Original Article
Association between Early-Onset Parkinson's Disease and Mutations in the Parkin Gene
N Engl J Med 2000; 342:1560-1567May 25, 2000
- Abstract
Background
Mutations in the parkin gene have recently been identified in patients with early-onset Parkinson's disease, but the frequency of the mutations and the associated phenotype have not been assessed in a large series of patients.
Methods
We studied 73 families in which at least one of the affected family members was affected at or before the age of 45 years and had parents who were not affected, as well as 100 patients with isolated Parkinson's disease that began at or before the age of 45 years. All subjects were screened for mutations in the parkin gene with use of a semiquantitative polymerase-chain-reaction assay that simultaneously amplified several exons. We sequenced the coding exons in a subgroup of patients. We also compared the clinical features of patients with parkin mutations and those without mutations.
Results
Among the families with early-onset Parkinson's disease, 36 (49 percent) had parkin mutations. The age at onset ranged from 7 to 58 years. Among the patients with isolated Parkinson's disease, mutations were detected in 10 of 13 patients (77 percent) with an age at onset of 20 years or younger, but in only 2 of 64 patients (3 percent) with an age at onset of more than 30 years. The mean (±SD) age at onset in the patients with parkin mutations was younger than that in those without mutations (32±11 vs. 42± 11 years, P<0.001), and they were more likely to have symmetric involvement and dystonia at onset, to have hyperreflexia at onset or later, to have a good response to levodopa therapy, and to have levodopa-induced dyskinesias during treatment. Nineteen different rearrangements of exons (deletions and multiplications) and 16 different point mutations were detected.
Conclusions
Mutations in the parkin gene are a major cause of early-onset autosomal recessive familial Parkinson's disease and isolated juvenile-onset Parkinson's disease (at or before the age of 20 years). Accurate diagnosis of these cases cannot be based only on the clinical manifestations of the disease.
Media in This Article
Figure 1
Mutations in the parkin Gene.Table 1
Frequency of Mutations in the parkin Gene in 73 Families with Autosomal Recessive Early-Onset Parkinson's Disease and 100 Patients with Isolated Early-Onset Parkinson's Disease.Article Activity
- Article
Parkinson's disease is one of the most frequent neurodegenerative disorders, with a prevalence of 1 to 2 percent among persons older than 65 years of age.1 It is characterized by resting tremor, rigidity, and bradykinesia, all of which respond well to treatment with levodopa. The pathological hallmarks are the presence of Lewy bodies (cytoplasmic eosinophilic hyaline inclusions) and massive loss of dopaminergic neurons in the pars compacta of the substantia nigra.2 The cause of the disease is still unknown, but the existence of genetic susceptibility factors is strongly suspected.3,4 Two genes (α-synuclein5 and ubiquitin carboxy-terminal hydrolase L1 [UCH-L1]6) and two gene loci (on chromosomes 2p13 and 4p14–16.3, respectively7,8) have been implicated in the pathogenesis of autosomal dominant Parkinson's disease, but they seem to account for the cases in only a few families. In contrast, mutations in the gene designated parkin have recently been identified in several families with autosomal recessive early-onset parkinsonism.9-14 However, the frequency of mutations in this gene in familial and isolated cases of early-onset parkinsonism has not yet been assessed in large series of patients.
The phenotype associated with mutations in the parkin gene has not been clearly established, making the selection of patients for genetic testing difficult. In Japanese patients with parkin mutations, the disease is characterized by an early onset, dystonia at onset, hyperreflexia, early complications resulting from levodopa treatment, and slow progression.9-11 In contrast, the clinical characteristics of some European and North African patients with parkin mutations were indistinguishable from those of patients with idiopathic Parkinson's disease, with an age at onset of up to 58 years.13,14 The number of families analyzed so far is small, however, and the correlations between genotype and phenotype are uncertain. Brain tissue from the patients studied did not contain Lewy bodies, suggesting that the pathologic process might differ from that of idiopathic Parkinson's disease.15,16
We performed a clinical and molecular study of 73 families with early-onset autosomal recessive Parkinson's disease, including 152 affected family members, and 100 patients with early-onset isolated Parkinson's disease. They were screened for mutations in the parkin gene by a semiquantitative polymerase-chain-reaction (PCR) assay designed to detect exon rearrangements (deletions and multiplications) and by genomic sequencing. Correlations between genotype and phenotype were assessed both in patients with parkin mutations and in those without such mutations.
Methods
Patients and Families
We studied 73 families (152 patients with Parkinson's disease and 53 unaffected relatives) that met the following criteria: symptoms of parkinsonism in affected family members that were reduced by at least 30 percent by treatment with levodopa (the response could not be assessed in 3 untreated patients); a mode of inheritance compatible with autosomal recessive transmission (affected siblings without affected parents); an age at onset of 45 years or younger in at least one of the affected siblings; and the absence of extensor plantar reflexes, ophthalmoplegia, early dementia, or early autonomic failure in the family members we examined. Twenty of the families originated from Italy, 14 from France, 12 from Great Britain, 10 from the Netherlands, 9 from Germany, 2 from Portugal, and 1 each from Spain, Algeria, Morocco, Argentina, India, and Vietnam. Eight of the families were consanguineous, and 12 have been described previously.13,14 In addition, we studied 100 patients with isolated Parkinson's disease with an age at onset of 45 years or younger, most of whom were European, and 8 of whom were from consanguineous marriages. These 100 patients were selected according to the same clinical criteria used for the patients with familial disease but who had no family history of Parkinson's disease. Eight of these 100 patients had never received treatment.
The enrollment of the subjects was random. For each subject, we obtained clinical information from the subject or the subject's records and peripheral blood for DNA analysis. DNA was extracted from peripheral-blood leukocytes according to standard procedures. The study was approved by ethics committees in the countries of all the participating investigators, and written informed consent was obtained from all the study subjects.
Molecular Analysis
Screening for mutations in the parkin gene was performed in all index patients (except those known to be homozygous or to have compound heterozygosity for such mutations13,14) with the use of a semiquantitative PCR assay for the detection of rearrangements of parkin exons. Exons 2 through 12 were amplified simultaneously in three groups by PCR (multiplex PCR): group 1 consisted of exons 4, 7, 8, and 11; group 2 consisted of exons 5, 6, 8, and 10; and group 3 consisted of exons 2, 3, 9, and 12 and an external control, C328, a 328-bp sequence of the transthyretin gene on chromosome 18. The primers used were the same as those described by Kitada et al.9 except for the primer for exon 3, for which exonic primers were used: 5'AATTGTGACCTGGATCAGC3' (Ex3iFor) as the forward primer and 5'CTGGACTTCCAGCTGGTGGTGAG3' (Ex3iRev) as the reverse primer. The C328 forward primer was 5'ACGTTCCTGATAATGGGATC3' (TTRForHex), and the reverse primer was 5'CCTCTCTCTACCAAGTGAGG3' (TTR328Rev). All forward primers were fluorescently labeled with HEX-phosphoramitide. The PCR products (2.5 μl) were analyzed by 5 percent denaturing polyacrylamide-gel electrophoresis with an automated sequencer (model ABI 377) and GeneScan version 3.1 and Genotyper version 1.1.1 software (all from Applied Biosystems). All reactions were performed at least twice. The DNA from a patient known to have a heterozygous deletion of exons 8 and 9 was always processed in parallel as an internal control.
We calculated the ratios of all the peak heights in a given reaction and then compared the ratios with the ratios measured in a specimen from a normal subject. This comparison yielded the following rules: values of 0.6 or less were interpreted as indicating a heterozygous deletion of an exon; values of 0.8 to 1.2 were interpreted as normal; values of 1.3 to 1.7 were interpreted as indicating a heterozygous duplication of an exon; values of 1.8 to 2.3 were interpreted as indicating a homozygous duplication or heterozygous triplication of an exon; and values of more than 2.6 were interpreted as indicating a homozygous triplication of an exon. An exon rearrangement was confirmed only if all the ratios concerning this exon were abnormal. The consequence of the rearrangements at the protein level (a frame shift vs. an in-frame rearrangement) was deduced from the exon sequences published by Kitada et al.9 (DNA Data Bank of Japan accession number AB009973).
Each PCR reaction involved, in a total volume of 25 μl, 40 ng of DNA, with 3 mM magnesium chloride, 0.2 mM of each deoxynucleoside triphosphate, and 1 U of Taq polymerase. Denaturation for 5 minutes at 95°C was followed by 23 cycles consisting of 30 seconds of denaturation at 95°C, 45 seconds of annealing at 53°C, and 2.5 minutes of extension at 68°C, with a final period of extension at 68°C for 5 minutes. Primer concentrations were chosen to yield — within the exponential phase of the PCR (data not shown) — similar peak heights in each multiplex reaction and ranged from 0.4 to 1.9 μM. Deletions and insertions of bases were deduced from the size of the PCR products.
In the case of 54 index patients with familial disease and 91 index patients with isolated disease, exon rearrangements or deletions or insertions of bases were not found on both chromosomes and thus did not account for the phenotype. Therefore, the entire coding region of the parkin gene (including exon–intron boundaries) was sequenced as described previously14 in 53 index patients with familial disease and 50 patients with isolated disease.
Whether the parkin variants we identified cosegregated with the disease was assessed by genotyping of all available members, affected or not, of the respective families. In addition, 114 chromosomes from mostly European, unrelated controls who had no movement disorders were analyzed for the point mutations and the rearrangements of the exons represented in multiplex group 3. The techniques used were restriction assays, polyacrylamide-gel electrophoresis, and the semiquantitative PCR assay. For two point mutations — the substitution of A for G at nucleotide 939 of complementary DNA (cDNA) and the substitution of T for C at nucleotide 1101 of cDNA — mismatched reverse primers were used in order to create a restriction site that depended on the point mutation being looked for: 5'GGCAGGGAGTAGCCAAGTTGAGGAT3' for digestion with Alw I and 5'AGCCCCGCTCCACAGCCAGCGC3' for digestion with Bst UI (in each primer, the underlined nucleotide differs from the wild-type sequence).
Statistical Analysis
Means (±SD) were compared with the nonparametric Mann–Whitney U test. Frequencies were compared with the chi-square test, with Yates' correction when appropriate.
Results
Frequency of Mutations in the parkin Gene
Twenty-five families (56 patients) with autosomal recessive Parkinson's disease had homozygous or compound heterozygous mutations on each allele of the parkin gene (Table 1Table 1
Frequency of Mutations in the parkin Gene in 73 Families with Autosomal Recessive Early-Onset Parkinson's Disease and 100 Patients with Isolated Early-Onset Parkinson's Disease.). In addition, 11 families (27 patients) with a mutation in one allele were considered to have parkin-related disease, on the basis of the assumption that the second mutation was not detected by the methods used in this study. Thus, mutations in the parkin gene were detected in 36 of 73 families (49 percent), including 12 previously described families.13,14 Among the 100 patients with isolated Parkinson's disease, 18 (18 percent) had parkin mutations. The frequency of mutations among consanguineous patients with isolated Parkinson's disease, a pattern that is suggestive of autosomal recessive inheritance, was similar to that among consanguineous patients with familial disease (50 percent vs. 62 percent). The frequency of mutations in the patients with isolated Parkinson's disease decreased significantly with increasing age at onset: mutations were detected in 10 of 13 patients (77 percent) with an age at onset of disease of 20 years or younger, but only in 2 of 64 patients (3 percent) with an age at onset of 31 to 45 years (Table 2Table 2
Frequency of Mutations in the parkin Gene in 100 Patients with Isolated Early-Onset Parkinson's Disease, According to the Age at Onset.). Sequencing of the parkin gene in 22 of the 64 patients with isolated Parkinson's disease who were older than 30 years at the onset of symptoms revealed a point mutation in only 1 patient. In 14 families in which the affected family members had parkin mutations on both chromosomes, none of 28 unaffected siblings had two parkin mutations, indicating the high penetrance of the mutations.Clinical Studies
The 36 families with Parkinson's disease and parkin mutations and the 18 patients with isolated Parkinson's disease and parkin mutations came from a variety of regions: France (in 15 cases), Italy (in 13), Great Britain (in 7), the Netherlands (in 3), Spain (in 3), Germany (in 3), Portugal (in 2), Algeria (in 2) and Lebanon, India, Pakistan, Vietnam, Japan, and Argentina (in 1 case each).
As a group, the 100 patients with parkin mutations had a mean (±SD) age at onset of 32±11 years (range, 7 to 58); the age at onset was not known for 1 patient (Table 3Table 3
Characteristics of Patients with Parkinson's Disease According to the Presence or Absence of Mutations in the parkin Gene.). Among the patients with an age at onset of 45 years or younger, the onset of the disease was earlier in the 18 patients with isolated Parkinson's disease and parkin mutations than in the 75 patients with familial Parkinson's disease and mutations (mean age, 21±9 vs. 32±9 years; median, 20 vs. 33 years; P<0.001). This difference was not due to selection bias, because the mean ages at onset were similar in the two groups when all initially included patients with an age at onset of 45 years or younger were compared, whether or not they had parkin mutations (age at onset in 118 patients with familial disease, 34±9 years; in 100 patients with isolated disease, 32±9 years). The mean age at onset was significantly younger in the patients with parkin mutations than in those without mutations, both in the total sample (Table 3) and in the group with familial cases alone (34±10 years for 82 patients with familial disease and mutations and 43±12 years for 65 patients with familial disease but without mutations; P<0.001).The initial manifestations of the disease in most patients with parkin mutations were tremor (65 percent) and bradykinesia (63 percent) (Table 3). The patients with parkin mutations had significantly higher frequencies of dystonia and symmetric symptoms at onset and of hyperreflexia at onset or later, as well as a better response to levodopa despite having had the disease for a longer period (Table 3) than those with no parkin mutations. Dystonia began in the lower limbs in 28 of 31 patients with mutations, but 2 patients first had torticollis and 1 had right-arm dystonia. Dyskinesia as a result of levodopa treatment was significantly more common in patients with mutations than in those with no mutations, but such dyskinesia occurred in both groups, on average, after nearly 5 years of treatment (range, 1 month to 20 years). There were no significant differences between the 24 patients with at least one missense mutation and the 52 patients with two truncating mutations; the 25 patients with single heterozygous truncating mutations were not assigned to either group, since the nature of the suspected second mutation was unknown.
Nineteen different homozygous and heterozygous exon rearrangements were found in 35 index patients, including 4 from previously described families with homozygous deletions of exons (Table 4Table 4
Frequency of Homozygous, Compound Heterozygous, and Single Heterozygous Mutations among 45 Index Patients with Familial or Isolated Parkinson's Disease, According to the Type of Mutation. and Figure 1AFigure 1Mutations in the parkin Gene.).13,14 In addition to identifying the suspected deletions of an exon, our approach provided evidence of four duplications of an exon and one triplication of an exon. The results were highly reproducible and confirmed by cosegregation analysis. Rearrangements of exons 2, 3, 9, and 12 were not found in the controls.Sixteen different exonic point mutations were found in 28 index patients, including 8 from previously described families14 (Table 4 and Figure 1B). In addition, an intronic deletion of 5 bp (IVS8 –21 to –17del) was detected. All point mutations cosegregated with the disease, and none were found in any control. The amino acids modified by mutations were conserved in the parkin orthologues in rats20 and mice (Gene Bank accession numbers AF210434 and AB019558, respectively). However, in two patients from one family, the homozygous point mutation Arg334Cys was associated with the homozygous intronic 5-bp deletion and the heterozygous Asp280Asn mutation, so that the pathogenicity of the latter two mutations cannot be ascertained.
Many of the exon rearrangements were found repeatedly among the index patients, particularly deletions of exon 3 (in 10 patients), exon 2 (in 4), exon 4 (in 4), and exons 3 and 4 (in 4) (Figure 1A). Six point mutations were found in more than one index patient: the deletion of A at nucleotide 255 of cDNA (in six index patients), the deletion of A and G at nucleotide 202 to 203 of cDNA (in five), Arg275Trp (in five), the insertion of G and T between nucleotide 321 and nucleotide 322 of cDNA (in two), Lys211Asn (in two), and Gly430Asp (in two) (Figure 1).
