Original Article
Rickettsia africae, a Tick-Borne Pathogen in Travelers to Sub-Saharan Africa
N Engl J Med 2001; 344:1504-1510May 17, 2001
- Abstract
Background
African tick-bite fever occurs after contact with ticks that carry Rickettsia africae and that parasitize cattle and game. Sporadic reports suggest that this infection has specific clinical and epidemiologic features.
Methods
We studied patients who were tested for a rickettsial disease after returning from a visit to Africa or Guadeloupe. To assess the value of the microimmunofluorescence assay, Western blotting, and cross-adsorption assays, we compared the results of these tests in 39 patients in whom African tick-bite fever had been confirmed by the polymerase-chain-reaction assay, cell culture, or both; 50 patients with documented R. conorii infection; and 50 blood donors. These diagnostic criteria were then applied to 376 additional patients who had returned from southern Africa and 2 who had returned from Guadeloupe and whose serum was being tested for rickettsial disease.
Results
In the 39 patients with direct evidence of R. africae infection, the combination of microimmunofluorescence assay, Western blotting, and cross-adsorption assays showing antibodies specific for R. africae had a sensitivity of 0.56; however, each test had a positive predictive value and a specificity of 1.0. An additional 80 patients were found to have an R. africae infection on the basis of these serologic criteria. Infections with R. africae were acquired by visitors to 11 African countries and Guadeloupe. The illness was generally mild and was characterized by a rash in 46 percent of the patients; the rash was usually maculopapular or vesicular and rarely purpuric. Ninety-five percent of patients had an inoculation eschar or eschars, and 54 percent of these patients had multiple eschars, a finding that is unusual in patients with rickettsial infection.
Conclusions
In this series, R. africae was the cause of nearly all cases of tick-bite rickettsiosis in patients who became ill after a trip to sub-Saharan Africa.
Media in This Article
Figure 2
Four Inoculation Eschars (Arrows) on the Legs of a Patient Who Presented with African Tick-Bite Fever after Returning from a Safari in South Africa.Figure 1
Results of Western Blot Assay of Serum from Three Patients.Article Activity
- Article
Rickettsia conorii infection was once considered the only tick-transmitted rickettsial infection in Europe and Africa, causing both Mediterranean spotted fever and African tick-bite fever. At that time, African tick-bite fever, which occurred after contact with ticks (amblyomma species) found on cattle and game and was characterized by signs of mild infection, usually with no rash,1 was considered a rural form of Mediterranean spotted fever. Mediterranean spotted fever was transmitted by dog ticks (rhipicephalus species) and was characterized by fever, headache, myalgias, a maculopapular rash, and a single inoculation eschar at the site of the tick bite.2 In 1936, Pijper suggested that these two diseases were caused by different agents,3 but it was not until 1992 that Kelly et al. demonstrated the causative role of a new rickettsia isolated from a patient who presented with fever, an inoculation eschar, and regional lymphadenopathy but no rash.4 This isolate was named R. africae; it was distinct from all other previously described rickettsiae but similar to a bacterium previously isolated from Amblyomma hebraeum ticks.4,5 Subsequently, R. africae has been implicated as the etiologic agent in several cases of African tick-bite fever in travelers returning from southern Africa6,7 and in one woman who was bitten by a tick in Guadeloupe.4,8,9 We evaluated a large series of patients with R. africae infections in order to describe the epidemiologic, clinical, and diagnostic features of African tick-bite fever and to validate serologic methods for the diagnosis of this disease.
Methods
Patients
We tested serum samples, blood samples, and skin-biopsy specimens that were obtained between January 1996 and March 2000 from patients who had had an influenza-like syndrome that was not due to malaria (as indicated by a negative blood smear) after returning from a trip to Africa or Guadeloupe. For each patient, data on epidemiologic and clinical features were obtained by the attending physician through the use of a standardized questionnaire. Information was obtained about whether the patient had been bitten by a tick (or had handled a tick) during the trip and, if so, the geographic area in which the bite had occurred; whether the patient had had any contact with animals during the trip; whether the patient had any underlying diseases; and whether the patient had had the following clinical symptoms: fever, headache, an inoculation eschar or eschars (and their locations if present), regional adenopathy, a rash, and if present, the type of rash (maculopapular, vesicular, or purpuric). Information about laboratory results and the outcome of the infection was also obtained. For each patient, a serum sample was obtained for serologic testing during the acute phase of the illness and, when possible, during convalescence. Some of the patients have been described previously.7,10 Each patient provided written informed consent.
Laboratory Diagnosis
A microimmunofluorescence assay was used as the reference method and was carried out as described previously with the use of both R. conorii strain Seven (Malish, American Type Culture Collection VR-613T) and R. africae strain ESF-5 (provided by Dr. G. Dasch) as antigens.9 Titers of 1:64 in the case of IgG antibody or of 1:32 in the case of IgM antibody (or both) were considered evidence of recent infection by a rickettsia species.11,12 Western blotting, cross-adsorption assays, cell or tissue culture, polymerase-chain-reaction (PCR) assays, and “suicide” PCR assays (this is a nested PCR whose name comes from the fact that the primers are used only once)13 were performed if adequate blood samples or tissue specimens were available. Western blotting procedures were performed as previously described14; 20 μg of R. africae antigen or R. conorii antigen was used per lane. Cross-adsorption assays15 for serologic testing were performed as previously described.16 We estimated the positive predictive value, specificity, and sensitivity of the microimmunofluorescence assay, Western blotting, and the cross-adsorption assay in 39 patients who had confirmed R. africae infection on the basis of cell-culture results, PCR assay, or both, by comparing their results with those of 50 patients with direct evidence of R. conorii infection contracted in France and 50 randomly chosen blood donors from Marseilles. We considered any of the following to be definite serologic evidence of an R. africae infection: titers of IgG antibody and IgM antibody against R. africae antigen that were at least two serial dilutions higher than titers of IgG and IgM antibody against R. conorii (e.g., 1:64 vs. 1:16), a Western blot profile that showed only R. africae–specific antibodies, or cross-adsorption studies demonstrating that the homologous antibodies were directed against R. africae. 17 We then applied these serologic diagnostic criteria to serum samples from 376 additional patients who had returned from southern Africa and 2 who had returned from Guadeloupe and who had provided serum samples for the diagnosis of rickettsiosis.
