Original Article
Brief Report
Acromegaly Caused by Secretion of Growth Hormone by a Non-Hodgkin's Lymphoma
N Engl J Med 2000; 342:1871-1876June 22, 2000
- Article
Acromegaly is a systemic disorder caused by sustained hypersecretion of growth hormone. The typical features include thickening of the skin, enlargement of the hands, feet, and mandible, and visceromegaly.1,2 Active disease is indicated by the presence of excessive sweating and soft-tissue swelling.1,2 Most patients with acromegaly have a growth hormone–secreting pituitary adenoma,3 but a few (less than 1 percent) have hypothalamic or other tumors that secrete growth hormone–releasing hormone.4 Isolated ectopic secretion of growth hormone has been reported only once, in a patient with a pancreatic islet-cell tumor.5,6 Here we describe a patient with recurrent non-Hodgkin's lymphoma and acromegaly caused by ectopic production of growth hormone by the lymphoma.
Case Report
In October 1994, a 57-year-old woman was referred to another hospital for evaluation of malignant lymphoma. She had a six-month history of excessive sweating, bone pain, swelling and stiffness of the hands, and weight loss of 7 kg, followed by a weight gain of 5 kg. In July 1994, she underwent bilateral decompression of the median nerve because of carpal tunnel syndrome. Abdominal lymphadenopathy was detected by ultrasonography and verified by abdominal computed tomography, which suggested the presence of a malignant lymphoma; a lymph-node biopsy revealed follicular non-Hodgkin's lymphoma grade 1 (according to the classification system of the World Health Organization7). Although her symptoms suggested that the patient had an excess of growth hormone secretion, the presence of acromegaly was not recognized at that time.
The patient was treated with four cycles of cyclophosphamide, vincristine, doxorubicin, etoposide, and prednisolone. The lymphoma responded well to treatment, and the symptoms and signs of active acromegaly resolved. The patient was well until the end of 1997, when excessive sweating and swelling and stiffness of her hands and feet gradually reappeared (Figure 1AFigure 1
Photographs and Computed Tomographic and Magnetic Resonance Images of a Patient with Acromegaly and Lymphoma.). She also noticed enlargement of her nose, lips, and jaw (Figure 1B). She was hospitalized at our institution in July 1998 and evaluated for growth hormone excess.The physical examination was normal except for the features of acromegaly and axillary and inguinal lymphadenopathy. Serum growth hormone concentrations were high (Table 1Table 1
Serum and Cell-Culture Concentrations of Hormones in a Patient with Acromegaly and Lymphoma.), with little diurnal variation, as were serum concentrations of insulin-like growth factor I (IGF-I) and insulin-like growth factor–binding protein 3 (IGFBP-3). Plasma growth hormone–releasing hormone (GHRH) concentrations were below the limit of detection. Growth hormone secretion did not change after the oral administration of 75 g of glucose, the subcutaneous administration of 100 μg of octreotide (Sandostatin, Novartis Pharma, Nuremberg, Germany), or the intravenous administration of 200 μg of thyrotropin-releasing hormone (Relefact TRH, Hoechst Marion Roussel, Bad Soden, Germany) and 1 μg of GHRH per kilogram of body weight (Ferring, Kiel, Germany).The results of magnetic resonance imaging of the pituitary gland were normal (Figure 1C), and jugular venous sampling did not reveal a pituitary-to-peripheral gradient in the serum growth hormone concentration. Abdominal computed tomography revealed enlargement of the liver, spleen, and multiple lymph nodes in the para-aortic region compressing the vena cava (Figure 1D). Inguinal lymph-node biopsy revealed follicular non-Hodgkin's lymphoma with characteristic expression of the B-cell markers CD20 and CD79a. Indium-111 pentetreotide scintigraphy revealed no uptake in the pituitary or in the lymphoma tissue.
