MICHAEL GEBEL, MICHAEL P MANNS, KARL L RUDOLPH. (2005) Hepatocellular carcinoma and octreotide: Treatment results in prospectively assigned patients with advanced tumor and cirrhosis stage. Journal of Gastroenterology and Hepatology 20:9, 1422-1428
CrossRef59
H. Toyoda, T. Honda, Y. Katano, H. Goto, J. Takamatsu. (2005) Clearance of GB virus C during highly active antiretroviral therapy and course of HIV disease progression in HIV-infected patients with hemophilia. European Journal of Clinical Microbiology & Infectious Diseases 24:9, 645-646
CrossRef60
Mark D. Berzsenyi, D. Scott Bowden, Stuart K. Roberts. (2005) GB virus C: Insights into co-infection. Journal of Clinical Virology 33:4, 257-266
CrossRef61
Susan Jung, Olivia Knauer, Norbert Donhauser, Melanie Eichenmüller, Martin Helm, Bernhard Fleckenstein, Heide Reil. (2005) Inhibition of HIV strains by GB virus C in cell culture can be mediated by CD4 and CD8 T-lymphocyte derived soluble factors. AIDS 19:12, 1267-1272
CrossRef62
Raed O. Abu Odeh, Moslih I. Al-Moslih, Mohammed Wafi Al-Jokhdar, Sinda A. Ezzeddine. (2005) Detection and genotyping of GBV-C virus in the United Arab Emirates. Journal of Medical Virology 76:4, 534-540
CrossRef63
JN Mehrishi, Tibor Bakács. (2005) HIV and hepatitis G virus/GB virus C co-infection: beneficial or not?. The Lancet Infectious Diseases 5:8, 464-465
CrossRef64
Mark D. Berzsenyi, D. Scott Bowden, Michael J. Bailey, Cheryl White, Patrick Coghlan, Francis J. Dudley, Stuart K. Roberts. (2005) Male to male sex is associated with a high prevalence of exposure to GB virus C. Journal of Clinical Virology 33:3, 243-246
CrossRef65
Abdurrahman Sagir, Ortwin Adams, Mehmet Antakyali, Mark Oette, Andreas Erhardt, Tobias Heintges, Dieter Häussinger. (2005) SEN virus has an adverse effect on the survival of HIV-positive patients. AIDS 19:10, 1091-1096
CrossRef66
M. Gimenez-Barcons, M. Ribera, A. Llano, B. Clotet, J. A. Este, M. A. Martinez. (2005) Analysis of Chemokine and Cytokine Expression in Patients with HIV and GB Virus Type C Coinfection. Clinical Infectious Diseases 40:9, 1342-1349
CrossRef67
Jinhua Xiang, Christina Martinez-Smith, Michael Gale, Qing Chang, Douglas R. Labrecque, Warren N. Schmidt, Jack T. Stapleton. (2005) GB Virus Type C NS5A Sequence Polymorphisms: Association with Interferon Susceptibility and Inhibition of PKR-Mediated eIF2α Phosphorylation. Journal of Interferon & Cytokine Research 25:5, 261-270
CrossRef68
Susan Schuval, Jane C. Lindsey, Jack T. Stapleton, Russell B. Van Dyke, Paul Palumbo, Lynne M. Mofenson, James M. Oleske, Joseph Cervia, Andrea Kovacs, Wayne N. Dankner, Elizabeth Smith, Barbara Nowak, Gregory Ciupak, Nancy Webb, Michelle Eagle, Dorothy Smith, Roslyn Hennessey, Melissa Goodman-Kerkau, Donna Klinzman, Georg Hess, Dietmar Zdunek, Myron J. Levin. (2005) GB Virus C Infection in Children With Perinatal Human Immunodeficiency Virus Infection. The Pediatric Infectious Disease Journal 24:5, 417-422
CrossRef69
S. Kaye, M. Howard, A. Alabi, A. Hansmann, H. Whittle, M. Schim van der Loeff. (2005) No Observed Effect of GB Virus C Coinfection on Disease Progression in a Cohort of African Woman Infected with HIV-1 or HIV-2. Clinical Infectious Diseases 40:6, 876-878
CrossRef70
Hashem B. El-Serag, Thomas P. Giordano, Jennifer Kramer, Peter Richardson, Julianne Souchek. (2005) Survival in hepatitis C and HIV co-infection: A cohort study of hospitalized veterans. Clinical Gastroenterology and Hepatology 3:2, 175-183
CrossRef71