The microorganism was isolated from skin-biopsy specimens and heparin-treated blood samples that were inoculated into shell vials, and the cultures were then cultivated as previously reported.9 For the molecular detection and identification of R. africae, DNA was extracted from ground eschar-biopsy specimens, from the leukocyte layer in the sediment of EDTA-treated blood samples, or from 200 μl of shell-vial supernatant with the QIAmp Tissue kit (Qiagen, Hilden, Germany) according to the manufacturer's recommendations. The standard PCR assay of the DNA extracts was conducted as described previously.18 In an effort to increase the sensitivity of DNA detection and to avoid false positive amplifications, we used a suicide PCR assay to test, when enough of the specimen or sample remained, all skin-biopsy specimens that were negative on the standard PCR assay and the serum sample obtained from each patient during the acute phase of the illness.13 Three series of samples were tested successively with the use of three sets of two pairs of single-use primers that amplified nonoverlapping fragments of the gene encoding outer-membrane protein A (ompA), a gene present in all spotted-fever-group rickettsia. The first suicide PCR assay used the primers AF1F (5'CACTCGGTGTTGCTGCA3') and AF1R (ATTAGTGCAGCATTCGCTC3') and AF2F (GCTGCAGGAGCATTTAGTG3') and AF2R (5'TATCGGCAGGAGCATCAA3') for the nested amplification. The second used the primers AF3F (5'GGTGGTGGTAACGTAATC3') and AF3R (5'CGTCAGTTATTGTAACGGC3') and AF4F (5'GGAACAGTTGCAGAAATCAA3') and AF4R (5'CTGCTACATTACTCCCAATA3') for the nested amplification. The third used the primers AF5F (5'GTATAACATTACACGCTGG3') and AF5R (5'GCAAGTGTTCCTATAGTTG3') and AF6F (5'TATAGATTTTGGAGCCAAGGA3') and AF6R (5'CCGTAAGTAACTTTGTATTAA3') for the nested amplification. DNA extracted from skin-biopsy specimens from a patient who had died of cancer and from serum specimens from blood donors were used as negative controls for PCR amplification from skin-biopsy specimens and serum samples from the study patients, respectively. One negative control was used for every seven samples. Testing was done in a blinded fashion. All positive PCR products were sequenced as previously described for the identification of the pathogenic rickettsial species.17,19
Statistical Analysis
We used Fisher's exact test with Epi Info version 6.020 to compare the sensitivity of the suicide PCR assay and blood or eschar culture. Observed differences were considered to be significant when the resulting two-tailed P value was less than 0.05.
Results
Laboratory Results
A total of 417 patients were tested for R. africae infection, and the diagnosis was established in 133, including 39 with direct evidence of R. africae on PCR assay, cell culture, or both and 94 with only a specific serologic response to R. africae on microimmunofluorescence assay. However, among the 417, 14 patients for whom epidemiologic and clinical information was missing were excluded from the study. On cell or tissue culture, R. africae was isolated from the blood of 2 of 18 patients who were tested and from the skin-biopsy specimens of 8 of 18 patients who were tested. A PCR assay carried out according to standard methods was positive in 1 of 8 blood samples that were tested and in 11 of 23 skin-biopsy specimens. All 15 skin-biopsy specimens that were evaluated with the suicide PCR assay were positive (including 7 that were negative on the standard PCR assay). Fragments of 330, 240, and 170 bp were obtained with use of the primer pairs AF2F and AF2R, AF4F and AF4R, and AF6F and AF6R, respectively. Of the 109 serum specimens tested with the use of this technique, 16 were positive. None of the negative controls were positive.
Amplification of DNA from skin-biopsy specimens with the use of the suicide PCR assay was significantly more sensitive than culture of skin-biopsy specimens (15 of 15 positive samples identified correctly, as compared with 7 of 17; P<0.01). However, suicide PCR assay of serum was not more sensitive than blood culture (16 of 109 positive samples identified correctly, as compared with 2 of 18; P=0.50). In every patient with positive results on either or both of the PCR assays, the sequence of the amplicon was 100 percent homologous to and specific for that of R. africae.
