Original Article
IGF-I Receptor Mutations Resulting in Intrauterine and Postnatal Growth Retardation
N Engl J Med 2003; 349:2211-2222December 4, 2003
- Abstract
Background
Approximately 10 percent of infants with intrauterine growth retardation remain small, and the causes of their growth deficits are often unclear. We postulated that mutations in the gene for the insulin-like growth factor I receptor (IGF-IR) might underlie some cases of prenatal and postnatal growth failure.
Methods
We screened two groups of children for abnormalities in the IGF-IR gene. In one group of 42 patients with unexplained intrauterine growth retardation and subsequent short stature, we used single-strand conformation polymorphism analysis, followed by direct DNA sequencing of any abnormalities found. A second cohort consisted of 50 children with short stature who had elevated circulating IGF-I concentrations. Complete sequencing of the IGF-IR gene was performed with DNA from nine children. We also studied a control group of 43 children with normal birth weights.
Results
In the first cohort, we identified one girl who was a compound heterozygote for point mutations in exon 2 of the IGF-IR gene that altered the amino acid sequence to Arg108Gln in one allele and Lys115Asn in the other. Fibroblasts cultured from the patient had decreased IGF-I–receptor function, as compared with that in control fibroblasts. No such mutations were found in the 43 controls. In the second group, we identified one boy with a nonsense mutation (Arg59stop) that reduced the number of IGF-I receptors on fibroblasts. Both children had intrauterine growth retardation and poor postnatal growth.
Conclusions
Mutations in the IGF-IR gene that lead to abnormalities in the function or number of IGF-I receptors may also retard intrauterine and subsequent growth in humans.
Media in This Article
Figure 1
Pedigree (Panel A) and Growth Curve (Panel B) for Patient 1.Figure 2
Mean (±SD) Binding of Insulin-like Growth Factor I (IGF-I) to Fibroblast Receptors (Panel A) and Scatchard Analysis (Panel B).Article Activity
- Article
Insulin-like growth factors I (IGF-I) and II (IGF-II) are major regulators of somatic growth and cellular proliferation and act through a common receptor, the type I IGF receptor. The gene for the IGF-I receptor (IGF-IR) is homologous to the insulin receptor gene in terms of both exon and intron organization and its amino acid sequence (more than 50 percent identical).1 Both encode precursor proteins that undergo post-translational modification to yield receptors composed of two α and two β subunits. The α subunits are extracellular, containing ligand-binding domains. The β subunits contain intracellular tyrosine kinase domains.2
More than 50 mutations of the human insulin receptor gene have been described, and the loss of cellular insulin signaling caused by these mutations results in various degrees of carbohydrate intolerance.3,4 By contrast, defects in the closely related IGF-IR gene have been suggested only from indirect evidence.5-9 Since deletion of the murine IGF-IR gene causes marked prenatal growth failure (birth weight, 45 percent of normal weight), with the affected neonates dying from respiratory depression,10 the complete absence of IGF-I receptors in humans would be expected to cause severe disease and perhaps be lethal. However, less severe perturbations might attenuate the phenotype, as do naturally occurring missense mutations in the insulin receptor gene that cause moderate insulin resistance.4 We describe two children with fetal and postnatal growth failure caused by defects in the IGF-IR gene.
Methods
Study Population
Between 1998 and 2002, we evaluated two groups of children with short stature for abnormalities of the IGF-IR gene. The first group consisted of 42 children from the United States who had unexplained intrauterine growth retardation (birth weight more than 2 SD below the mean for gestational age) and persistent short stature (height more than 2 SD below the mean for age after 18 months of age). The children were recruited from pediatric endocrine clinics at participating centers. Children with circulating concentrations of IGF-I and insulin-like growth factor–binding protein 3 (IGFBP-3) that were below the normal reference range for age were excluded, as were children born to mothers with toxemia, severe hypertension, or cardiovascular disease and children with underlying chronic disease. Control subjects were 43 healthy children residing in Cincinnati whose birth weights were within 1 SD of the average for gestational age.
A second cohort of children with potential resistance to IGF was selected from the CrescNetR registry,11 which includes data on the growth of 150,000 children in Germany, 3000 of whom had a height that was more than 2.5 SD below the average for age. In this group, 50 children were found to have serum IGF-I concentrations that were more than 2 SD above the means for age and sex; DNA was obtained from 9 of these children, who were arbitrarily selected on the basis of their availability, for direct sequencing of the IGF-IR gene.
The study was conducted independently at the Division of Endocrinology, Cincinnati Children's Hospital Medical Center, Cincinnati, and at the Hospital for Children and Adolescents, University of Leipzig, Leipzig, Germany. The study was approved by the institutional review board at each institution. Written informed consent was obtained from all those who underwent research procedures or from their parents or guardians.
Single-Strand Conformation Polymorphism Analysis
Exons 2 to 6 and 16 to 20 of the IGF-IR gene were selected for initial single-strand conformation polymorphism (SSCP) analysis because they encode most of the binding and catalytic domains of the IGF-I receptor. DNA was extracted from whole blood with the use of the Puregene DNA isolation kit (Gentra Systems). In a few cases, microwaved serum served as the DNA source.12 Samples were electrophoresed under two conditions (10 percent glycerol and 20 mM HEPES) to improve sensitivity13 (described in Supplementary Appendix 1, available with the full text of this article at www.nejm.org).
Cell Culture and IGF-I–Binding Studies
Fibroblast cultures were initiated from skin-biopsy specimens obtained from the two children who were found to have IGF-IR mutations. Cells were routinely cultured at 37°C in Dulbecco's modified essential medium with penicillin, streptomycin, and 10 percent fetal-calf serum. To overcome the effects of cell-surface–associated IGF-binding proteins,14 IGF-I binding was quantified in the presence of a high concentration of an IGF-I analogue that is bound by IGF-binding proteins but not by the IGF-I receptor (Ala31Leu60-IGF-I, GroPep). The addition of this analogue saturates the IGF-binding proteins but leaves the IGF-I receptor free to interact with native IGF-I. Binding studies were performed in triplicate on intact cells grown for five to seven days in 24-well plates (Falcon) without changing the medium, as previously described.15 After being washed with serum-free medium, the cells were incubated at 15°C with 30,000 cpm of [125I]IGF-I, 250 ng of Ala31Leu60-IGF-I per milliliter, and graded amounts of native IGF-I in 250 μl of HEPES binding buffer (100 mM HEPES, pH 7.8; 0.5 percent fatty-acid–free bovine serum albumin; 120 mM sodium chloride; 1.2 mM magnesium sulfate; 5 mM potassium chloride; 15 mM sodium acetate; and 10 mM dextrose). After 18 hours, the cells were washed and then solubilized in 1 N sodium hydroxide. Cell-associated radioactivity was measured with a gamma counter.
Phosphorylation of IGF-I Receptors
Serum-starved fibroblasts were exposed to graded amounts of IGF-I (Gropep), and the resultant receptor kinase activity was assessed by quantifying the phosphorylation of the IGF-I receptor β subunit according to previously described methods.16 Cell lysates were subjected to sodium dodecyl sulfate–polyacrylamide-gel electrophoresis and then to immunoblotting with an antibody specific for the phosphorylation of the IGF-I receptor at Tyr1131 (PY1158, BioSource International). Specific protein bands were identified with a chemiluminescent method (ECL, Perkin Elmer).
