Original Article
Testing for Polyomavirus Type BK DNA in Plasma to Identify Renal-Allograft Recipients with Viral Nephropathy
N Engl J Med 2000; 342:1309-1315May 4, 2000
- Abstract
Background
Reactivation of polyomavirus type BK (BK virus) is increasingly recognized as a cause of severe renal-allograft dysfunction. Currently, patients at risk for nephropathy due to infection with the BK virus are identified by the presence of cells containing viral inclusion bodies (“decoy cells”) in the urine or by biopsy of allograft tissue.
Methods
In a retrospective analysis, we performed polymerase-chain-reaction assays for BK virus DNA in plasma samples from 9 renal-allograft recipients with BK virus nephropathy; 41 renal-allograft recipients who did not have signs of nephropathy, 16 of whom had decoy cells in the urine; and as immunocompromised controls, 17 patients who had human immunodeficiency virus type 1 (HIV-1) infection (stage C3 according to the classification of the Centers for Disease Control and Prevention) and who had not undergone transplantation.
Results
In all nine patients with BK virus nephropathy, BK virus DNA was detected in the plasma at the time of the initial histologic diagnosis (a mean [±SD] of 46±28 weeks after transplantation) and during the course of histologically diagnosed, persistent BK virus disease. In three of the six patients with nephropathy who were studied serially after transplantation, BK virus DNA was initially undetectable but was detected 16 to 33 weeks before nephropathy became clinically evident and was confirmed by biopsy. Tests for BK virus DNA in plasma became negative and the nephropathy resolved after the doses of immunosuppressive drugs were decreased in two patients and after removal of the renal allograft in three patients. BK virus DNA was found in the plasma of only 2 of the 41 renal-allograft recipients who had no signs of nephropathy and in none of the patients with HIV-1 infection.
Conclusions
Testing for BK virus DNA in plasma from renal-allograft recipients with use of the polymerase chain reaction is a sensitive and specific method for identifying viral nephropathy.
Media in This Article
Figure 1
Urine and Allograft-Biopsy Specimens from a Patient with BK Virus Nephropathy.Figure 2
PCR Assay of BK Virus DNA in the Plasma of Patients with BK Virus Nephropathy.Article Activity
- Article
The human polyomaviruses BK virus and JC virus are nonenveloped viruses that have a diameter of 45 nm and a circular, double-stranded–DNA genome of 5300 bp.1 Each of the two viruses is 70 percent homologous with the other and with simian virus 40 (SV40).1 Typically, primary infection with the BK virus or JC virus occurs during childhood and does not produce specific symptoms; the prevalence on serologic testing is more than 80 percent among adults worldwide.1,2 Serologic studies suggest that the BK virus and JC virus are transmitted independently of one another, most likely by the oral or respiratory route.1
After primary infection, the polyomaviruses remain latent in the urogenital tract.3 Asymptomatic reactivation and intermittent shedding of virus in the urine occur spontaneously in immunocompetent persons but are more frequent among those with altered cellular immunity, such as pregnant women,3,4 patients with cancer who are receiving chemotherapy,5 patients with human immunodeficiency virus type 1 (HIV-1) infection,6,7 and recipients of renal or other allografts.8,9 Overt clinical disease from polyomavirus infection is rare and is clearly linked to the degree of immunocompromise.
One of the most debilitating diseases associated with this infection is progressive multifocal leukoencephalopathy, which is caused by the JC virus10; the incidence of this disease has increased since the beginning of the acquired immunodeficiency syndrome epidemic.11 In recipients of bone marrow transplants, infection with the BK virus may cause hemorrhagic cystitis.9,12,13 In recipients of renal allografts, increased replication of the virus is readily detectable in the urine by the presence of “decoy cells,” which contain characteristic intranuclear viral inclusion bodies.14,15 In four studies involving more than 600 renal-allograft recipients, reactivation of the BK virus was associated only inconsistently with ureteral stenosis or varying degrees of graft dysfunction.8,15-17
More recently, persistent polyomavirus replication in patients with renal allografts was identified as an important cause of progressive graft dysfunction and graft loss among those treated with immunosuppressive regimens that included tacrolimus or mycophenolate mofetil.18-22 In these patients, histologic examination of allograft-biopsy specimens revealed extensive replication of the BK virus, necrosis of the cells of the tubules and collecting ducts, and varying degrees of interstitial inflammation.20 Whereas biopsy of allograft tissue is mandatory for the definitive diagnosis of BK virus nephropathy, use of this invasive procedure seems inappropriate for monitoring. The detection of decoy cells by cytologic testing of urine, even in a quantitative manner (i.e., by cell counts), has a low positive predictive value (<20 percent in our series20) for BK virus nephropathy. In the current study, we investigated whether BK virus DNA can be detected by polymerase-chain-reaction (PCR) assay of the plasma of renal-allograft recipients with BK virus nephropathy.