When we compared the 39 patients with confirmed R. africae infection with 50 patients with confirmed R. conorii infection and 50 blood donors, 10 of our patients with R. africae infection but none of the controls had levels of IgG antibody and IgM antibody against R. africae antigen that were higher than the IgG and IgM antibody levels against R. conorii by at least two dilutions (positive predictive value, 1.0; specificity, 1.0; and sensitivity, 0.26). Five of six patients with R. africae infection but none of the controls had an antibody response specific for R. africae infection on cross-adsorption testing (positive predictive value, 1.0; specificity, 1.0; and sensitivity, 0.83). Eighteen of 34 patients but none of the controls had antibodies specific for R. africae by Western blotting (positive predictive value, 1.0; specificity, 1.0; and sensitivity, 0.53) (Figure 1Figure 1
Results of Western Blot Assay of Serum from Three Patients.). The remaining 16 patients had antibodies against both R. africae and R. conorii. When we combined the results of the microimmunofluorescence assay, Western blotting, and cross-adsorption tests, the results of at least one of these three tests were positive in 22 of the 39 patients with confirmed infection (56 percent). When we applied these serologic tests to 378 other patients with potential R. africae infection, 81 patients for whom clinical information was available had positive results (Table 1Table 1
Results from 80 Patients with a Serologic Diagnosis of African Tick-Bite Fever and 1 Patient with a Serologic Diagnosis of Mediterranean Spotted Fever.). Serum samples obtained during the acute phase of the illness were available for 77 patients, whereas samples obtained during convalescence were available for 47. The microimmunofluorescence assay indicated that 68 patients were seropositive; titers of IgG antibody against R. africae antigen ranged from 0 to 1:32 and 0 to 1:2048 in samples obtained during the acute phase and convalescence, respectively, whereas titers of IgM antibody ranged from 0 to 1:256 in samples obtained during the acute phase and from 0 to 1:1024 in samples obtained during convalescence. In 33 patients the levels of IgG and IgM antibody against R. africae antigen were higher than the levels of these antibodies against R. conorii antigen, and 46 had a specific antibody response against R. africae antigen on Western blotting. In an additional 33 patients, the presence of antibodies against both R. africae and R. conorii antigen prevented us from determining the causative pathogen.By combining the results of the microimmunofluorescence assay and Western blotting, we obtained a specific diagnosis in 66 patients. In 14 patients for whom the levels of IgG and IgM could not be used to identify the infecting organism and for whom the results of Western blotting were negative but who had positive results on the microimmunofluorescence assay, the cross-adsorption assay confirmed the presence of an R. africae infection. Of the 46 patients with positive results on Western blotting, 13 had no detectable antibodies on the microimmunofluorescence assay. One additional patient who had returned from South Africa had R. conorii infection on the basis of serologic analysis after cross-adsorption assay (Table 1).
Epidemiologic and Clinical Findings
Of the 119 patients with R. africae infection, 106 (89 percent) were members of 21 tourist groups. In 88 cases (74 percent) the infections occurred in clusters. One hundred sixteen patients (97 percent) had traveled to 1 of 11 African countries (Table 2Table 2
Country of Origin and Country in Which the Disease Was Acquired in the Case of 119 Patients with Rickettsia africae Infection.). Three patients acquired the disease outside Africa: two were infected in Guadeloupe, and the other was a young postdoctoral student in Great Britain who was bitten by an imported South African amblyomma tick that he was studying (Table 2). Seventy-four patients were male (62 percent), and 45 were female (38 percent). Their mean (±SD) age was 44.6±15.7 years (range, 15 to 77). Tick bites or handling of ticks was reported by 52 patients (44 percent) (Table 3Table 3
Signs and Symptoms of Patients with African Tick-Bite Fever, Patients with Mediterranean Spotted Fever, and Patients with Rocky Mountain Spotted Fever.), and we used this information to determine the mean incubation time of 6.6±3.0 days.Symptoms at onset included fever in 105 patients (88 percent) and an influenza-like syndrome in 75 (63 percent). One hundred thirteen patients (95 percent) presented with inoculation eschars; 52 patients had a single eschar (46 percent), and 61 had multiple eschars (54 percent) (Figure 2Figure 2
Four Inoculation Eschars (Arrows) on the Legs of a Patient Who Presented with African Tick-Bite Fever after Returning from a Safari in South Africa.). Eschars were located on the arms in 12 patients (11 percent); the legs in 70 (62 percent); the chest, abdomen, or groin in 20 (18 percent); the back or the buttocks in 5 (4 percent), and the face, scalp, or neck in 6 (5 percent). Fifty-one of the 119 patients (43 percent) presented with regional lymphadenopathy. Fifty-five patients (46 percent) had a rash; among these 55 patients the rash was maculopapular in 28 (51 percent), vesicular in 25 (45 percent), and purpuric in 2 (4 percent).Information about treatment was available for 88 patients; 74 percent received doxycycline for a mean of 6.3±3.1 days (range, 7 to 15), 1 percent received minocycline, 6 percent received erythromycin, 3 percent received ciprofloxacin, and 16 percent received no antibiotic therapy. All patients recovered without any sequelae.
Discussion
African tick-bite fever is highly prevalent in Africa (seroprevalence, 30 to 56 percent),12 and it is also an important disease among visitors to this region.23 Most of the reported cases of African tick-bite fever have been part of outbreaks.4,7,24 The rate of suspected R. africae infections among U.S. Army troops deployed to Botswana was 14 percent.25 During an outbreak of R. africae infections among participants in an adventure race in South Africa, the estimated rate of infection was 3.9 to 7.6 percent.26 In our series of 120 patients, 117 of whom had returned from a trip to Africa, who had been given a diagnosis of tick-bite–related disease and for whom the infecting rickettsia could be identified, 119 were infected with R. africae and 1 with R. conorii.
Mediterranean spotted fever and Rocky mountain spotted fever are generally sporadic, and the vectors of these diseases are very host-specific.27 In contrast, amblyomma ticks, which are parasites of cattle and wild ungulates and have been found to carry R. africae in all tested areas,12,28 are not host-specific. They readily feed on humans, which may explain why cases of R. africae infection often occur as clusters and why patients often present with multiple inoculation eschars. On the basis of our data, African tick-bite fever appears to be acquired after travel in the countryside and through contact with ticks that parasitize cattle or wild animals, especially amblyomma ticks.
African tick-bite fever is characterized by an incubation period of six to seven days. Specific features include its tendency to occur in clusters, multiple inoculation eschars, regional lymphadenopathy, the frequent absence of a rash or the presence of a pale vesicular eruption, and the absence of complications. Such features are uncommon in patients with Mediterranean spotted fever and those with Rocky mountain spotted fever (Table 3).21 These potentially severe diseases most often occur as single cases after a bite by a dog tick, in particular rhipicephalus species or dermacentor species, or a wood tick.29 Although clusters of cases of other tick-borne rickettsioses have been described,22 clustering appears to be characteristic of cases of African tick-bite fever.