Analysis of IGF-I Receptor RNA
A single-step method (RNAzol, Invitrogen) was used to isolate total RNA from monolayers of skin fibroblasts from Patient 2 and from fibroblasts from three controls matched for age and sex (GM 05565, GM 00498, and GM 05381, Human Genetic Mutant Cell Repository, Coriell Institute of Medical Research, Camden, N.J.), and cultured under identical conditions. RNA was also obtained from peripheral-blood lymphocytes from the mother and a half sibling of Patient 2. IGF-IR complementary DNA (cDNA) was prepared by reverse transcription and amplified by means of the polymerase chain reaction (PCR) with use of the 5'tcgacatccgcaacgactatc3' forward primer and the 5'cgaagatgaccagggcgtag3' reverse primer. PCR products were cloned into pCR II-TOPO (Invitrogen), and inserts were confirmed by sequencing.
For restriction-site analysis, genomic DNA and cDNA, as well as the cloned mutant and wild-type alleles, were amplified by PCR with the use of the primers mentioned above. PCR products were digested with DdeI (New England Biolabs), and the resulting fragments were characterized by agarose-gel electrophoresis and staining with ethidium bromide.
Flow-Cytometric Measurement of IGF-I Receptors
Fibroblasts from six-well plates were suspended in 0.5 mM EDTA buffer without trypsin, washed three times with phosphate-buffered saline containing 0.2 percent bovine serum albumin, stained with monoclonal phycoerythrin-conjugated antibody against the human IGF-I receptor (R&D Systems), and analyzed by means of flow cytometry (Epics XL, Coulter).
Results
Two patients with mutations of the IGF-IR gene were identified among the 51 children with short stature who provided DNA for analysis (the U.S. and German cohorts combined).
Patient 1
Case Report
Patient 1 was the product of a nonconsanguineous union, born to a gravida 1, para 1 woman after 38 weeks of pregnancy complicated only by poor fetal growth. Her birth weight was 1.4 kg (3.5 SD below the mean for gestational age). Although she ingested up to 124 kcal per kilogram of body weight per day of high-calorie formulas, there was no catch-up in linear growth. Acquisition of gross and fine motor skills was mildly delayed. Her first tooth erupted at 14 months (average, 6 to 8). Her growth remained markedly retarded (Figure 1Figure 1
Pedigree (Panel A) and Growth Curve (Panel B) for Patient 1.), and at the age of 4 1/2 years, she was enrolled in a research study evaluating growth hormone therapy in patients with short stature associated with intrauterine growth retardation. At that time, her serum IGF-I concentration was normal for her age (63 ng per milliliter) and her bone age was three years (2.2 SD below the mean for age, according to Greulich and Pyle18). In response to clonidine (0.15 mg per square meter of body-surface area), the serum concentration of growth hormone peaked at 51 ng per milliliter (7.5 SD above the normal mean).19 The mean overnight growth hormone concentration was 11.4 ng per milliliter (2.8 SD above the normal mean).19 The child was treated with growth hormone according to the research protocol (0.375 mg per kilogram of body weight per week, given as three injections per week), and her growth rate increased (from 5.2 cm per year at base line to 7.2 cm per year during the first year), but at the age of six years and nine months, therapy was discontinued for two years in order to reassess her basal growth rate. Her average height velocity during this period was 3.6 cm per year (below the third percentile for her age), and the serum concentration of IGF-I at this time was 891 ng per milliliter (normal range, 123 to 330). Growth hormone therapy was resumed at a daily dose of 0.375 mg per kilogram per week, and her height velocity increased to 6.5 cm per year (75th percentile for her age). She had normal concentrations of 25- and 1,25-dihydroxyvitamin D (13 and 59.7 pg per milliliter, respectively). Her lumbar-spine bone mineral density (1.5 SD below average for the age of 12 years on dual-energy x-ray absorptiometry) was considered to be normal in relation to her stature.
The results of a physical examination at the age of 11 years were normal except for severe short stature. The patient's arms and legs were symmetric and proportional. Her verbal IQ was 134, but her performance IQ was 89. She had rapid, pressured speech; an anxious affect; and psychomotor agitation. A psychiatric evaluation reported signs of a nonverbal learning disorder, with obsessive tendencies, excessive fantasy role playing, and social phobias. The rate of acquisition of secondary sexual characteristics was normal, with pubarche at the age of 10 years and 2 months, thelarche at the age of 10 years and 9 months, and menarche at the age of 12 years and 6 months. The patient reached a mature height of 134.1 cm (4.8 SD below the normal mean) at the age of 14 years. Her target height of 152 cm was calculated from the heights of her parents, each of whom was of below-average height (Figure 1).
Characterization of the IGF-IR Gene
Patient 1 had an abnormal SSCP-band pattern for exon 2. DNA sequencing showed that this abnormality was due to two distinct single–base-pair substitutions in the codon for amino acid 108 (CGG→CAG) and the codon for amino acid 115 (AAA→AAC) of the mature protein (see Supplementary Appendix 1, available with the full text of this article at www.nejm.org). Analysis of parental DNA indicated that the mutation at position 108 was inherited from her father, and the mutation at position 115 from her mother. Thus, Patient 1 was a compound heterozygote for mutations in exon 2 of the IGF-IR gene. Exon 2 was normal on SSCP analysis in the other 41 children with intrauterine growth retardation and in the 43 controls in the U.S. cohort (data not shown).
The point mutations identified alter the amino acid sequence of the receptor, changing arginine to glutamine at position 108 and lysine to asparagine at position 115. Because of the heterotetrameric structure of the receptor, each of the two α subunits in the patient's mature receptor will contain one of these mutations in various combinations (i.e., 108/108, 108/115, or 115/115).