Methods
Subjects
We collected a total of 67 plasma or serum samples (hereafter referred to as plasma) for PCR amplification of BK virus DNA from nine renal-allograft recipients (two women and seven men) with histologically confirmed BK virus nephropathy. Four patients had received allografts from living donors and five had received allografts from cadaveric donors a mean (±SD) of 46±28 weeks before viral nephropathy was diagnosed. All nine patients had cells containing intranuclear viral inclusions (“decoy cells”) in the urine at the time of diagnosis. None had ureteral stenosis. One patient had hypogammaglobulinemia, which was treated with intravenous immune globulin.
The initial immunosuppressive therapy in seven of the nine patients consisted of antilymphocyte globulin, cyclosporine, azathioprine, and methylprednisolone; in one patient it consisted of cyclosporine, mycophenolate mofetil, and methylprednisolone; and in one patient it consisted of tacrolimus, azathioprine, and methylprednisolone. Methylprednisolone was given initially (intravenously in a dose of 500 mg daily for three days), followed by oral prednisone (0.5 mg per kilogram of body weight daily; the dose was decreased by 5 mg every two weeks). The initial dose of azathioprine was 2 mg per kilogram daily, and it was decreased in steps of 25 mg. The dose of cyclosporine was guided by measuring trough blood concentrations, with a goal of 250 to 300 ng of cyclosporine per milliliter during the first 12 months and 150 to 200 ng per milliliter thereafter. Initially, allograft function in these nine patients was good, with serum creatinine concentrations of 1.4±0.6 mg per deciliter (125±56 μmol per liter) on day 6 after transplantation.
Subsequently, all nine patients had episodes of rejection, confirmed by biopsy, with rapid increases in serum creatinine concentrations that responded partially to the administration of intravenous methylprednisolone (500 mg daily) for three days and antilymphocyte preparations or muromonab-CD3 for six days. For seven of the eight patients whose initial immunosuppressive regimen did not include tacrolimus, high-dose tacrolimus was given as rescue therapy (trough blood concentration, 15 to 29 ng per milliliter), and for the eight patients who were taking azathioprine, the azathioprine was switched to mycophenolate mofetil (1000 mg twice daily). Renal function was progressively deteriorating in all nine patients when BK virus nephropathy was diagnosed. In three patients, nephrectomy of the allograft (performed 3, 20, and 72 weeks after the diagnostic biopsies) revealed persistence of the viral nephropathy. In two of the nine patients, the dose of the rescue immunosuppressive therapy was decreased to control the replication of virus. In one of these two patients, the serum creatinine concentration increased from 2.0 mg per deciliter (175 μmol per liter) to 4.2 mg per deciliter (370 μmol per liter), despite a change in immunosuppressive therapy, from tacrolimus and mycophenolate mofetil back to cyclosporine and azathioprine; when the dose of cyclosporine was reduced so that the trough blood concentration was about 150 ng per milliliter, histologic examination showed that the viral nephropathy had resolved, but the patient nonetheless had end-stage nephropathy involving the allograft and required hemodialysis. In the other patient, the tacrolimus used for rescue therapy was replaced by cyclosporine, but the serum creatinine concentration rose to 2.1 mg per deciliter (185 μmol per liter). When the dose of cyclosporine was lowered, the viral nephropathy was found to have resolved on histologic examination, and the serum creatinine concentration decreased to 1.5 mg per deciliter (135 μmol per liter); the patient's regimen of mycophenolate mofetil (1000 mg twice daily) and prednisone (10 mg daily) remained unchanged.
We also collected 58 plasma samples for PCR amplification of BK virus DNA from 41 renal-allograft recipients (16 women and 25 men) who had no evidence of BK virus nephropathy. Sixteen of these patients were asymptomatic but were shedding decoy cells in their urine (3 women and 13 men; 7 had received allografts from living donors, and 9 had received allografts from cadaveric donors). In 8 of these 16 patients, examination of allograft tissue by light microscopy and immunohistochemical techniques revealed signs of acute rejection (in 2 patients) or chronic rejection (in 6 patients) but no viral inclusions. In the other 25 patients (13 women and 12 men; 13 had received allografts from living donors, and 12 had received allografts from cadaveric donors), no decoy cells were detected in the urine. An allograft-biopsy specimen from one of these patients showed signs of acute rejection but no signs of viral nephropathy. In 17 of these 25 patients, the results of cytologic tests of urine and PCR assays of plasma performed two to nine months later were available.