The usual method of diagnosing rickettsiosis is a microimmunofluorescence assay of a serum sample. However, serologic cross-reactions are common among rickettsiae in the spotted-fever group. The three serologic tests that we used were highly specific for and predictive of R. africae infection in patients with direct evidence of R. africae infection and allowed us to identify 80 patients as being infected with R. africae and 1 as being infected with R. conorii. A difference in specific IgG or IgM antibody titers has been reported to be useful for distinguishing R. prowazekii from R. typhi infections.30 Such a difference was evident in 33 patients with African tick-bite fever, including 18 for whom the Western blot assay was not specific. We have previously demonstrated that the Western blot assay is positive earlier in the course of illness than is the microimmunofluorescence assay in patients with Mediterranean spotted fever.31 Antibodies against high-molecular-weight proteins were detected by Western blotting in 13 patients with a negative microimmunofluorescence assay and were the only proof of infection in these patients. The cross-adsorption assay was informative in 47 percent of the serum samples that were tested. Overall, the combination of these three serologic criteria confirmed the diagnosis in only 56 percent of the 39 with confirmed infection on the basis of a PCR assay, cell culture, or both. Therefore, some of the 284 patients for whom all serologic tests were negative may have been infected by R. africae, and the frequency of the disease may have been underestimated.
Since rickettsiae multiply at the site of inoculation, the eschar should be the preferred source of a biopsy specimen for isolation procedures or genomic detection. In our study, PCR-based methods, using ompA-derived primers,19 were very sensitive and specific for both the detection and the identification of R. africae from skin-biopsy specimens. The suicide PCR assay appeared to be very efficient, since it allowed us to confirm the diagnosis in all 15 skin-biopsy specimens and in 16 of 109 serum samples that were tested, some of which were negative on the standard PCR assay. Most patients in our series were treated with 200 mg of doxycycline per day for 7 to 15 days. Given the benign nature of African tick-bite fever, this regimen could probably be shortened to a single day, as has been proposed for the treatment of Mediterranean spotted fever.32 We found that the majority of cases of rickettsiosis among patients returning from sub-Saharan Africa are caused by R. africae and not by R. conorii.33 Therefore, physicians need to recognize that African tick-bite fever is a disease of international importance.
Source Information
From the Unité des Rickettsies, Faculté de Médecine, Université de la Méditerranée, Marseilles, France (D.R., P.E.F., F.F.); the Department of Internal Medicine, Aker University Hospital, Oslo, Norway (M.J.); the Department of Infectious Diseases, Rigshospitalet, University of Copenhagen, Copenhagen, Denmark (T.P.); the Laboratoire de Biologie, Hôpital d'Instruction des Armées Laveran, Marseille Armées, France (J.J.D.); the Divisione Malattie Infettive, Ospedale di Belluno, Belluno, Italy (G.C.); the Department of Microbiology and Infectious Diseases, John Radcliffe Hospital, Oxford, United Kingdom (N.J.); the Medical Department, Kaiser Franz Josef Hospital, Vienna, Austria (H.L.); the Division of Clinical Microbiology, Mayo Clinic, Rochester, Minn. (J.E.R.); and the Department of Medicine, University of Alberta, Edmonton, Alta., Canada (T.J.M.).
Address reprint requests to Dr. Raoult at the Unité des Rickettsies, CNRS:UPRESA 6020, Faculté de Medicine, Université de la Méditerranée, 27 Blvd. Jean Moulin, 13385 Marseilles CEDEX 05, France, or at didier. raoult@medecine.univ.mrs.fr.
- References
References
1
Troup JM ,Pijper A . Tick-bite fever in Southern Africa. Lancet 1931;2:1183-1186
CrossRef | Web of Science2
Raoult D ,Weiller PJ ,Chagnon A ,Chaudet H ,Gallais H ,Casanova P . Mediterranean spotted fever: clinical, laboratory and epidemiological features of 199 cases. Am J Trop Med Hyg 1986;35:845-850
Web of Science | Medline3
Pijper A . Étude expérimentale comparée de la fièvre boutonneuse et de la tick-bite-fever. Arch Inst Pasteur Tunis 1936;25:388-4014
Kelly PJ ,Matthewman LA ,Beati L , et al. African tick-bite fever --a new spotted fever group rickettsiosis under an old name. Lancet 1992;340:982-983
CrossRef | Web of Science | Medline5
Kelly PJ ,Beati L ,Mason PR ,Matthewman LA ,Roux V ,Raoult D . Rickettsia africae sp.nov., the etiological agent of African tick bite fever. Int J Syst Bacteriol 1996;46:611-614