Effect of Mutations on the Function of IGF-I Receptors
The amino acid substitutions found in the extracellular domain of the IGF-IR gene suggested a resultant functional deficit. Specific binding of IGF-I to IGF-I receptors on fibroblasts was reduced in Patient 1 as compared with the controls (P<0.05 by the Mann–Whitney U test) (Figure 2AFigure 2
Mean (±SD) Binding of Insulin-like Growth Factor I (IGF-I) to Fibroblast Receptors (Panel A) and Scatchard Analysis (Panel B).). Detailed binding studies involving graded amounts of IGF-I and Scatchard analysis with the use of a two-site model indicated that the IGF-I binding affinity was one third of that of the controls (Figure 2B).Receptor phosphorylation in response to IGF-I was assessed in order to determine the effect of reduced hormone binding on receptor signaling. IGF-I stimulated receptor tyrosine phosphorylation in a dose-dependent manner in fibroblasts from Patient 1 and control fibroblasts, but the patient's fibroblasts had a marked decrease in sensitivity relative to that of controls (Figure 3Figure 3
Phosphorylation of Insulin-like Growth Factor I (IGF-I) Receptors in Response to IGF-I.). In control fibroblasts, receptor phosphorylation was evident at an IGF-I concentration of 10–9 M, with maximal phosphorylation at an IGF-I concentration of 10–8 M. By contrast, stimulation was barely detectable at a concentration of 3×10–9 M in fibroblasts from Patient 1 and increased substantially at concentrations above 10–8 M (Figure 3C). In fibroblasts from two control subjects, half-maximal phosphorylation occurred at IGF-I concentrations of approximately 1 and 3 nM, respectively, whereas half-maximal phosphorylation in cells from the patient required 80 nM of IGF-I (P<0.01 by Student's t-test).IGF–IGFBP Axis
The discovery of the defects in the IGF-IR gene led to a more detailed examination of IGF and IGF-binding proteins in Patient 1 (Table 1Table 1
Circulating Concentrations of Insulin-like Growth Factors and Binding Proteins in Patient 1 and Her Parents.). Her basal circulating IGF-I concentration was high and increased during growth hormone therapy. Serum concentrations of IGFBP-3 and the acid-labile subunit were also elevated. Serum IGFBP-2 concentrations were low, and IGF-II concentrations were normal. The changes in IGF and IGF-binding protein concentrations reflect supranormal secretion of growth hormone.20 Neither of the patient's parents had increased concentrations of IGF-I or IGFBP-3.Patient 2
Case Report
Patient 2 was born at term after an uneventful pregnancy. At birth, his weight was 2000 g (3.5 SD below the mean for gestational age), his length was 40 cm (5.8 SD below the mean for gestational age), and he had microcephaly (head circumference, 31.0 cm; 4.6 SD below the mean for gestational age). He did not have catch-up growth (Figure 4Figure 4
Pedigree (Panel A) and Growth Curve (Panel B) for Patient 2.), although he had a normal caloric intake and no evidence of gastrointestinal dysfunction. He was referred to the Hospital for Children and Adolescents, University of Leipzig, at the age of 14 months with extremely short stature (height, 3.8 SD below the mean for age). The microcephaly had persisted, and he had mild retardation of motor development and speech. His growth was monitored, and he was tested for growth hormone deficiency, but no specific treatment was given. Physical examination when the boy was five years of age showed, in addition to severe short stature, a receding hairline, bushy eyebrows, a broad nasal bridge, a broad and rounded nasal tip, a long and smooth philtrum, a thin upper lip, and a broad, everted, and fleshy lower lip (Figure 4, inset). He also had short fingers (especially the thumbs), clinodactyly, wide-set nipples, and pectus excavatum.Because of the child's short stature and reduced growth rate, stimulated and spontaneous growth hormone secretion were assessed. The peak growth hormone responses after an infusion of arginine (0.5 g per kilogram) and insulin-induced hypoglycemia were 6.0 and 5.7 ng per milliliter, respectively (normal value, >7.0 for each), whereas the response of growth hormone to an infusion of growth hormone–releasing hormone (1 μg per kilogram) was 21.2 ng per milliliter (within the normal range) when he was three years old. The mean overnight growth hormone concentration was 1.9 and 2.5 ng per milliliter on two separate occasions (at the ages of three and five years). Serum IGF-I concentrations, measured on several occasions, ranged from 121 to 222 μg per liter (from 1.1 to 2.3 SD above the mean for age), whereas IGFBP-3 concentrations remained within normal limits (2.1 to 3.7 mg per liter; from 0.7 SD below to 1.8 SD above the mean for age). The boy's radiographic bone age was retarded by 1 to 1.5 years. Secretory responses of thyrotropin, corticotropin, and prolactin to stimulation were normal, as were the results of a chromosome analysis, blood counts, electrolyte measurements, and tests of liver and kidney function.
Characterization of the IGF-IR Gene
Analysis of the IGF-IR gene revealed that Patient 2 was heterozygous for the point mutation CGA to TGA (Arg59stop) in exon 2 (see Supplementary Appendix 2, available with the full text of this article at www.nejm.org). His mother and a half sibling were also heterozygous for this mutation and were small for gestational age at birth (Figure 4). The mother was short (a height that was 2.6 SD below the normal mean) as an adult but not dysmorphic. No other relatives were tested for the mutation. Sequencing of all exons encoding the IGF-I receptor showed no other mutations, ruling out the possibility of compound heterozygous mutations involving both alleles. Exon 2 is the first exon to encode a substantial portion of the mature receptor; therefore, no viable receptor protein would be expected as a result of the mutant allele. No IGF-IR mutations were found in DNA from the other eight German children with elevated IGF-I concentrations who were evaluated.
Effect of Mutations in IGF-I Receptors
Normal transcription of the mutant IGF-IR allele was anticipated and verified by restriction-endonuclease analysis of IGF-IR cDNA from Patient 2 and his mother (Figure 5AFigure 5
Restriction-Endonuclease Analysis of Genomic and Complementary DNA (cDNA) of the Gene for the Insulin-like Growth Factor I (IGF-I) Receptor in Patient 2 and His Mother (Panel A) and Expression of IGF-I Receptors on Fibroblasts (Panel B).). However, flow-cytometric data indicated that the number of IGF-I receptors per fibroblast was lower in the patient than in the control subjects. Intact cells labeled with a monoclonal antibody against human IGF-I receptor were quantified by flow-cytometric analysis. As compared with three control subjects, Patient 2 had significantly fewer specifically labeled, cultured fibroblasts and lower median fluorescence intensity (P<0.001) (Figure 5B).Discussion
We identified two children with biologically significant mutations of the IGF-IR gene. Patient 1, a compound heterozygote for missense mutations within the highly conserved, ligand-binding domain of the IGF-IR gene, had biochemical features of IGF-I resistance, with high circulating concentrations of IGF-I and growth hormone. The missense mutations R108Q and K115N are located at the edge of the putative ligand-binding pocket of the IGF-IR extracellular domain in the L1 region (Figure 6Figure 6
The Position of Mutated Amino Acids in the Insulin-like Growth Factor I Receptor in Patient 1.)23 and involve changes in the amino acid charge (from basic to neutral), which may alter the binding-domain conformation and thereby reduce ligand binding. Studies of cultured fibroblasts supported this possibility by showing reduced affinity of the patient's fibroblasts for IGF-I binding and a rightward shift of the dose–response curve for the activation of IGF-I receptors. However, further studies will be required to determine whether the decrease in binding alone explains these observations. Indeed, a defect in the homologous domain of the insulin receptor (I119M) (Figure 6) appears to disrupt intracellular transport and processing and decrease the abundance of cell-surface insulin receptors.4,24 The mechanism involved in Patient 2 and two relatives with growth retardation and the same mutation is more straightforward. These three all had nonsense mutations, which, as predicted, reduced the expression of IGF-I receptors on fibroblasts.IGF-I resistance due to a reduction in the number of IGF-I receptors has been proposed to explain the growth phenotypes of the African Efe Pygmy8 and patients with partial deletions of chromosome 15.25 However, Pygmies have low circulating IGF-I concentrations, and the finding of an apparent reduction in the number of IGF-I receptors is based entirely on studies in transformed lymphocyte lines.8,26 Thus, it is not clear whether a defect in the IGF-IR gene explains the lack of growth of the Pygmy. Patients who are haploinsufficient for the IGF-IR gene because of aneuploidy of chromosome 15 typically have dysmorphism and mental as well as growth retardation.25 The extent to which these features reflect the loss of contiguous genes on chromosome 15 is uncertain. There was a clear gene-dosage effect on somatic growth in the family of Patient 2, suggesting that the growth retardation associated with chromosome 15 aberrations is due to IGF-I resistance. Furthermore, an apparent effect of heterozygosity was suggested in the parents of Patient 1, each of whom had marginal growth retardation at birth and whose adult height was substantially below the population mean.
IGF-I has diverse effects in multiple tissues. In addition to stimulating skeletal growth, this protein affects carbohydrate homeostasis, brain growth, and vitamin D metabolism and serves as a negative-feedback regulator of growth hormone secretion.27 Both of our patients had several traits typically associated with IGF-I resistance, including intrauterine and postnatal growth failure, delayed bone maturation, and increased concentrations of IGF-I. However, there were also unexpected findings. Bone age was less delayed than is typical in patients with growth hormone deficiency, and height velocity nearly doubled in Patient 1 in response to exogenous growth hormone, perhaps because the direct actions of growth hormone were unimpeded or because the mutant IGF-I receptors still had residual function. In addition, her bone mineral status appeared to be adequate, as did brain growth and intelligence.