After one cycle of cyclophosphamide, vincristine, and prednisone, clinical and biochemical signs of acromegaly persisted, and the lymphoma was unchanged in size. The patient was therefore treated with fludarabine, mitoxantrone, and dexamethasone, which resulted in rapid clinical improvement and a rapid decrease in the serum concentration of growth hormone and IGF-I (Figure 2Figure 2
Serum Concentrations of Growth Hormone (GH) and Insulin-like Growth Factor I (IGF-I) during Treatment in a Patient with Acromegaly and Lymphoma.). The patient has since remained in remission.Methods
Assays
Serum growth hormone was measured by a commercial radioimmunoassay (Sorin Biomedica, Düsseldorf, Germany). To determine whether the tumor secreted the pituitary or placental growth hormone isoforms,9 both serum and cell-culture supernatants were analyzed in an immunofunctional assay,10 which recognizes pituitary and placental growth hormone equally well, and by a sandwich immunoassay specific for pituitary growth hormone.11 Serum IGF-I (Mediagnost, Tübingen, Germany) and GHRH12 were measured by radioimmunoassay, and IGFBP-3 by enzyme-linked immunosorbent assay (Diagnostic Systems Laboratories, Webster, Tex.).
Tissue and Cell Studies
Portions of the inguinal lymph node were subjected to primary cell culture or immediately frozen and stored at –80°C. Frozen sections of growth hormone–producing pituitary adenoma, normal liver, and normal lymph node from patients without acromegaly served as controls. The use of tissue samples for research was approved by the ethics committee of the University of Freiburg, and the patient gave written informed consent for the studies.
Reverse-Transcriptase Polymerase Chain Reaction
Total RNA was extracted with use of RNeasy Mini Kit (Qiagen, Hilden, Germany). The reverse-transcriptase polymerase chain reaction was performed according to the manufacturer's instructions (Perkin–Elmer Cetus), with 35 cycles of amplification (each consisting of 1 minute at 95°C, 1 minute at 55°C, and 1 minute at 72°C), followed by a final extension cycle of 10 minutes at 72°C. The primer sequences for pituitary growth hormone were 5'GTGCAGTTCCTCAGGAGTGTCT3' and 5'GAGTAGTGCGTCATCGTTGTGT3'. The primers for the growth hormone receptor13 and GHRH14 have been reported previously. To characterize the growth hormone receptor amplification product, we hybridized it with a full-length [32P]-α-cytosine triphosphate–labeled insert of pcDNA1 growth hormone–receptor plasmid, as described elsewhere.15 An ovarian-cancer cell line expressing GHRH messenger RNA (mRNA) served as a positive control for the amplification of GHRH.14
Immunofluorescence Microscopy
Ten-micrometer cryostat sections were fixed in cold acetone and dried overnight. After incubation with methanol–hydrogen peroxide (0.6 percent) to inhibit endogenous peroxidase activity, the sections were washed in 0.05 M TRIS–hydrochloric acid and 0.15 M sodium chloride at a pH of 7.6 and incubated at 4°C overnight with a rabbit polyclonal antibody against growth hormone (Dako Diagnostika, Hamburg, Germany) at a concentration of 30 μg per milliliter in phosphate-buffered saline containing 3 percent bovine serum albumin. Bound primary antibody was visualized with a fluorescein isothiocyanate–conjugated sheep F(ab')2 fragment directed against rabbit IgG (Boehringer, Mannheim, Germany).
Cell-Culture Experiments
Lymphoma tissue was placed in RPMI 1640 medium containing 10 percent fetal-calf serum, 2 percent l-glutamine, gentamicin (50 μg per milliliter), amphotericin B (1 μg per milliliter), and interleukin-4 (10 ng per milliliter); the tissue was mechanically dispersed until a suspension of single cells was obtained. The cells were grown in serum-free RPMI 1640 medium in six-well plates at a density of about 100,000 cells per well. The medium was changed every 12 hours, and the supernatant was stored at –20°C for measurement of growth hormone, IGF-I, and GHRH. As controls, peripheral-blood lymphocytes obtained from a normal subject after separation on a Ficoll–Hypaque gradient and cells from two patients with low-grade non-Hodgkin's lymphomas were grown under identical conditions, and the culture medium was subjected to hormone analysis.
Results
Expression of mRNA in Lymphoma Tissue
We detected mRNA encoding growth hormone and growth hormone receptors in the patient's lymphoma tissue (Figure 3Figure 3
Results of Molecular and Imaging Studies., top), whereas GHRH mRNA was undetectable.Immunofluorescence Microscopy
The patient's lymphoma tissue showed strong immunoreactivity to growth hormone; the immunoreactivity was similar to that of tissue from a growth hormone–secreting pituitary adenoma from another patient with acromegaly (Figure 3, bottom). Nearly all the patient's tumor cells stained for growth hormone. At the cellular level, the immunoreactivity in the patient's lymphoma was restricted to the cytoplasmic compartment.