We also collected plasma samples for PCR amplification of BK virus DNA from 17 patients (6 women and 11 men) who had not undergone transplantation and who had HIV-1 infection (stage C3 according to the classification of the Centers for Disease Control and Prevention); these patients served as immunocompromised controls. Five had progressive multifocal leukoencephalopathy, four toxoplasmic encephalitis, two primary non-Hodgkin's lymphoma of the brain, one cytomegalovirus encephalitis, one myeloradiculitis, one peripheral neuropathy, and three HIV-1 encephalopathy. A study including 15 of these 17 patients has previously been published.23
This retrospective study was performed in accordance with the guidelines of the University Hospitals Basel, Basel, Switzerland, and the protocol was approved by the ethics committee of Basel.
Cytologic and Histologic Studies
The cytologic and histologic procedures used to diagnose nephropathy due to infection with BK virus have been described previously.20 Decoy cells were identified by their typical ground-glass intranuclear inclusions on cellular smears of urine samples stained by the Papanicolaou method (Figure 1AFigure 1
Urine and Allograft-Biopsy Specimens from a Patient with BK Virus Nephropathy.). The number of decoy cells per 10 high-power fields was counted. Immunohistochemical detection of polyomavirus antigens was performed with mouse monoclonal antibodies against either the BK virus or the JC virus (Readysysteme, Bad Zurzach, Switzerland) and against SV40 large T antigen (Oncogene Research Products, Cambridge, Mass.), with use of 3-amino-9-ethylcarbazole as the chromogen and hematoxylin as the counterstain. On examination of the biopsy specimens, BK virus nephropathy was identified by the presence of intranuclear viral inclusion bodies in epithelial cells obtained from the entire length of the nephron. The cells were enlarged, often necrotic, and more abundant in distal tubular segments and collecting ducts (Figure 1B).20 There was no histologic, immunohistochemical, ultrastructural, or serologic evidence of concurrent infection with cytomegalovirus, Epstein–Barr virus, herpes simplex virus, or adenovirus in any of the patients.PCR Assays
DNA was extracted from EDTA-anticoagulated plasma, serum, or urine by digestion with proteinase K and purification on silica columns before elution with double-distilled water, according to the protocol of the manufacturer of the kit (QIAmp, Qiagen, Basel). The use of semi-nested PCR assay for detection of polyomavirus DNA has been validated previously.20,23 The outer primer pair 5'AAGTCTTTAGGGTCTTCTAC3' and 5'GTGCCAACCTATGGAACAGA3' was used to generate a common 176-bp amplicon. For specific detection, we used the common primer 5'AAGTCTTTAGGGTCTTCTAC3' with 5'GAGTCCTGGTGGAGTT-CC3' to obtain the 149-bp BK virus–specific fragment or with 5'GAATCCTGGTGGAATACA3' to obtain the 146-bp JC virus–specific fragment. The threshold of detection was three to five copies of the BK virus and the JC virus plasmids per reaction. Each sample was analyzed in duplicate and with the addition of 15 copies of the respective plasmid to the reaction mixture to rule out inhibition of the PCR in negative results (Figure 2Figure 2
PCR Assay of BK Virus DNA in the Plasma of Patients with BK Virus Nephropathy.). Quantification of the BK viral load in two patients revealed approximately 100,000 copies of the viral genome per milliliter of plasma collected at the time that BK virus nephropathy was histologically proved (unpublished data). The investigators performing the PCR analyses were blinded to other information about the patients (the immunosuppressive regimens, laboratory results, and results of histologic analysis).Results
All nine renal-allograft recipients with BK virus nephropathy had the characteristic manifestations of this infection, including high serum creatinine concentrations (a mean of 3.8±2.1 mg per deciliter [335± 186 μmol per liter]), shedding of decoy cells in the urine, and extensive viral infection and necrosis of tubular cells in allograft-biopsy specimens (Table 1Table 1
Detection of BK Virus DNA by PCR in the Plasma of Patients with BK Virus Nephropathy and Control Subjects with HIV-1 Infection. and Figure 1). In all nine patients, BK virus DNA, but not JC virus DNA, was detected in plasma samples drawn at the time that BK virus nephropathy was histologically proved (Table 1). For eight of the nine patients, the plasma sample had been drawn at the time of the initial diagnostic biopsy. For one patient, the only plasma sample available had been drawn at the time of nephrectomy of the allograft.In contrast, BK virus DNA was detected in the plasma of only 1 of the 16 renal-allograft recipients who had decoy cells in the urine but no evidence of BK virus nephropathy (there was an absence of viral inclusions in renal-biopsy specimens in 8 of these patients). Among the 25 renal-allograft recipients with no decoy cells in the urine, BK virus DNA was detected in the plasma of 1 patient (Table 1). The allograft-biopsy specimen obtained at the same time as the plasma sample from this patient showed no signs of BK virus nephropathy. In 17 of these 25 patients, additional studies performed two to nine months later revealed no BK virus DNA in the plasma and no decoy cells in the urine. In the 17 patients with HIV-1 infection, no BK virus DNA was detected in plasma (Table 1). Thus, BK virus DNA was found in 2 of the 58 patients (75 samples) without histologic signs of BK virus nephropathy. During nine months of follow-up, no signs of graft dysfunction appeared in either patient.