Discussion
We detected mutations in the parkin gene in almost half the families with autosomal recessive Parkinson's disease in which at least one affected member was 45 years of age or younger at the onset of symptoms. The frequency of such mutations was lower in a group of patients with isolated early-onset Parkinson's disease.
On average, patients with parkin mutations began to have symptoms in their early 30s, but the age at onset ranged widely, from 7 to 58 years. The fact that the onset occurred at an earlier age in patients with isolated Parkinson's disease and parkin mutations than in those with familial Parkinson's disease and parkin mutations suggests that among patients who are older than 30 years at the onset of isolated Parkinson's disease, the disease is mainly due to causes other than parkin mutations.
Can patients with parkin mutations be distinguished clinically from patients with early-onset Parkinson's disease from other causes? As a group, those with parkin mutations had an earlier onset of disease, were more likely to have dystonia and symmetric signs at onset, as well as hyperreflexia at onset or later, and were more likely to have a better response to levodopa, but were also more likely to have dyskinesia during treatment, than were patients without parkin mutations. These signs were less frequent, however, than in previous reports11,21 and could not be used specifically to identify patients with mutations. Furthermore, the clinical manifestations of the parkin mutations were independent of the age at onset.
In addition, patients with late-onset disease who have mutations can be difficult to distinguish from those with idiopathic Parkinson's disease. In general, however, the disease progressed slowly in the patients with mutations. Despite having had symptoms for many years, the majority of patients with parkin mutations had good responses to low doses of levodopa. Although levodopa-induced dyskinesia was reported to develop early,9,11,21 the mean delay in our patients was about 5 years, with a maximum of 20 years. This time frame was similar to that for the patients without parkin mutations.
Finally, dementia was rare among the patients with mutations. This might be explained by a less widespread neuronal loss in patients with mutations, in whom the substantia nigra and, to a lesser extent, the locus caeruleus are selectively affected, as compared with patients with idiopathic Parkinson's disease.15,16 However, the low frequency of dementia in the patients with mutations could also be due to a younger mean age at examination or to the exclusion of patients who had dementia early in the course of the disease.
There were no clinical differences between patients with missense mutations and those with truncating mutations. This finding was surprising, since missense mutations might be expected to interfere less with the function of the parkin protein than truncating mutations and therefore to result in a milder phenotype. We therefore assume that the 10 conserved amino acids that were affected by the missense mutations are of crucial importance for the function of the protein or that their modification results in decreased protein synthesis or more rapid degradation.22 In addition, the wide range of clinical signs, even within single families with mutations (e.g., variation of up to 20 years in the age at onset) suggests that additional factors contribute to the phenotype.
The chief histopathological differences between patients with parkin mutations and those with idiopathic Parkinson's disease that have been detected so far are the absence of Lewy bodies and the restriction of neuronal cell loss to the substantia nigra and the locus caeruleus in the patients with parkin mutations.16 Thus, parkin gene mutations are responsible for the death of selective cells, the mechanism of which might differ from that in idiopathic Parkinson's disease.
The PCR-based technique that we used revealed numerous rearrangements of exons, including those identified in eight families in which no mutations were found by direct sequencing.14 In combination with genomic sequencing, this technique greatly improves the sensitivity of the molecular diagnosis in patients with parkin gene mutations. The various combinations of exon deletions, the exon multiplications, and the newly identified point mutations increase the already wide variety of disease-related mutations identified in the parkin gene. The position of the mutations indicates functionally important protein regions such as the RING–IBR–RING domain, as does conservation of the corresponding amino acids in mice and rats.20
The presence of both deletions and multiplications of some exons (e.g., exon 2 and 3) suggests that a mechanism such as unequal recombination might be involved. The observation that 13 of the mutations were found repeatedly in as many as 10 families raises the possibility of a founder effect. However, many of the mutations were found in families from different European countries, suggesting that these alterations are recurrent. The point mutations that accounted for the disease in approximately 40 percent of our patients seem to be less frequent among Japanese patients.11 Finally, the identification of 15 index patients with single heterozygous mutations indicates that other mutations remain to be discovered, perhaps in noncoding regions of the parkin gene.
In conclusion, mutations of the parkin gene are frequent among patients with autosomal recessive Parkinson's disease. Although dystonia at the onset of disease, hyperreflexia, and a slow rate of disease progression are characteristic features of patients with parkin mutations, there are no specific clinical signs that distinguish these patients from patients with other causes of Parkinson's disease. The wide spectrum of mutations in the parkin gene renders molecular diagnosis difficult, but the relatively simple semiquantitative PCR method that we used detected approximately 70 percent of the mutations found in this series of patients.
Supported by the Assistance Publique–Hôpitaux de Paris; the Association France–Parkinson; the Italian Ministry for University, Scientific and Technological Research; the Parkinson's Disease Society (United Kingdom); the Doris Hillier Award (British Medical Association); by a grant from the European Community Biomed 2 (BMH4CT960664); and by the Prinses Beatrix Fund. Drs. Lücking and Gasser were supported by the Deutsche Forschungsgemeinschaft.
We are indebted to Drs. N. Vanacore (Rome), L. Capus, A. Amoroso (Trieste, Italy), B.-P. Bejjani (Beirut, Lebanon), S. Medjbeur, P. Ferroir (Paris), F. Dubas (Angers, France), and M.W.I.M. Horstink (Nijmegen, the Netherlands) for directing patients to the study; to C. Penet, A. Camuzat, J. Bou, V. Chesneaux, and Y. Pothin (Paris) for expert technical assistance; to the families for their participation; and to Dr. Merle Ruberg for helpful discussions.
Source Information
From INSERM Unité 289, Hôpital de la Salpêtrière, Paris (C.B.L., A.D., Y.A., A.B.); the Dipartimento di Scienze Neurologiche, Università La Sapienza, Rome (V.B., G.M.); the Institute of Neurology, London (J.V., N.W.W.); the Dipartimento di Scienze Neurologiche, Università Federico II, Naples, Italy (G.D.); the Neurologische Klinik, Klinikum Großhadern, Ludwig Maximilians Universität, Munich, Germany (T.G.); the Department of Epidemiology and Biostatistics, Erasmus University Medical School, Rotterdam, the Netherlands (B.S.H); and Evry Genomics Center, Aventis Pharma France, Evry, France (P.D.).
Address reprint requests to Dr. Brice at INSERM Unité 289, Hôpital de la Salpêtrière, 47 Blvd. de l'Hôpital, 75651 Paris CEDEX 13, France, or at brice@ccr.jussieu.fr.
Other participants in the study are listed in the Appendix.
Other authors were D. Nicholl, M.D. (University of Birmingham, Birmingham, United Kingdom); M.M.B. Breteler, M.D. (Erasmus University Medical School, Rotterdam, the Netherlands); B.A. Oostra, M.D. (Erasmus University, Rotterdam, the Netherlands); M. De Mari, M.D. (Università degli Studi di Bari, Bari, Italy); R. Marconi, M.D. (Ospedale della Misericordia, Grosseto, Italy); A. Filla, M.D. (Università Federico II, Naples, Italy); A.-M. Bonnet, M.D. (Hôpital de la Salpêtrière, Paris); E. Broussolle, M.D. (Hôpital Pierre Wertheimer, Lyons, France); P. Pollak, M.D. (Centre Hospitalier Universitaire de Grenoble, Grenoble, France); O. Rascol, M.D. (INSERM Unité 455, Toulouse, France); and M. Rosier, Ph.D., and I. Arnould, Ph.D. (Aventis Pharma France, Evry, France).
Appendix
In addition to the authors, the following persons also participated in the study: M. Martinez, J. Feingold, E. Fabrizio, G. Volpe, and B. Bereznai (the European Consortium on Genetic Susceptibility in Parkinson's Disease); N. Abbas, M. Borg, A. Destée, F. Durif, G. Fénelon, J.-R. Fève, F. Gasparini, F. Tison, C. Tranchant, M. Vérin, F. Viallet, M. Vidailhet, and J.-M. Warter (the French Parkinson's Disease Genetics Study Group); and E. Turlotte, D. Debono, S. Ricard, L. Pradier, and G.A. Böhme.
- References
References
1
de Rijk MC ,Tzourio C ,Breteler MMB , et al. Prevalence of parkinsonism and Parkinson's disease in Europe: the EUROPARKINSON Collaborative Study: European community concerted action on the epidemiology of Parkinson's disease. J Neurol Neurosurg Psychiatry 1997;62:10-15
CrossRef | Web of Science | Medline2
Fearnley JM ,Lees AJ . Ageing and Parkinson's disease: substantia nigra regional selectivity. Brain 1991;114:2283-2301
CrossRef | Web of Science | Medline3
Wood N . Genes and parkinsonism. J Neurol Neurosurg Psychiatry 1997;62:305-309
CrossRef | Web of Science | Medline4
Piccini P ,Burn DJ ,Ceravolo R ,Maraganore D ,Brooks DJ . The role of inheritance in sporadic Parkinson's disease: evidence from a longitudinal study of dopaminergic function in twins. Ann Neurol 1999;45:577-582
CrossRef | Web of Science | Medline5
Polymeropoulos MH ,Lavedan C ,Leroy E , et al. Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science 1997;276:2045-2047
CrossRef | Web of Science | Medline6
Leroy E ,Boyer R ,Auburger G , et al. The ubiquitin pathway in Parkinson's disease. Nature 1998;395:451-452
CrossRef | Web of Science | Medline7
Gasser T ,Muller-Myhsok B ,Wszolek ZK , et al. A susceptibility locus for Parkinson's disease maps to chromosome 2p13. Nat Genet 1998;18:262-265
CrossRef | Web of Science | Medline8
Farrer M ,Gwinn-Hardy K ,Muenter M , et al. A chromosome 4p haplotype segregating with Parkinson's disease and postural tremor. Hum Mol Genet 1999;8:81-85
CrossRef | Web of Science | Medline9
Kitada T ,Asakawa S ,Hattori N , et al. Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 1998;392:605-608
CrossRef | Web of Science | Medline10
Hattori N ,Matsumine H ,Asakawa S , et al. Point mutations (Thr240Arg and Ala311Stop) in the parkin gene. Biochem Biophys Res Commun 1998;249:754-758[Erratum, Biochem Biophys Res Commun 1998;251:666.]
CrossRef | Web of Science | Medline11
Hattori N ,Kitada T ,Matsumine H , et al. Molecular genetic analysis of a novel parkin gene in Japanese families with autosomal recessive juvenile parkinsonism: evidence for variable homozygous deletions in the parkin gene in affected individuals. Ann Neurol 1998;44:935-941
CrossRef | Web of Science | Medline12
Leroy E ,Anastasopoulos D ,Konitsiotis S ,Lavedan C ,Polymeropoulos MH . Deletions in the parkin gene and genetic heterogeneity in a Greek family with early onset Parkinson's disease. Hum Genet 1998;103:424-427
CrossRef | Web of Science | Medline13
Lucking CB ,Abbas N ,Durr A , et al. Homozygous deletions in parkin gene in European and North African families with autosomal recessive juvenile parkinsonism. Lancet 1998;352:1355-1356
CrossRef | Web of Science | Medline14
Abbas N ,Lucking CB ,Ricard S , et al. A wide variety of mutations in the parkin gene are responsible for autosomal recessive parkinsonism in Europe. Hum Mol Genet 1999;8:567-574
CrossRef | Web of Science | Medline15
Takahashi H ,Ohama E ,Suzuki S , et al. Familial juvenile parkinsonism: clinical and pathologic study in a family. Neurology 1994;44:437-441
Web of Science | Medline16
Mori H ,Kondo T ,Yokochi M , et al. Pathologic and biochemical studies of juvenile parkinsonism linked to chromosome 6q. Neurology 1998;51:890-892
Web of Science | Medline17
Fahn S, Elton RL, UPDRS Development Committee. Unified Parkinson's Disease Rating Scale. In: Fahn S, Marsden CD, Goldstein M, Calne DB, eds. Recent developments in Parkinson's disease. Vol. 2. Florham Park, N.J.: Macmillan Healthcare Information, 1987:153-63.
18
Hoehn MM ,Yahr MD . Parkinsonism: onset, progression and mortality. Neurology 1967;17:427-442
Web of Science | Medline19
Morett E ,Bork P . A novel transactivation domain in parkin. Trends Biochem Sci 1999;24:229-231
CrossRef | Web of Science | Medline20
Gu W-J ,Abbas N ,Lagune-Zarate M , et al. Cloning of rat parkin cDNA and distribution of parkin in rat brain. J Neurochem 2000;74:1773-1776
CrossRef | Web of Science | Medline21
Ishikawa A ,Tsuji S . Clinical analysis of 17 patients in 12 Japanese families with autosomal-recessive type juvenile parkinsonism. Neurology 1996;47:160-166
Web of Science | Medline22
Bross P ,Corydon TJ ,Andresen BS ,Jorgensen MM ,Bolund L ,Gregersen N . Protein misfolding and degradation in genetic diseases. Hum Mutat 1999;14:186-198
CrossRef | Web of Science | Medline
- Citing Articles (334)
Citing Articles
1
Enza Maria Valente, Giuseppe Arena, Liliana Torosantucci, Vania Gelmetti. (2012) Molecular pathways in sporadic PD. Parkinsonism & Related Disorders 18, S71-S73
CrossRef2
Vincenzo Bonifati. (2012) Autosomal recessive parkinsonism. Parkinsonism & Related Disorders 18, S4-S6
CrossRef3
Kimberly McDowell, Marie-Françoise Chesselet. (2012) Animal models of the non-motor features of Parkinson's disease. Neurobiology of Disease
CrossRef4
Manabu Funayama, Hiroyo Yoshino, Yuanzhe Li, Hiromichi Kusaka, Hiroyuki Tomiyama, Nobutaka Hattori. (2012) Pseudo-heterozygous rearrangement mutation of parkin. Movement Disordersn/a-n/a
CrossRef5
Tauser Roxana-Georgiana, Antohe Dan-Stefan. 2011. Overview of CNS Neuropharmaceuticals. .
CrossRef6
Pravir Kumar, Kaveri Pradhan, R. Karunya, Rashmi K. Ambasta, Henry W. Querfurth. (2011) Cross-functional E3 ligases Parkin and C-terminus Hsp70-interacting protein in neurodegenerative disorders. Journal of Neurochemistryno-no
CrossRef7
K. Löw, P. Aebischer. (2011) Use of viral vectors to create animal models for Parkinson's disease. Neurobiology of Disease
CrossRef8
Claire Henchcliffe, Richard Dodel, M. Flint Beal. (2011) Biomarkers of Parkinson's disease and Dementia with Lewy bodies. Progress in Neurobiology 95:4, 601-613
CrossRef9
Lilach Soreq, Yoram Ben-Shaul, Zvi Israel, Hagai Bergman, Hermona Soreq. (2011) Meta-analysis of genetic and environmental Parkinson's disease models reveals a common role of mitochondrial protection pathways. Neurobiology of Disease
CrossRef10
Peter Elfferich, Marja C. Verleun-Mooijman, J. Anneke Maat-Kievit, Bart P. C. Warrenburg, Wilson F. Abdo, Sylvia A. Eshuis, Klaus L. Leenders, Ad Hovestadt, Jan C. M. Zijlmans, Jan-Pieter M. Stroy, John C. Swieten, Agnita J. W. Boon, Klaartje Engelen, Corien C. Verschuuren-Bemelmans, Saskia A. J. Lesnik-Oberstein, Cristina Tassorelli, Leonardo Lopiano, Vincenzo Bonifati, Dennis Dooijes, Rick Minkelen. (2011) Breakpoint mapping of 13 large parkin deletions/duplications reveals an exon 4 deletion and an exon 7 duplication as founder mutations. neurogenetics 12:4, 263-271
CrossRef11
James Dominic Mills, Michal Janitz. (2011) Alternative splicing of mRNA in the molecular pathology of neurodegenerative diseases. Neurobiology of Aging
CrossRef12
Alzbeta Trancikova, Elpida Tsika, Darren J. Moore. (2011) Mitochondrial Dysfunction in Genetic Animal Models of Parkinson's Disease. Antioxidants & Redox Signaling111004125330001
CrossRef13
Junko Odajima, Zachary P. Wills, Yasmine M. Ndassa, Miho Terunuma, Karla Kretschmannova, Tarek Z. Deeb, Yan Geng, Sylwia Gawrzak, Isabel M. Quadros, Jennifer Newman, Manjusri Das, Marie E. Jecrois, Qunyan Yu, Na Li, Frederic Bienvenu, Stephen J. Moss, Michael E. Greenberg, Jarrod A. Marto, Piotr Sicinski. (2011) Cyclin E Constrains Cdk5 Activity to Regulate Synaptic Plasticity and Memory Formation. Developmental Cell 21:4, 655-668
CrossRef14
William L. Haylett, Rowena J. Keyser, Melissa C. du Plessis, Celia van der Merwe, Janine Blanckenberg, Debbie Lombard, Jonathan Carr, Soraya Bardien. (2011) Mutations in the parkin gene are a minor cause of Parkinson's disease in the South African population. Parkinsonism & Related Disorders
CrossRef15
H. F. Harbo, J. Finsterer, J. Baets, C. Van Broeckhoven, S. Di Donato, B. Fontaine, P. De Jonghe, A. Lossos, T. Lynch, C. Mariotti, L. Schöls, A. Spinazzola, Z. Szolnoki, S. J. Tabrizi, C. Tallaksen, M. Zeviani, J-M. Burgunder, T. Gasser. 2011. Molecular Diagnosis of Neurogenetic Disorders: General Issues, Huntington's Disease, Parkinson's Disease and Dystonias. , 51-60.