In Vitro Secretion of Growth Hormone
The cultured lymphoma cells from the patient secreted large amounts of growth hormone into the medium (Table 1). By comparison, no growth hormone was detected in the medium from the cultures of peripheral-blood lymphocytes from the normal subject or the two other lymphomas. The patient's lymphoma secreted only pituitary growth hormone and no placental growth hormone. GHRH was not detected in any sample of culture medium.
Discussion
Ectopic secretion of growth hormone has been suggested by the in vitro detection of immunoreactive growth hormone in some endocrine and nonendocrine tumors.16-22 However, most reported cases have not met the criteria for the diagnosis of ectopic growth hormone secretion5: marked arteriovenous gradients of serum growth hormone concentrations across the ectopic source, cure of acromegaly after the removal of the tumor, and evidence of the expression of growth hormone gene by tumor tissue. We evaluated a patient with acromegaly due to the secretion of growth hormone by a non-Hodgkin's lymphoma. That the patient's lymphoma produced and secreted growth hormone was demonstrated by the decrease in serum growth hormone concentrations during chemotherapy, the presence of growth hormone mRNA and growth hormone immunoreactivity in tumor cells, and the secretion of growth hormone by tumor cells in vitro. GHRH mRNA or protein was not detected. Magnetic resonance imaging of the pituitary did not reveal somatotroph hyperplasia, a feature of ectopic GHRH secretion, and selective venous sampling did not reveal a pituitary-to-peripheral gradient in serum growth hormone concentrations.
Ectopic hormone secretion is a typical feature of neuroendocrine tumors and many others. Although we are not aware of other cases in which there was ectopic growth hormone secretion from the lymphatic system, a growing body of evidence suggests that growth hormone is a paracrine growth factor within the immune system.23 The hormone has immunomodulatory properties, is required for development and function of the immune system,24-26 and has a profound influence on both cellular and humoral immunity.22 For example, the secretion of thymulin, a hormone produced by thymic epithelial cells, is up-regulated by growth hormone.27 In aging rats, the administration of growth hormone increased the total number of thymocytes.28,29 Normal lymphocytes have receptors for growth hormone,30,31 and both rodent and human mononuclear cells synthesize and secrete growth hormone–like molecules.32-35 Growth hormone mRNA has been detected in normal lymphoid tissues and in B-cell and T-cell lymphomas.36 These findings support the concept of an autocrine or paracrine effect of growth hormone produced by the lymphoma cells on tumor proliferation. In this context, so-called ectopic growth hormone production by the lymphoma is not genuinely ectopic but, rather, a modification of normal cell function.37
The mechanisms by which growth hormone gene expression was up-regulated in the patient's lymphoma are not known. Amplification of the growth hormone gene locus or chromosomal translocation causing gene rearrangement or mutations in the growth hormone promoter could have contributed to the hypersecretion of growth hormone by the lymphoma. The majority of malignant lymphomas express somatostatin receptors and can be visualized by pentetreotide scintigraphy.38,39 In our patient, the pentetreotide scan was negative, despite the extensive lymphoma. In addition, the patient's serum growth hormone concentrations did not decrease after the administration of octreotide. The absence of the expression of somatostatin receptors may have contributed to growth hormone excess because of the lack of inhibitory effects of endogenous somatostatin.
Supported by grants (to Dr. Reincke) from the Zentrum für Klinische Forschung 1, University of Freiburg, and the Deutsche Forschungsgemeinschaft (Re 752/11-1).
We are indebted to Professor F. Hirsch of the Klinikum Offenburg and Dr. H. Jäger, Appenweier, Germany, for providing the follow-up data; to Dr. R.J. Ross of the Department of Medicine, Sheffield University, United Kingdom, for providing the pcDNA1 growth hormone–receptor plasmid; to Mrs. P. Mora and Dr. A. Klink for excellent technical assistance; to Professor A. Lindemann and Dr. A. Mackensen for providing the non-Hodgkin's lymphomas for use as controls and for their assistance with the cell-culture experiments; and to Professor B. Allolio for helpful discussions.