CrossRef | Medline6
Brouqui P ,Harle JR ,Delmont J ,Frances C ,Weiller PJ ,Raoult D . African tick-bite fever: an imported spotless rickettsiosis. Arch Intern Med 1997;157:119-124
CrossRef | Web of Science | Medline7
Jensenius M ,Hasle G ,Henriksen AZ , et al. African tick-bite fever imported into Norway: presentation of 8 cases. Scand J Infect Dis 1999;31:131-133
CrossRef | Web of Science | Medline8
Parola P ,Jourdan J ,Raoult D . Tick-borne infection caused by Rickettsia africae in the West Indies. N Engl J Med 1998;338:1391-1391
Full Text | Web of Science | Medline9
Fournier PE ,Roux V ,Caumes E ,Donzel M ,Raoult D . Outbreak of Rickettsia africae infections in participants of an adventure race from South Africa. Clin Infect Dis 1998;27:316-323
CrossRef | Web of Science | Medline10
Fournier PE ,Beytout J ,Raoult D . Tick-transmitted infections in Transvaal: consider Rickettsia africae. Emerg Infect Dis 1999;5:178-181
CrossRef | Web of Science | Medline11
Babalis T ,Dupont HT ,Tselentis Y ,Chatzichristodoulou C ,Raoult D . Rickettsia conorii in Greece: comparison of a microimmunofluorescence assay and Western blotting for seroepidemiology. Am J Trop Med Hyg 1993;48:784-792
Web of Science | Medline12
Dupont HT ,Brouqui P ,Faugere B ,Raoult D . Prevalence of antibodies to Coxiella burnetii, Rickettsia conorii, and Rickettsia typhi in seven African countries. Clin Infect Dis 1995;21:1126-1133
CrossRef | Web of Science | Medline13
Raoult D ,Aboudharam G ,Crubezy E ,Larrouy G ,Ludes B ,Drancourt M . Molecular identification by “suicide PCR“ of Yersinia pestis as the agent of medieval Black Death. Proc Natl Acad Sci U S A 2000;97:12800-12803
CrossRef | Web of Science | Medline14
Raoult D ,Dasch GA . Line blot and Western blot immunoassays for diagnosis of Mediterranean spotted fever. J Clin Microbiol 1989;27:2073-2079
Web of Science | Medline15
Goldwasser RA ,Shepard CC . Fluorescent antibody methods in the differentiation of murine and epidemic typhus sera: specificity changes resulting from previous immunization. J Immunol 1959;82:373-380
Web of Science | Medline16
Hechemy KE ,Anacker RL ,Carlo NL ,Fox JA ,Gaafar HA . Absorption of Rickettsia rickettsii antibodies by Rickettsia rickettsii antigens in four diagnostic tests. J Clin Microbiol 1983;17:445-449
Web of Science | Medline17
Kelly PJ ,Beati L ,Matthewman LA ,Mason PR ,Dasch GA ,Raoult D . A new pathogenic spotted fever group rickettsia from Africa. J Trop Med Hyg 1994;97:129-137
Medline18
Fournier PE ,Roux V ,Raoult D . Phylogenetic analysis of spotted fever group rickettsiae by study of outer surface protein rOmpA. Int J Syst Bacteriol 1998;48:839-849
CrossRef | Medline19
Roux V ,Fournier PE ,Raoult D . Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol 1996;34:2058-2065
Web of Science | Medline20
Dean AG, Dean JA, Burton AH, Dicker RC. Epi Info, version 5: a word processing program, database, and statistics program for epidemiology on microcomputers. Atlanta: Centers for Disease Control, 1991.
21
Helmick CG ,Bernard KW ,D'Angelo LJ . Rocky Mountain spotted fever: clinical, laboratory, and epidemiological features of 262 cases. J Infect Dis 1984;150:480-488
CrossRef | Web of Science | Medline22
Rotz L ,Callejas L ,McKechine D , et al. An epidemiologic and entomologic investigation of a cluster of Rocky Mountain spotted fever cases in Delaware. Del Med J 1998;70:285-291
Medline23
Kelly PJ ,Mason PR ,Matthewman LA ,Raoult D . Seroepidemiology of spotted fever group rickettsial infections in humans in Zimbabwe. J Trop Med Hyg 1991;94:304-309
Medline24
Norval RAI . The ticks of Zimbabwe. VII. The genus Amblyomma. Zimbabwe Vet J 1983;13:3-1825
Smoak BL ,McClain JB ,Brundage JF , et al. An outbreak of spotted fever rickettsiosis in U.S. Army troops deployed to Botswana. Emerg Infect Dis 1996;2:217-221
CrossRef | Web of Science | Medline26
Pece S ,Giuliani G ,Fumarola D ,Antonaci S ,Jirillo E . Mechanisms of immunoresponsiveness against emerging intracellular bacteria. Med Sci Res 1996;24:435-43827
Ecology of non-nidicolous ticks. In: Soneshine DE. Biology of ticks. Vol. 2. New York: Oxford University Press, 1993:3-65.
28
Dupont HT ,La Scola B ,Williams R ,Raoult D . A focus of tick-borne relapsing fever in southern Zaïre. Clin Infect Dis 1997;25:139-144
CrossRef | Web of Science | Medline29
Walker D, Raoult D, Brouqui P, Marrie T. Rickettsial diseases. In: Fauci AS, Braunwald E, Isselbacher KJ, et al., eds. Harrison's principles of internal medicine. 14th ed. Vol. 1. New York: McGraw-Hill, 1998:1045-52.
