Original Article
Brief Report
Transmission of a T-Cell Lymphoma by Allogeneic Bone Marrow Transplantation
N Engl J Med 2001; 345:1458-1463November 15, 2001
- Article
Secondary cancer is a well-established long-term complication of bone marrow transplantation.1-3 These post-transplantation cancers are usually associated with exposure to radiation, other genotoxic agents, or Epstein–Barr virus; in rare cases, they result from the transfer of neoplastic cells in transplanted tissue.4
We describe two sisters, one the donor and the other the recipient of a bone marrow transplant, in whom subcutaneous panniculitic T-cell lymphoma5,6 developed three years after the procedure. The finding of identical T-cell clones in the tumors of both sisters implicated the transfer of neoplastic T cells during bone marrow transplantation as the cause of the recipient's subcutaneous lymphoma.
Case Reports
A 19-year-old woman presented in 1993 with stage IVB, anaplastic large-cell lymphoma of T-cell lineage (Ki-1 lymphoma). She had a complete remission after treatment with cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) followed by etoposide, vincristine, doxorubicin, cyclophosphamide, and prednisone, but lymphomatous meningitis later developed. After conditioning therapy, she received a T-cell–depleted bone marrow transplant from her HLA-identical sister, who was 25 years old, and again entered a remission. She died of an independent lymphoma eight years after the initial diagnosis and seven and a half years after the transplant.
Three and a half years after the transplantation, the marrow donor presented with eczematous dermatitis on her legs, a nodule on her left arm, and fever. Biopsy of the nodule revealed lobular lymphocytic panniculitis with perivascular lymphocytes. Biopsy of a persistent nodule on her leg revealed an ulcerated epidermis overlying a dense lobular subcutaneous infiltrate composed of pleomorphic, atypical lymphocytes that surrounded adipocytes (Figure 1Figure 1
The Donor's Lymphoma.). The atypical cells were positive for CD3, CD8, granzyme B, and TIA-1 (a granular protein of cytotoxic T cells) and negative for CD56 and CD20. The infiltrate contained a monoclonal population of T cells with rearranged T-cell receptor γ (TCRγ) genes and was negative for Epstein–Barr virus on in situ hybridization.Despite treatment, the donor's cutaneous lesions and constitutional symptoms progressed. A serologic test for human T-cell lymphotropic virus type I was negative, and the results of a serologic test for Epstein–Barr virus were consistent with a history of prior exposure. Evidence of the hemophagocytic syndrome and pancytopenia developed. After two cycles of CHOP chemotherapy, gross gastrointestinal hemorrhage occurred, and the patient died two years after presentation.
One month before her sister's death the recipient was seen for a one-year history of skin lesions on her legs. Physical examination showed eczematous plaques and nodules on the lower part of both legs. Histologic examination of a nodule revealed many similarities to the subcutaneous panniculitic T-cell lymphoma identified in her sister, including atypical T cells infiltrating the dermis and subcutis, with rimming of adipocytes. The subcutaneous tumor cells were positive for CD3, CD8, TIA-1, and granzyme B and negative for CD30 (Ki-1) and CD56. Polymerase-chain-reaction (PCR) assessment of this tumor revealed a monoclonal rearrangement of the TCRγ gene. In situ hybridization was negative for Epstein–Barr virus. The findings in the subcutaneous nodule were consistent with a diagnosis of subcutaneous panniculitic T-cell lymphoma rather than a recurrence of the original lymphoma.
The similarities of the sisters' tumors raised the suspicion that the lymphoma had been transmitted from the donor to the recipient during bone marrow transplantation. Therefore, further tests were conducted.