Source Information
From the Department of Medicine II, Klinikum der Albert-Ludwigs-Universität Freiburg, Freiburg (F.B., V.S., D.M., H.E.B., M.R.); the Medical Department, Klinikum Innenstadt der Ludwig-Maximilians-Universität, Munich (C.J.S., M.B.); and the German Cancer Research Center, Heidelberg (P.L.) — all in Germany.
Address reprint requests to Dr. Reincke at Abteilung Innere Medizin II, Klinikum der Albert-Ludwigs-Universität Freiburg, Hugstetter Strasse 55, D-79106 Freiburg, Germany, or at reincke@med1.ukl.uni-freiburg.de.
- References
References
1
Ezzat S ,Forster MJ ,Berchtold P ,Redelmeier DA ,Boerlin V ,Harris AG . Acromegaly: clinical and biochemical features in 500 patients. Medicine (Baltimore) 1994;73:233-240
Web of Science | Medline2
Molitch ME . Clinical manifestations of acromegaly. Endocrinol Metab Clin North Am 1992;21:597-614
Web of Science | Medline3
Melmed S ,Ho K ,Klibanski A ,Reichlin S ,Thorner M . Recent advances in pathogenesis, diagnosis, and management of acromegaly. J Clin Endocrinol Metab 1995;80:3395-3402
CrossRef | Web of Science | Medline4
Sano T ,Asa SL ,Kovacs K . Growth hormone-releasing hormone-producing tumors: clinical, biochemical, and morphological manifestations. Endocr Rev 1988;9:357-373
CrossRef | Web of Science | Medline5
Melmed S ,Ezrin C ,Kovacs K ,Goodman RS ,Frohman LA . Acromegaly due to secretion of growth hormone by an ectopic pancreatic islet-cell tumor. N Engl J Med 1995;312:9-17
Full Text | Web of Science6
Ezzat S ,Ezrin C ,Yamashita S ,Melmed S . Recurrent acromegaly resulting from ectopic growth hormone gene expression by a metastatic pancreatic tumor. Cancer 1993;71:66-70
CrossRef | Web of Science | Medline7
Harris NL ,Jaffe ES ,Diebold J , et al. World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting -- Airlie House, Virginia, November 1997. J Clin Oncol 1999;17:3835-3849
Web of Science | Medline8
Wilson JD, Foster DW, Kronenberg HM, Larsen PR, eds. Williams textbook of endocrinology. 9th ed. Philadelphia: W.B. Saunders, 1998:300.
9
Baumann G . Growth hormone heterogeneity: genes, isohormones, variants, and binding proteins. Endocr Rev 1991;12:424-449
CrossRef | Web of Science | Medline10
Strasburger CJ ,Wu Z ,Pflaum CD ,Dressendorfer RA . Immunofunctional assay of human growth hormone (hGH) in serum: a possible consensus for quantitative hGH measurement. J Clin Endocrinol Metab 1996;81:2613-2620
CrossRef | Web of Science | Medline11
Wu Z ,Kirk SE ,Strasburger CJ . Quantitative measurement of human placental growth hormone (GH-V) by the immunofunctional HGH assay and a pituitary (GH-N)-specific sandwich immunoassay. Endocr Soc 1998;80:291-291 abstract.12
Losa M ,Wolfram G ,Mojto J , et al. Presence of growth hormone-releasing hormone-like immunoreactivity in human tumors: characterization of immunological and biological properties. J Clin Endocrinol Metab 1990;70:62-68
CrossRef | Web of Science | Medline13
Shen XY ,Holt RI ,Miell JP , et al. Cirrhotic liver expresses low levels of the full-length and truncated growth hormone receptors. J Clin Endocrinol Metab 1998;83:2532-2538
CrossRef | Web of Science | Medline14
Kahan Z ,Arencibia JM ,Csernus VJ , et al. Expression of growth hormone-releasing hormone (GHRH) messenger ribonucleic acid and the presence of biologically active GHRH in human breast, endometrial, and ovarian cancers. J Clin Endocrinol Metab 1999;84:582-589
CrossRef | Web of Science | Medline15