30
La Scola B ,Rydkina L ,Ndihokubwayo JB ,Vene S ,Raoult D . Serological differentiation of murine typhus and epidemic typhus using cross-adsorption and Western blotting. Clin Diagn Lab Immunol 2000;7:612-616
Medline31
Teysseire N ,Raoult D . Comparison of Western immunoblotting and microimmunofluorescence for diagnosis of Mediterranean spotted fever. J Clin Microbiol 1992;30:455-460
Web of Science | Medline32
Raoult D ,Roux V . Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev 1997;10:694-719
Web of Science | Medline33
Herrero-Herrero JI ,Ruiz-Beltran R ,Walker DH . Antigens of Rickettsia conorii recognized by seropositive healthy people from Salamanca (central-west Spain). Eur J Epidemiol 1993;9:59-63
CrossRef | Web of Science | Medline
- Citing Articles (66)
Citing Articles
1
E. Botelho-Nevers, D. Raoult. (2011) Host, pathogen and treatment-related prognostic factors in rickettsioses. European Journal of Clinical Microbiology & Infectious Diseases 30:10, 1139-1150
CrossRef2
Rosanne W. Wieten, Joppe W.R. Hovius, Emilie J. Groen, Allard C. van der Wal, Peter J. de Vries, Matthijs F.C. Beersma, Ellen Tijsse-Klasen, Hein Sprong, Martin P. Grobusch. (2011) Molecular Diagnostics of Rickettsia africae Infection in Travelers Returning from South Africa to The Netherlands. Vector-Borne and Zoonotic Diseases110919133451008
CrossRef3
M. Prabhu, W. L. Nicholson, A. J. Roche, G. J. Kersh, K. A. Fitzpatrick, L. D. Oliver, R. F. Massung, A. B. Morrissey, J. A. Bartlett, J. J. Onyango, V. P. Maro, G. D. Kinabo, W. Saganda, J. A. Crump. (2011) Q Fever, Spotted Fever Group, and Typhus Group Rickettsioses Among Hospitalized Febrile Patients in Northern Tanzania. Clinical Infectious Diseases 53:4, e8-e15
CrossRef4
Marc Mendelson, Olga Perovic, Lucille Blumberg. 2011. Southern Africa. , 111-127.
CrossRef5
Andreas Neumayr, Christoph Hatz. 2011. Eastern Africa. , 64-83.
CrossRef6
Vicky Merhej, Didier Raoult. (2011) Rickettsial evolution in the light of comparative genomics. Biological Reviews 86:2, 379-405
CrossRef7
J. Shelley. (2011) Rash and eschars in a returning traveller. Clinical and Experimental Dermatology 36:2, 222-224
CrossRef8
Patrick Kelly, Helene Lucas, Lorenza Beati, Charles Yowell, Suman Mahan, John Dame. (2010) Rickettsia africae in Amblyomma variegatum and Domestic Ruminants on Eight Caribbean Islands. Journal of Parasitology 96:6, 1086-1088
CrossRef9
Fabrice Althaus, Gilbert Greub, Didier Raoult, Blaise Genton. (2010) African tick-bite fever: a new entity in the differential diagnosis of multiple eschars in travelers. Description of five cases imported from South Africa to Switzerland. International Journal of Infectious Diseases 14, e274-e276
CrossRef10
Ju Jiang, Tamasin Yarina, Melissa K. Miller, Ellen Y. Stromdahl, Allen L. Richards. (2010) Molecular Detection of Rickettsia amblyommii in Amblyomma americanum Parasitizing Humans. Vector-Borne and Zoonotic Diseases 10:4, 329-340
CrossRef11
Didier Raoult, J. Stephen Dumler. 2010. Rickettsia and Orienta. .
CrossRef12
Paul Henri Consigny, Ina Schuett, Sylvie Fraitag, Jean-Marc Rolain, Pierre Buffet. (2009) Unusual Location of an Inoculation Lesion in a Traveler with African Tick-Bite Fever Returning from South Africa. Journal of Travel Medicine 16:6, 439-440
CrossRef13
Bettina Berger-Schreck. (2009) Zeckenbissfieber durch Rickettsien: klinische und labordiagnostische Aspekte / Rickettsial tick-bite fever: clinical aspects and laboratory diagnosis. LaboratoriumsMedizin 33:4, 194-201
CrossRef14
Victoria Johnston, Jane M. Stockley, David Dockrell, David Warrell, Robin Bailey, Geoffrey Pasvol, John Klein, Andrew Ustianowski, Michael Jones, Nicholas J. Beeching, Michael Brown, Ann L.N. Chapman, Frances Sanderson, Christopher J.M. Whitty. (2009) Fever in returned travellers presenting in the United Kingdom: Recommendations for investigation and initial management. Journal of Infection 59:1, 1-18
CrossRef15
Bettina Berger-Schreck. (2009) Rickettsial tick bite fever: clinical aspects and laboratory diagnosis 1. LaboratoriumsMedizin 33:4, ---
CrossRef16
Ali N. Dana. (2009) Diagnosis and treatment of tick infestation and tick-borne diseases with cutaneous manifestations. Dermatologic Therapy 22:4, 293-326
CrossRef17
Jennilee B. Robinson, Marina E. Eremeeva, Patrick E. Olson, Scott A. Thornton, Michael J. Medina, John W. Sumner, Gregory A. Dasch. (2009) New Approaches to Detection and Identification of Rickettsia africae and Ehrlichia ruminantium in Amblyomma variegatum (Acari: Ixodidae) Ticks From the Caribbean. Journal of Medical Entomology 46:4, 942-951
CrossRef18
Frédéric Méchaï, Yue Han, Bertrand Gachot, Paul-Henri Consigny, Jean Paul Viard, Marc Lecuit, Olivier Lortholary. (2009) Pristinamycin for Rickettsia africae Infection. Journal of Travel Medicine 16:2, 136-137
CrossRef19