It is noteworthy that these patients with defects in the IGF-IR gene were not phenotypically identical, nor did they share all the clinical characteristics of the patient described by Woods et al., who lacked the IGF-I gene.28 For instance, head size was decreased only in Patient 2 and the patient of Woods et al., measures of growth hormone secretion were increased only in Patient 1 and the patient of Woods et al., and only Patient 2 and the patient of Woods et al. had dysmorphic features. The reasons for these differences are not evident but could reflect differences in the intensity of IGF-I signaling among these patients, since the IGF-IR mutations blunt but do not abrogate IGF-I signaling. The phenotypic differences may also be explained by tissue-specific imprinting of the expression of the IGF-IR alleles. For example, if expression were monoallelic in certain tissues, Patient 2 might have a complete deficiency of IGF-I receptors in those tissues, whereas the same tissues in Patient 1 would have residual signaling of IGF-I receptors because of the mutant IGF-IR. Although tissue-specific imprinting has been observed with other growth-regulating genes,29 studies of the IGF-IR in the limited tissues examined to date have not shown imprinting.30,31
We have established that molecular defects in the IGF-I receptor lead to a clinical phenotype dominated by reduced growth. Experimental evidence that the IGFs are necessary for normal brain development and function suggest that these mutations may also affect brain growth and neurologic development32; the constellation of psychiatric anomalies found in Patient 1 may even reflect the state of partial resistance to IGF-I.
Our findings suggest that IGF-IR mutations are uncommon causes of intrauterine and postnatal growth failure, although the frequency of such mutations in different populations remains to be defined. A better understanding of the nature of such mutations and their associated phenotypes may provide insights into both growth retardation and the IGF system in humans.
Supported by grants from the Genentech Foundation for Growth and Development and Pharmacia (to Dr. Chernausek), a General Clinical Research Center grant (MO1RR08084) from the National Institutes of Health, a grant (DK43038) from the National Institutes of Health, research funds from the Hallett Center (to Dr. Smith), grants from the German Endocrine Society (to Dr. Schneider), and a grant from Interdisziplinäre Zentrum für Klinische Forschung, Leipzig, through Bundesministerium für Bildung und Forschung, Bonn, Germany.
Dr. Abuzzahab reports having received honorariums for speeches or consulting from Novo Nordisk, Lilly, and Pharmacia. Dr. Goddard is employed by Genentech and reports owning equity in the company. Dr. Kiess reports having received honorariums for speeches from Lilly, Novo Nordisk, and Pharmacia. Dr. Pfäffle reports having received grant support from Lilly. Dr. Chernausek reports having received honorariums for speeches or consulting from Pharmacia and Tercica; having received grant support from Novo Nordisk, Pharmacia, and Genentech; and owning equity in Pfizer.
Drs. Abuzzahab and Schneider contributed equally to this article.
We are indebted to James Fagin, Edith Markoff, Saundra Stringer, Walter Banach, and Jean Yuan for technical advice and assistance.
Source Information
From Cincinnati Children's Hospital Medical Center, Cincinnati (M.J.A., S.D.C.); the Hospital for Children and Adolescents (A.S., E.K., W.K., J. Klammt, R.P., K.R., B.S.) and the Institute of Laboratory Medicine, Clinical Chemistry, and Molecular Diagnostics ( J. Kratzsch), University of Leipzig, Leipzig, Germany; Genentech, San Francisco (A.G.); Institut Universitaire de Recherche Clinique, Montpellier, France (F.G., C.L.); and the Hallett Center for Diabetes and Endocrinology, Brown Medical School, Providence, R.I. (D.O., R.J.S.).
Address reprint requests to Dr. Chernausek at the Division of Endocrinology, Cincinnati Children's Hospital Medical Center, 3333 Burnet Ave., Cincinnati, OH 45229, or at steven.chernausek@cchmc.org.
Other members of the IUGR Study Group are listed in the Appendix.
Appendix
Other members of the IUGR Study Group include G.R. Frank, Schneider Children's Hospital, New Hyde Park, N.Y.; P.B. Kaplowitz, Medical College of Virginia, Richmond; O.H. Pescovitz, Indiana University Medical Center, Indianapolis; and E.P. Smith, University of Cincinnati, Cincinnati.
- References
References
1
Abbott AM ,Bueno R ,Pedrini MT ,Murray JM ,Smith RJ . Insulin-like growth factor I receptor gene structure. J Biol Chem 1992;267:10759-10763
Web of Science | Medline2
LeRoith D ,Werner H ,Beitner-Johnson D ,Roberts CT Jr . Molecular and cellular aspects of the insulin-like growth factor I receptor. Endocr Rev 1995;16:143-163
Web of Science | Medline3
Tritos NA ,Mantzoros CS . Clinical review 97: syndromes of severe insulin resistance. J Clin Endocrinol Metab 1998;83:3025-3030
CrossRef | Web of Science | Medline4
Accili D . Molecular defects of the insulin receptor gene. Diabetes Metab Rev 1995;11:47-62
CrossRef | Web of Science | Medline5
Bierich JR ,Moeller H ,Ranke MB ,Rosenfeld RG . Pseudopituitary dwarfism due to resistance to somatomedin: a new syndrome. Eur J Pediatr 1984;142:186-188
CrossRef | Web of Science | Medline6
Heath-Monning E ,Wohltmann HJ ,Mills-Dunlap B ,Daughaday WH . Measurement of insulin-like growth factor-I (IGF-I) responsiveness of fibroblasts of children with short stature: identification of a patient with IGF-1 resistance. J Clin Endocrinol Metab 1987;64:501-507
CrossRef | Web of Science | Medline7
Momoi T ,Yamanaka C ,Kobayashi M , et al. Short stature with normal growth hormone and elevated IGF-I. Eur J Pediatr 1992;151:321-325
CrossRef | Web of Science | Medline8
Hattori Y ,Vera JC ,Rivas CI , et al. Decreased insulin-like growth factor I receptor expression and function in immortalized African Pygmy T cells. J Clin Endocrinol Metab 1996;81:2257-2263
CrossRef | Web of Science | Medline9
Roback EW ,Barakat AJ ,Dev VG ,Mbikay M ,Chretien M ,Butler MG . An infant with deletion of the distal long arm of chromosome 15 (q26.1→qter) and loss of insulin-like growth factor 1 receptor gene. Am J Med Genet 1991;38:74-79
CrossRef | Web of Science | Medline10
Liu J-P ,Baker J ,Perkins AS ,Robertson EJ ,Efstratiadis A . Mice carrying null mutations of the genes encoding insulin-like growth factor (Igf-1) and the type 1 IGF receptor (Igf1r). Cell 1993;75:59-72
Web of Science | Medline11
Kiess W ,Gausche R ,Keller A ,Burmeister J ,Willgerodt H ,Keller E . Computer-guided, population-based screening system for growth disorders (CrescNet) and on-line generation of normative data for growth and development. Horm Res 2001;56:Suppl 1:59-66
CrossRef | Web of Science | Medline12
Sandford AJ ,Pare PD . Direct PCR of small genomic DNA fragments from serum. Biotechniques 1997;23:890-892
Web of Science | Medline13
Glavac D ,Dean M . Optimization of the single-strand conformation polymorphism (SSCP) technique for detection of point mutations. Hum Mutat 1993;2:404-414
CrossRef | Web of Science | Medline14
McCusker RH ,Camacho-Hubner C ,Bayne ML ,Cascieri MA ,Clemmons DR . Insulin-like growth factor (IGF) binding to human fibroblast and glioblastoma cells: the modulating effect of cell released IGF binding proteins (IGFBPs). J Cell Physiol 1990;144:244-253
CrossRef | Web of Science | Medline15
Orlowski CC ,Chernausek SD ,Akeson R . Actions of insulin-like growth factor-I on the B104 neuronal cell line: effects on cell replication, receptor characteristics, and influence of secreted binding protein on ligand binding. J Cell Physiol 1989;139:469-476
CrossRef | Web of Science | Medline16
Chow JC ,Condorelli G ,Smith RJ . Insulin-like growth factor-I receptor internalization regulates signaling via the Shc/mitogen-activated protein kinase pathway, but not the insulin receptor substrate-1 pathway. J Biol Chem 1998;273:4672-4680
CrossRef | Web of Science | Medline17
Kuczmarski RJ, Ogden CL, Grummer-Strawn LM, et al. CDC growth charts: United States. Advance data from vital and health statistics. No. 314. Hyattsville, Md.: National Center for Health Statistics, 2000. (DHHS publication no. (PHS) 2000-1250 0-0431.)