Methods
Specimen Collection, Histochemical Analysis, and Isolation of DNA
Peripheral-blood specimens were obtained from the donor and the recipient before transplantation and from the recipient periodically after transplantation. Tumor-biopsy specimens from the two sisters were prepared for histologic examination according to standard techniques. The specimens were stained with the following immunohistochemical stains: CD3 (dilution, 1:300) (Dako, Carpinteria, Calif.), CD4 (dilution, 1:10) (Vector, Burlingame, Calif.), CD8 (dilution, 1:20) (Dako), CD20 (dilution, 1:1000) (Dako), CD30 (dilution, 1:180) (Dako), and TIA-1 (dilution, 1:500) (Coulter, Miami, Fla.). DNA was isolated according to standard methods.7
PCR for TCRγ Gene Rearrangements
After informed consent was obtained from the patient and her mother, a two-step PCR assay was used to identify rearrangements of the TCRγ subunit gene.8-11 The sizes of the PCR products were determined with the use of capillary electrophoresis (model 310, Applied Biosystems, Foster City, Calif.).
Microsatellite Analysis
Peripheral-blood samples obtained from the donor and recipient before transplantation and specimens of subcutaneous panniculitic T-cell lymphoma from the two sisters were assessed for nine microsatellite loci by PCR with use of a forensics identity-testing kit (ABI Profiler, Applied Biosystems).
Tumor-Specific PCR Analysis
Cycle sequencing of the TCRγ PCR products was performed directly or after cloning into a TA cloning vector (One-Shot INV-α, Invitrogen, Carlsbad, Calif.) with use of a dye-terminator method (Big Dye, Terminator Cycle Sequencing Ready Reaction Kit, Applied Biosystems). Initial linear amplification of TCRγ was performed as previously described.9 The second, tumor-specific PCR was performed with the use of TV-γ, a standard forward primer, and TJ-N(R) (5'GAGTTTCTTATGGAGGCGGG3'), a tumor-specific reverse primer, for 45 cycles. The TJ-N(R) primer is specific for the unique N-region and joining-region sequences identified in the lymphomas from the donor and recipient; N regions are sites of insertion or deletion of bases during the rearrangement of T-cell receptor genes.
Results
The Size of the Rearranged TCRγ Genes
The DNA products (amplicons) generated by PCR analysis of randomly rearranged TCRγ alleles vary in size and base sequence (Figure 2AFigure 2
Germ-Line and Rearranged T-Cell Receptor γ (TCRγ) Gene (Panel A) and Results of T-Cell Receptor γ PCR Assay of Biopsy Samples of Subcutaneous Panniculitic T-Cell Lymphoma from the Donor (Panel B) and the Recipient (Panel C).). PCR analysis of subcutaneous panniculitic T-cell lymphomas from the donor (Figure 2B) and the recipient (Figure 2C) produced amplicons of the same size (181 bases), findings consistent with the presence of identical T-cell clones in the two tumors. Similar analysis of the recipient's original Ki-1 lymphoma did not reveal this T-cell clone (data not shown).Microsatellite Analysis
We assessed whether the recipient's post-transplantation lymphoma was derived from donor or recipient cells using an identity-testing PCR kit that amplifies nine microsatellite loci. Figure 3Figure 3
Results of Microsatellite Analysis at One Locus from the Peripheral Blood and Tumors of the Donor (Panels A and C) and the Recipient (Panels B and D). illustrates the result at one locus. The germ-line patterns of the donor's cells (Figure 3A) and recipient's cells (Figure 3B) differ. The patterns in the donor's lymphoma (Figure 3C) and the recipient's lymphoma (Figure 3D) were identical; both matched the donor's germ-line pattern. At other loci tested (data not shown), donor alleles were also the dominant pattern in the recipient's subcutaneous panniculitic T-cell lymphoma.Sequences of the Rearranged TCRγ Genes
We sequenced the TCRγ gene PCR products from the subcutaneous-lymphoma specimens from the donor and recipient to identify the TCRγ gene rearrangements. To do so, PCR amplicons were cloned, and the resulting sequences of the cloned products were identical in both tumors (Figure 4Figure 4
Sequencing of the Cloned Products of PCR Analysis of Specimens of Subcutaneous Panniculitic T-Cell Lymphomas from the Donor (Panel A) and the Recipient (Panel B).). Particularly relevant were the identical N regions in the two tumors (Figure 4). N regions are unique clonal markers because they are sites of random insertions and deletions of bases during the rearrangement of T-cell receptor genes.PCR Analysis of Blood Cells before and after Transplantation