Progressive impairment of renal function due to persistent BK virus nephropathy was documented by subsequent histologic evaluation of biopsy specimens and explanted graft tissue in eight of the nine patients. BK virus DNA was always detected in the plasma when persistent viral nephropathy was diagnosed by histologic examination of biopsy specimens and explanted grafts (Figure 3Figure 3
Time Course of Detection of BK Virus DNA in the Plasma of Representative Renal-Allograft Recipients with BK Virus Nephropathy.). In five patients, viral DNA was no longer detectable in the plasma after these patients' immunosuppressive therapy was changed. In three patients, viral DNA became undetectable 2±2 weeks after allograft nephrectomy. In two patients, the doses of immunosuppressive drugs were reduced, in one because of end-stage nephropathy of the allograft and in the other as a first attempt to control the BK virus infection. It was consistent with the absence of BK virus DNA in the plasma that biopsy of the patients' grafts at this time revealed signs of end-stage allograft nephropathy in the former patient and acute rejection in the latter but no further signs of BK virus nephropathy.Plasma samples obtained 2 to 55 weeks before the histologic diagnosis of BK virus nephropathy were available for six of the nine patients. Viral DNA was not detected in any of the samples. In three of these six patients (Patients 4, 9, and 7), the time at which BK virus DNA was detected in plasma coincided with the histologic diagnosis of BK virus nephropathy. (The results for Patients 4 and 9 are shown in Figure 3.) In the other three patients (Patients 2, 3, and 8), detection of BK virus DNA in the plasma preceded the histologic diagnosis by 16 to 33 weeks. In two of the nine patients, the first available plasma sample was collected at the time of diagnosis and was positive for BK virus DNA (data not shown). In one patient (Patient 5), the only available plasma sample had been obtained before transplantation, and it was negative for BK virus DNA (Figure 3).
Discussion
Polyomavirus type BK has rarely been detected outside the urogenital tract, and its presence has often seemed clinically unimportant.7,12,24 In the current study, we consistently detected BK virus DNA in the plasma of renal-allograft recipients with BK virus nephropathy — a finding with diagnostic, therapeutic, and pathogenetic implications. Formerly an exceedingly rare condition, BK virus nephropathy has been increasingly identified as a cause of dysfunction and loss of renal allografts. Among the suggested risk factors for this infection are recurrent episodes of rejection and intensive immunosuppressive regimens with new drugs such as tacrolimus and mycophenolate mofetil.18 A systematic study of allograft-biopsy specimens and allograft tissue after nephrectomy revealed that tubular necrosis is the chief cause of graft dysfunction and that it is a direct consequence of extensive replication of the BK virus.20 No antiviral treatment for this infection is currently available, and the only therapeutic approach seems to be a careful reduction in the doses of immunosuppressive therapy to control the replication of BK virus.1,19
With respect to diagnosis, we found that PCR assays for BK virus DNA in plasma had a sensitivity of 100 percent and a specificity of 88 percent for detecting BK virus nephropathy when we included only patients with histologically confirmed diagnoses (positive predictive value, 82 percent; negative predictive value, 100 percent). The specificity was 95 percent when all 41 renal-allograft recipients who did not have evidence of BK virus nephropathy were included in the analysis. Among all 58 control patients, only 2 patients with no evidence of BK virus nephropathy had plasma samples that were positive for BK virus DNA; 1 of them had acute rejection and the other had chronic rejection. Review of their medical records revealed that both patients had a history suggestive of reactivation of the BK virus, including repeated episodes of rejection, ureteral stenosis in the graft (in one patient), and an immunosuppressive regimen that included mycophenolate mofetil (in the other patient).