CrossRef16
F.J. Kirkham, P. Haywood, P. Kashyape, J. Borbone, A. Lording, K. Pryde, M. Cox, J. Keslake, M. Smith, L. Cuthbertson, V. Murugan, S. Mackie, N.H. Thomas, A. Whitney, K.M. Forrest, A. Parker, R. Forsyth, C.M. Kipps. (2011) Movement disorder emergencies in childhood. European Journal of Paediatric Neurology 15:5, 390-404
CrossRef17
Consiglia Pacelli, Domenico De Rasmo, Anna Signorile, Ignazio Grattagliano, Giuseppe di Tullio, Andria D'Orazio, Beatrice Nico, Giacomo Pietro Comi, Dario Ronchi, Ermanno Ferranini, Domenico Pirolo, Peter Seibel, Susanna Schubert, Antonio Gaballo, Gaetano Villani, Tiziana Cocco. (2011) Mitochondrial defect and PGC-1α dysfunction in parkin-associated familial Parkinson's disease. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1812:8, 1041-1053
CrossRef18
R. Inzelberg, J. M. Rabey, E. Melamed, R. Djaldetti, A. Reches, S. Badarny, S. Hassin-Baer, O. Cohen, H. Trau, J. Aharon-Peretz, R. Milo, M. Schwartz, M. Huberman, L. Gilead, M. Barchana, I. Liphshiz, C. Fitzer-Attas, N. Giladi. (2011) High prevalence of malignant melanoma in Israeli patients with Parkinson’s disease. Journal of Neural Transmission 118:8, 1199-1207
CrossRef19
Kah-Leong Lim, Xiao-Hui Ng, Lim Gui-Yin Grace, Tso-Pang Yao. (2011) Mitochondrial Dynamics and Parkinson's Disease: Focus on Parkin. Antioxidants & Redox Signaling110722133435001
CrossRef20
Melissa K. McCoy, Mark R. Cookson. (2011) Mitochondrial Quality Control and Dynamics in Parkinson's Disease. Antioxidants & Redox Signaling110707120450009
CrossRef21
A. Merola, M. Zibetti, S. Angrisano, L. Rizzi, V. Ricchi, C. A. Artusi, M. Lanotte, M. G. Rizzone, L. Lopiano. (2011) Parkinson's disease progression at 30 years: a study of subthalamic deep brain-stimulated patients. Brain 134:7, 2074-2084
CrossRef22
Douglas E. Hobson. (2011) Asymmetry in parkinsonism, spreading pathogens and the nose. Parkinsonism & Related Disorders
CrossRef23
Hui-Ming Gao, Jau-Shyong Hong. (2011) Gene–environment interactions: Key to unraveling the mystery of Parkinson's disease. Progress in Neurobiology 94:1, 1-19
CrossRef24
Angela Scheuerle, Kathleen Wilson. (2011) PARK2 copy number aberrations in two children presenting with autism spectrum disorder: Further support of an association and possible evidence for a new microdeletion/microduplication syndrome. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics 156:4, 413-420
CrossRef25
Joao P. Lopes, Paula Agostinho. (2011) Cdk5: Multitasking between physiological and pathological conditions. Progress in Neurobiology 94:1, 49-63
CrossRef26
Hee Jin Kim, Han-Joon Kim, Jee-Young Lee, Ji Young Yun, So Yeon Kim, Sung Sup Park, Beom S. Jeon. (2011) Phenotype analysis in patients with early onset Parkinson’s disease with and without parkin mutations. Journal of Neurology
CrossRef27
M. Rafiuddin Ahmed, Xuanzhi Zhan, Xiufeng Song, Seunghyi Kook, Vsevolod V. Gurevich, Eugenia V. Gurevich. (2011) Ubiquitin Ligase Parkin Promotes Mdm2–Arrestin Interaction but Inhibits Arrestin Ubiquitination. Biochemistry 50:18, 3749-3763
CrossRef28
SY Kim, MW Seong, BS Jeon, SY Kim, HS Ko, JY Kim, SS Park. (2011) Phase analysis identifies compound heterozygous deletions of the PARK2 gene in patients with early-onset Parkinson disease. Clinical Geneticsno-no
CrossRef29
Sharon Hassin-Baer, Nobutaka Hattori, Oren S. Cohen, Magdalena Massarwa, Simon D. Israeli-Korn, Rivka Inzelberg. (2011) Phenotype of the 202 adenine deletion in the parkin gene: 40 years of follow-up. Movement Disorders 26:4, 719-722
CrossRef30
Joshua M. Shulman, Philip L. De Jager, Mel B. Feany. (2011) Parkinson's Disease: Genetics and Pathogenesis. Annual Review of Pathology: Mechanisms of Disease 6:1, 193-222
CrossRef31
I. Molchadski, A. D. Korczyn, O. S. Cohen, A. Katzav, Z. Nitzan, J. Chapman, S. Hassin-Baer. (2011) The role of apolipoprotein E polymorphisms in levodopa-induced dyskinesia. Acta Neurologica Scandinavica 123:2, 117-121
CrossRef32
Andrea Alter, Audrey Grant, Laurent Abel, Alexandre Alcaïs, Erwin Schurr. (2011) Leprosy as a genetic disease. Mammalian Genome 22:1-2, 19-31
CrossRef33
Brandon K. Harvey, Christopher T. Richie, Barry J. Hoffer, Mikko Airavaara. (2011) Transgenic animal models of neurodegeneration based on human genetic studies. Journal of Neural Transmission 118:1, 27-45
CrossRef34
Marianna Orlova, Tania Di Pietrantonio, Erwin Schurr. (2011) Review: Genetics of infectious diseases: hidden etiologies and common pathways. Clinical Chemistry and Laboratory Medicine-
CrossRef35
Stanley Fahn, Joseph Jankovic, Mark Hallett. 2011. Parkinsonism. , 66-92.
CrossRef36
Elise Caccappolo, Roy N. Alcalay, Helen Mejia-Santana, Ming-X. Tang, Brian Rakitin, Llency Rosado, Elan D. Louis, Cynthia L. Comella, Amy Colcher, Danna Jennings, Martha A. Nance, Susan Bressman, William K. Scott, Caroline M. Tanner, Susan F. Mickel, Howard F. Andrews, Cheryl Waters, Stanley Fahn, Lucien J. Cote, Steven Frucht, Blair Ford, Michael Rezak, Kevin Novak, Joseph H. Friedman, Ronald F. Pfeiffer, Laura Marsh, Brad Hiner, Andrew D. Siderowf, Barbara M. Ross, Miguel Verbitsky, Sergey Kisselev, Ruth Ottman, Lorraine N. Clark, Karen S. Marder. (2011) Neuropsychological Profile of Parkin Mutation Carriers with and without Parkinson Disease: The CORE-PD Study. Journal of the International Neuropsychological Society 17:01, 91-100
CrossRef37
Shin Hisahara, Shun Shimohama. (2011) Toxin-Induced and Genetic Animal Models of Parkinson's Disease. Parkinson's Disease 2011, 1-14
CrossRef38
Caroline Fernandes, Yong Rao. (2011) Genome-wide screen for modifiers of Parkinson's disease genes in Drosophila. Molecular Brain 4:1, 17
CrossRef39
Christine Klein, Ana Djarmati. (2011) Parkinson disease: Genetic testing in Parkinson disease—who should be assessed?. Nature Reviews Neurology 7:1, 7-9
CrossRef40
Ross B. Mounsey, Peter Teismann. (2011) Mitochondrial Dysfunction in Parkinson's Disease: Pathogenesis and Neuroprotection. Parkinson's Disease 2011, 1-18
CrossRef41
Farzaneh Ghazavi, Zeinab Fazlali, Setareh Sadat Banihosseini, Sayed-Rzgar Hosseini, Mohammad Hossein Kazemi, Seyedmehdi Shojaee, Khosro Parsa, Homa Sadeghi, Farzad Sina, Mohammad Rohani, Gholam-Ali Shahidi, Nasser Ghaemi, Mostafa Ronaghi, Elahe Elahi. (2011) PRKN, DJ-1, and PINK1 screening identifies novel splice site mutation in PRKN and two novel DJ-1 mutations. Movement Disorders 26:1, 80-89
CrossRef42
Tahira Farooqui, Akhlaq A. Farooqui. (2011) Lipid-Mediated Oxidative Stress and Inflammation in the Pathogenesis of Parkinson's Disease. Parkinson's Disease 2011, 1-9
CrossRef43
Stanley Fahn, Joseph Jankovic, Mark Hallett. 2011. Current concepts on the etiology and pathogenesis of Parkinson disease. , 93-118.
CrossRef44
Yi Zhang, Zhen-Zhen Wang, Hong-Mei Sun. (2011) Lack of association between p.Ser167Asn variant of Parkin and Parkinson's disease: A meta-analysis of 15 studies involving 2,280 cases and 2,459 controls. American Journal of Medical Genetics Part B: Neuropsychiatric Geneticsn/a-n/a
CrossRef45
Qian Huang, Maria E. Figueiredo-Pereira. (2010) Ubiquitin/proteasome pathway impairment in neurodegeneration: therapeutic implications. Apoptosis 15:11, 1292-1311
CrossRef46
Susanne A. Schneider, Kailash P. Bhatia. (2010) Rare Causes of Dystonia Parkinsonism. Current Neurology and Neuroscience Reports 10:6, 431-439
CrossRef47
Nidhi Saini, Sandra Oelhafen, Haiqing Hua, Oleg Georgiev, Walter Schaffner, Hansruedi Büeler. (2010) Extended lifespan of Drosophila parkin mutants through sequestration of redox-active metals and enhancement of anti-oxidative pathways. Neurobiology of Disease 40:1, 82-92
CrossRef48
I. Ron, D. Rapaport, M. Horowitz. (2010) Interaction between parkin and mutant glucocerebrosidase variants: a possible link between Parkinson disease and Gaucher disease. Human Molecular Genetics 19:19, 3771-3781
CrossRef49
Coro Paisán-Ruiz, Rocio Guevara, Monica Federoff, Hasmet Hanagasi, Fardaz Sina, Elahe Elahi, Susanne A. Schneider, Petra Schwingenschuh, Nin Bajaj, Murat Emre, Andrew B. Singleton, John Hardy, Kailash P. Bhatia, Sebastian Brandner, Andrew J. Lees, Henry Houlden. (2010) Early-onset L-dopa-responsive parkinsonism with pyramidal signs due to ATP13A2, PLA2G6, FBXO7 and spatacsin mutations. Movement Disorders 25:12, 1791-1800
CrossRef50
Karin D. van Dijk, Charlotte E. Teunissen, Benjamin Drukarch, Connie R. Jimenez, Henk J. Groenewegen, Henk W. Berendse, Wilma D.J. van de Berg. (2010) Diagnostic cerebrospinal fluid biomarkers for Parkinson's disease: A pathogenetically based approach. Neurobiology of Disease 39:3, 229-241
CrossRef51
Kathrin Reetz, Vera Tadic, Meike Kasten, Norbert Brüggemann, Alexander Schmidt, Johann Hagenah, Peter P. Pramstaller, Alfredo Ramirez, Maria I. Behrens, Hartwig R. Siebner, Christine Klein, Ferdinand Binkofski. (2010) Structural imaging in the presymptomatic stage of genetically determined parkinsonism. Neurobiology of Disease 39:3, 402-408
CrossRef52
Karen Nuytemans, Jessie Theuns, Marc Cruts, Christine Van Broeckhoven. (2010) Genetic etiology of Parkinson disease associated with mutations in the SNCA, PARK2, PINK1, PARK7, and LRRK2 genes: a mutation update. Human Mutation 31:7, 763-780
CrossRef53
L. Gao, F. J. Díaz-Corrales, F. Carrillo, J. Díaz-Martín, M. T. Caceres-Redondo, M. Carballo, A. Palomino, J. López-Barneo, P. Mir. (2010) Brain-derived neurotrophic factor G196A polymorphism and clinical features in Parkinson’s disease. Acta Neurologica Scandinavica 122:1, 41-45
CrossRef54
C. Pont-Sunyer, M. J. Martí, E. Tolosa. (2010) Focal limb dystonia. European Journal of Neurology 17, 22-27
CrossRef55
L G T Morris, S Veeriah, T A Chan. (2010) Genetic determinants at the interface of cancer and neurodegenerative disease. Oncogene 29:24, 3453-3464
CrossRef56
Ted M. Dawson, Han Seok Ko, Valina L. Dawson. (2010) Genetic Animal Models of Parkinson's Disease. Neuron 66:5, 646-661
CrossRef57
J.-Y. Lee, Y. Nagano, J. P. Taylor, K. L. Lim, T.-P. Yao. (2010) Disease-causing mutations in Parkin impair mitochondrial ubiquitination, aggregation, and HDAC6-dependent mitophagy. The Journal of Cell Biology 189:4, 671-679
CrossRef58
Kathrin Brockmann, Thomas Gasser. 2010. Genetic Basis of Monogenic Forms of Parkinson Disease. .