On the basis of the above sequencing data, we designed a tumor-specific assay using a PCR primer complementary to the unique joining-region and N-region sequences of the neoplastic clone (Figure 4). We validated the results of the assay using a tumor sample from the recipient (Figure 5AFigure 5
Results of T-Cell Receptor γ PCR and Tumor-Specific PCR of Specimens of Subcutaneous Panniculitic T-Cell Lymphoma and Peripheral Blood from the Donor and the Recipient.). Controls, consisting of three polyclonal and five unrelated monoclonal samples, were not amplified by the tumor-specific primer (data not shown).Examination of peripheral-blood cells obtained from the donor before bone marrow transplantation with use of the standard T-cell receptor PCR assay did not reveal the malignant 181-base clone (Figure 5B). This assay can detect approximately 1 clonal T cell among 100 polyclonal T cells.9 The tumor-specific PCR of peripheral-blood cells obtained from the donor before transplantation revealed a TCRγ clone identical in size to that in her tumor (Figure 5C), demonstrating that her blood contained clonal T cells when her marrow cells were harvested. The tumor-specific PCR analysis of bone marrow obtained from the recipient before transplantation showed no evidence of the malignant clone, but multiple samples of bone marrow and peripheral blood obtained after transplantation (from 1994 to 1999) were positive for the donor's clonal TCRγ rearrangement. These data show that the donor's neoplastic T-cell clone persisted in the recipient for five years before clinically evident disease appeared.
Discussion
We describe the transmission of subcutaneous panniculitic T-cell lymphoma by bone marrow transplantation. This rare lymphoma, a proliferation of neoplastic T cells, is initially characterized by multiple subcutaneous nodules, especially on the arms and legs. Its behavior ranges from indolent to aggressive, and an adverse outcome is commonly associated with the hemophagocytic syndrome.5,12-15
The molecular fingerprint of this tumor, the rearrangement of its TCRγ gene, permitted us to document not only that the subcutaneous tumor in the recipient originated in the donor but also that there was a long period of latency (three years) before the neoplasm became clinically evident.
Patients who undergo bone marrow transplantation are at risk for the transmission of a variety of conditions.16,17 Although the risk of a secondary hematologic cancer is increased by a factor of four to seven,3,18,19 reflecting the mutagenicity of the preparative regimens for transplantation, the transmission of neoplastic tissue by bone marrow and solid-organ transplantation is uncommon. Acute promyelocytic leukemia has been transferred by the transplantation of a cadaveric liver allograft,20 metastatic glioblastoma multiforme has been transferred in kidney and liver transplants,21,22 and acute myeloid leukemia has been transmitted by the transplantation of donor bone marrow.4
Using molecular techniques, we have identified a case of transmission of subcutaneous T-cell lymphoma by a bone marrow transplantation. One important aspect of this case is that two independent T-cell lymphomas (the recipient's original anaplastic large-cell lymphoma and the donor's subcutaneous panniculitic T-cell lymphoma) arose in two sisters at young ages. Although it is tempting to postulate that there was a common genetic or infectious cause, these lymphomas appear to be clinically and histologically distinct from the familial lymphoma syndromes that arise in patients with Epstein–Barr virus or human T-cell lymphotropic virus type I infections.23-25 Moreover, tests of the bone marrow recipient were negative for both these infectious agents. It is also interesting to consider the possibility that with increasing age and a corresponding increase in the frequency of occult neoplasms in older donors, the likelihood of the transfer of a tumor during transplantation will increase. Methods for preventing such transfers may require the transplantation of highly purified stem cells or the development of more sensitive screening assays for neoplastic cells.