F. Martini, M. Solmone, C. Agrati, M. R. Capobianchi, F. Iacomi, G. Antonucci, F. Poccia. (2005) Influence of GB Virus Type C and HIV Coinfection on T cells. Clinical Infectious Diseases 40:2, 326-328
CrossRef72
Sarah L. George, Dino Varmaz. (2005) What you need to know about GB virus C. Current Gastroenterology Reports 7:1, 54-62
CrossRef73
Per Bj??rkman, Leo Flamholc, Anders Widell. (2004) GB virus C viraemia and HIV progression. AIDS 18:17, 2345-2346
CrossRef74
H. L. Tillmann, M. P. Manns, C. Claes, H. Heiken, R. E. Schmidt, M. Stoll. (2004) GB virus C infection and quality of life in HIV-positive patients. AIDS Care 16:6, 736-743
CrossRef75
Marc Lehmann, Manuela F. Meyer, Masyar Monazahian, Hans L. Tillmann, Michael P. Manns, Heiner Wedemeyer. (2004) High rate of spontaneous clearance of acute hepatitis C virus genotype 3 infection. Journal of Medical Virology 73:3, 387-391
CrossRef76
H. J. Alter. (2004) Emerging, re-emerging and submerging infectious threats to the blood supply. Vox Sanguinis 87:s2, 56-61
CrossRef77
(2004) GB Virus C and Survival in Persons with HIV Infection. New England Journal of Medicine 350:25, 2617-2618
Full Text78
V. Vargas Blasco. (2004) Hepatitis por otros virus hepatotropos. Medicine - Programa de Formación Médica Continuada Acreditado 9:11, 666-673
CrossRef79
Anthony L. DeVico, Robert C. Gallo. (2004) Control of HIV-1 infection by soluble factors of the immune response. Nature Reviews Microbiology 2:5, 401-413
CrossRef80
Per Bj??rkman, Leo Flamholc, Anders Naucl??r, Vilma Molnegren, Ewa Wallmark, Anders Widell. (2004) GB virus C during the natural course of HIV-1 infection. AIDS 18:6, 877-886
CrossRef81
Williams, Carolyn F., Klinzman, Donna, Yamashita, Traci E., Xiang, Jinhua, Polgreen, Philip M., Rinaldo, Charles, Liu, Chenglong, Phair, John, Margolick, Joseph B., Zdunek, Dietmar, Hess, Georg, Stapleton, Jack T., . (2004) Persistent GB Virus C Infection and Survival in HIV-Infected Men. New England Journal of Medicine 350:10, 981-990
Full Text82
Robert C. Bollinger, Amita Gupta. (2004) Editorial Commentary: GB Virus Type C: A Virus in Search of a Disease or a Role in HIV Therapy?. Clinical Infectious Diseases 38:3, 410-411
CrossRef83
Mahomed A. Sathar, Denis F. York, Eleanor Gouws, Anna Coutsoudis, Hoosen M. Coovadia. (2004) GB Virus Type C Coinfection in HIV‐Infected African Mothers and Their Infants, KwaZulu Natal, South Africa. Clinical Infectious Diseases 38:3, 405-409
CrossRef84
H. Wedemeyer, M. Cornberg, B. Tegtmeyer, H. Frank, H. L. Tillmann, M. P. Manns. (2004) Isolated anti-HBV core phenotype in anti-HCV-positive patients is associated with hepatitis C virus replication. Clinical Microbiology and Infection 10:1, 70-72
CrossRef85
Maria Teresa Bortolin, Stefania Zanussi, Rosamaria Tedeschi, Chiara Pratesi, Monica D’Andrea, Ettore Bidoli, Giampiero di Gennaro, Paolo De Paoli. (2004) Evaluation of Three Molecular Biology-Based Assays for the Detection of GB Virus C/Hepatitis G Virus in Clinical Specimens. Intervirology 47:6, 314-320
CrossRef86
Eugenia Quiros-Roldan, Carlo Torti, Silvia Pirovano, Francesca Moretti, Salvatore Casari, Giampiero Carosi, Vicente Soriano, Luisa Imberti. (2004) Modifications in SENV DNA Detection and/or SENV Subtype Determination over a Prospective Follow-Up in a Cohort of HIV-Positive Patients: Is This a Moving Target?. Intervirology 47:6, 350-354
CrossRef87
Daniel E. Kaufmann, Mathias Lichterfeld, Marcus Altfeld, Marylyn M. Addo, Mary N. Johnston, Paul K. Lee, Bradford S. Wagner, Elizabeth T. Kalife, Daryld Strick, Eric S. Rosenberg, Bruce D. Walker. (2004) Limited Durability of Viral Control following Treated Acute HIV Infection. PLoS Medicine 1:2, e36