CrossRef59
Chenere P. Ramsey, Benoit I. Giasson. (2010) Identification and characterization of a novel endogenous murine parkin mutation. Journal of Neurochemistry 113:2, 402-417
CrossRef60
L. Samaranch, O. Lorenzo-Betancor, J. M. Arbelo, I. Ferrer, E. Lorenzo, J. Irigoyen, M. A. Pastor, C. Marrero, C. Isla, J. Herrera-Henriquez, P. Pastor. (2010) PINK1-linked parkinsonism is associated with Lewy body pathology. Brain 133:4, 1128-1142
CrossRef61
Héctor R. Martínez, Humberto González-González, Leonel Cantú-Martínez, Ricardo Rangel-Guerra, Carlos D. Hernández-Castillo, Juan J.J. Vergara-Saavedra, Martin R. Ramos-Gonzalez, Ricardo M. Cerda-Flores, Marco A. Morales-Garza, Marcos J. Guerrero-Muñoz. (2010) PARKIN-coding polymorphisms are not associated with Parkinson's disease in a population from northeastern Mexico. Neuroscience Letters 468:3, 264-266
CrossRef62
Juan Perucho, Maria J. Casarejos, Isabel Rubio, José A. Rodriguez-Navarro, Ana Gómez, Israel Ampuero, Izaskun Rodal, Rosa M. Solano, Eva Carro, Justo García de Yébenes, Maria A. Mena. (2010) The effects of parkin suppression on the behaviour, amyloid processing, and cell survival in APP mutant transgenic mice. Experimental Neurology 221:1, 54-67
CrossRef63
F. Viallet, D. Gayraud, B. Bonnefoi, L. Renie, R. Aurenty. (2010) Morbo di Parkinson idiopatico: aspetti clinici, diagnostici e terapeutici. EMC - Neurologia 10:3, 1-29
CrossRef64
Sun Ju Chung. (2010) Genetics in Parkinson's disease. Journal of the Korean Medical Association 54:1, 70
CrossRef65
Selvaraju Veeriah, Barry S Taylor, Shasha Meng, Fang Fang, Emrullah Yilmaz, Igor Vivanco, Manickam Janakiraman, Nikolaus Schultz, Aphrothiti J Hanrahan, William Pao, Marc Ladanyi, Chris Sander, Adriana Heguy, Eric C Holland, Philip B Paty, Paul S Mischel, Linda Liau, Timothy F Cloughesy, Ingo K Mellinghoff, David B Solit, Timothy A Chan. (2010) Somatic mutations of the Parkinson's disease–associated gene PARK2 in glioblastoma and other human malignancies. Nature Genetics 42:1, 77-82
CrossRef66
Kenneth M. Rosen, Charbel E.-H. Moussa, Han-Kyu Lee, Pravir Kumar, Tohru Kitada, Gangjian Qin, Qinghao Fu, Henry W. Querfurth. (2010) Parkin reverses intracellular
-amyloid accumulation and its negative effects on proteasome function. Journal of Neuroscience Research 88:1, 167-178
CrossRef67
Stanley Fahn. (2010) Parkinson's disease: 10 years of progress, 1997-2007. Movement Disorders 25:S1, S2-S14
CrossRef68
Ying Jiao Zhao, Hwee Lin Wee, Yiong-Huak Chan, Soo Hoon Seah, Wing Lok Au, Puay Ngoh Lau, Emmanuel Camara Pica, Shu Chuen Li, Nan Luo, Louis C.S. Tan. (2010) Progression of Parkinson's disease as evaluated by Hoehn and Yahr stage transition times. Movement DisordersNA-NA
CrossRef69
S. Lesage, A. Brice. (2010) Basi molecolari del morbo di Parkinson. EMC - Neurologia 10:2, 1-9
CrossRef70
Werner Poewe, Philipp Mahlknecht. (2009) The clinical progression of Parkinson's disease. Parkinsonism & Related Disorders 15, S28-S32
CrossRef71
Jean-François Trempe, Carol X.-Q. Chen, Karl Grenier, Edna Matta Camacho, Guennadi Kozlov, Peter S. McPherson, Kalle Gehring, Edward A. Fon. (2009) SH3 Domains from a Subset of BAR Proteins Define a Ubl-Binding Domain and Implicate Parkin in Synaptic Ubiquitination. Molecular Cell 36:6, 1034-1047
CrossRef72
Caroline Pirkevi, Suzanne Lesage, Alexis Brice, A. Nazli Başak. (2009) From Genes to Proteins in Mendelian Parkinson's Disease: An Overview. The Anatomical Record: Advances in Integrative Anatomy and Evolutionary Biology 292:12, 1893-1901
CrossRef73
Christine Klein, Susanne A. Schneider, Anthony E. Lang. (2009) Hereditary parkinsonism: Parkinson disease look-alikes-An algorithm for clinicians to “ PARK ” genes and beyond. Movement Disorders 24:14, 2042-2058
CrossRef74
Lauren Martz. (2009) Rat race in PD. Science-Business eXchange 2:41,
CrossRef75
Nadège Limousin, Eric Konofal, Elias Karroum, Ebba Lohmann, Ioannis Theodorou, Alexandra Dürr, Isabelle Arnulf. (2009) Restless legs syndrome, rapid eye movement sleep behavior disorder, and hypersomnia in patients with two parkin mutations. Movement Disorders 24:13, 1970-1976
CrossRef76
Rodolphe Perrot, Joël Eyer. (2009) Neuronal intermediate filaments and neurodegenerative disorders. Brain Research Bulletin 80:4-5, 282-295
CrossRef77
Kathleen M. Fitzpatrick, James Raschke, Marina E. Emborg. (2009) Cell-Based Therapies for Parkinson's Disease: Past, Present, and Future. Antioxidants & Redox Signaling 11:9, 2189-2208
CrossRef78
U. Muller. (2009) The monogenic primary dystonias. Brain 132:8, 2005-2025
CrossRef79
Isabel Rubio, José Antonio Rodríguez-Navarro, Cristina Tomás-Zapico, Carolina Ruíz, María José Casarejos, Juan Perucho, Ana Gómez, Izaskun Rodal, José J. Lucas, María Angeles Mena, Justo García de Yébenes. (2009) Effects of partial suppression of parkin on huntingtin mutant R6/1 mice. Brain Research 1281, 91-100
CrossRef80
Karen Nuytemans, Bram Meeus, David Crosiers, Nathalie Brouwers, Dirk Goossens, Sebastiaan Engelborghs, Philippe Pals, Barbara Pickut, Marleen Van den Broeck, Ellen Corsmit, Patrick Cras, Peter P. De Deyn, Jurgen Del-Favero, Christine Van Broeckhoven, Jessie Theuns. (2009) Relative contribution of simple mutations vs. copy number variations in five Parkinson disease genes in the Belgian population. Human Mutation 30:7, 1054-1061
CrossRef81
Julien Dusonchet, Jean-Charles Bensadoun, Bernard L. Schneider, Patrick Aebischer. (2009) Targeted overexpression of the parkin substrate Pael-R in the nigrostriatal system of adult rats to model Parkinson's disease. Neurobiology of Disease 35:1, 32-41
CrossRef82
Cécile Cazeneuve, Channkanira Sân, Salah A. Ibrahim, Maowia M. Mukhtar, Musa M. Kheir, Eric LeGuern, Alexis Brice, Mustafa A. Salih. (2009) A new complex homozygous large rearrangement of the PINK1 gene in a Sudanese family with early onset Parkinson’s disease. neurogenetics 10:3, 265-270
CrossRef83
Juliet M. Taylor, Ruey-Meei Wu, Matthew J. Farrer, Martin B. Delatycki, Paul J. Lockhart. (2009) Analysis of PArkin Co-Regulated Gene in a Taiwanese–Ethnic Chinese cohort with early-onset Parkinson's disease. Parkinsonism & Related Disorders 15:6, 417-421
CrossRef84
Thomas Gasser. (2009) Molecular pathogenesis of Parkinson disease: insights from genetic studies. Expert Reviews in Molecular Medicine 11,
CrossRef85
Tohru Kitada, Antonio Pisani, Maha Karouani, Marian Haburcak, Giuseppina Martella, Anne Tscherter, Paola Platania, Bei Wu, Emmanuel N. Pothos, Jie Shen. (2009) Impaired dopamine release and synaptic plasticity in the striatum of Parkin −/− mice. Journal of Neurochemistry 110:2, 613-621
CrossRef86
H. F. Harbo, J. Finsterer, J. Baets, C. Van Broeckhoven, S. Di Donato, B. Fontaine, P. De Jonghe, A. Lossos, T. Lynch, C. Mariotti, L. Schöls, A. Spinazzola, Z. Szolnoki, S. J. Tabrizi, C. Tallaksen, M. Zeviani, J.-M. Burgunder, T. Gasser. (2009) EFNS guidelines on the molecular diagnosis of neurogenetic disorders: general issues, Huntington’s disease, Parkinson’s disease and dystonias. European Journal of Neurology 16:7, 777-785
CrossRef87
F. Clot, D. Grabli, C. Cazeneuve, E. Roze, P. Castelnau, B. Chabrol, P. Landrieu, K. Nguyen, G. Ponsot, M. Abada, D. Doummar, P. Damier, R. Gil, S. Thobois, A. J. Ward, M. Hutchinson, A. Toutain, F. Picard, A. Camuzat, E. Fedirko, C. San, D. Bouteiller, E. LeGuern, A. Durr, M. Vidailhet, A. Brice, . (2009) Exhaustive analysis of BH4 and dopamine biosynthesis genes in patients with Dopa-responsive dystonia. Brain 132:7, 1753-1763
CrossRef88
Yunjong Lee. (2009) Mitochondrial Biology in Parkinson's Disease. Interdisciplinary Bio Central 1:2, 1-19
CrossRef89
John Hardy, Patrick Lewis, Tamas Revesz, Andrew Lees, Coro Paisan-Ruiz. (2009) The genetics of Parkinson's syndromes: a critical review. Current Opinion in Genetics & Development 19:3, 254-265
CrossRef90
Hiroyuki Tomiyama, Yuanzhe Li, Hiroyo Yoshino, Yoshikuni Mizuno, Shin-ichiro Kubo, Tatsushi Toda, Nobutaka Hattori. (2009) Mutation analysis for DJ-1 in sporadic and familial parkinsonism: Screening strategy in parkinsonism. Neuroscience Letters 455:3, 159-161
CrossRef91
M. M. Wickremaratchi, Y. Ben-Shlomo, H. R. Morris. (2009) The effect of onset age on the clinical features of Parkinson’s disease. European Journal of Neurology 16:4, 450-456
CrossRef92
Susanne A. Schneider, Kailash P. Bhatia, John Hardy. (2009) Complicated recessive dystonia parkinsonism syndromes. Movement Disorders 24:4, 490-499
CrossRef93
Soraya Bardien, Rowena Keyser, Yandiswa Yako, Debbie Lombard, Jonathan Carr. (2009) Molecular analysis of the parkin gene in South African patients diagnosed with Parkinson's disease. Parkinsonism & Related Disorders 15:2, 116-121
CrossRef94
George D. Mellick, Gerhard A. Siebert, Manabu Funayama, Daniel D. Buchanan, Yuanzhe Li, Yoko Imamichi, Hiroyo Yoshino, Peter A. Silburn, Nobutaka Hattori. (2009) Screening PARK genes for mutations in early-onset Parkinson's disease patients from Queensland, Australia. Parkinsonism & Related Disorders 15:2, 105-109
CrossRef95
Marco D'Amelio, Paolo Ragonese, Gabriella Sconzo, Paolo Aridon, Giovanni Savettieri. (2009) Parkinson's Disease and Cancer. Annals of the New York Academy of Sciences 1155:1, 324-334
CrossRef96
Velia D’Agata, Adriana Tiralongo, Alessandro Castorina, Gian Marco Leggio, Vincenzo Micale, Maria Luisa Carnazza, Filippo Drago. (2009) Parkin Expression Profile in Dopamine D3 Receptor Knock-Out Mice Brains. Neurochemical Research 34:2, 327-332
CrossRef97
S. Koene, J. Smeitink. (2009) Mitochondrial medicine: entering the era of treatment. Journal of Internal Medicine 265:2, 193-209
CrossRef98
Maria G. Macedo, Dagmar Verbaan, Yue Fang, Stephanie M. van Rooden, Martine Visser, Burcu Anar, Antonella Uras, Justus L. Groen, Patrizia Rizzu, Jacobus J. van Hilten, Peter Heutink. (2009) Genotypic and phenotypic characteristics of Dutch patients with early onset Parkinson's disease. Movement Disorders 24:2, 196-203
CrossRef99
Kathrin Reetz, Christian Gaser, Christine Klein, Johannes Hagenah, Christian Büchel, Stefan Gottschalk, Peter P. Pramstaller, Hartwig R. Siebner, Ferdinand Binkofski. (2009) Structural findings in the basal ganglia in genetically determined and idiopathic Parkinson's disease. Movement Disorders 24:1, 99-103
CrossRef100
Ming-Jen Lee, Ignacio F. Mata, Chin-Hsien Lin, Kai-Yuan Tzen, Sarah J. Lincoln, Rebecca Bounds, Paul J. Lockhart, Mary M. Hulihan, Matthew J. Farrer, Ruey-Meei Wu. (2009) Genotype-phenotype correlates in Taiwanese patients with early-onset recessive parkinsonism. Movement Disorders 24:1, 104-108
CrossRef101
Mindhu M. Wickremaratchi, Elisa Majounie, Huw R. Morris, Nigel M. Williams, Helen Lewis, Steven S. Gill, Sadaquate Khan, Peter Heywood, John Hardy, Charles M. Wiles, Andrew B. Singleton, Niall P. Quinn. (2009) Parkin -related disease clinically diagnosed as a pallido-pyramidal syndrome. Movement Disorders 24:1, 138-140
CrossRef102
Werner Poewe. (2009) Clinical measures of progression in Parkinson's disease. Movement Disorders 24:S2, S671-S676
CrossRef103
Randolph Stephenson, Andrew Siderowf, Matthew B. Stern. (2009) Premotor Parkinson's disease: Clinical features and detection strategies. Movement Disorders 24:S2, S665-S670
CrossRef104
Yih-Ru Wu, Chun-Hsien Wu, Chih-Ying Chao, Chun-Chieh Kuan, Wan-Ling Zhang, Cheng-Kuang Wang, Chun-Yuh Chang, Yi-Chun Chang, Guey-Jen Lee-Chen, Chung-Mei Chen. (2009) Genetic analysis of Parkin in early onset Parkinson's disease (PD): Novel intron 9 g > a single nucleotide polymorphism and risk of Taiwanese PD. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics 9999B, n/a-n/a
CrossRef105
Charbel E.-H. Moussa. (2009) Parkin Attenuates Wild-Type τ Modification in the Presence of β-Amyloid and α-Synuclein. Journal of Molecular Neuroscience 37:1, 25-36
CrossRef106
Esther M. Sammler, Robert J. Swingler, Arlene Stuart, Miratul Muqit. (2009) Dopamine dysregulation syndrome in a patient with early onset Parkinsonism and Parkin gene mutations. Movement DisordersNA-NA
CrossRef107
M.A. Mena, M.J. Casarejos, R. Solano, J.A. Rodríguez-Navarro, A. Gómez, I. Rodal, M. Medina, J.G. de Yebenes. (2009) NP7 protects from cell death induced by oxidative stress in neuronal and glial midbrain cultures from parkin null mice. FEBS Letters 583:1, 168-174
CrossRef108
Andrew Siderowf, Matthew B. Stern. (2008) Premotor Parkinson's disease: Clinical features, detection, and prospects for treatment. Annals of Neurology 64:S2, S139-S147
CrossRef109
Dag Aarsland, Mona K Beyer, Martin W Kurz. (2008) Dementia in Parkinsonʼs disease. Current Opinion in Neurology 21:6, 676-682
CrossRef110
Julia C. Fitzgerald, Helene Plun-Favreau. (2008) Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease - a common pathway?. FEBS Journal 275:23, 5758-5766
CrossRef111
Subhankar Paul. (2008) Dysfunction of the ubiquitin-proteasome system in multiple disease conditions: therapeutic approaches. BioEssays 30:11-12, 1172-1184
CrossRef112
Heather Mortiboys, Kelly Jean Thomas, Werner J. H. Koopman, Stefanie Klaffke, Patrick Abou-Sleiman, Simon Olpin, Nicholas W. Wood, Peter H. G. M. Willems, Jan A. M. Smeitink, Mark R. Cookson, Oliver Bandmann. (2008) Mitochondrial function and morphology are impaired in parkin -mutant fibroblasts. Annals of Neurology 64:5, 555-565
CrossRef113
Zen Kobayashi, Hirotomo Miake, Hiroto Fujigasaki. (2008) Brain perfusion abnormalities in a sibship with parkin-linked parkinsonism. Parkinsonism & Related Disorders 14:7, 581-583
CrossRef114
Ji-Feng Guo, Bin Xiao, Bing Liao, Xue-Wei Zhang, Li-Luo Nie, Yu-Hu Zhang, Lu Shen, Hong Jiang, Kun Xia, Qian Pan, Xin-Xiang Yan, Bei-Sha Tang. (2008) Mutation analysis of Parkin , PINK1 , DJ-1 and ATP13A2 genes in Chinese patients with autosomal recessive early-onset Parkinsonism. Movement Disorders 23:14, 2074-2079