We are indebted to Drs. William Baldwin, Steven Desidario, Frederick Racke, Noel Rose, and Johnathan Schneck for helpful discussions; to Dr. Terry Barrett for critical review of the manuscript; to Cynthia Glaser, M.T., Karen Miller, M.T., Michael Hafez, M.T., and Lisa Cooper, M.T., for technical assistance; and to Anita Hawkins for cytogenetic analysis.
Source Information
From the Departments of Pathology (K.D.B., K.M.H., M.G.G., K.M.M., C.A.G., L.S.R.-V., M.J.B., J.R.E.), Dermatology (N.K.B., K.M.H., H.C.N.), Medicine (M.G.G.), and Oncology (K.D.B., M.G.G., R.J.J., C.A.G., L.S.R.-V., J.R.E.), Johns Hopkins School of Medicine, Baltimore; and the Department of Hematology and Oncology, Geisinger Medical Center, Danville, Pa. (A.M.).
Address reprint requests to Dr. Eshleman at the Department of Pathology, 632 Ross Bldg., 720 Rutland Ave., Baltimore, MD 21205, or at jeshlema@jhmi.edu.
- References
References
1
Curtis RE ,Rowlings PA ,Deeg HJ , et al. Solid cancers after bone marrow transplantation. N Engl J Med 1997;336:897-904
Full Text | Web of Science | Medline2
Deeg HJ ,Socie G . Malignancies after hematopoietic stem cell transplantation: many questions, some answers. Blood 1998;91:1833-1844
Web of Science | Medline3
Curtis RE ,Travis LB ,Rowlings PA , et al. Risk of lymphoproliferative disorders after bone marrow transplantation: a multi-institutional study. Blood 1999;94:2208-2216
Web of Science | Medline4
Niederwieser DW ,Appelbaum FR ,Gastl G , et al. Inadvertent transmission of a donor's acute myeloid leukemia in bone marrow transplantation for chronic myelocytic leukemia. N Engl J Med 1990;322:1794-1796
Full Text | Web of Science | Medline5
Gonzalez CL ,Medeiros LJ ,Braziel RM ,Jaffe ES . T-cell lymphoma involving subcutaneous tissue: a clinicopathologic entity commonly associated with hemophagocytic syndrome. Am J Surg Pathol 1991;15:17-27
CrossRef | Web of Science | Medline6
Wang CY ,Su WP ,Kurtin PJ . Subcutaneous panniculitic T-cell lymphoma. Int J Dermatol 1996;35:1-8
CrossRef | Web of Science | Medline7
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Plainview, N.Y.: Cold Spring Harbor Laboratory Press, 1989:9.16-9.19.
8
Huck S ,Dariavach P ,Lefranc MP . Variable region genes in the human T-cell rearranging gamma (TRG) locus: V-J junction and homology with the mouse genes. EMBO J 1988;7:719-726
Web of Science | Medline9
Lee SC ,Berg KD ,Racke FK ,Griffin CA ,Eshleman JR . Pseudo-spikes are common in histologically benign lymphoid tissues. J Mol Diagn 2000;2:145-152
CrossRef | Web of Science | Medline10
Benhattar J ,Delacretaz F ,Martin P ,Chaubert P ,Costa J . Improved polymerase chain reaction detection of clonal T-cell lymphoid neoplasms. Diagn Mol Pathol 1995;4:108-112
CrossRef | Web of Science | Medline11
Bourguin A ,Tung R ,Galili N ,Sklar J . Rapid, nonradioactive detection of clonal T-cell receptor gene rearrangements in lymphoid neoplasms. Proc Natl Acad Sci U S A 1990;87:8536-8540
CrossRef | Web of Science | Medline12
Kumar S ,Krenacs L ,Medeiros J , et al. Subcutaneous panniculitic T-cell lymphoma is a tumor of cytotoxic T lymphocytes. Hum Pathol 1998;29:397-403
CrossRef | Web of Science | Medline13