Nadjet Mouffok, Philippe Parola, Hubert Lepidi, Didier Raoult. (2009) Mediterranean spotted fever in Algeria — new trends. International Journal of Infectious Diseases 13:2, 227-235
CrossRef20
Edward F. Hendershot, Daniel J. Sexton. (2009) Scrub typhus and rickettsial diseases in international travelers: A review. Current Infectious Disease Reports 11:1, 66-72
CrossRef21
Philippe Parola, Marcelo B. Labruna, Didier Raoult. (2009) Tick-borne rickettsioses in America: Unanswered questions and emerging diseases. Current Infectious Disease Reports 11:1, 40-50
CrossRef22
Cécile Cazorla, Cristina Socolovschi, Mogens Jensenius, Philippe Parola. (2008) Tick-borne Diseases: Tick-borne Spotted Fever Rickettsioses in Africa. Infectious Disease Clinics of North America 22:3, 531-544
CrossRef23
Nathalie Roch, Olivier Epaulard, Isabelle Pelloux, Patricia Pavese, Jean‐Paul Brion, Didier Raoult, Max Maurin. (2008) African Tick Bite Fever in Elderly Patients: 8 Cases in French Tourists Returning from South Africa. Clinical Infectious Diseases 47:3, e28-e35
CrossRef24
Jan Schuster, Iliana Tantcheva-Poor, Claudia Wickenhauser, Jens-Marcus Chemnitz, Nicolas Hunzelmann, Thomas Krieg, Karin Hartmann. (2008) African tick bite fever – Papulovesicular exanthem with fever after staying in South Africa. JDDG 6:5, 379-381
CrossRef25
David H. Walker, Nahed Ismail. (2008) Emerging and re-emerging rickettsioses: endothelial cell infection and early disease events. Nature Reviews Microbiology 6:5, 375-386
CrossRef26
Cristian Speil, Adnan Mushtaq, Alys Adamski, Nancy Khardori. (2007) Fever of Unknown Origin in the Returning Traveler. Infectious Disease Clinics of North America 21:4, 1091-1113
CrossRef27
Elisabeth Botelho-Nevers, Didier Raoult. (2007) Fever of Unknown Origin Due to Rickettsioses. Infectious Disease Clinics of North America 21:4, 997-1011
CrossRef28
Pierre-Edouard Fournier, Michel Drancourt, Didier Raoult. (2007) Bacterial genome sequencing and its use in infectious diseases. The Lancet Infectious Diseases 7:11, 711-723
CrossRef29
Florence Fenollar, Didier Raoult. (2007) Molecular diagnosis of bloodstream infections caused by non-cultivable bacteria. International Journal of Antimicrobial Agents 30, 7-15
CrossRef30
D. H. Walker. (2007) Rickettsiae and Rickettsial Infections: The Current State of Knowledge. Clinical Infectious Diseases 45:Supplement 1, S39-S44
CrossRef31
M. E. Wilson, L. H. Weld, A. Boggild, J. S. Keystone, K. C. Kain, F. von Sonnenburg, E. Schwartz, . (2007) Fever in Returned Travelers: Results from the GeoSentinel Surveillance Network. Clinical Infectious Diseases 44:12, 1560-1568
CrossRef32
Avi Keysary, Israel Potasman, Avi Itzhaki, Renato Finkelstein, Shmuel Yitzhaki, Carmela Strenger, Sabine Rzotkiewicz, Moshe Leitner. (2007) Clusters of Mediterranean Spotted Fever in Israel. Vector-Borne and Zoonotic Diseases 7:2, 143-146
CrossRef33
Mogens Jensenius, Lucy Ndip, Bjørn Myrvang. 2007. African Tick-Bite Fever. , 117-124.
CrossRef34
Florence Fenollar, Pierre-Edouard Fournier, Didier Raoult. 2007. Diagnostic Strategy of Rickettsioses and Ehrlichioses. , 315-330.
CrossRef35
Patrick J. Kelly. (2006) Rickettsia africae in the West Indies. Emerging Infectious Diseases 12:2, 224-226
CrossRef36
Freedman, David O., Weld, Leisa H., Kozarsky, Phyllis E., Fisk, Tamara, Robins, Rachel, von Sonnenburg, Frank, Keystone, Jay S., Pandey, Prativa, Cetron, Martin S., . (2006) Spectrum of Disease and Relation to Place of Exposure among Ill Returned Travelers. New England Journal of Medicine 354:2, 119-130
Full Text37
Mogens Jensenius, Pierre-Edouard Fournier, Tormod Fladby, Kjell Block Hellum, Tormod Hagen, Tine Priø, Merete Skovdal Christiansen, Sirkka Vene, Didier Raoult, Bjørn Myrvang. (2006) Sub-acute neuropathy in patients with African tick bite fever. Scandinavian Journal of Infectious Diseases 38:2, 114-118
CrossRef38
Jose-Luis Pérez-Arellano, Florence Fenollar, Alfonso Angel-Moreno, Margarita Bolaños, Michele Hernández, Evora Santana, Marion Hemmersbach-Miller, Antonio-M Martín, Didier Raoult. (2005) Human Rickettsia felis Infection, Canary Islands, Spain. Emerging Infectious Diseases 11:12, 1961-1964
CrossRef39
Paul H. Consigny, Jean-Marc Rolain, Daniel Mizzi, Didier Raoult. (2005) African Tick-bite Fever in French Travelers. Emerging Infectious Diseases 11:11, 1804-1806
CrossRef40
Mogens Jensenius, Anne-Marié Pretorius, Francoise Clarke, Bjørn Myrvang. (2005) Repellent efficacy of four commercial DEET lotions against Amblyomma hebraeum (Acari: Ixodidae), the principal vector of Rickettsia africae in southern Africa. Transactions of the Royal Society of Tropical Medicine and Hygiene 99:9, 708-711
CrossRef41
Raoult, Didier, , Paddock, Christopher D., . (2005) Rickettsia parkeri Infection and Other Spotted Fevers in the United States. New England Journal of Medicine 353:6, 626-627