18
Greulich WW, Pyle SI. Radiographic atlas of skeletal development of the hand and wrist. 2nd ed. Stanford, Calif.: Stanford University Press, 1959.
19
Zadik Z ,Chalew SA ,Kowarski A . Assessment of growth hormone secretion in normal stature children using 24-hour integrated concentration of GH and pharmacological stimulation. J Clin Endocrinol Metab 1990;71:932-936
CrossRef | Web of Science | Medline20
Juul A ,Main K ,Blum WF ,Lindholm J ,Ranke MB ,Shakkebaek NE . The ratio between serum levels of insulin-like growth factor (IGF)-I and the IGF binding proteins (IGFBP-1, 2 and 3) decreases with age in healthy adults and is increased in acromegalic patients. Clin Endocrinol (Oxf) 1994;41:85-93
CrossRef | Web of Science | Medline21
Largo RH ,Walli R ,Duc G ,Fanconi A ,Prader A . Evaluation of perinatal growth: presentation of combined intra- and extrauterine growth standards for weight, length and head circumference. Helv Paediatr Acta 1980;35:419-436
Medline22
Prader A ,Largo RH ,Molinari L ,Issler C . Physical growth of Swiss children from birth to 20 years of age: First Zurich Longitudinal Study of growth and development. Helv Paediatr Acta Suppl 1989;52:1-125
Medline23
Garrett TP ,McKern NM ,Lou M , et al. Crystal structure of the first three domains of the type-1 insulin-like growth factor receptor. Nature 1998;394:395-399
CrossRef | Web of Science | Medline24
Hone J ,Accili D ,al-Gazali LI ,Lestringant G ,Orban T ,Taylor SI . Homozygosity for a new mutation (Ile119→Met) in the insulin receptor gene in five sibs with familial insulin resistance. J Med Genet 1994;31:715-716
CrossRef | Web of Science | Medline25
Peoples R ,Milatovich A ,Francke U . Hemizygosity at the insulin-like growth factor I receptor (IGF1R) locus and growth failure in the ring chromosome 15 syndrome. Cytogenet Cell Genet 1995;70:228-234
CrossRef | Medline26
Geffner ME ,Bailey RC ,Bersch N ,Vera JC ,Golde DW . Insulin-like growth factor-I unresponsiveness in an Efe Pygmy. Biochem Biophys Res Commun 1993;193:1216-1223
CrossRef | Web of Science | Medline27
Rosenfeld RG ,Rosenbloom AL ,Guevara-Aguirre J . Growth hormone (GH) insensitivity due to primary GH receptor deficiency. Endocr Rev 1994;15:369-390
Web of Science | Medline28
Woods KA ,Camacho-Hubner C ,Savage MO ,Clark AJL . Intrauterine growth retardation and postnatal growth failure associated with deletion of the insulin-like growth factor I gene. N Engl J Med 1996;335:1363-1367
Full Text | Web of Science | Medline29
Blagitko N ,Mergenthaler S ,Schulz U , et al. Human GRB10 is imprinted and expressed from the paternal and maternal allele in a highly tissue- and isoform-specific fashion. Hum Mol Genet 2000;9:1587-1595
CrossRef | Web of Science | Medline30
Howard TK ,Algar EM ,Glatz JA ,Reeve AE ,Smith PJ . The insulin-like growth factor 1 receptor gene is normally biallelically expressed in human juvenile tissue and tumours. Hum Mol Genet 1993;2:2089-2022
CrossRef | Web of Science | Medline31
Ogawa O ,Eccles MR ,Szeto J , et al. Relaxation of insulin-like growth factor II gene imprinting implicated in Wilms' tumour. Nature 1993;362:749-751
CrossRef | Web of Science | Medline32
D'Ercole AJ ,Ye P ,Calikoglu AS ,Gutierrez-Ospina G . The role of the insulin-like growth factors in the central nervous system. Mol Neurobiol 1996;13:227-255
CrossRef | Web of Science | Medline
- Citing Articles (94)
Citing Articles
1
Lynda K. Harris, Melissa Westwood. (2012) Biology and significance of signalling pathways activated by IGF-II. Growth Factors 30:1, 1-12
CrossRef2
A.l.i. Mohamadi, Roberto Salvatori. 2012. Neuroendocrine Growth Disorders – Dwarfism, Gigantism. , 707-721.
CrossRef3
Silke Hartleb, Ursula Plöckinger, Günter K Stalla, Ulrich Tuschy, Matthias M Weber, Andreas Pfützner, Peter Herbert Kann. (2011) Additive effect of GHRd3 and COLIA1 polymorphisms on the GH-substitution dose in GH-deficient adults. Pharmacogenomics1-9
CrossRef4
H Werner. (2011) Tumor suppressors govern insulin-like growth factor signaling pathways: implications in metabolism and cancer. Oncogene
CrossRef5
Galia Gat-Yablonski, Michal Yackobovitch-Gavan, Moshe Phillip. (2011) Nutrition and Bone Growth in Pediatrics. Pediatric Clinics of North America 58:5, 1117-1140
CrossRef6
Chih-Ping Chen, Yi-Hui Lin, Heng-Kien Au, Yi-Ning Su, Chin-Yuan Hsu, Yu-Peng Liu, Pei-Chen Wu, Schu-Rern Chern, Yu-Ting Chen, Li-Feng Chen, Adam Hwa-Ming Hsieh, Wayseen Wang. (2011) Chromosome 15q overgrowth syndrome: Prenatal diagnosis, molecular cytogenetic characterization, and perinatal findings in a fetus with dup(15)(q26.2q26.3). Taiwanese Journal of Obstetrics and Gynecology 50:3, 359-365
CrossRef7
Liliana Silvano, Mirta Miras, Adriana Pérez, Gabriela Picotto, Gabriela Díaz de Barboza, Liliana Muñoz, Silvia Martin, Gabriela Sobrero, Pedro Armelini, Verónica Mericq, Nori Tolosa de Talamoni. (2011) Comparative analysis of clinical, biochemical and genetic aspects associated with bone mineral density in small for gestational age children. Journal of Pediatric Endocrinology and Metabolism 24:7-8, 511-517
CrossRef8
Kara Calkins, Sherin U. Devaskar. (2011) Fetal Origins of Adult Disease. Current Problems in Pediatric and Adolescent Health Care 41:6, 158-176
CrossRef9
MELISSA WESTWOOD, SHAHIN H. TAJBAKHSH, KIRK W. SIDDALS, ANDREW J. WHATMORE, PETER E. CLAYTON. (2011) Reduced Pericellular Sensitivity to IGF-I in Fibroblasts From Girls With Turner Syndrome: A Mechanism to Impair Clinical Responses to GH. Pediatric Research 70:1, 25-30
CrossRef10
J. Klammt, W. Kiess, R. Pfäffle. (2011) IGF1R mutations as cause of SGA. Best Practice & Research Clinical Endocrinology & Metabolism 25:1, 191-206
CrossRef11
J.M. Wit, W. Kiess, P. Mullis. (2011) Genetic evaluation of short stature. Best Practice & Research Clinical Endocrinology & Metabolism 25:1, 1-17
CrossRef12
Irène Netchine, Salah Azzi, Yves Le Bouc, Martin O. Savage. (2011) IGF1 molecular anomalies demonstrate its critical role in fetal, postnatal growth and brain development. Best Practice & Research Clinical Endocrinology & Metabolism 25:1, 181-190
CrossRef13
Harohalli Shashidhar, Vasundhara Tolia. 2011. Failure to Thrive. , 136-145.