CrossRef115
Susanne A. Schneider, Penelope Talelli, Binith J. Cheeran, Naheed L. Khan, Nicholas W. Wood, John C. Rothwell, Kailash P. Bhatia. (2008) Motor cortical physiology in patients and asymptomatic carriers of parkin gene mutations. Movement Disorders 23:13, 1812-1819
CrossRef116
M. I. Shadrina, P. A. Slominsky. (2008) Mitochondrial dysfunction and oxidative damage in the molecular pathology of Parkinson’s disease. Molecular Biology 42:5, 720-728
CrossRef117
Jung Mi Choi, Myoung Soo Woo, Hyeo-Il Ma, Suk Yun Kang, Young-Hee Sung, Seok Woo Yong, Sun Ju Chung, Joong-Seok Kim, Hae-won Shin, Chul Hyoung Lyoo, Phil Hyu Lee, Jong Sam Baik, Sang-Jin Kim, Mee Young Park, Young Ho Sohn, Jin-Ho Kim, Jae Woo Kim, Myung Sik Lee, Myoung Chong Lee, Dong-Hyun Kim, Yun Joong Kim. (2008) Analysis of PARK genes in a Korean cohort of early-onset Parkinson disease. Neurogenetics 9:4, 263-269
CrossRef118
Hua-Qin Wang, Yuzuru Imai, Haruhisa Inoue, Ayane Kataoka, Sachiko Iita, Nobuyuki Nukina, Ryosuke Takahashi. (2008) Pael-R transgenic mice crossed with parkin deficient mice displayed progressive and selective catecholaminergic neuronal loss. Journal of Neurochemistry 107:1, 171-185
CrossRef119
Mauro Fasano, Tiziana Alberio, Leonardo Lopiano. (2008) Peripheral biomarkers of Parkinson’s disease as early reporters of central neurodegeneration. Biomarkers in Medicine 2:5, 465-478
CrossRef120
Saskia Biskup, Manfred Gerlach, Andreas Kupsch, Heinz Reichmann, Peter Riederer, Peter Vieregge, Ullrich Wüllner, Thomas Gasser. (2008) Genes associated with Parkinson syndrome. Journal of Neurology 255:S5, 8-17
CrossRef121
Christopher F. McNicoll, Jeanne C. Latourelle, Marcy E. MacDonald, Mark F. Lew, Oksana Suchowersky, Christine Klein, Lawrence I. Golbe, Margery H. Mark, John H. Growdon, G. Frederick Wooten, Ray L. Watts, Mark Guttman, Brad A. Racette, Joel S. Perlmutter, Anwar Ahmed, Holly A. Shill, Carlos Singer, Marie H. Saint-Hilaire, Tiffany Massood, Karen W. Huskey, Anita L. DeStefano, Tammy Gillis, Jayalakshmi Mysore, Stefano Goldwurm, Gianni Pezzoli, Kenneth B. Baker, Ilia Itin, Irene Litvan, Garth Nicholson, Alastair Corbett, Martha Nance, Edward Drasby, Stuart Isaacson, David J. Burn, Patrick F. Chinnery, Peter P. Pramstaller, Jomana Al-Hinti, Anette T. Moller, Karen Ostergaard, Scott J. Sherman, Richard Roxburgh, Barry Snow, John T. Slevin, Franca Cambi, James F. Gusella, Richard H. Myers. (2008) Huntington CAG repeat size does not modify onset age in familial Parkinson's disease: The Gene PD study. Movement Disorders 23:11, 1596-1601
CrossRef122
Anna Håkansson, Andrea Carmine Belin, Camilla Stiller, Olof Sydow, Bo Johnels, Lars Olson, Björn Holmberg, Hans Nissbrandt. (2008) Investigation of genes related to familial forms of Parkinson's disease – With focus on the Parkin gene. Parkinsonism & Related Disorders 14:6, 520-522
CrossRef123
Giovanni Savettieri, Grazia Annesi, Donatella Civitelli, Innocenza Claudia Cirò Candiano, Giuseppe Salemi, Paolo Ragonese, Ferdinanda Annesi, Patrizia Tarantino, Valeria Terruso, Marco D'Amelio, Aldo Quattrone. (2008) Identification of the novel D297fsX318 PINK1 mutation and phenotype variation in a family with early-onset Parkinson's disease. Parkinsonism & Related Disorders 14:6, 509-512
CrossRef124
Rodolphe Perrot, Raphael Berges, Arnaud Bocquet, Joel Eyer. (2008) Review of the Multiple Aspects of Neurofilament Functions, and their Possible Contribution to Neurodegeneration. Molecular Neurobiology 38:1, 27-65
CrossRef125
Daniel G Healy, Mario Falchi, Sean S O'Sullivan, Vincenzo Bonifati, Alexandra Durr, Susan Bressman, Alexis Brice, Jan Aasly, Cyrus P Zabetian, Stefano Goldwurm, Joaquim J Ferreira, Eduardo Tolosa, Denise M Kay, Christine Klein, David R Williams, Connie Marras, Anthony E Lang, Zbigniew K Wszolek, Jose Berciano, Anthony HV Schapira, Timothy Lynch, Kailash P Bhatia, Thomas Gasser, Andrew J Lees, Nicholas W Wood. (2008) Phenotype, genotype, and worldwide genetic penetrance of LRRK2-associated Parkinson's disease: a case-control study. The Lancet Neurology 7:7, 583-590
CrossRef126
Furong Yu, Jianhua Zhou. (2008) Parkin is ubiquitinated by Nrdp1 and abrogates Nrdp1-induced oxidative stress. Neuroscience Letters 440:1, 4-8
CrossRef127
Darren J. Moore, Andrew B. West, Dustin A. Dikeman, Valina L. Dawson, Ted M. Dawson. (2008) Parkin mediates the degradation-independent ubiquitination of Hsp70. Journal of Neurochemistry 105:5, 1806-1819
CrossRef128
Carola Schiesling, Nicole Kieper, Kay Seidel, Rejko Krüger. (2008) Review: Familial Parkinson's disease – genetics, clinical phenotype and neuropathology in relation to the common sporadic form of the disease. Neuropathology and Applied Neurobiology 34:3, 255-271
CrossRef129
Daniel Kam Yin Chan, Vincent Mok, Ping Wing Ng, Jonas Yeung, John B. Kwok, Zhi Ming Fang, Raymond Clarke, Lawrence Wong, Peter R. Schofield, Nobutaka Hattori. (2008) PARK2 mutations and clinical features in a Chinese population with early-onset Parkinson’s disease. Journal of Neural Transmission 115:5, 715-719
CrossRef130
Christopher Schroeder, Michael Walter, Daniela Berg, Petra Leitner, Peter Bauer, Zacharias Kohl, Jürgen Winkler, Olaf Riess, Michael Bonin. (2008) High-Throughput Homogeneous Mass Cleave Assay Technology for the Diagnosis of Autosomal Recessive Parkinson's Disease. The Journal of Molecular Diagnostics 10:3, 217-224
CrossRef131
Francesca Sironi, Paola Primignani, Michela Zini, Sara Tunesi, Claudio Ruffmann, Sara Ricca, Tiziana Brambilla, Angelo Antonini, Silvana Tesei, Margherita Canesi, Anna Zecchinelli, Claudio Mariani, Nicoletta Meucci, Giorgio Sacilotto, Roberto Cilia, Ioannis U. Isaias, Barbara Garavaglia, Daniele Ghezzi, Maurizio Travi, Adriano Decarli, Domenico A. Coviello, Gianni Pezzoli, Stefano Goldwurm. (2008) Parkin analysis in early onset Parkinson's disease. Parkinsonism & Related Disorders 14:4, 326-333
CrossRef132
Cam Patterson, J
CrossRef133
Shoichi Sasaki, Akiko Shirata, Kiyomi Yamane, Makoto Iwata. (2008) Involvement of spinal motor neurons in parkin-positive autosomal recessive juvenile parkinsonism. Neuropathology 28:1, 74-80
CrossRef134
Hao Deng, Weidong Le, Joohi Shahed, Wenjie Xie, Joseph Jankovic. (2008) Mutation analysis of the parkin and PINK1 genes in American Caucasian early-onset Parkinson disease families. Neuroscience Letters 430:1, 18-22
CrossRef135
Anthony HV Schapira. (2008) Mitochondria in the aetiology and pathogenesis of Parkinson's disease. The Lancet Neurology 7:1, 97-109
CrossRef136
Yiwen Chen, Feng Ding, Huifen Nie, Adrian W. Serohijos, Shantanu Sharma, Kyle C. Wilcox, Shuangye Yin, Nikolay V. Dokholyan. (2008) Protein folding: Then and now. Archives of Biochemistry and Biophysics 469:1, 4-19
CrossRef137
Serena Rosner, Nir Giladi, Avi Orr-Urtreger. (2008) Advances in the genetics of Parkinson's disease. Acta Pharmacologica Sinica 29:1, 21-34
CrossRef138
Fatih Bayrakli, Kaya Bilguvar, Christopher E. Mason, Michael L. DiLuna, Yasar Bayri, Levent Gungor, Murat Terzi, Shrikant M. Mane, Richard P. Lifton, Matthew W. State, Murat Gunel. (2007) Rapid identification of disease-causing mutations using copy number analysis within linkage intervals. Human Mutation 28:12, 1236-1240
CrossRef139
Nathan Pankratz, Tatiana Foroud. (2007) Genetics of Parkinson disease. Genetics in Medicine 9:12, 801-811
CrossRef140
Oronzo Scarciolla, Francesco Brancati, Enza Maria Valente, Alessandro Ferraris, Maria Vittoria De Angelis, Stefano Valbonesi, Barbara Garavaglia, Antonino Uncini, Giandomenico Palka, Liborio Stuppia, Bruno Dallapiccola. (2007) Multiplex ligation-dependent probe amplification assay for simultaneous detection of Parkinson's disease gene rearrangements. Movement Disorders 22:15, 2274-2278
CrossRef141
A Biswas, M Maulik, SK Das, , K Ray, J Ray. (2007) Parkin polymorphisms: risk for Parkinson’s disease in Indian population. Clinical Genetics 72:5, 484-486
CrossRef142
Owen A. Ross, Kristoffer Haugarvoll, Jeremy T. Stone, Michael G. Heckman, Linda R. White, Jan O. Aasly, J. Mark Gibson, Timothy Lynch, Zbigniew K. Wszolek, Ryan J. Uitti, Matthew J. Farrer. (2007) Lack of evidence for association of Parkin promoter polymorphism (PRKN-258) with increased risk of Parkinson's disease. Parkinsonism & Related Disorders 13:7, 386-388
CrossRef143
Xin-Ran Zhu, Lyutha Maskri, Christina Herold, Verian Bader, Christine C. Stichel, Onur Güntürkün, Hermann Lübbert. (2007) Non-motor behavioural impairments in parkin-deficient mice. European Journal of Neuroscience 26:7, 1902-1911
CrossRef144
Hui Yang, Hai-Yan Zhou, Biao LI, Guo-Zhong Niu, Sheng-Di Chen. (2007) Downregulation of Parkin Damages Antioxidant Defenses and Enhances Proteasome Inhibition-Induced Toxicity in PC12 Cells. Journal of Neuroimmune Pharmacology 2:3, 276-283
CrossRef145
Meng K. Lim, Takeshi Kawamura, Yosuke Ohsawa, Masafumi Ohtsubo, Shuichi Asakawa, Atsushi Takayanagi, Nobuyoshi Shimizu. (2007) Parkin interacts with LIM Kinase 1 and reduces its cofilin-phosphorylation activity via ubiquitination. Experimental Cell Research 313:13, 2858-2874
CrossRef146
Jose A. Rodríguez-Navarro, M. José Casarejos, Jaime Menéndez, Rosa M. Solano, Izaskun Rodal, Ana Gómez, Justo García de Yébenes, Maria A. Mena. (2007) Mortality, oxidative stress and tau accumulation during ageing in parkin null mice. Journal of Neurochemistry 0:0, 070710052154006-???
CrossRef147
Christine Klein, Katja Lohmann-Hedrich, Ekaterina Rogaeva, Michael G Schlossmacher, Anthony E Lang. (2007) Deciphering the role of heterozygous mutations in genes associated with parkinsonism. The Lancet Neurology 6:7, 652-662
CrossRef148
Eng-King Tan, Lisa M. Skipper. (2007) Pathogenic mutations in Parkinson disease. Human Mutation 28:7, 641-653
CrossRef149
Joaquim J. Ferreira, Leonor Correia Guedes, Mário Miguel Rosa, Miguel Coelho, Marina van Doeselaar, Dorothea Schweiger, Alessio Di Fonzo, Ben A. Oostra, Cristina Sampaio, Vincenzo Bonifati. (2007) High prevalence ofLRRK2 mutations in familial and sporadic Parkinson's disease in Portugal. Movement Disorders 22:8, 1194-1201
CrossRef150
Michael R Douglas, Alistair J Lewthwaite, David J Nicholl. (2007) Genetics of Parkinson’s disease and parkinsonism. Expert Review of Neurotherapeutics 7:6, 657-666
CrossRef151
Lorraine N. Clark, Eneli Haamer, Helen Mejia-Santana, Juliette Harris, Suzanne Lesage, Alexandra Durr, Sabine Janin Bs, Katja Hedrich, Elan D. Louis, Lucien J. Cote, Howard Andrews, Stanley Fahn, Cheryl Waters, Blair Ford, Steven Frucht, William Scott, Christine Klein, Alexis Brice, Hanno Roomere, Ruth Ottman, Karen Marder. (2007) Construction and validation of a Parkinson's disease mutation genotyping array for the Parkin gene. Movement Disorders 22:7, 932-937
CrossRef152
Isabella Ghione, Alessio Di Fonzo, Francesca Saladino, Roberto Del Bo, Nereo Bresolin, Giacomo Pietro Comi, Mario Rango. (2007) Parkin polymorphisms and environmental exposure: Decrease in age at onset of Parkinson's disease. NeuroToxicology 28:3, 698-701
CrossRef153
S. N. Illarioshkin, M. I. Shadrina, P. A. Slominsky, E. V. Bespalova, T. B. Zagorovskaya, G. Kh. Bagyeva, E. D. Markova, S. A. Limborska, I. A. Ivanova-Smolenskaya. (2007) A common leucine-rich repeat kinase 2 gene mutation in familial and sporadic Parkinson's disease in Russia. European Journal of Neurology 14:4, 413-417
CrossRef154
M. C. Shih, A. C. Felicio, C. de Oliveira Godeiro-Junior, P. de Carvalho Aguiar, L. A. F. de Andrade, H. B. Ferraz, R. A. Bressan. (2007) Molecular imaging in hereditary forms of parkinsonism. European Journal of Neurology 14:4, 359-368
CrossRef155
Francesca Del Sorbo, Antonio E. Elia, Gabriella De Joanna, Luigi M. Romito, Barbara Garavaglia, Alberto Albanese. (2007) Normal cardiovascular reflex testing in patients withparkin disease. Movement Disorders 22:4, 528-532
CrossRef156
Lilach Ephraty, Omer Porat, David Israeli, Oren S. Cohen, Olga Tunkel, Shinar Yael, Yasaku Hatano, Nobutaka Hattori, Sharon Hassin-Baer. (2007) Neuropsychiatric and cognitive features in autosomal-recessive early parkinsonism due to PINK1 mutations. Movement Disorders 22:4, 566-569
CrossRef157
Thomas Gasser. (2007) Update on the genetics of Parkinson's disease. Movement Disorders 22:S17, S343-S350
CrossRef158
Enrico Schmidt, Mark Seifert, Ralf Baumeister. (2007) <i>Caenorhabditis elegans </i>as a Model System for Parkinson’s Disease. Neurodegenerative Diseases 4:2-3, 199-217
CrossRef159
Suzanne Lesage, Periquet Magali, Ebba Lohmann, Lucette Lacomblez, Helio Teive, Sabine Janin, Pierre-Yves Cousin, Alexandra Dürr, Alexis Brice, . (2007) Deletion of the parkin and PACRG gene promoter in early-onset parkinsonism. Human Mutation 28:1, 27-32
CrossRef160
Suzanne Lesage, Laurence Leclere, Ebba Lohmann, Michel Borg, Merle Ruberg, Alexandra Dürr, Alexis Brice. (2007) Frequency of the <i>LRRK2 </i>G2019S Mutation in Siblings with Parkinson’s Disease. Neurodegenerative Diseases 4:2-3, 195-198
CrossRef161
Denise M. Kay, Dawn Moran, Lina Moses, Parvoneh Poorkaj, Cyrus P. Zabetian, John Nutt, Stewart A. Factor, Chang-En Yu, Jennifer S. Montimurro, Robert G. Keefe, Gerard D. Schellenberg, Haydeh Payami. (2007) Heterozygous parkin point mutations are as common in control subjects as in Parkinson's patients. Annals of Neurology 61:1, 47-54
CrossRef162
Christian Wider, Zbigniew K. Wszolek. (2007) Clinical genetics of Parkinson's disease and related disorders. Parkinsonism & Related Disorders 13, S229-S232
CrossRef163
Vincenzo Bonifati. (2007) Genetics of parkinsonism. Parkinsonism & Related Disorders 13, S233-S241
CrossRef164
Joseph Jankovic. 2007. Movement Disorders. , 735-763.