CrossRef88
J. T. Wilde. (2004) HIV and HCV coinfection in haemophilia. Haemophilia 10:1, 1-8
CrossRef89
Masahiko TAKAHASHI. (2004) Japanese Journal of Thrombosis and Hemostasis 15:6, 483-500
CrossRef90
Philip M. Polgreen, Jinhua Xiang, Qing Chang, Jack T. Stapleton. (2003) GB virus type C/hepatitis G virus: a non-pathogenic flavivirus associated with prolonged survival in HIV-infected individuals. Microbes and Infection 5:13, 1255-1261
CrossRef91
Roel Sentjens, Miren Basaras, Peter Simmonds, Hans Vrielink, Henk Reesink. (2003) HGV/GB virus C transmission by blood components in patients undergoing open-heart surgery. Transfusion 43:11, 1558-1562
CrossRef92
Jacob Nattermann, Hans-Dieter Nischalke, Bernd Kupfer, Jürgen Rockstroh, Lothar Hess, Tilman Sauerbruch, Ulrich Spengler. (2003) Regulation of CC chemokine receptor 5 in Hepatitis G virus infection. AIDS 17:10, 1457-1462
CrossRef93
Ligia A Pinto, Edith Grene, Robin Baker, C Mac Trubey, Naomi Torres, Matthew Trivett, Gene M Shearer. (2003) HIV inhibitory activity generated by antigen-stimulated cord blood leukocytes. AIDS 17:9, 1389-1392
CrossRef94
Peer B. Christensen, Niels Fisker, Lone H. Mygind, Henrik B. Krarup, Niels Wedderkopp, Kim Varming, J
rgen Georgsen. (2003) GB Virus C epidemiology in denmark: Different routes of transmission in children and low- and high-risk adults. Journal of Medical Virology 70:1, 156-162
CrossRef95
A. Scott Muerhoff, Hans L. Tillmann, Michael P. Manns, George J. Dawson, Suresh M. Desai. (2003) GB Virus C genotype determination in GB Virus-C/HIV co-infected individuals. Journal of Medical Virology 70:1, 141-149
CrossRef96
Barbara Suligoi, Maria Dorrucci, Ilaria Uccella, Massimo Andreoni, Giovanni Rezza, . (2003) Effect of multiple herpesvirus infections on the progression of HIV disease in a cohort of HIV seroconverters. Journal of Medical Virology 69:2, 182-187
CrossRef97
Paola Costa, Stefano Rusconi, Manuela Fogli, Domenico Mavilio, Giuseppe Murdaca, Francesco Puppo, Maria Cristina Mingari, Massimo Galli, Lorenzo Moretta, Andrea De Maria. (2003) Low expression of inhibitory natural killer receptors in CD8 cytotoxic T lymphocytes in long-term non-progressor HIV-1-infected patients. AIDS 17:2, 257-260
CrossRef98
P. Vanhems, N. Voirin, C. Trépo, M.A. Trabaud, D. Yzèbe, C. Del Signore, C. Régis, J. Fabry. (2003) The risk of hospital-acquired GB virus C infection: a pilot case–control study. Journal of Hospital Infection 53:1, 72-75
CrossRef99
Sarah L. George, Sabina Wünschmann, James McCoy, Jinhua Xiang, Jack T. Stapleton. (2002) Interactions between GB virus type C and HIV. Current Infectious Disease Reports 4:6, 550-558
CrossRef100
Markus Birk, Stefan Lindbäck, Christer Lidman. (2002) No influence of GB virus C replication on the prognosis in a cohort of HIV-1-infected patients. AIDS 16:18, 2482-2485
CrossRef101
M. Schroter, R. Laufs, B. Zollner, B. Knodler, P. Schafer, M. Sterneck, L. Fischer, H.-H. Feucht. (2002) Prevalence of SENV-H viraemia among healthy subjects and individuals at risk for parenterally transmitted diseases in Germany. Journal of Viral Hepatitis 9:6, 455-459
CrossRef102
C. Anthony Hart, Nicholas J. Beeching. (2002) New pathogens. Current Opinion in Infectious Diseases 15:5, 497-500
CrossRef103
Avram J. Smukler, Lee Ratner. (2002) Hepatitis viruses and hepatocellular carcinoma in HIV-infected patients. Current Opinion in Oncology 14:5, 538-542
CrossRef104
Jonathan Allen Cohn. (2002) HIV-1 infection in injection drug users. Infectious Disease Clinics of North America 16:3, 745-770