CrossRef14
Sumito Dateki, Maki Fukami, Yoko Tanaka, Goro Sasaki, Hiroyuki Moriuchi, Tsutomu Ogata. (2011) Identification of chromosome 15q26 terminal deletion with telomere sequences and its bearing on genotype-phenotype analysis. Endocrine Journal 58:3, 155-159
CrossRef15
Michael L. Cunningham, Jeremy A. Horst, Mark J. Rieder, Anne V. Hing, Ian B. Stanaway, Sarah S. Park, Ram Samudrala, Matthew L. Speltz. (2011) IGF1R variants associated with isolated single suture craniosynostosis. American Journal of Medical Genetics Part A 155:1, 91-97
CrossRef16
Laura I. Rudaks, Jillian K. Nicholl, Drago Bratkovic, Christopher P. Barnett. (2011) Short stature due to 15q26 microdeletion involving IGF1R: Report of an additional case and review of the literature. American Journal of Medical Genetics Part An/a-n/a
CrossRef17
Vivien S. Herman-Bonert, Shlomo Melmed. 2011. Growth Hormone. , 83-117.
CrossRef18
Shoshana Yakar, Hayden-William Courtland, David Clemmons. (2010) IGF-1 and bone: New discoveries from mouse models. Journal of Bone and Mineral Research 25:12, 2543-2552
CrossRef19
Katherine A. Janeway, Mei-Jun Zhu, Jordi Barretina, Antonio Perez-Atayde, George D. Demetri, Jonathan A. Fletcher. (2010) Strong expression of IGF1R in pediatric gastrointestinal stromal tumors without IGF1R genomic amplification. International Journal of Cancer 127:11, 2718-2722
CrossRef20
M. P. Rogan, L. R. Reznikov, A. A. Pezzulo, N. D. Gansemer, M. Samuel, R. S. Prather, J. Zabner, D. C. Fredericks, P. B. McCray, M. J. Welsh, D. A. Stoltz. (2010) Pigs and humans with cystic fibrosis have reduced insulin-like growth factor 1 (IGF1) levels at birth. Proceedings of the National Academy of Sciences 107:47, 20571-20575
CrossRef21
Christopher J. Bowman, Randal D. Streck, Robert E. Chapin. (2010) Maternal-placental insulin-like growth factor (IGF) signaling and its importance to normal embryo-fetal development. Birth Defects Research Part B: Developmental and Reproductive Toxicology 89:4, 339-349
CrossRef22
Christopher J. Bowman, Gary Chmielewski, Satoru Oneda, Deborah Finco, Mary A. Boucher, Marque Todd. (2010) Embryo-fetal developmental toxicity of figitumumab, an anti-insulin-like growth factor-1 receptor (IGF-1R) monoclonal antibody, in cynomolgus monkeys. Birth Defects Research Part B: Developmental and Reproductive Toxicology 89:4, 326-338
CrossRef23
Martin O. Savage, Christine P. Burren, Ron G. Rosenfeld. (2010) The continuum of growth hormone-IGF-I axis defects causing short stature: diagnostic and therapeutic challenges. Clinical Endocrinology 72:6, 721-728
CrossRef24
T Horio, K Kamide, S Takiuchi, M Yoshii, Y Miwa, T Matayoshi, F Yoshihara, S Nakamura, T Tokudome, T Miyata, Y Kawano. (2010) Association of insulin-like growth factor-1 receptor gene polymorphisms with left ventricular mass and geometry in essential hypertension. Journal of Human Hypertension 24:5, 320-326
CrossRef25
Peter Rotwein, Dennis J. Chia. (2010) Gene regulation by growth hormone. Pediatric Nephrology 25:4, 651-658
CrossRef26
Jesús Argente, Otto Mehls, Vicente Barrios. (2010) Growth and body composition in very young SGA children. Pediatric Nephrology 25:4, 679-685
CrossRef27
P. Backeljauw,, P. Bang,, D.B. Dunger,, A. Juul,, Y. Le Bouc,, R. Rosenfeld,. (2010) Insulin-like Growth Factor-I in Growth and Metabolism. Journal of Pediatric Endocrinology and Metabolism 23:1-2, 3-16
CrossRef28
Silvia Sookoian, Tomas Fernandez Gianotti, Carolina Gemma, Adriana L Burgueño, Carlos J Pirola. (2010) Role of genetic variation in insulin-like growth factor 1 receptor on insulin resistance and arterial hypertension. Journal of Hypertension1
CrossRef29
Ron G. Rosenfeld, Vivian Hwa. 2010. Genetic Diagnosis of Growth Failure. , 283-335.
CrossRef30
Srividhya Sankaran, Phillipa M. Kyle. (2009) Aetiology and Pathogenesis of IUGR. Best Practice & Research Clinical Obstetrics & Gynaecology 23:6, 765-777
CrossRef31
Silke Meyer, Stephan Schaefer, Lisette Stolk, Pascal Arp, André G Uitterlinden, Ursula Plöckinger, Günter K Stalla, Ulrich Tuschy, Matthias M Weber, Alexander Weise, Andreas Pfützner, Peter H Kann. (2009) Association of the exon 3 deleted/full-length GHR polymorphism with recombinant growth hormone dose in growth hormone-deficient adults. Pharmacogenomics 10:10, 1599-1608
CrossRef32
Galia Gat-Yablonski, Michal Yackobovitch-Gavan, Moshe Phillip. (2009) Nutrition and Bone Growth in Pediatrics. Endocrinology & Metabolism Clinics of North America 38:3, 565-586
CrossRef33
Ameeta Mehta, Evelien F. Gevers, Mehul T. Dattani. 2009. Congenital Disorders of the Hypothalamo-Pituitary-Somatotrope Axis. , 60-105.
CrossRef34
Jerry K. Wales. 2009. Evaluation of Growth Disorders. , 124-154.