CrossRef165
Werner Poewe. (2006) The natural history of Parkinson’s disease. Journal of Neurology 253:S7, vii2-vii6
CrossRef166
Eduardo Tolosa, Yaroslau Compta. (2006) Dystonia in Parkinson’s disease. Journal of Neurology 253:S7, vii7-vii13
CrossRef167
A. Wood-Kaczmar, S. Gandhi, N.W. Wood. (2006) Understanding the molecular causes of Parkinson's disease. Trends in Molecular Medicine 12:11, 521-528
CrossRef168
C. Warren Olanow, Kevin St. P. McNaught. (2006) Ubiquitin–proteasome system and Parkinson's disease. Movement Disorders 21:11, 1806-1823
CrossRef169
2006. Parkinson's Disease. .
CrossRef170
John Hardy, Huaiban Cai, Mark R. Cookson, Katrina Gwinn-Hardy, Andrew Singleton. (2006) Genetics of Parkinson's disease and parkinsonism. Annals of Neurology 60:4, 389-398
CrossRef171
Jacobo Lester, Enrique Otero-Siliceo. (2006) Parkinson??s Disease and Genetics. The Neurologist 12:5, 240-244
CrossRef172
Katja Hedrich, Susen Winkler, Johann Hagenah, Kemal Kabakci, Meike Kasten, Eberhard Schwinger, Jens Volkmann, Peter P. Pramstaller, Vladimir Kostic, Peter Vieregge, Christine Klein. (2006) RecurrentLRRK2 (Park8) mutations in early-onset Parkinson's disease. Movement Disorders 21:9, 1506-1510
CrossRef173
Ditte Bjerre, Lone Bruhn Madsen, Christian Bendixen, Knud Larsen. (2006) Porcine Parkin: Molecular cloning of PARK2 cDNA, expression analysis, and identification of a splicing variant. Biochemical and Biophysical Research Communications 347:3, 803-813
CrossRef174
Denise M. Kay, Tom D. Bird, Cyrus P. Zabetian, Stewart A. Factor, Ali Samii, Donald S. Higgins, John Nutt, John W. Roberts, Alida Griffith, Berta C. Leis, Jennifer S. Montimurro, Sean Philpott, Haydeh Payami. (2006) Validity and Utility of a LRRK2 G2019S Mutation Test for the Diagnosis of Parkinson's Disease. Genetic Testing 10:3, 221-227
CrossRef175
Yan Xiang Yang, Miratul M. K. Muqit, David S. Latchman. (2006) Induction of parkin expression in the presence of oxidative stress. European Journal of Neuroscience 24:5, 1366-1372
CrossRef176
Chiara Criscuolo, Giampiero Volpe, Anna De Rosa, Andrea Varrone, Roberta Marongiu, Pietro Mancini, Elena Salvatore, Bruno Dallapiccola, Alessandro Filla, Enza Maria Valente, Giuseppe De Michele. (2006) PINK1 homozygous W437X mutation in a patient with apparent dominant transmission of parkinsonism. Movement Disorders 21:8, 1265-1267
CrossRef177
Lara Fallon, Catherine M.L. Bélanger, Amadou T. Corera, Maria Kontogiannea, Elsa Regan-Klapisz, France Moreau, Jarno Voortman, Michael Haber, Geneviève Rouleau, Thorhildur Thorarinsdottir, Alexis Brice, Paul M.P. van Bergen en Henegouwen, Edward A. Fon. (2006) A regulated interaction with the UIM protein Eps15 implicates parkin in EGF receptor trafficking and PI(3)K–Akt signalling. Nature Cell Biology 8:8, 834-842
CrossRef178
M. I. Shadrina, P. A. Slominsky. (2006) Molecular genetics of Parkinson’s disease. Russian Journal of Genetics 42:8, 858-871
CrossRef179
Hiroyuki Tomiyama, Yuanzhe Li, Manabu Funayama, Kazuko Hasegawa, Hiroyo Yoshino, Shin-Ichiro Kubo, Kenichi Sato, Tatsuya Hattori, Chin-Song Lu, Rivka Inzelberg, Ruth Djaldetti, Eldad Melamed, Rim Amouri, Neziha Gouider-Khouja, Faycal Hentati, Yasuko Hatano, Mei Wang, Yoko Imamichi, Koichi Mizoguchi, Hiroaki Miyajima, Fumiya Obata, Tatsushi Toda, Matthew J. Farrer, Yoshikuni Mizuno, Nobutaka Hattori. (2006) Clinicogenetic study of mutations inLRRK2 exon 41 in Parkinson's disease patients from 18 countries. Movement Disorders 21:8, 1102-1108
CrossRef180
Yoon Suk Kim, Seung-Jae Lee. (2006) Novel covalent modifications of α-synuclein during the recovery from proteasomal dysfunction. Biochemical and Biophysical Research Communications 346:4, 1312-1319
CrossRef181
M. Bauer, M. Ueffing. (2006) Reverse genetics for proteomics: From proteomic discovery to scientific content. Journal of Neural Transmission 113:8, 1033-1040
CrossRef182
Andrew Siderowf, Matthew B. Stern. (2006) Preclinical diagnosis of parkinson’s disease: Are we there yet?. Current Neurology and Neuroscience Reports 6:4, 295-301
CrossRef183
Shin-Ichiro Kubo, Nobutaka Hattori, Yoshikuni Mizuno. (2006) Recessive Parkinson's disease. Movement Disorders 21:7, 885-893
CrossRef184
Cindy Zadikoff, Ekaterina Rogaeva, Ana Djarmati, Christine Sato, Shabnam Salehi-Rad, Peter St. George-Hyslop, Christine Klein, Anthony E. Lang. (2006) Homozygous and heterozygous PINK1 mutations: Considerations for diagnosis and care of Parkinson's disease patients. Movement Disorders 21:6, 875-879
CrossRef185
D. Gosal, O. A. Ross, M. Toft. (2006) Parkinson's disease: the genetics of a heterogeneous disorder. European Journal of Neurology 13:6, 616-627
CrossRef186
Christoph Scherfler, Naheed L. Khan, Nicola Pavese, Andrew J. Lees, Niall P. Quinn, David J. Brooks, Paola P. Piccini. (2006) Upregulation of dopamine D2 receptors in dopaminergic drug-naive patients withparkin gene mutations. Movement Disorders 21:6, 783-788
CrossRef187
Lena Elisabeth Hjermind, Lis Gitte Johannsen, Nenad Blau, Ron Allan Wevers, Christoph-Burkhard Lucking, Jens Michael Hertz, Lars Friberg, Lisbeth Regeur, Jørgen Erik Nielsen, Sven Asger Sørensen. (2006) Dopa-responsive dystonia and early-onset Parkinson's disease in a patient with GTP cyclohydrolase I deficiency?. Movement Disorders 21:5, 679-682
CrossRef188
Kazuhiro Nakaso, Yoshiki Adachi, Kenichi Yasui, Kenji Sakuma, Kenji Nakashima. (2006) Detection of compound heterozygous deletions in the parkin gene of fibroblasts in patients with autosomal recessive hereditary parkinsonism (PARK2). Neuroscience Letters 400:1-2, 44-47
CrossRef189
J. M. Hertz, K. Ostergaard, I. Juncker, S. Pedersen, A. Romstad, L. B. Moller, F. Guttler, E. Dupont. (2006) Low frequency of Parkin, Tyrosine Hydroxylase, and GTP Cyclohydrolase I gene mutations in a Danish population of early-onset Parkinson's Disease. European Journal of Neurology 13:4, 385-390
CrossRef190
Christine Klein, Michael G Schlossmacher. (2006) The genetics of Parkinson disease: implications for neurological care. Nature Clinical Practice Neurology 2:3, 136-146
CrossRef191
Wendy R. Galpern, Anthony E. Lang. (2006) Interface between tauopathies and synucleinopathies: A tale of two proteins. Annals of Neurology 59:3, 449-458
CrossRef192
Patrick M. Abou-Sleiman, Miratul M. K. Muqit, Nicholas W. Wood. (2006) Expanding insights of mitochondrial dysfunction in Parkinson's disease. Nature Reviews Neuroscience 7:3, 207-219
CrossRef193
Hsin F. Chien, Christan F. Rohé, Maria D. L. Costa, Guido J. Breedveld, Ben A. Oostra, Egberto R. Barbosa, Vincenzo Bonifati. (2006) Early-onset Parkinson's disease caused by a novel parkin mutation in a genetic isolate from north-eastern Brazil. Neurogenetics 7:1, 13-19
CrossRef194
P. G. Unschuld, J. Dächsel, F. Darios, A. Kohlmann, E. Casademunt, K. Lehmann-Horn, M. Dichgans, M. Ruberg, A. Brice, T. Gasser, C. B. Lücking. (2006) Parkin Modulates Gene Expression in Control and Ceramide-Treated PC12 Cells. Molecular Biology Reports 33:1, 13-32
CrossRef195
A. Rosa, G. Volpe, L. Marcantonio, L. Santoro, A. Brice, A. Filla, A. Perretti, G. Michele. (2006) Neurophysiological evidence of corticospinal tract abnormality in patients with Parkin mutations. Journal of Neurology 253:3, 275-279
CrossRef196
Benoit I. Giasson, Jason P. Covy, Nancy M. Bonini, Howard I. Hurtig, Matthew J. Farrer, John Q. Trojanowski, Vivianna M. Van Deerlin. (2006) Biochemical and pathological characterization of Lrrk2. Annals of Neurology 59:2, 315-322
CrossRef197
Nobutaka Hattori, Yoshikuni Mizuno. 2006. Parkinson Disease. .
CrossRef198
Lesage, Suzanne, Dürr, Alexandra, , Tazir, Meriem, , Lohmann, Ebba, Leutenegger, Anne-Louise, Janin, Sabine, , Pollak, Pierre, , Brice, Alexis, . (2006) LRRK2 G2019S as a Cause of Parkinson's Disease in North African Arabs. New England Journal of Medicine 354:4, 422-423
Full Text199
Katherine J. Schweitzer, Rüdiger Hilker, Uwe Walter, Lothar Burghaus, Daniela Berg. (2006) Substantia nigra hyperechogenicity as a marker of predisposition and slower progression in Parkinson's disease. Movement Disorders 21:1, 94-98
CrossRef200
Eduardo Tolosa, Gregor Wenning, Werner Poewe. (2006) The diagnosis of Parkinson's disease. The Lancet Neurology 5:1, 75-86
CrossRef201
Magali Periquet, Olga Corti, Sandrine Jacquier, Alexis Brice. (2005) Proteomic analysis of parkin knockout mice: alterations in energy metabolism, protein handling and synaptic function. Journal of Neurochemistry 95:5, 1259-1276
CrossRef202
E. K. Tan, H. Shen, J. M. M. Tan, K. L. Lim, S. Fook-Chong, W. P. Hu, M. C. Paterson, V. R. Chandran, K. Yew, C. Tan, Y. Yuen, R. Pavanni, M. C. Wong, K. Puvan, Y. Zhao. (2005) Differential expression of splice variant and wild-type parkin in sporadic Parkinson's disease. Neurogenetics 6:4, 179-184
CrossRef203
Dominic C. Paviour, Tamas Revesz, Janice L. Holton, Andrew Evans, Jan-Edvin Olsson, Andrew J. Lees. (2005) Neuronal intranuclear inclusion disease: Report on a case originally diagnosed as dopa-responsive dystonia with Lewy bodies. Movement Disorders 20:10, 1345-1349
CrossRef204
Alistair J. Lewthwaite, David J. Nicholl. (2005) Genetics of Parkinsonism. Current Neurology and Neuroscience Reports 5:5, 397-404
CrossRef205
Christine Klein, Ana Djarmati, Katja Hedrich, Nora Schäfer, Cesa Scaglione, Roberta Marchese, Norman Kock, Birgitt Schüle, Anja Hiller, Thora Lohnau, Susen Winkler, Karin Wiegers, Robert Hering, Peter Bauer, Olaf Riess, Giovanni Abbruzzese, Paolo Martinelli, Peter P Pramstaller. (2005) PINK1, Parkin, and DJ-1 mutations in Italian patients with early-onset parkinsonism. European Journal of Human Genetics 13:9, 1086-1093
CrossRef206
Peter P. Pramstaller, Michael G. Schlossmacher, Thomas S. Jacques, Francesco Scaravilli, Cordula Eskelson, Imelda Pepivani, Katja Hedrich, Susanna Adel, Melissa Gonzales-McNeal, Rüdiger Hilker, Patricia L. Kramer, Christine Klein. (2005) Lewy body Parkinson's disease in a large pedigree with 77Parkin mutation carriers. Annals of Neurology 58:3, 411-422
CrossRef207
Jin H. Son, Hibiki Kawamata, Myung S. Yoo, Dae J. Kim, Young K. Lee, SooYoul Kim, Ted M. Dawson, Hui Zhang, David Sulzer, Lichuan Yang, M. Flint Beal, Lorraine A. DeGiorgio, Hong S. Chun, Harriet Baker, Chu Peng. (2005) Neurotoxicity and behavioral deficits associated with Septin 5 accumulation in dopaminergic neurons. Journal of Neurochemistry 94:4, 1040-1053
CrossRef208
Darren J. Moore, Andrew B. West, Valina L. Dawson, Ted M. Dawson. (2005) MOLECULAR PATHOPHYSIOLOGY OF PARKINSON'S DISEASE. Annual Review of Neuroscience 28:1, 57-87
CrossRef209
Sheila M. Fleming, Pierre-Olivier Fernagut, Marie-Françoise Chesselet. (2005) Genetic mouse models of parkinsonism: Strengths and limitations. NeuroRX 2:3, 495-503
CrossRef210
I MATA, V ALVAREZ, E COTO, M BLAZQUEZ, L GUISASOLA, C SALVADOR, J KACHERGUS, S LINCOLN, M FARRER. (2005) Homozygous partial genomic triplication of the parkin gene in early-onset parkinsonism. Neuroscience Letters 380:3, 257-259
CrossRef211
Alexis Elbaz, Brett J. Peterson, James H. Bower, Ping Yang, Demetrius M. Maraganore, Shannon K. McDonnell, J. Eric Ahlskog, Walter A. Rocca. (2005) Risk of cancer after the diagnosis of Parkinson's disease: A historical cohort study. Movement Disorders 20:6, 719-725
CrossRef212
T KLOPSTOCK, M ELSTNER, C LUCKING, B MULLERMYHSOK, T GASSER, E BOTZ, P LICHTNER, K HORTNAGEL. (2005) Mutations in the pantothenate kinase gene are not associated with Parkinson disease. Neuroscience Letters 379:3, 195-198
CrossRef213
Naheed L. Khan, Wagner Horta, Louise Eunson, Elizabeth Graham, Janel O. Johnson, Shannon Chang, Mary Davis, Andrew Singleton, Nicholas W. Wood, Andrew J. Lees. (2005) Parkin disease in a Brazilian kindred: Manifesting heterozygotes and clinical follow-up over 10 years. Movement Disorders 20:4, 479-484
CrossRef214
Cheng Wang, Jeanne M. M. Tan, Michelle W. L. Ho, Norazean Zaiden, Siew Heng Wong, Constance L. C. Chew, Pei Woon Eng, Tit Meng Lim, Ted M. Dawson, Kah Leong Lim. (2005) Alterations in the solubility and intracellular localization of parkin by several familial Parkinson's disease-linked point mutations. Journal of Neurochemistry 93:2, 422-431
CrossRef215
Aida M. Bertoli-Avella, Jos
CrossRef216
Jordi Clarimon, Janel Johnson, Okan Dogu, Wagner Horta, Naheed Khan, Andrew J. Lees, John Hardy, Andrew Singleton. (2005) Defining the ends of Parkin exon 4 deletions in two different families with Parkinson's disease. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics 133B:1, 120-123
CrossRef217
Luigi M. A. Romito, Maria F. Contarino, Daniele Ghezzi, Angelo Franzini, Barbara Garavaglia, Alberto Albanese. (2005) High frequency stimulation of the subthalamic nucleus is efficacious in Parkin disease. Journal of Neurology 252:2, 208-211
CrossRef218
Wei-Ping Yu, Jeanne M.M. Tan, Katherine C.M. Chew, Tania Oh, Prasanna Kolatkar, Byrappa Venkatesh, Ted M. Dawson, Kah Leong Lim. (2005) The 350-fold compacted Fugu parkin gene is structurally and functionally similar to human Parkin. Gene 346, 97-104
CrossRef219
Vaidehi Jobanputra, Jonathan Sebat, Jennifer Troge, Wendy Chung, Kwame Anyane-Yeboa, Michael Wigler, Dorothy Warburton. (2005) Application of ROMA (representational oligonucleotide microarray analysis) to patients with cytogenetic rearrangements. Genetics in Medicine 7:2, 111-118
CrossRef220
Douglas E. Crompton, Patrick F. Chinnery, David Bates, Timothy J. Walls, Margaret J. Jackson, Andrew J. Curtis, John Burn. (2005) Spectrum of movement disorders in neuroferritinopathy. Movement Disorders 20:1, 95-99