With respect to the course of BK virus nephropathy, we found that the presence of viral DNA in plasma reflected the dynamics of the disease: the conversion of plasma from negative to positive for BK virus DNA after transplantation, the presence of DNA in plasma in conjunction with the persistence of viral nephropathy on histologic examination, and the disappearance of viral DNA from plasma after the doses of immunosuppressive therapy had been reduced.
How does the BK virus gain access to the bloodstream? From our data and a review of the literature,1,8,14-16,20 it is evident that replication of the BK virus, even when it leads to abundant shedding of decoy cells in the urine, is not necessarily associated with viral nephropathy or with the presence of BK virus in plasma. This idea is consistent with the presumed urothelial origin of decoy cells and the detection of virus-infected cells primarily in superficial urothelial layers, from which the BK virus is unlikely to reach the circulation. However, after cell-to-cell spread from renal papillae to terminal collecting ducts,20 the BK virus may reach the circulation by way of the adjacent peritubular capillaries. This hypothesis may explain the early detection of BK virus DNA in the plasma of three patients whose biopsy specimens were initially negative for the virus.
Although prospective studies are needed for further validation, our data provide evidence that the detection of BK virus DNA in the plasma identifies renal-allograft recipients who are at risk for BK virus nephropathy. Among patients with impaired graft function, we currently screen for decoy cells in urine by cytologic tests. If decoy cells are present, we perform PCR analysis specific for the BK virus in plasma samples; if the samples are positive for the virus, we confirm the diagnosis by allograft biopsy and perform additional PCR assays on plasma to monitor the course of the nephropathy.
Source Information
From the Institute for Pathology (V.N., P.D., M.J.M.), the Institute for Medical Microbiology (T.K., V.D.Z., H.H.H.), and the Division of Nephrology, Department of Internal Medicine (I.F.B., G.T.), University of Basel, Basel, Switzerland.
Address reprint requests to Dr. Hirsch at the Department of Internal Medicine, University Hospitals, Petersgraben 4, CH-4031 Basel, Switzerland, or at hans.hirsch@unibas.ch.
- References
References
1
Shah KV. Polyomaviruses. In: Fields BN, Knipe DM, Howley PM, eds. Fields virology. 3rd ed. Philadelphia: Lippincott-Raven, 1996:2027-43.
2
Shah KV ,Daniel RW ,Warszawski RM . High prevalence of antibodies to BK virus, an SV40-related papovavirus, in residents in Maryland. J Infect Dis 1973;128:784-787
CrossRef | Web of Science | Medline3
Chesters PM ,Heritage J ,McCance DJ . Persistence of DNA sequences of BK virus and JC virus in normal human tissues and in diseased tissues. J Infect Dis 1983;147:676-684
CrossRef | Web of Science | Medline4
Coleman DV ,Wolfendale MR ,Daniel RA , et al. A prospective study of human polyomavirus infection in pregnancy. J Infect Dis 1980;142:1-8
CrossRef | Web of Science | Medline5
Hogan TF ,Padgett BL ,Walker DL ,Borden EC ,Frias Z . Survey of human polyomavirus (JCV, BKV) infections in 139 patients with lung cancer, breast cancer, melanoma, or lymphoma. Prog Clin Biol Res 1983;105:311-324
Medline6
Markowitz RB ,Thompson HC ,Mueller JF ,Cohen JA ,Dynan WS . Incidence of BK virus and JC virus viruria in human immunodeficiency virus-infected and -uninfected subjects. J Infect Dis 1993;167:13-20
CrossRef | Web of Science | Medline7
Sundsfjord A ,Flaegstad T ,Flo R , et al. BK and JC viruses in human immunodeficiency virus type 1-infected persons: prevalence, excretion, virema, and viral regulatory regions. J Infect Dis 1994;169:485-490