Ross RJ ,Esposito N ,Shen XY , et al. A short isoform of the human growth hormone receptor functions as a dominant negative inhibitor of the full-length receptor and generates large amounts of binding protein. Mol Endocrinol 1997;11:265-273
CrossRef | Web of Science | Medline16
Cameron DP ,Burger HG ,DeKretzer DM ,Catt KJ ,Best JB . On the presence of immunoreactive growth hormone in a bronchogenic carcinoma. Australas Ann Med 1969;18:143-146
Medline17
Sparagana M ,Phillips G ,Hoffman C ,Kucera L . Ectopic growth hormone syndrome associated with lung cancer. Metabolism 1971;20:730-736
CrossRef | Web of Science | Medline18
Greenberg PB ,Martin TJ ,Beck C ,Burger HG . Synthesis and release of human growth hormone from lung carcinoma in cell culture. Lancet 1972;1:350-352
CrossRef | Web of Science | Medline19
Kaganowicz A ,Farkouh NH ,Frantz AG ,Blaustein AU . Ectopic human growth hormone in ovaries and breast cancer. J Clin Endocrinol Metab 1979;48:5-8
CrossRef | Web of Science | Medline20
Dabek FT . Bronchial carcinoid tumour with acromegaly in two patients. J Clin Endocrinol Metab 1974;38:329-333
CrossRef | Web of Science | Medline21
Leveston SA ,McKeel DW Jr ,Buckley PJ , et al. Acromegaly and Cushing's syndrome associated with a foregut carcinoid tumor. J Clin Endocrinol Metab 1981;53:682-689
CrossRef | Web of Science | Medline22
Kayano K ,Takeo M ,Morisue S ,Yamamoto M ,Mizuno Y ,Meguro F . A case of human growth hormone (h-GH)-producing adenocarcinoma of the lung. Nippon Kyobu Geka Gakkai Zasshi 1995;43:538-542
Medline23
Clark R . The somatogenic hormones and insulin-like growth factor-1: stimulators of lymphopoiesis and immune function. Endocr Rev 1997;18:157-179
CrossRef | Web of Science | Medline24
Auernhammer CJ ,Strasburger CJ . Effects of growth hormone and insulin-like growth factor I on the immune system. Eur J Endocrinol 1995;133:635-645
CrossRef | Web of Science | Medline25
LeRoith D ,Yanowski J ,Kaldjian EP , et al. The effects of growth hormone and insulin-like growth factor I on the immune system of aged female monkeys. Endocrinology 1996;137:1071-1079
CrossRef | Web of Science | Medline26
Harvey S ,Hull KL . Growth hormone: a paracrine growth factor? Endocrine 1997;7:267-279
CrossRef | Web of Science | Medline27
Timsit J ,Savino W ,Safieh B , et al. Growth hormone and insulin-like growth factor-I stimulate hormonal function and proliferation of thymic epithelial cells. J Clin Endocrinol Metab 1992;75:183-188
CrossRef | Web of Science | Medline28
Kelley KW ,Brief S ,Westly HJ , et al. GH3 pituitary adenoma cells can reverse thymic aging in rats. Proc Natl Acad Sci U S A 1986;83:5663-5667
CrossRef | Web of Science | Medline29
Li YM ,Brunke DL ,Dantzer R ,Kelley KW . Pituitary epithelial cell implants reverse the accumulation of CD4-CD8- lymphocytes in thymus glands of aged rats. Endocrinology 1992;130:2703-2709
CrossRef | Web of Science | Medline30
Leung DW ,Spencer SA ,Cachianes G , et al. Growth hormone receptor and serum binding protein: purification, cloning, and expression. Nature 1987;330:537-543
CrossRef | Web of Science | Medline31
Kiess W ,Butenandt O . Specific growth hormone receptors on human peripheral mononuclear cells: reexpression, identification, and characterization. J Clin Endocrinol Metab 1985;60:740-746
CrossRef | Web of Science | Medline32
Weigent DA ,Riley JE ,Galin FS ,LeBoeuf RD ,Blalock JE . Detection of growth hormone and growth hormone-releasing hormone-related messenger RNA in rat leukocytes by the polymerase chain reaction. Proc Soc Exp Biol Med 1991;198:643-648
Web of Science | Medline33