Salhany KE ,Macon WR ,Choi JK , et al. Subcutaneous panniculitis-like T-cell lymphoma: clinicopathologic, immunophenotypic, and genotypic analysis of alpha/beta and gamma/delta subtypes. Am J Surg Pathol 1998;22:881-893
CrossRef | Web of Science | Medline14
Willemze R ,Kerl H ,Sterry W , et al. EORTC classification for primary cutaneous lymphomas: a proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer. Blood 1997;90:354-371
Web of Science | Medline15
Norton AJ . Classification of cutaneous lymphoma: a critical appraisal of recent proposals. Am J Dermatopathol 1999;21:279-287
CrossRef | Web of Science | Medline16
Agosti JM ,Sprenger JD ,Lum LG , et al. Transfer of allergen-specific IgE-mediated hypersensitivity with allogeneic bone marrow transplantation. N Engl J Med 1988;319:1623-1628
Full Text | Web of Science | Medline17
Heyll A ,Meckenstock G ,Aul C , et al. Possible transmission of sarcoidosis via allogeneic bone marrow transplantation. Bone Marrow Transplant 1994;14:161-164
Web of Science | Medline18
Witherspoon RP ,Fisher LD ,Schoch G , et al. Secondary cancers after bone marrow transplantation for leukemia or aplastic anemia. N Engl J Med 1989;321:784-789
Full Text | Web of Science | Medline19
Browne PV ,Lawler M ,Humphries P ,McCann SR . Donor-cell leukemia after bone marrow transplantation for severe aplastic anemia. N Engl J Med 1991;325:710-713
Full Text | Web of Science | Medline20
Bodo I ,Peters M ,Radich JP , et al. Donor-derived acute promyelocytic leukemia in a liver-transplant recipient. N Engl J Med 1999;341:807-813
Full Text | Web of Science | Medline21
Healey PJ ,Davis CL . Transmission of tumours by transplantation. Lancet 1998;352:2-3
CrossRef | Web of Science | Medline22
Frank S ,Muller J ,Bonk C ,Haroske G ,Schackert HK ,Schackert G . Transmission of glioblastoma multiforme through liver transplantation. Lancet 1998;352:31-31[Erratum, Lancet 1998;352:1316.]
CrossRef | Web of Science | Medline23
Shpilberg O ,Modan M ,Modan B ,Chetrit A ,Fuchs Z ,Ramot B . Familial aggregation of haematological neoplasms: a controlled study. Br J Haematol 1994;87:75-80
CrossRef | Web of Science | Medline24
Donadieu J ,Canioni D ,Cuenod B , et al. A familial T-cell lymphoma with gamma delta phenotype and an original location: possible role of chronic Epstein-Barr virus infection. Cancer 1996;77:1571-1577
CrossRef | Web of Science | Medline25
Kozuru M ,Uike N ,Muta K ,Goto T ,Suehiro Y ,Nagano M . High occurrence of primary malignant neoplasms in patients with adult T-cell leukemia/lymphoma, their siblings, and their mothers. Cancer 1996;78:1119-1124
CrossRef | Web of Science | Medline
- Citing Articles (27)
Citing Articles
1
Daniel H. Wiseman. (2011) Donor Cell Leukemia: A Review. Biology of Blood and Marrow Transplantation 17:6, 771-789
CrossRef2
Sergey V. Anisimov, Asuka Morizane, Ana S. Correia. (2010) Risks and Mechanisms of Oncological Disease Following Stem Cell Transplantation. Stem Cell Reviews and Reports 6:3, 411-424
CrossRef3
Hung Yang, June Lee, Clive R. Seed, Anthony J. Keller. (2010) Can Blood Tranfusion Transmit Cancer? A Literature Review. Transfusion Medicine Reviews 24:3, 235-243
CrossRef4