CrossRef | Web of Science | Medline8
Mackenzie EF ,Poulding JM ,Harrison PR ,Amer B . Human polyoma virus (HPV) -- a significant pathogen in renal transplantation. Proc Eur Dial Transplant Assoc 1978;15:352-360
Medline9
Arthur RR ,Shah KV ,Charache P ,Saral R . BK and JC virus infections in recipients of bone marrow transplants. J Infect Dis 1988;158:563-569
CrossRef | Web of Science | Medline10
Padgett BL ,Walker DL ,ZuRhein GM ,Eckroade RJ ,Dessel BH . Cultivation of papova-like virus from human brain with progressive multifocal leucoencephalopathy. Lancet 1971;1:1257-1260
CrossRef | Web of Science | Medline11
Holman RC ,Torok TJ ,Belay ED ,Janssen RS ,Schonberger LB . Progressive multifocal leukoencephalopathy in the United States, 1979-1994: increased mortality associated with HIV infection. Neuroepidemiology 1998;17:303-309
CrossRef | Web of Science | Medline12
Bogdanovic G ,Ljungman P ,Wang F ,Dalianis T . Presence of human polyomavirus DNA in the peripheral circulation of bone marrow transplant patients with and without hemorrhagic cystitis. Bone Marrow Transplant 1996;17:573-576
Web of Science | Medline13
Cottler-Fox M ,Lynch M ,Deeg HJ ,Koss LG . Human polyomavirus: lack of relationship of viruria to prolonged or severe hemorrhagic cysti-tis after bone marrow transplant. Bone Marrow Transplant 1989;4:279-282
Web of Science | Medline14
Stilmant MM ,Freedlund MC ,Schmitt GW . Cytologic evaluation of urine after kidney transplantation. Acta Cytol 1987;31:625-630
Web of Science | Medline15
Gardner SD ,MacKenzie EF ,Smith C ,Porter AA . Prospective study of the human polyomaviruses BK and JC and cytomegalovirus in renal transplant recipients. J Clin Pathol 1984;37:578-586
CrossRef | Web of Science | Medline16
Hogan TF ,Borden EC ,McBain JA ,Padgett BL ,Walker DL . Human polyomavirus infections with JC virus and BK virus in renal transplant patients. Ann Intern Med 1980;92:373-378
Web of Science | Medline17
Andrews CA ,Shah KV ,Daniel RW ,Hirsch MS ,Rubin RH . A serological investigation of BK virus and JC virus infections in recipients of renal allografts. J Infect Dis 1988;158:176-181
CrossRef | Web of Science | Medline18
Binet I ,Nickeleit V ,Hirsch HH , et al. Polyomavirus disease under new immunosuppressive drugs: a cause of renal graft dysfunction and graft loss. Transplantation 1999;67:918-922
CrossRef | Web of Science | Medline19
Randhawa PS ,Finkelstein S ,Scantlebury V , et al. Human polyoma virus-associated interstitial nephritis in the allograft kidney. Transplantation 1999;67:103-109
CrossRef | Web of Science | Medline20
Nickeleit V ,Hirsch HH ,Binet IF , et al. Polyomavirus infection of renal allograft recipients: from latent infection to manifest disease. J Am Soc Nephrol 1999;10:1080-1089
Web of Science | Medline21
Mathur VS ,Olson JL ,Darragh TM ,Yen TS . Polyomavirus-induced interstitial nephritis in two renal transplant recipients: case reports and review of the literature. Am J Kidney Dis 1997;29:754-758
CrossRef | Web of Science | Medline22
Boubenider S ,Hiesse C ,Marchand S ,Hafi A ,Kriaa F ,Charpentier B . Post-transplantation polyomavirus infections. J Nephrol 1999;12:24-29
Web of Science | Medline23
Hirsch HH ,Meylan PRA ,Zimmerli W , et al. HIV-1-infected patients with focal neurological signs: diagnostic role of PCR for Toxoplasma gondii, Epstein-Barr virus, and JC virus. Clin Microbiol Infect 1998;4:577-584
CrossRef | Medline24
Dorries K ,Vogel E ,Gunther S ,Czub S . Infection of human polyomaviruses JC and BK in peripheral blood leukocytes from immunocompetent individuals. Virology 1994;198:59-70