CrossRef35
Ursula Hiden, Elisabeth Glitzner, Michaele Hartmann, Gernot Desoye. (2009) Insulin and the IGF system in the human placenta of normal and diabetic pregnancies. Journal of Anatomy 215:1, 60-68
CrossRef36
Masanobu Kawai, Clifford J. Rosen. (2009) Insulin-like growth factor-I and bone: lessons from mice and men. Pediatric Nephrology 24:7, 1277-1285
CrossRef37
German Iñiguez, Paulina Ormazabal, Teresa López, Diego Maldonado, Alejandra Avila, Rossana Román, Fernando Cassorla. (2009) IGF-IR/ERK content and response to IGF-I and insulin in adipocytes from small for gestational age children. Growth Hormone & IGF Research 19:3, 256-261
CrossRef38
ANJA TZSCHOPPE, ELLEN STRUWE, HOLGER BLESSING, FABIAN FAHLBUSCH, GISELA LIEBHABER, HELMUTH G. DÖRR, MANFRED RAUH, WOLFGANG RASCHER, TAMME W. GOECKE, RALF L. SCHILD, EKKEHARD SCHLEUSSNER, CERRIE SCHELER, AXEL HÜBLER, PETER DAHLEM, JÖRG DÖTSCH. (2009) Placental 11β-HSD2 Gene Expression at Birth Is Inversely Correlated With Growth Velocity in the First Year of Life After Intrauterine Growth Restriction. Pediatric Research 65:6, 647-653
CrossRef39
Kathleen O’Day, Richard Gorlick. (2009) Novel therapeutic agents for osteosarcoma. Expert Review of Anticancer Therapy 9:4, 511-523
CrossRef40
Randeep Sangha, Primo N Lara, Philip C Mack, David R Gandara. (2009) Beyond antiepidermal growth factor receptors and antiangiogenesis strategies for nonsmall cell lung cancer: exploring a new frontier. Current Opinion in Oncology 21:2, 116-123
CrossRef41
Sampo Sammalisto, Tero Hiekkalinna, Karen Schwander, Sharon Kardia, Alan B Weder, Beatriz L Rodriguez, Alessandro Doria, Jennifer A Kelly, Gail R Bruner, John B Harley, Susan Redline, Emma K Larkin, Sanjay R Patel, Amy JH Ewan, James L Weber, Markus Perola, Leena Peltonen. (2009) Genome-wide linkage screen for stature and body mass index in 3.032 families: evidence for sex- and population-specific genetic effects. European Journal of Human Genetics 17:2, 258-266
CrossRef42
Arlan L. Rosenbloom. (2009) Mecasermin (recombinant human insulin-like growth factor I). Advances in Therapy 26:1, 40-54
CrossRef43
Se Young Kim. (2009) Growth and sex differentiation of children born small for gestational age. Korean Journal of Pediatrics 52:2, 142
CrossRef44
P Rump, T Dijkhuizen, B Sikkema-Raddatz, HH Lemmink, YJ Vos, JBGM Verheij, CMA Van Ravenswaaij. (2008) Drayer’s syndrome of mental retardation, microcephaly, short stature and absent phalanges is caused by a recurrent deletion of chromosome 15(q26.2→qter). Clinical Genetics 74:5, 455-462
CrossRef45
Jürgen Klammt, Roland Pfäffle, Haim Werner, Wieland Kiess. (2008) IGF signaling defects as causes of growth failure and IUGR. Trends in Endocrinology & Metabolism 19:6, 197-205
CrossRef46
Anna Asanbaeva, Koichi Masuda, Eugene J-M. A. Thonar, Stephen M. Klisch, Robert L. Sah. (2008) Regulation of immature cartilage growth by IGF-I, TGF-β1, BMP-7, and PDGF-AB: role of metabolic balance between fixed charge and collagen network. Biomechanics and Modeling in Mechanobiology 7:4, 263-276
CrossRef47
Marie J.E. Walenkamp, Jan M. Wit. (2008) Single gene mutations causing SGA. Best Practice & Research Clinical Endocrinology & Metabolism 22:3, 433-446
CrossRef48
Tomohiko Urano, Ken’ichiro Narusawa, Masataka Shiraki, Takahiko Usui, Noriko Sasaki, Takayuki Hosoi, Yasuyoshi Ouchi, Toshitaka Nakamura, Satoshi Inoue. (2008) Association of a Single Nucleotide Polymorphism in the Insulin-Like Growth Factor-1 Receptor Gene With Spinal Disc Degeneration in Postmenopausal Japanese Women. Spine 33:11, 1256-1261
CrossRef49
J.M. Wit, P.E. Clayton, A.D. Rogol, M.O. Savage, P.H. Saenger, P. Cohen. (2008) Idiopathic short stature: Definition, epidemiology, and diagnostic evaluation. Growth Hormone & IGF Research 18:2, 89-110
CrossRef50
Y. Suh, G. Atzmon, M.-O. Cho, D. Hwang, B. Liu, D. J. Leahy, N. Barzilai, P. Cohen. (2008) Functionally significant insulin-like growth factor I receptor mutations in centenarians. Proceedings of the National Academy of Sciences 105:9, 3438-3442
CrossRef51
S. Kajimura, C. Duan. (2007) Insulin-like growth factor-binding protein-1: an evolutionarily conserved fine tuner of insulin-like growth factor action under catabolic and stressful conditions. Journal of Fish Biology 71:sc, 309-325
CrossRef52
J BLUM, T ELSASSER, D GREGER, S WITTENBERG, F DEVRIES, O DISTL. (2007) Insulin-like growth factor type-1 receptor down-regulation associated with dwarfism in Holstein calves. Domestic Animal Endocrinology 33:3, 245-268
CrossRef53
Yan Wang, Yongquan Bai. (2007) A corpus-based syntactic study of medical research article titles. System 35:3, 388-399
CrossRef54
Guillaume Lettre, Johannah L. Butler, Kristin G. Ardlie, Joel N. Hirschhorn. (2007) Common genetic variation in eight genes of the GH/IGF1 axis does not contribute to adult height variation. Human Genetics 122:2, 129-139
CrossRef55
Christian Plank, Udo Meißner, Manfred Rauh, Hartmut Wollmann, Helmuth-Günther Dörr, Wolfgang Rascher, Jörg Dötsch. (2007) Cortisol?cortisone ratios in small for gestational age (SGA) children without postnatal catch-up growth. Clinical Endocrinology 67:2, 304-309
CrossRef56
Santiago Rodriguez, Tom R. Gaunt, Ian N. M. Day. (2007) Molecular genetics of human growth hormone, insulin-like growth factors and their pathways in common disease. Human Genetics 122:1, 1-21
CrossRef57
P J Schlueter, G Peng, M Westerfield, C Duan. (2007) Insulin-like growth factor signaling regulates zebrafish embryonic growth and development by promoting cell survival and cell cycle progression. Cell Death and Differentiation 14:6, 1095-1105
CrossRef58
Pierre Bougnères, Vincent Goffin. (2007) The Growth Hormone Receptor in Growth. Endocrinology & Metabolism Clinics of North America 36:1, 1-16
CrossRef59
Charmian A. Quigley. (2007) Growth Hormone Treatment of Non–Growth Hormone-Deficient Growth Disorders. Endocrinology & Metabolism Clinics of North America 36:1, 131-186
CrossRef60
S.G. Kant, M. Kriek, M.J.E. Walenkamp, K.B.M. Hansson, A. van Rhijn, J. Clayton-Smith, J.M. Wit, M.H. Breuning. (2007) Tall stature and duplication of the insulin-like growth factor I receptor gene. European Journal of Medical Genetics 50:1, 1-10
CrossRef61
Arlan L. Rosenbloom. (2007) Recombinant Human Insulin-Like Growth Factor I (rhIGF-I) and rhIGF-I/rhIGF-Binding-Protein-3: New Growth Treatment Options?. The Journal of Pediatrics 150:1, 7-11
CrossRef62
Iwona Pilecka, Andrew Whatmore, Rob Hooft van Huijsduijnen, Benoit Destenaves, Peter Clayton. (2007) Growth hormone signalling: sprouting links between pathways, human genetics and therapeutic options. Trends in Endocrinology & Metabolism 18:1, 12-18