P. J. Phelan, R. K. J. Murphy, M. Farrell, O. O'Toole, J. Heffernan, D. O'Brien, O. Breathnach, P. J. Conlon. (2010) EBV-positive B cell cerebral lymphoma 12 years after sex-mismatched kidney transplantation: post-transplant lymphoproliferative disorder or donor-derived lymphoma?. Nephrology Dialysis Transplantation 25:6, 2032-2035
CrossRef5
A. Santos-Briz, A. Romo, P. Antúnez, C. Román, M. Alcoceba, J. L. Garcia, L. Vazquez, M. González, P. Unamuno. (2009) Primary cutaneous T-cell lymphoproliferative disorder of donor origin after allogeneic haematopoietic stem-cell transplantation. Clinical and Experimental Dermatology 34:8, e778-e781
CrossRef6
M Ditschkowski, C Haferlach, C Schulte, R Trenschel, D W Beelen. (2009) Occurrence of AML in cells of donor origin after treatment of CML in relapse with imatinib and donor stem cell boost 16 years after the original allogeneic BMT. Bone Marrow Transplantation 44:4, 265-266
CrossRef7
Lewis Glasser, Aurelia Meloni-Ehrig, Wesley Greaves, Kurt C. Demel, James Butera. (2009) Synchronous development of acute myeloid leukemia in recipient and donor after allogeneic bone marrow transplantation: report of a case with comments on donor evaluation. Transfusion 49:3, 555-562
CrossRef8
Noelle V. Frey, Christopher E. Leid, Peter C. Nowell, Ewa Tomczak, Honore T. Strauser, Margaret Kasner, Steven Goldstein, Alison Loren, Edward Stadtmauer, Selina Luger, Elizabeth Hexner, Joanne Hinkle, David L. Porter. (2008) Trisomy 8 in an allogeneic stem cell transplant recipient representative of a donor-derived constitutional abnormality. American Journal of Hematology 83:11, 846-849
CrossRef9
Fernando Gallardo, Ramon M. Pujol. (2008) Subcutaneous Panniculitic-Like T-Cell Lymphoma and Other Primary Cutaneous Lymphomas with Prominent Subcutaneous Tissue Involvement. Dermatologic Clinics 26:4, 529-540
CrossRef10
A Kolstad, G Tjønnfjord, V Jønsson. (2008) High frequency of unrecognized indolent hematological disorders among HLA-matched siblings of patients with lymphoproliferative malignancies eligible for allo-SCT. Bone Marrow Transplantation 42:6, 427-428
CrossRef11
J. W. Harbell, T. B. Dunn, M. Fauda, D. G. John, A. S. Goldenberg, L. W. Teperman. (2007) Transmission of Anaplastic Large Cell Lymphoma via Organ Donation After Cardiac Death. American Journal of Transplantation 0:0, 071117175452009-???
CrossRef12
Manish J. Gandhi, D. Michael Strong. (2007) Donor derived malignancy following transplantation: a review. Cell and Tissue Banking 8:4, 267-286
CrossRef13
Gustaf Edgren, Henrik Hjalgrim, Marie Reilly, Trung Nam Tran, Klaus Rostgaard, Agneta Shanwell, Kjell Titlestad, Johanna Adami, Agneta Wikman, Casper Jersild, Gloria Gridley, Louise Wideroff, Olof Nyrén, Mads Melbye. (2007) Risk of cancer after blood transfusion from donors with subclinical cancer: a retrospective cohort study. The Lancet 369:9574, 1724-1730
CrossRef14
Maria R. Kamstrup, Robert Gniadecki, Gunhild L. Skovgaard. (2007) Putative cancer stem cells in cutaneous malignancies. Experimental Dermatology 16:4, 297-301
CrossRef15
Jason Hart, A. Robert Turner, Loree Larratt, James Russell, Bevin Franko, Christine Frantz, Teresa Paonessa, Adnan Mansoor, Raymond Lai. (2007) Transmission of a follicular lymphoma by allogeneic bone marrow transplantation ? evidence to support the existence of lymphoma progenitor cells. British Journal of Haematology 136:1, 166-167