CrossRef221
Aideen McInerney-Leo, Donald W. Hadley, Katrina Gwinn-Hardy, John Hardy. (2005) Genetic testing in Parkinson's disease. Movement Disorders 20:1, 1-10
CrossRef222
Alexis Brice. (2005) How much does dardarin contribute to Parkinson's disease?. The Lancet 365:9457, 363-364
CrossRef223
Philipp Kahle. (2004) Parkinson: Toxische Fehlfaltung von Eiwei
CrossRef224
Uwe Walter, Christine Klein, Ruediger Hilker, Reiner Benecke, Peter P. Pramstaller, Dirk Dressler. (2004) Brain parenchyma sonography detects preclinical parkinsonism. Movement Disorders 19:12, 1445-1449
CrossRef225
Marsha S.A. Smith, Marian L. Evatt. (2004) Movement disorders in pregnancy. Neurologic Clinics 22:4, 783-798
CrossRef226
Daniel G Healy, Patrick M Abou-Sleiman, Nicholas W Wood. (2004) PINK, PANK, or PARK? A clinicians' guide to familial parkinsonism. The Lancet Neurology 3:11, 652-662
CrossRef227
Rainer Coelln, Valina L. Dawson, Ted M. Dawson. (2004) Parkin-associated Parkinson?s disease. Cell and Tissue Research 318:1, 175-184
CrossRef228
Katja Hedrich, Cordula Eskelson, Beth Wilmot, Karen Marder, Juliette Harris, Jennifer Garrels, Helen Meija-Santana, Peter Vieregge, Helfried Jacobs, Susan B. Bressman, Anthony E. Lang, Martin Kann, Giovanni Abbruzzese, Paolo Martinelli, Eberhard Schwinger, Laurie J. Ozelius, Peter P. Pramstaller, Christine Klein, Patricia Kramer. (2004) Distribution, type, and origin ofParkin mutations: Review and case studies. Movement Disorders 19:10, 1146-1157
CrossRef229
Hatice Kumru, Joan Santamaria, Eduardo Tolosa, Francesc Valldeoriola, Esteban Mu
CrossRef230
Robert Hering, Karsten M. Strauss, Xiao Tao, Andreas Bauer, Dirk Woitalla, Eva-Maria Mietz, Slobodanka Petrovic, Peter Bauer, Wilhelm Schaible, Thomas M
CrossRef231
John Hardy, J. William Langston. (2004) How many pathways are there to nigral death?. Annals of Neurology 56:3, 316-318
CrossRef232
Paul J. Lockhart, Rebecca Bounds, Mary Hulihan, Jennifer Kachergus, Sarah Lincoln, Chin-Hsien Lin, Ruey-Meei Wu, Matthew J. Farrer. (2004) Lack of mutations in DJ-1 in a cohort of Taiwanese ethnic Chinese with early-onset parkinsonism. Movement Disorders 19:9, 1065-1069
CrossRef233
Christan F. Roh
CrossRef234
Enza Maria Valente, Sergio Salvi, Tamara Ialongo, Roberta Marongiu, Antonio Emanuele Elia, Viviana Caputo, Luigi Romito, Alberto Albanese, Bruno Dallapiccola, Anna Rita Bentivoglio. (2004) PINK1 mutations are associated with sporadic early-onset parkinsonism. Annals of Neurology 56:3, 336-341
CrossRef235
Yasuko Hatano, Yuanzhe Li, Kenichi Sato, Shuichi Asakawa, Yasuhiro Yamamura, Hiroyuki Tomiyama, Hiroyo Yoshino, Masato Asahina, Susumu Kobayashi, Sharon Hassin-Baer, Chin-Song Lu, Arlene R. Ng, Raymond L. Rosales, Nobuyoshi Shimizu, Tatsushi Toda, Yoshikuni Mizuno, Nobutaka Hattori. (2004) NovelPINK1 mutations in early-onset parkinsonism. Annals of Neurology 56:3, 424-427
CrossRef236
P. Poorkaj, J. G. Nutt, D. James, S. Gancher, T. D. Bird, E. Steinbart, G. D. Schellenberg, Haydeh Payami. (2004) parkin mutation analysis in clinic patients with early-onset Parkinson's disease. American Journal of Medical Genetics 129A:1, 44-50
CrossRef237
Giovanni Abbruzzese, Simona Pigullo, Angelo Schenone, Emilia Bellone, Roberta Marchese, Emilio Di Maria, Luana Benedetti, Paola Ciotti, Lucilla Nobbio, Vincenzo Bonifati, Franco Ajmar, Paola Mandich. (2004) Does parkin play a role in the peripheral nervous system? A family report. Movement Disorders 19:8, 978-981
CrossRef238
Nobutaka Hattori, Yoshikuni Mizuno. (2004) Pathogenetic mechanisms of parkin in Parkinson's disease. The Lancet 364:9435, 722-724
CrossRef239
Lorraine N. Clark, Shehla Afridi, Helen Mejia-Santana, Juliette Harris, Elan D. Louis, Lucien J. Cote, Howard Andrews, Andrew Singleton, Fabienne Wavrant De-Vrieze, John Hardy, Richard Mayeux, Stanley Fahn, Cheryl Waters, Blair Ford, Steven Frucht, Ruth Ottman, Karen Marder. (2004) Analysis of an early-onset Parkinson's disease cohort for DJ-1 mutations. Movement Disorders 19:7, 796-800
CrossRef240
Okan Dogu, Janel Johnson, Dena Hernandez, Melissa Hanson, John Hardy, Hulya Apaydin, Sibel Özekmekçi, Serhan Sevim, Katrina Gwinn-Hardy, Andrew Singleton. (2004) A consanguineous Turkish family with early-onset Parkinson's disease and an exon 4 parkin deletion. Movement Disorders 19:7, 812-816
CrossRef241
Joseph Wiley, Timothy Lynch, Sarah Lincoln, Lisa Skipper, Mary Hulihan, David Gosal, Gina Bisceglio, Jennifer Kachergus, John Hardy, Matthew J. Farrer. (2004) Parkinson's disease in Ireland: Clinical presentation and genetic heterogeneity in patients with parkin mutations. Movement Disorders 19:6, 677-681
CrossRef242
Wang Tao, Liang Zhihou, Sun Shenggang, Cao Xuebing, Peng Hai, Liu Hongjin, Tong Etang. (2004) Exon deletions of parkin gene in patients with parkinson disease. Journal of Huazhong University of Science and Technology [Medical Sciences] 24:3, 262-265
CrossRef243
Jan C.M. Zijlmans, Susan E. Daniel, Andrew J. Hughes, Tamas Révész, Andrew J. Lees. (2004) Clinicopathological investigation of vascular parkinsonism, including clinical criteria for diagnosis. Movement Disorders 19:6, 630-640
CrossRef244
Abbas Parsian, Rashmi Sinha, Brad Racette, Jing H Zhao, Joel S Perlmutter. (2004) Association of a variation in the promoter region of the brain-derived neurotrophic factor gene with familial Parkinson's disease. Parkinsonism & Related Disorders 10:4, 213-219
CrossRef245
Ali Samii, John G Nutt, Bruce R Ransom. (2004) Parkinson's disease. The Lancet 363:9423, 1783-1793
CrossRef246
Nathan Pankratz, Tatiana Foroud. (2004) Genetics of Parkinson disease. NeuroRX 1:2, 235-242
CrossRef247
A Parsian, B Racette, Z.H Zhang, M Rundle, J.S Perlmutter. (2004) Association of variations in monoamine oxidases A and B with Parkinson's disease subgroups. Genomics 83:3, 454-460
CrossRef248
Robert E. Burke. (2004) Recent Advances in Research on Parkinson Disease: Synuclein and Parkin. The Neurologist 10:2, 75-81
CrossRef249
Lawrence I. Golbe, M. Maral Mouradian. (2004) Alpha-synuclein in Parkinson's disease: Light from two new angles. Annals of Neurology 55:2, 153-156
CrossRef250
Dominic C. Paviour, Robert A.H. Surtees, Andrew J. Lees. (2004) Diagnostic considerations in juvenile parkinsonism. Movement Disorders 19:2, 123-135
CrossRef251
R. Inzelberg, E. Schecthman, D. Paleacu, L. Zach, R. Bonwitt, R.L. Carasso, P. Nisipeanu. (2004) Onset and progression of disease in familial and sporadic Parkinson's disease. American Journal of Medical Genetics 124A:3, 255-258
CrossRef252
Stanley Fahn, David Sulzer. (2004) Neurodegeneration and neuroprotection in Parkinson disease. NeuroRX 1:1, 139-154
CrossRef253
Nathan Pankratz, Tatiana Foroud. (2004) Genetics of Parkinson disease. NeuroRX 1:2, 235
CrossRef254
Stanley Fahn, David Sulzer. (2004) Neurodegeneration and neuroprotection in Parkinson disease. NeuroRX 1:1, 139
CrossRef255
Helen C. Ardley, Philip A. Robinson. (2004) The Role of Ubiquitin-Protein Ligases in Neurodegenerative Disease. Neurodegenerative Diseases 1:2-3, 71-87
CrossRef256
Wen-Jie Gu, Olga Corti, Francisco Araujo, Cornelia Hampe, Sandrine Jacquier, Christoph B Lücking, Nacer Abbas, Charles Duyckaerts, Thomas Rooney, Laurent Pradier, Merle Ruberg, Alexis Brice. (2003) The C289G and C418R missense mutations cause rapid sequestration of human Parkin into insoluble aggregates. Neurobiology of Disease 14:3, 357-364
CrossRef257
Maria Bozi, Kailash P. Bhatia. (2003) Paroxysmal exercise-induced dystonia as a presenting feature of young-onset Parkinson's disease. Movement Disorders 18:12, 1545-1547
CrossRef258
Demetrius M. Maraganore, Matthew J. Farrer, Timothy G. Lesnick, Mariza De Andrade, James H. Bower, Dena Hernandez, John A. Hardy, Walter A. Rocca. (2003) Case-control study of the ?-synuclein interacting protein gene and Parkinson's disease. Movement Disorders 18:11, 1233-1239
CrossRef259
Sarah J. Lincoln, Demetrius M. Maraganore, Timothy G. Lesnick, Rebecca Bounds, Mariza de Andrade, James H. Bower, John A. Hardy, Matthew J. Farrer. (2003) Parkin variants in North American Parkinson's disease: Cases and controls. Movement Disorders 18:11, 1306-1311
CrossRef260
Hyoung-gon Lee, Robert B. Petersen, Xiongwei Zhu, Kazuhiro Honda, Gjumrakch Aliev, Mark A. Smith, George Perry. (2003) Will Preventing Protein Aggregates Live Up to Its Promise as Prophylaxis Against Neurodegenerative Diseases?. Brain Pathology 13:4, 630-638
CrossRef261
Karen Marder, Gilberto Levy, Elan D. Louis, Helen Mejia-Santana, Lucien Cote, Howard Andrews, Juliette Harris, Cheryl Waters, Blair Ford, Steven Frucht, Stanley Fahn, Ruth Ottman. (2003) Familial aggregation of early- and late-onset Parkinson's disease. Annals of Neurology 54:4, 507-513
CrossRef262
Christine Klein, Katja Hedrich, Claudia Wellenbrock, Martin Kann, Juliette Harris, Karen Marder, Anthony E. Lang, Eberhard Schwinger, Laurie J. Ozelius, Peter Vieregge, Peter P. Pramstaller, Patricia L. Kramer. (2003) Frequency ofparkin mutations in late-onset Parkinson's disease. Annals of Neurology 54:3, 415-416
CrossRef263
Patrick M. Abou-Sleiman, Daniel G. Healy, Niall Quinn, Andrew J. Lees, Nicholas W. Wood. (2003) The role of pathogenicDJ-1 mutations in Parkinson's disease. Annals of Neurology 54:3, 283-286
CrossRef264
Darren J. Moore, Valina L. Dawson, Ted M. Dawson. (2003) Genetics of Parkinson's disease: What do mutations in DJ-1 tell us?. Annals of Neurology 54:3, 281-282
CrossRef265
Sergei N. Illarioshkin, Magali Periquet, Nina Rawal, Christoph B. L
CrossRef266
Ebba Lohmann, Magali Periquet, Vincenzo Bonifati, Nick W. Wood, Giuseppe De Michele, Anne-Marie Bonnet, Val
CrossRef267
Marieke Dekker, Vincenzo Bonifati, John van Swieten, Nico Leenders, Robert-Jan Galjaard, Pieter Snijders, Marten Horstink, Peter Heutink, Ben Oostra, Cornelia van Duijn. (2003) Clinical features and neuroimaging ofPARK7-linked parkinsonism. Movement Disorders 18:7, 751-757
CrossRef268
Louis C. Tan, Caroline M. Tanner, Rong Chen, Piu Chan, Matthew Farrer, John Hardy, J. William Langston. (2003) Marked variation in clinical presentation and age of onset in a family with a heterozygous parkin mutation. Movement Disorders 18:7, 758-763
CrossRef269
Merja Lakso, Suvi Vartiainen, Anu-Maarit Moilanen, Jouni Sirviö, James H. Thomas, Richard Nass, Randy D. Blakely, Garry Wong. (2003) Dopaminergic neuronal loss and motor deficits in Caenorhabditis elegans overexpressing human α-synuclein. Journal of Neurochemistry 86:1, 165-172
CrossRef270
Fusun Duzcan, Mehmet Zencir, Fatma Ozdemir, G. Ozan Cetin, Huseyin Bagci, Peter Heutink, Vincenzo Bonifati, Turker Sahiner. (2003) Familial influence on parkinsonism in a rural area of Turkey (K?z?lcaboluk-Denizli): A community-based case-control study. Movement Disorders 18:7, 799-804
CrossRef271
Seung-Jae Lee. (2003) α-Synuclein Aggregation: A Link Between Mitochondrial Defects and Parkinson's Disease?. Antioxidants & Redox Signaling 5:3, 337-348
CrossRef272
Wang Tao, Liang Zhihou, Sun Shenggang, Cao Xuebing, Peng Hai, Cao Fei, Liu Hongjin, Tong E-tang. (2003) Point mutation in the parkin gene on patients with Parkinson’s disease. Journal of Huazhong University of Science and Technology [Medical Sciences] 23:2, 145-147
CrossRef273
Neziha Gouider-Khouja, Abdelmajid Larnaout, Rim Amouri, Sana Sfar, Samir Belal, Christiane Ben Hamida, Mongi Ben Hamida, Nobutaka Hattori, Yoshikuni Mizuno, Fayçal Hentati. (2003) Autosomal recessive parkinsonism linked to parkin gene in a Tunisian family. Clinical, genetic and pathological study. Parkinsonism & Related Disorders 9:5, 247-251
CrossRef274
Sofia A. Oliveira, William K. Scott, Eden R. Martin, Martha A. Nance, Ray L. Watts, Jean P. Hubble, William C. Koller, Rajesh Pahwa, Matthew B. Stern, Bradley C. Hiner, William G. Ondo, Fred H. Allen, Burton L. Scott, Christopher G. Goetz, Gary W. Small, Frank Mastaglia, Jeffrey M. Stajich, Fengyu Zhang, Michael W. Booze, Michelle P. Winn, Lefkos T. Middleton, Jonathan L. Haines, Margaret A. Pericak-Vance, Jeffery M. Vance. (2003) Parkin mutations and susceptibility alleles in late-onset Parkinson's disease. Annals of Neurology 53:5, 624-629
CrossRef275
A West. (2003) Parkin is not regulated by the unfolded protein response in human neuroblastoma cells. Neuroscience Letters 341:2, 139-142
CrossRef276
Guttmacher, Alan E., Collins, Francis S., , Nussbaum, Robert L., Ellis, Christopher E., . (2003) Alzheimer's Disease and Parkinson's Disease. New England Journal of Medicine 348:14, 1356-1364
Full Text277
Nathan Pankratz, William C. Nichols, Sean K. Uniacke, Cheryl Halter, Alice Rudolph, Cliff Shults, P. Michael Conneally, Tatiana Foroud. (2003) Significant Linkage of Parkinson Disease to Chromosome 2q36-37. The American Journal of Human Genetics 72:4, 1053-1057
CrossRef278
Richard Mayeux. (2003) E
PIDEMIOLOGY OF NEURODEGENERATION . Annual Review of Neuroscience 26:1, 81-104
CrossRef279
Hideo Mori, Nobutaka Hattori, Yoshikuni Mizuno. (2003) Genotype-phenotype correlation: Familial Parkinson disease. Neuropathology 23:1, 90-94
CrossRef280
Wood, Alastair J.J., , Evans, William E., McLeod, Howard L., . (2003) Pharmacogenomics — Drug Disposition, Drug Targets, and Side Effects. New England Journal of Medicine 348:6, 538-549
Full Text281
Ted M. Dawson, Valina L. Dawson. (2003) Rare genetic mutations shed light on the pathogenesis of Parkinson disease. Journal of Clinical Investigation 111:2, 145-151
CrossRef282
Lewis R. Sudarsky. 2003. Parkinson's Disease: Recognition, Diagnosis, and Measurement. , 740-743.