CrossRef | Web of Science | Medline
- Citing Articles (176)
Citing Articles
1
P.-L. Chen, P.-H. Hsu, C.-Y. Fang, C.-F. Chang, W.-C. Ou, M. Wang, D. Chang. (2011) Phosphorylation of Ser-80 of VP1 and Ser-254 of VP2 is essential for human BK virus propagation in tissue culture. Journal of General Virology 92:11, 2637-2645
CrossRef2
Mihir Raval, Alison Gulbis, Catherine Bollard, Ann Leen, Roy Chemaly, Elizabeth Shpall, Amit Lahoti, Partow Kebriaei. (2011) Evaluation and Management of BK Virus-Associated Nephropathy Following Allogeneic Hematopoietic Cell Transplantation. Biology of Blood and Marrow Transplantation 17:11, 1589-1593
CrossRef3
T. Schachtner, K. Müller, M. Stein, C. Diezemann, A. Sefrin, N. Babel, P. Reinke. (2011) BK Virus-Specific Immunity Kinetics: A Predictor of Recovery From Polyomavirus BK-Associated Nephropathy. American Journal of Transplantation 11:11, 2443-2452
CrossRef4
Hilary L. Haines, Benjamin L. Laskin, Jens Goebel, Stella M. Davies, Hong J. Yin, Julia Lawrence, Parinda A. Mehta, Jack J. Bleesing, Alexandra H. Filipovich, Rebecca A. Marsh, Sonata Jodele. (2011) Blood, and Not Urine, BK Viral Load Predicts Renal Outcome in Children with Hemorrhagic Cystitis following Hematopoietic Stem Cell Transplantation. Biology of Blood and Marrow Transplantation 17:10, 1512-1519
CrossRef5
Duvuru Geetha, Stephen M. Sozio, Mythili Ghanta, Michelle Josephson, Ron Shapiro, Darshana Dadhania, Sundaram Hariharan. (2011) Results of Repeat Renal Transplantation After Graft Loss From BK Virus Nephropathy. Transplantation 92:7, 781-786
CrossRef6
Natasha Ali, Mohammad Usman Shaikh, Sheema Hasan. (2011) BK Virus Associated Late Onset Haemorrhagic Cystitis After Allogeneic Peripheral Blood Stem Cell Transplant. Indian Journal of Hematology and Blood Transfusion 27:3, 177-179
CrossRef7
Ecaterina M. Enache, Luminita S. Iancu, Simona Hogas, Daniela Jitaru, Iuliu C. Ivanov, Liviu Segall, Adrian C. Covic. (2011) Screening for latent BK virus infection in a renal transplant population for the first time in Romania: a single-center experience. International Urology and Nephrology
CrossRef8
H. Dheir, S. Sahin, M. Uyar, A. Gurkan, V. Turunc, S. Kacar, D. Bayirli Turan, G. Basdemir. (2011) Intensive Polyoma Virus Nephropathy Treatment as a Preferable Approach for Graft Surveillance. Transplantation Proceedings 43:3, 867-870
CrossRef9
C.C. Geddes, R. Gunson, E. Mazonakis, R. Wan, L. Thomson, M. Clancy, W.F. Carman. (2011) BK viremia surveillance after kidney transplant: single-center experience during a change from cyclosporine-to lower-dose tacrolimus-based primary immunosuppression regimen. Transplant Infectious Disease 13:2, 109-116
CrossRef10
Sonia Badwal, GS Chopra, PP Varma, AK Hooda. (2011) BK polyoma viral infection in renal allograft recipients. Medical Journal Armed Forces India 67:2, 122-130
CrossRef11
Puneet Sood, Sundaram Hariharan. (2011) BK virus infection after renal transplantation. Dialysis & Transplantation 40:3, 102-107
CrossRef12
Patrizia Comoli, Fabrizio Ginevri. (2011) Monitoring and managing viral infections in pediatric renal transplant recipients. Pediatric Nephrology
CrossRef13
I. Koleilat, L. Kushnir, M. Gallichio, D.J. Conti. (2011) Initiation of a screening protocol for polyoma virus results in a decreased rate of opportunistic non-BK viral disease after renal transplantation. Transplant Infectious Disease 13:1, 1-8
CrossRef14
Katherine A. Barraclough, Nicole M. Isbel, Christine E. Staatz, David W. Johnson. (2011) BK Virus in Kidney Transplant Recipients: The Influence of Immunosuppression. Journal of Transplantation 2011, 1-9
CrossRef15
Alkesh Jani. 2011. Biomarkers in Kidney Transplantation. , 233-290.