CrossRef16
Zafer Cetin, Gulsun Tezcan, Sibel Berker Karauzum, Alphan Kupesiz, Ayse Esra Manguoglu, Akif Yesilipek, Guven Luleci, Volkan Hazar. (2006) Donor Cell-derived Acute Myeloblastic Leukemia After Allogeneic Peripheral Blood Hematopoietic Stem Cell Transplantation for Juvenile Myelomonocytic Leukemia. Journal of Pediatric Hematology/Oncology 28:11, 763-767
CrossRef17
Rukhsana Jabeen, Deborah Payne, John Wiktorowicz, Amin Mohammad, John Petersen. (2006) Capillary electrophoresis and the clinical laboratory. ELECTROPHORESIS 27:12, 2413-2438
CrossRef18
Olga Sala-Torra, Colleen Hanna, Michael R. Loken, Mary E.D. Flowers, Michael Maris, Paula A. Ladne, James R. Mason, David Senitzer, Roberto Rodriguez, Stephen J. Forman, H. Joachim Deeg, Jerald P. Radich. (2006) Evidence of Donor-Derived Hematologic Malignancies after Hematopoietic Stem Cell Transplantation. Biology of Blood and Marrow Transplantation 12:5, 511-517
CrossRef19
Hideki Mitsui, Norimitsu Saito, Atsushi Satake, Tsuyoshi Nakazawa, Takahiro Karasuno, Akira Hiraoka. (2005) A Novel Chromosomal Abnormality, t(6;10)(q27;q22), Found in a Polycythemic Potential Donor for Allogeneic Hematopoietic Stem Cell Transplantation. International Journal of Hematology 82:1, 72-74
CrossRef20
Ronald S. Go, Susan M. Wester. (2004) Immunophenotypic and molecular features, clinical outcomes, treatments, and prognostic factors associated with subcutaneous panniculitis-like T-cell lymphoma. Cancer 101:6, 1404-1413
CrossRef21
M Kligman. (2003) Cortical and cancellous morselized allograft in acetabular revision total hip replacement Minimum 5-year follow-up. The Journal of Arthroplasty 18:7, 907-913
CrossRef22
Baron, Frederic, Dresse, Marie-Françoise, Beguin, Yves, . (2003) Transmission of Chronic Myeloid Leukemia through Peripheral-Blood Stem-Cell Transplantation. New England Journal of Medicine 349:9, 913-914
Full Text23
Jakub Tolar, Joseph P. Neglia. (2003) Transplacental and Other Routes of Cancer Transmission Between Individuals. Journal of Pediatric Hematology/Oncology 25:6, 430-434
CrossRef24
M R Canninga-van Dijk, C J Sanders, L F Verdonck, R Fijnheer, J G van den Tweel. (2003) Differential diagnosis of skin lesions after allogeneic haematopoietic stem cell transplantation. Histopathology 42:4, 313-330
CrossRef25
John R Petersen, Anthony O Okorodudu, Amin Mohammad, Deborah A Payne. (2003) Capillary electrophoresis and its application in the clinical laboratory. Clinica Chimica Acta 330:1-2, 1-30
CrossRef26
S.R. Hoque, F.J. Child, S.J. Whittaker, S. Ferreira, G. Orchard, K. Jenner, M. Spittle, R. Russell-Jones. (2003) Subcutaneous panniculitis-like T-cell lymphoma: a clinicopathological, immunophenotypic and molecular analysis of six patients. British Journal of Dermatology 148:3, 516-525
CrossRef27
William H. Kruger, Hans-Heinrich Wolf, Wieland Voigt, Thomas Skibbe, Hans-Joachim Schmoll. (2002) Detection of an Occult B-cell Lymphoma in the Donor's Bone Marrow Prior to HLA-Matched Sibling Transplantation. Journal of Hematotherapy <html_ent glyph="@amp;" ascii="&"/> Stem Cell Research 11:2, 169-170
CrossRef