Full Text42
P.-E. Fournier, F. Gouriet, P. Brouqui, F. Lucht, D. Raoult. (2005) Lymphangitis-Associated Rickettsiosis, a New Rickettsiosis Caused by Rickettsia sibirica mongolotimonae: Seven New Cases and Review of the Literature. Clinical Infectious Diseases 40:10, 1435-1444
CrossRef43
J. M. Rolain, F. Gouriet, P. Brouqui, D. Larrey, F. Janbon, S. Vene, V. Jarnestrom, D. Raoult. (2005) Concomitant or Consecutive Infection with Coxiella burnetii and Tickborne Diseases. Clinical Infectious Diseases 40:1, 82-88
CrossRef44
FLORENCE FENOLLAR, DIDIER RAOULT. (2004) Molecular genetic methods for the diagnosis of fastidious microorganisms. APMIS 112:11-12, 785-807
CrossRef45
P. Brouqui, F. Bacellar, G. Baranton, R. J. Birtles, A. Bjoersdorff, J. R. Blanco, G. Caruso, M. Cinco, P. E. Fournier, E. Francavilla, M. Jensenius, J. Kazar, H. Laferl, A. Lakos, S. Lotric Furlan, M. Maurin, J. A. Oteo, P. Parola, C. Perez-Eid, O. Peter, D. Postic, D. Raoult, A. Tellez, Y. Tselentis, B. Wilske. (2004) Guidelines for the diagnosis of tick-borne bacterial diseases in Europe. Clinical Microbiology and Infection 10:12, 1108-1132
CrossRef46
C. Strub, M. Weisser, S. Bassetti. (2004) Tropenr
ckkehrerin mit papulovesikul
CrossRef47
C. D. Ericsson, M. Jensenius, P.-E. Fournier, D. Raoult. (2004) Rickettsioses and the International Traveler. Clinical Infectious Diseases 39:10, 1493-1499
CrossRef48
Jean-Marc Rolain, Mogens Jensenius, Didier Raoult. (2004) Rickettsial infections - a threat to travellers?. Current Opinion in Infectious Diseases 17:5, 433-437
CrossRef49
N. M. Delfos, E. F. Schippers, D. Raoult, L. G. Visser. (2004) Fever and Vesicular Rash in a Traveler Returning from South Africa. Clinical Infectious Diseases 39:5, 741-742
CrossRef50
Philippe Parola. (2004) Tick-borne rickettsial diseases: emerging risks in Europe. Comparative Immunology, Microbiology and Infectious Diseases 27:5, 297-304
CrossRef51
Yves Jackson, François Chappuis, Louis Loutan. (2004) African Tick-bite Fever: Four Cases Among Swiss Travelers Returning from South Africa. Journal of Travel Medicine 11:4, 225-230
CrossRef52
Mogens Jensenius, Pierre-Edouard Fournier, Didier Raoult. (2004) Tick-borne rickettsioses in international travellers. International Journal of Infectious Diseases 8:3, 139-146
CrossRef53
Pierre Abgueguen, Jean Marie Chennebault, Eric Pichard. (2004) A Traveler Returning from South Africa with Rash and Genital Ulceration. Clinical Infectious Diseases 38:6, 908-909
CrossRef54
Didier Raoult. (2004) Editorial Commentary: A New Rickettsial Disease in the United States. Clinical Infectious Diseases 38:6, 812-813
CrossRef55
Mary E. Wilson, Lin H. Chen. (2004) Dermatologic infectious diseases in international travelers. Current Infectious Disease Reports 6:1, 54-62
CrossRef56
Jean-Marc Rolain, Stanislas Shpynov, Didier Raoult. (2003) Spotted-fever-group rickettsioses in north Asia. The Lancet 362:9399, 1939
CrossRef57
George Watt, Philippe Parola. (2003) Scrub typhus and tropical rickettsioses. Current Opinion in Infectious Diseases 16:5, 429-436
CrossRef58
Mogens Jensenius, Pierre-Edouard Fournier, Patrick Kelly, Bjørn Myrvang, Didier Raoult. (2003) African tick bite fever. The Lancet Infectious Diseases 3:9, 557-564
CrossRef59
Hui-min Feng, David H. Walker. (2003) Cross-protection between distantly related spotted fever group rickettsiae. Vaccine 21:25-26, 3901-3905
CrossRef60
M. Jensenius, P.-E. Fournier, K. B. Hellum, L. Wesslen, G. Caruso, T. Prio, K. Lohne, S. Vene, D. Raoult, B. Myrvang. (2003) Sequential changes in hematologic and biochemical parameters in African tick bite fever. Clinical Microbiology and Infection 9:7, 678-683
CrossRef61
Valérie D'Acremont, Bernard Burnand, Ann-Emmanuelle Ambresin, Blaise Genton. (2003) Practice Guidelines for Evaluation of Fever in Returning Travelers and Migrants. Journal of Travel Medicine 10, S25-S45
CrossRef62
M. Jensenius, P.-E. Fournier, S. Vene, T. Hoel, G. Hasle, A. Z. Henriksen, K. B. Hellum, D. Raoult, B. Myrvang, . (2003) African Tick Bite Fever in Travelers to Rural Sub-Equatorial Africa. Clinical Infectious Diseases 36:11, 1411-1417
CrossRef63
Anne-Marié Pretorius, Mogens Jensenius, Francoise Clarke, Signe Holta Ringertz. (2003) Repellent Efficacy of DEET and KBR 3023 Against Amblyomma hebraeum (Acari: Ixodidae). Journal of Medical Entomology 40:2, 245-248
CrossRef64
L. G. Visser. (2003) Koorts na een tropische reis. Bijblijven 19:1, 19-26
CrossRef65
Ryan, Edward T., Wilson, Mary E., Kain, Kevin C., . (2002) Illness after International Travel. New England Journal of Medicine 347:7, 505-516
Full Text66
M. J. Burridge, L. A. Simmons, B. H. Simbi, S. M. Mahan, P-E. Fournier, D. Raoult. (2002) Introduction of the Exotic Tick Amblyomma hebraeum into Florida on a Human Host. Journal of Parasitology 88:4, 800-801
CrossRef