CrossRef105
Zabrina L Brumme, Keith J Chan, Winnie WY Dong, Theresa Mo, Brian Wynhoven, Robert S Hogg, Julio SG Montaner, Michael V O'Shaughnessy, P Richard Harrigan. (2002) No association between GB virus-C viremia and virological or immunological failure after starting initial antiretroviral therapy. AIDS 16:14, 1929-1933
CrossRef106
Paul Klenerman, Ying Wu, Rodney Phillips. (2002) HIV: current opinion in escapology. Current Opinion in Microbiology 5:4, 408-413
CrossRef107
Eugenia Quiros-Roldan, M. Carmen Maroto, Carlo Torti, Francesca Moretti, Salvatore Casari, Angelo Pan, Giampiero Carosi. (2002) No evidence of benefical effect of GB virus type C infection on the course of HIV infection. AIDS 16:10, 1430-1431
CrossRef108
Nicolas Voirin, Christian Trépo, Jacques Estève, Philippe Chevallier, Jacques Ritter, Jacques Fabry, Philippe Vanhems. (2002) Effects of co-infection with hepatitis C virus and GB virus C on CD4 cell count and HIV-RNA level among HIV-infected patients treated with highly active antiretroviral therapy. AIDS 16:11, 1556-1559
CrossRef109
D.Michael Strong, Louis Katz. (2002) Blood-bank testing for infectious diseases: how safe is blood transfusion?. Trends in Molecular Medicine 8:7, 355-358
CrossRef110
Robin A. Weiss. (2002) Virulence and pathogenesis. Trends in Microbiology 10:7, 314-317
CrossRef111
Andreas Cerny. (2002) Viral crosstalk: Who gets to say what first?. Hepatology 35:6, 1540-1543
CrossRef112
T. Bourlet, P. Berthelot, F. Grattard, C. Genin, F. R. Lucht, B. Pozzetto. (2002) Detection of GB virus C/hepatitis G virus in semen and saliva of HIV type-1 infected men. Clinical Microbiology and Infection 8:6, 352-357
CrossRef113
Vincent Soriano, Mark Sulkowski, Colm Bergin, Angelos Hatzakis, Patrice Cacoub, Christine Katlama, Antonietta Cargnel, Stefan Mauss, Douglas Dieterich, Santiago Moreno, Carlo Ferrari, Thierry Poynard, Jürgen Rockstroh. (2002) Care of patients with chronic hepatitis C and HIV co-infection: recommendations from the HIV–HCV International Panel. AIDS 16:6, 813-828
CrossRef114
Hans L. Tillmann, Matthias Stoll, Michael P. Manns, Reinhold E. Schmidt, Hans Heiken. (2002) Chemokine receptor polymorphisms and GB virus C status in HIV-positive patients. AIDS 16:5, 808-809
CrossRef115
(2002) GB Virus C and Mortality from HIV Infection. New England Journal of Medicine 346:5, 377-379
Full Text116
Jeffrey Laurence. (2002) Bullet Points: New Topics in HIV/AIDS. AIDS Patient Care and STDs 16:1, 1-4
CrossRef117
Caroline A. Sabin. (2002) The changing clinical epidemiology of AIDS in the highly active antiretroviral therapy era. AIDS, Supplement 16, S61-S68
CrossRef118
Kazuhiko HAYASHI, Yoshihide FUKUDA, Junki Takamatsu. (2002) Japanese Journal of Thrombosis and Hemostasis 13:4, 299-303
CrossRef119
Adrian M Di Bisceglie. (2001) SEN and sensibility: interactions between newly discovered and other hepatitis viruses?. The Lancet 358:9297, 1925-1926
CrossRef120
Jeffrey Laurence. (2001) Coinfection with Hepatitis Viruses and HIV: Good and Bad News. AIDS Patient Care and STDs 15:12, 599-602
CrossRef121
Joanna Owens, Joanna Milburn, Joanne Clough, Ben Ramster, Natalie Baderman, Rebecca Lawrence. (2001) News in brief. Drug Discovery Today 6:21, 1083-1087
CrossRef122
Hans L Tillmann, Michael P Manns. (2001) GB virus-C infection in patients infected with the human immunodeficiency virus. Antiviral Research 52:2, 83-90
CrossRef123
Stosor, Valentina, Wolinsky, Steven, . (2001) GB Virus C and Mortality from HIV Infection. New England Journal of Medicine 345:10, 761-762
Full Text