Hattori N ,Ikekubo K ,Ishihara T ,Moridera K ,Hino M ,Kurahachi H . Spontaneous growth hormone (GH) secretion by unstimulated human lymphocytes and effects of GH-releasing hormone and somatostatin. J Clin Endocrinol Metab 1994;79:1678-1680
CrossRef | Web of Science | Medline34
Varma S ,Sabharwal P ,Sheridan JF ,Malarkey WB . Growth hormone secretion by human peripheral blood mononuclear cells detected by an enzyme-linked immunoplaque assay. J Clin Endocrinol Metab 1993;76:49-53
CrossRef | Web of Science | Medline35
Weigent DA ,Baxter JB ,Wear WE ,Smith LR ,Bost KL ,Blalock JE . Production of immunoreactive growth hormone by mononuclear leukocytes. FASEB J 1988;2:2812-2818
Web of Science | Medline36
Wu H ,Devi R ,Malarkey WB . Localization of growth hormone messenger ribonucleic acid in the human immune system -- a Clinical Research Center study. J Clin Endocrinol Metab 1996;81:1278-1282
CrossRef | Web of Science | Medline37
Odell WD . Endocrine/metabolic syndromes of cancer. Semin Oncol 1997;24:299-317
Web of Science | Medline38
Krenning EP ,Kwekkeboom DJ ,Reubi JC , et al. 111In-octreotide scintigraphy in oncology. Metabolism 1992;41:Suppl 2:83-86
CrossRef | Web of Science | Medline39
Lipp RW ,Silly H ,Ranner G , et al. Radiolabeled octreotide for the demonstration of somatostatin receptors in malignant lymphoma and lymphadenopathy. J Nucl Med 1995;36:13-18
Web of Science | Medline
- Citing Articles (11)
Citing Articles
1
Julia Goulart Appel, Marvin Bergsneider, Harry Vinters, Noriko Salamon, Marilene B. Wang, Anthony P. Heaney. (2011) Acromegaly due to an ectopic pituitary adenoma in the clivus: case report and review of literature. Pituitary
CrossRef2
Jose Hernan Martinez, Mariel Davila Martinez, Marcos Mercado de Gorgola, Luis F. Montalvo, Jaime E. Tome. (2011) The Coexistence of an Intrasellar Adenoma, Lymphocytic Hypophysitis, and Primary Pituitary Lymphoma in a Patient with Acromegaly. Case Reports in Endocrinology 2011, 1-6
CrossRef3
Shlomo Melmed. 2011. Acromegaly. , 433-474.
CrossRef4
Glenn D. Braunstein. 2011. The Hypothalamus. , 303-341.
CrossRef5
Kristin D. Helm, Ralf M. Nass, William S. Evans. 2009. Physiologic and Pathophysiologic Alterations of the Neuroendocrine Components of the Reproductive Axis. , 441-488.
CrossRef6
L. Vieira Neto, G. F. Taboada, L. L. Corrêa, J. Polo, A. F. Nascimento, L. Chimelli, K. Rumilla, M. R. Gadelha. (2007) Acromegaly Secondary to Growth Hormone-releasing Hormone Secreted by an Incidentally Discovered Pheochromocytoma. Endocrine Pathology 18:1, 46-52
CrossRef7
Melmed, Shlomo, . (2006) Acromegaly. New England Journal of Medicine 355:24, 2558-2573
Full Text8
Sébastien Jeay, Gail E. Sonenshein, Marie-Catherine Postel-Vinay, Paul A. Kelly, Elena Baixeras. (2002) Growth hormone can act as a cytokine controlling survival and proliferation of immune cells: new insights into signaling pathways. Molecular and Cellular Endocrinology 188:1-2, 1-7
CrossRef9
Fernando Cordido, Angela Penalva, Teresa Martinez, Felipe F. Casanueva, Carlos Dieguez. (2001) Effect of acute pharmacological modulation of plasma free fatty acids on GH secretion in acromegalic patients. Clinical Endocrinology 54:4, 509-513
CrossRef10
Allen W. Root. (2001) The tall, rapidly growing infant, child, and adolescent. Current Opinion in Endocrinology & Diabetes 8:1, 6-16
CrossRef11
Ron Kooijman, Sarah Gerlo, Astrid Coppens, Elisabeth L. Hooghe-Peters. (2000) Myeloid leukemic cells express and secrete bioactive pituitary-sized 23 kDa prolactin. Journal of Neuroimmunology 110:1-2, 252-258
CrossRef