CrossRef63
GARY D. RICHARDS. (2006) Genetic, physiologic and ecogeographic factors contributing to variation in Homo sapiens: Homo floresiensis reconsidered. Journal of Evolutionary Biology 19:6, 1744-1767
CrossRef64
M.E. Street, P. Seghini, M.A. Ziveri, S. Fieni, C. Volta, T.M. Neri, I. Viani, A. Bacchi-Modena, S. Bernasconi. (2006) Interleukin-6 and insulin-like growth factor system relationships and differences in the human placenta and fetus from the 35th week of gestation. Growth Hormone & IGF Research 16:5-6, 365-372
CrossRef65
Ádám Balogh, László Derzbach, Ádám Vannay, Barna Vásárhelyi. (2006) Lack of association between insulin-like growth factor I receptor G+3174A polymorphism and retinopathy of prematurity. Graefe's Archive for Clinical and Experimental Ophthalmology 244:8, 1035-1038
CrossRef66
C. Gennigens, C. Menetrier-Caux, J.P. Droz. (2006) Insulin-Like Growth Factor (IGF) family and prostate cancer. Critical Reviews in Oncology/Hematology 58:2, 124-145
CrossRef67
D Yee. (2006) Targeting insulin-like growth factor pathways. British Journal of Cancer 94:4, 465-468
CrossRef68
R. Cediel, R. Riquelme, J. Contreras, A. Díaz, I. Varela-Nieto. (2006) Sensorineural hearing loss in insulin-like growth factor I-null mice: a new model of human deafness. European Journal of Neuroscience 23:2, 587-590
CrossRef69
D.B. Dunger, C.J. Petry, K.K. Ong. (2006) Genetic Variations and Normal Fetal Growth. Hormone Research 65:3, 34-40
CrossRef70
Deepali Sachdev, Douglas Yee. (2006) Inhibitors of Insulin-like Growth Factor Signaling: A Therapeutic Approach for Breast Cancer. Journal of Mammary Gland Biology and Neoplasia 11:1, 27-39
CrossRef71
S. Cianfarani, C. Ladaki, C. Geremia. (2006) Hormonal Regulation of Postnatal Growth in Children Born Small for Gestational Age. Hormone Research 65:3, 70-74
CrossRef72
C. Gicquel, Y. Le Bouc. (2006) Hormonal Regulation of Fetal Growth. Hormone Research 65:3, 28-33
CrossRef73
Kunihiko HANEW, Katsuhiko TACHIBANA, Susumu YOKOYA, Kenji FUJIEDA, Toshiaki TANAKA, Yutaka IGARASHI, Akira SHIMATSU, Hiroyuki TANAKA, Takakuni TANIZAWA, Akira TERAMOTO, Yoshikazu NISHI, Yukihiro HASEGAWA, Naomi HIZUKA, Takeki HIRANO, Keinosuke FUJITA. (2006) Clinical Characteristics, Etiologies and Pathophysiology of Patients with Severe Short Stature with Severe GH Deficiency: Questionnaire Study on the Data Registered with the Foundation for Growth Science, Japan. Endocrine Journal 53:2, 259-265
CrossRef74
Rose A. Gubitosi-Klug, Leona Cuttler. (2005) Idiopathic Short Stature. Endocrinology & Metabolism Clinics of North America 34:3, 565-580
CrossRef75
David B. Dunger, Ken K. Ong. (2005) Endocrine and Metabolic Consequences of Intrauterine Growth Retardation. Endocrinology & Metabolism Clinics of North America 34:3, 597-615
CrossRef76
A. Lelbach, Gy. Muzes, J. Feher. (2005) The insulin-like growth factor system: IGFs, IGF-binding proteins and IGFBP-proteases. Acta Physiologica Hungarica 92:2, 97-107
CrossRef77
W. Kiess, J. Kratzsch, E. Keller, A. Schneider, K. Raile, J. Klammt, B. Seidel, A. Garten, H. Schmidt, R. Pfäffle. (2005) Clinical Examples of Disturbed IGF Signaling: Intrauterine and Postnatal Growth Retardation due to Mutations of the Insulin-Like Growth Factor I Receptor (IGF-IR) Gene. Reviews in Endocrine and Metabolic Disorders 6:3, 183-187
CrossRef78
Feng Dong, Stephen P. Ford, Cindy X. Fang, Mark J. Nijland, Peter W. Nathanielsz, Jun Ren. (2005) Maternal nutrient restriction during early to mid gestation up-regulates cardiac insulin-like growth factor (IGF) receptors associated with enlarged ventricular size in fetal sheep. Growth Hormone & IGF Research 15:4, 291-299
CrossRef79
Renato Baserga. (2005) The insulin-like growth factor-I receptor as a target for cancer therapy. Expert Opinion on Therapeutic Targets 9:4, 753-768
CrossRef80
Ron G. Rosenfeld. (2005) The molecular basis of idiopathic short stature. Growth Hormone & IGF Research 15, 3-5
CrossRef81
R CLAY BUNN, WILLIAM D. KING, MARGARET K. WINKLER, JOHN L. FOWLKES. (2005) Early Developmental Changes in IGF-I, IGF-II, IGF Binding Protein-1, and IGF Binding Protein-3 Concentration in the Cerebrospinal Fluid of Children. Pediatric Research 58:1, 89-93
CrossRef82
Undurti N. Das. (2005) Pathophysiology of metabolic syndrome X and its links to the perinatal period. Nutrition 21:6, 762-773
CrossRef83
Joachim Woelfle, Dennis J. Chia, Mylynda B. Massart-Schlesinger, Paula Moyano, Peter Rotwein. (2005) Molecular physiology, pathology, and regulation of the growth hormone/insulin-like growth factor-I system. Pediatric Nephrology 20:3, 295-302
CrossRef84
Manmohan Kamboj. (2005) Short stature and growth hormone. The Indian Journal of Pediatrics 72:2, 149-157
CrossRef85
Joyce Lee, Ram K. Menon. (2005) Molecular defects in the growth hormone-IGF axis. The Indian Journal of Pediatrics 72:2, 145-148
CrossRef86
David B. Dunger, Ken K. Ong. (2005) Babies Born Small for Gestational Age: Insulin Sensitivity and Growth Hormone Treatment. Hormone Research 64:3, 58-65
CrossRef87
Kunihiko HANEW, Katsuhiko TACHIBANA, Susumu YOKOYA, Kenji FUJIEDA, Toshiaki TANAKA, Yutaka IGARASHI, Akira SHIMATSU, Hiroyuki TANAKA, Takakuni TANIZAWA, Akira TERAMOTO, Yoshikazu NISHI, Yukihiro HASEGAWA, Naomi HIZUKA, Takeki HIRANO, Keinosuke FUJITA. (2005) Studies of Very Severe Short Stature with Severe GH Deficiency: From the Data Registered with the Foundation for Growth Science. Endocrine Journal 52:1, 37-43
CrossRef88
Michael Yanney, Neil Marlow. (2004) Paediatric consequences of fetal growth restriction. Seminars in Fetal and Neonatal Medicine 9:5, 411-418
CrossRef89
Yasir H Ibrahim, Douglas Yee. (2004) Insulin-like growth factor-I and cancer risk. Growth Hormone & IGF Research 14:4, 261-269
CrossRef90
Michael N. Pollak, Eva S. Schernhammer, Susan E. Hankinson. (2004) Insulin-like growth factors and neoplasia. Nature Reviews Cancer 4:7, 505-518
CrossRef91
Mehul Dattani, Michael Preece. (2004) Growth hormone deficiency and related disorders: insights into causation, diagnosis, and treatment. The Lancet 363:9425, 1977-1987
CrossRef92
(2004) IGF-I Receptor Mutations and Intrauterine and Postnatal Growth Retardation. New England Journal of Medicine 350:13, 1362-1363
Full Text93
Francis de Zegher. (2004) Endocrinology of Small-for-Gestational-Age Children: Recent Advances. Hormone Research 62:Suppl. 3, 141-142
CrossRef94
Rosenfeld, Ron G., . (2003) Insulin-like Growth Factors and the Basis of Growth. New England Journal of Medicine 349:23, 2184-2186
Full Text
- Letters