CrossRef283
Thomas Gasser, Susan Bressman, Alexandra D
CrossRef284
Thomas T. Warner, Anthony H. V. Schapira. (2003) Genetic and environmental factors in the cause of Parkinson's disease. Annals of Neurology 53:S3, S16-S25
CrossRef285
T. Palomo, R. J. Beninger, R. M. Kostrzewa, T. Archer. (2003) Brain sites of movement disorder: Genetic and environmental agents in neurodevelopmental perturbations. Neurotoxicity Research 5:1-2, 1-26
CrossRef286
P. Riederer. (2003) Is there a subtype of developmental Parkinson's disease?. Neurotoxicity Research 5:1-2, 27-34
CrossRef287
Maria Dolores Ledesma, Cristian Galvan, Bianca Hellias, Carlos Dotti, Poul Henning Jensen. (2002) Astrocytic but not neuronal increased expression and redistribution of parkin during unfolded protein stress. Journal of Neurochemistry 83:6, 1431-1440
CrossRef288
A. H. V. Schapira. (2002) Dopamine agonists and neuroprotection in Parkinson's disease. European Journal of Neurology 9:s3, 7-14
CrossRef289
Andrew A. Hicks, Hj
CrossRef290
W. Poewe, G. Wenning. (2002) The differential diagnosis of Parkinson's disease. European Journal of Neurology 9:s3, 23-30
CrossRef291
Blas Morales, Armando Martínez, Isabel Gonzalo, Lidice Vidal, Raquel Ros, Estrella Gomez-Tortosa, Alberto Rabano, Israel Ampuero, Marina Sánchez, Janet Hoenicka, Justo García de Yébenes. (2002) Steele-Richardson-Olszewski syndrome in a patient with a single C212Y mutation in the parkin protein. Movement Disorders 17:6, 1374-1380
CrossRef292
Kah Leong Lim, Valina L. Dawson, Ted M. Dawson. (2002) The genetics of Parkinson’s disease. Current Neurology and Neuroscience Reports 2:5, 439-446
CrossRef293
Sepideh Zareparsi, Haydeh Payami. (2002) Reply to correspondence from Inzelberg et al.??onset age of Parkinson disease?. American Journal of Medical Genetics 111:4, 461-461
CrossRef294
J. M. Autere, M. J. Hiltunen, A. J. Mannermaa, P. A. Jakala, P. H. Hartikainen, K. Majamaa, I. Alafuzoff, H. S. Soininen. (2002) Molecular genetic analysis of the alpha-synuclein and the parkin gene in Parkinson's disease in Finland. European Journal of Neurology 9:5, 479-483
CrossRef295
I Mata. (2002) Single-nucleotide polymorphisms in the promoter region of the PARKIN gene and Parkinson's disease. Neuroscience Letters 329:2, 149-152
CrossRef296
Nutan Sharma, David G Standaert. (2002) Inherited movement disorders. Neurologic Clinics 20:3, 759-778
CrossRef297
Andrew West, Magali Periquet, Sarah Lincoln, Christoph B. L
CrossRef298
Damian C. Crowther. (2002) Familial conformational diseases and dementias. Human Mutation 20:1, 1-14
CrossRef299
Nathan Pankratz, William C. Nichols, Sean K. Uniacke, Cheryl Halter, Alice Rudolph, Cliff Shults, P. Michael Conneally, Tatiana Foroud. (2002) Genome Screen to Identify Susceptibility Genes for Parkinson Disease in a Sample without parkin Mutations. The American Journal of Human Genetics 71:1, 124-135
CrossRef300
Pramod K. Pal, Joanne Leung, Katya Hedrich, Ali Samii, Abraham Lieberman, Paul A. Nausieda, Donald B. Calne, Xandra O. Breakefield, Christine Klein, A. Jon Stoessl. (2002) [18F]-Dopa positron emission tomography imaging in early-stage, non-parkin juvenile parkinsonism. Movement Disorders 17:4, 789-794
CrossRef301
Ruey-Meei Wu, Din-E Shan, Chen-Ming Sun, Ren-Shyan Liu, Wuh-Liang Hwu, Chun-Hwei Tai, Jennifer Hussey, Andrew West, Katrina Gwinn-Hardy, John Hardy, Judy Chen, Matt Farrer, Sarah Lincoln. (2002) Clinical,18F-dopa PET, and genetic analysis of an ethnic Chinese kindred with early-onset parkinsonism andparkin gene mutations. Movement Disorders 17:4, 670-675
CrossRef302
Paul S. Fishman, George A. Oyler. (2002) Significance of the parkin gene and protein in understanding Parkinson’s disease. Current Neurology and Neuroscience Reports 2:4, 296-302
CrossRef303
Vincenzo Bonifati. (2002) Deciphering Parkinson's disease—PARK8. The Lancet Neurology 1:2, 83
CrossRef304
Martin Kann, Helfried Jacobs, Kathrin Mohrmann, Kirsten Schumacher, Katja Hedrich, Jennifer Garrels, Karin Wiegers, Eberhard Schwinger, Peter P. Pramstaller, Xandra O. Breakefield, Laurie J. Ozelius, Peter Vieregge, Christine Klein. (2002) Role of parkin mutations in 111 community-based patients with early-onset parkinsonism. Annals of Neurology 51:5, 621-625
CrossRef305
Rejko Krüger, Olaf Eberhardt, Olaf Riess, Jörg B Schulz, Olaf Riess. (2002) Parkinson's disease: one biochemical pathway to fit all genes?. Trends in Molecular Medicine 8:5, 236-240
CrossRef306
N.E. Maher, L.J. Currie, A.M. Lazzarini, J.B. Wilk, C.A. Taylor, M.H. Saint-Hilaire, R.G. Feldman, L.I. Golbe, G.F. Wooten, R.H. Myers. (2002) Segregation analysis of Parkinson disease revealing evidence for a major causative gene. American Journal of Medical Genetics 109:3, 191-197
CrossRef307
Michael G. Schlossmacher, Matthew P. Frosch, Wei Ping Gai, Miguel Medina, Nutan Sharma, Lysia Forno, Tomoyo Ochiishi, Hideki Shimura, Ronit Sharon, Nobutaka Hattori, J. William Langston, Yoshikuni Mizuno, Bradley T. Hyman, Dennis J. Selkoe, Kenneth S. Kosik. (2002) Parkin Localizes to the Lewy Bodies of Parkinson Disease and Dementia with Lewy Bodies. The American Journal of Pathology 160:5, 1655-1667
CrossRef308
Rüdiger Hilker, Christine Klein, Katja Hedrich, Laurie J. Ozelius, Peter Vieregge, Karl Herholz, Peter P. Pramstaller, Wolf-Dieter Heiss. (2002) The striatal dopaminergic deficit is dependent on the number of mutant alleles in a family with mutations in the parkin gene: evidence for enzymatic parkin function in humans. Neuroscience Letters 323:1, 50-54
CrossRef309
Anthony E. Lang, Hakan Widner. (2002) Deep brain stimulation for Parkinson's disease: Patient selection and evaluation. Movement Disorders 17:S3, S94-S101
CrossRef310
Peter P. Pramstaller, Bernhard Kis, Cordula Eskelson, Katja Hedrich, Monika Scherer, Eberhard Schwinger, Xandra O. Breakefield, Patricia L. Kramer, Laurie J. Ozelius, Christine Klein. (2002) Phenotypic variability in a large kindred (Family LA) with deletions in theparkin gene. Movement Disorders 17:2, 424-426
CrossRef311
Vincenzo Bonifati, Guido J. Breedveld, Ferdinando Squitieri, Nicola Vanacore, Pierluigi Brustenghi, Biswadjiet S. Harhangi, Pasquale Montagna, Milena Cannella, Giovanni Fabbrini, Patrizia Rizzu, Cornelia M. van Duijn, Ben A. Oostra, Giuseppe Meco, Peter Heutink. (2002) Localization of autosomal recessive early-onset parkinsonism to chromosome 1p36 (PARK7) in an independent dataset. Annals of Neurology 51:2, 253-256
CrossRef312
N. Shimizu. 2002. Parkin. .
CrossRef313
Sepideh Zareparsi, Richard Camicioli, Gary Sexton, Thomas Bird, Phillip Swanson, Jeffrey Kaye, John Nutt, Haydeh Payami. (2002) Age at onset of Parkinson disease and apolipoprotein E genotypes. American Journal of Medical Genetics 107:2, 156-161
CrossRef314
Enza Maria Valente, Francesco Brancati, Alessandro Ferraris, Elizabeth A. Graham, Mary B. Davis, Monique M.B. Breteler, Thomas Gasser, Vincenzo Bonifati, Anna Rita Bentivoglio, Giuseppe De Michele, Alexandra D
CrossRef315
Amy Colcher. (2002) Management of Parkinson’s disease. Expert Review of Neurotherapeutics 2:1, 97-104
CrossRef316
V Alvarez. (2001) Early-onset Parkinson's disease associated with a new parkin mutation in a Spanish family. Neuroscience Letters 313:1-2, 108-110
CrossRef317
Anna R. Bentivoglio, Pietro Cortelli, Enza M. Valente, T
CrossRef318
Joseph Jankovic, Ron Tintner. (2001) Dystonia and parkinsonism. Parkinsonism & Related Disorders 8:2, 109-121
CrossRef319
Andrew West, Matt Farrer, Leonard Petrucelli, Mark Cookson, Paul Lockhart, John Hardy. (2001) Identification and characterization of the human parkin gene promoter. Journal of Neurochemistry 78:5, 1146-1152
CrossRef320
C.M. van Duijn, M.C.J. Dekker, V. Bonifati, R.J. Galjaard, J.J. Houwing-Duistermaat, P.J.L.M. Snijders, L. Testers, G.J. Breedveld, M. Horstink, L.A. Sandkuijl, J.C. van Swieten, B.A. Oostra, P. Heutink. (2001) PARK7, a Novel Locus for Autosomal Recessive Early-Onset Parkinsonism, on Chromosome 1p36. The American Journal of Human Genetics 69:3, 629-634
CrossRef321
Olga Corti, Alexis Brice. (2001) Parkin and Parkinson's: More than homonymy?. Annals of Neurology 50:3, 283-285
CrossRef322
Matt Farrer, Piu Chan, Rong Chen, Louis Tan, Sarah Lincoln, Dena Hernandez, Lysia Forno, Katrina Gwinn-Hardy, Leonard Petrucelli, Jennifer Hussey, Andrew Singleton, Caroline Tanner, John Hardy, J. William Langston. (2001) Lewy bodies and parkinsonism in families withparkin mutations. Annals of Neurology 50:3, 293-300
CrossRef323
Barkur S. Shastry. (2001) Parkinson disease: etiology, pathogenesis and future of gene therapy. Neuroscience Research 41:1, 5-12
CrossRef324
William E. Evans, Julie A. Johnson. (2001) P
HARMACOGENOMICS : The Inherited Basis for Interindividual Differences in Drug Response. Annual Review of Genomics and Human Genetics 2:1, 9-39
CrossRef325
Carolyn A. Rankin, Claudio A. P. Joazeiro, Erik Floor, Tony Hunter. (2001) E3 ubiquitin-protein ligase activity of parkin is dependent on cooperative interaction of RING finger (TRIAD) elements. Journal of Biomedical Science 8:5, 421-429
CrossRef326
Andrew Siderowf. (2001) Parkinson's disease. Neurologic Clinics 19:3, 565-578
CrossRef327
Yoshikuni Mizuno, Nobutaka Hattori, Hideo Mori, Toshiaki Suzuki, Keiji Tanaka. (2001) Parkin and Parkinsonʼs disease. Current Opinion in Neurology 14:4, 477-482
CrossRef328
(2001) EFNS task force on molecular diagnosis of neurologic disorders Guidelines for the molecular diagnosis of inherited neurologic diseases First of two parts. European Journal of Neurology 8:4, 299-314
CrossRef329
Enza Maria Valente, Anna Rita Bentivoglio, Peter H. Dixon, Alessandro Ferraris, Tamara Ialongo, Marina Frontali, Alberto Albanese, Nicholas W. Wood. (2001) Localization of a Novel Locus for Autosomal Recessive Early-Onset Parkinsonism, PARK6, on Human Chromosome 1p35-p36. The American Journal of Human Genetics 68:4, 895-900
CrossRef330
Ruediger Hilker, Christine Klein, Mehran Ghaemi, Bernhard Kis, Tim Strotmann, Laurie J. Ozelius, Olaf Lenz, Peter Vieregge, Karl Herholz, Wolf-Dieter Heiss, Peter P. Pramstaller. (2001) Positron emission tomographic analysis of the nigrostriatal dopaminergic system in familial Parkinsonism associated with mutations in theParkin gene. Annals of Neurology 49:3, 367-376
CrossRef331
Magali Periquet, Christoph B. Lücking, Jenny R. Vaughan, Vincenzo Bonifati, Alexandra Dürr, Giuseppe De Michele, Martin W. Horstink, Matt Farrer, Sergei N. Illarioshkin, Pierre Pollak, Michel Borg, Christine Brefel-Courbon, Patrice Denefle, Giuseppe Meco, Thomas Gasser, Monique M.B. Breteler, Nick W. Wood, Yves Agid, Alexis Brice. (2001) Origin of the Mutations in the parkin Gene in Europe: Exon Rearrangements Are Independent Recurrent Events, whereas Point Mutations May Result from Founder Effects. The American Journal of Human Genetics 68:3, 617-626
CrossRef332
Julie A. Johnson. (2001) Drug Target Pharmacogenomics. American Journal of PharmacoGenomics 1:4, 271-281
CrossRef333
Philipp J. Kahle, Uwe Leimer, Christian Haass. (2000) Does failure of parkin-mediated ubiquitination cause juvenile parkinsonism?. Trends in Biochemical Sciences 25:11, 524-527
CrossRef334
John D. O'Sullivan, Hasmet A. Hanagasi, Susan E. Daniel, Phillip Tidswell, Stephen W. Davies, Andrew J. Lees. (2000) Neuronal intranuclear inclusion disease and juvenile Parkinsonism. Movement Disorders 15:5, 990-995
CrossRef