CrossRef16
Peter J Dupont, Oriol Manuel, Manuel Pascual. (2010) Infection and chronic allograft dysfunction. Kidney International 78, S47-S53
CrossRef17
S. Schaub, H. H. Hirsch, M. Dickenmann, J. Steiger, M. J. Mihatsch, H. Hopfer, M. Mayr. (2010) Reducing Immunosuppression Preserves Allograft Function in Presumptive and Definitive Polyomavirus-Associated Nephropathy. American Journal of Transplantation 10:12, 2615-2623
CrossRef18
Mohamed I. Husseiny, Bishoy Anastasi, Jennifer Singer, Simon F. Lacey. (2010) A comparative study of Merkel cell, BK and JC polyomavirus infections in renal transplant recipients and healthy subjects. Journal of Clinical Virology 49:2, 137-140
CrossRef19
N. Ganguly, L.A. Clough, L.K. DuBois, J.P. Mcguirk, S. Abhyankar, O.S. Aljitawi, N. O'Neal, C.L. Divine, S. Ganguly. (2010) Low-dose cidofovir in the treatment of symptomatic BK virus infection in patients undergoing allogeneic hematopoietic stem cell transplantation: a retrospective analysis of an algorithmic approach. Transplant Infectious Disease 12:5, 406-411
CrossRef20
Gang Huang, Li-Zhong Chen, Jiang Qiu, Chang-Xi Wang, Ji-Guang Fei, Su-Xiong Deng, Jun Li, Guo-Dong Chen, Lei Zhang, Qian Fu, Wen-Tao Zeng, Da-Qiang Zhao. (2010) Prospective study of polyomavirus BK replication and nephropathy in renal transplant recipients in China: a single-center analysis of incidence, reduction in immunosuppression and clinical course. Clinical Transplantation 24:5, 599-609
CrossRef21
Darshana Dadhania, Catherine Snopkowski, Ruchuang Ding, Thangamani Muthukumar, Jun Lee, Heejung Bang, Vijay K. Sharma, Surya Seshan, Phyllis August, Sandip Kapur, Manikkam Suthanthiran. (2010) Validation of Noninvasive Diagnosis of BK Virus Nephropathy and Identification of Prognostic Biomarkers. Transplantation 90:2, 189-197
CrossRef22
Luis Rubio, Joel Pinczewski, Cinthia B. Drachenberg, Francisco J. Vera-Sempere, Richard Y. Zhao. (2010) A Multiplex Real-time PCR Method for Quantification of BK and JC Polyomaviruses in Renal Transplant Patients. Diagnostic Molecular Pathology 19:2, 105-111
CrossRef23
Ilkka Helanterä, Adrian Egli, Petri Koskinen, Irmeli Lautenschlager, Hans H. Hirsch. (2010) Viral Impact on Long-term Kidney Graft Function. Infectious Disease Clinics of North America 24:2, 339-371
CrossRef24
Raghavender Boothpur, Daniel C. Brennan. (2010) Human polyoma viruses and disease with emphasis on clinical BK and JC. Journal of Clinical Virology 47:4, 306-312
CrossRef25
A. N. Kinnaird, G. M. Anstead. (2010) Hemorrhagic Cystitis and Possible Neurologic Disease from BK Virus Infection in a Patient with AIDS. Infection 38:2, 124-127
CrossRef26
Éva Kemény, Hans H. Hirsch, József Eller, Ursula Dürmüller, Helmut Hopfer, Michael J. Mihatsch. (2010) Plasma cell infiltrates in polyomavirus nephropathy. Transplant International 23:4, 397-406
CrossRef27
Geoffrey A. Weinberg, Ayesa N. Mian. (2010) BK Virus Nephropathy and Other Polyoma Virus Infections. The Pediatric Infectious Disease Journal 29:3, 257-260
CrossRef28
H. H. Hirsch, P. Randhawa, . (2009) BK Virus in Solid Organ Transplant Recipients. American Journal of Transplantation 9, S136-S146
CrossRef29
Tatsuya Takayama, Toshiki Ito, Kazuo Suzuki, Tomomi Ushiyama, Toshinobu Horii, Katsutoshi Miura, Seiichiro Ozono. (2009) BK virus nephropathy: Clinical experience in a university hospital in Japan. International Journal of Urology 16:12, 924-928
CrossRef30
Liesl K. Jeffers, Vicki Madden, Jennifer Webster-Cyriaque. (2009) BK virus has tropism for human salivary gland cells in vitro: Implications for transmission. Virology 394:2, 183-193
CrossRef31
Ibrahim Batal, Zachary M. Franco, Ron Shapiro, Amit Basu, Henkie Tan, Liise Kayler, Adriana Zeevi, Claire Morgan, Parmjeet Randhawa. (2009) Clinicopathologic analysis of patients with BK viruria and rejection-like graft dysfunction. Human Pathology 40:9, 1312-1319
CrossRef32
Can Li, Chul Woo Yang. (2009) The pathogenesis and treatment of chronic allograft nephropathy. Nature Reviews Nephrology 5:9, 513-519
CrossRef33
Kalle Kantola, Mohammadreza Sadeghi, Anne Lahtinen, Minna Koskenvuo, Leena-Maija Aaltonen, Merja Möttönen, Jaana Rahiala, Ulla Saarinen-Pihkala, Pekka Riikonen, Tuomas Jartti, Olli Ruuskanen, Maria Söderlund-Venermo, Klaus Hedman. (2009) Merkel cell polyomavirus DNA in tumor-free tonsillar tissues and upper respiratory tract samples: Implications for respiratory transmission and latency. Journal of Clinical Virology 45:4, 292-295
CrossRef34
Alexander C. Wiseman. (2009) Polyomavirus Nephropathy: A Current Perspective and Clinical Considerations. American Journal of Kidney Diseases 54:1, 131-142
CrossRef35
Wana Manitpisitkul, Cinthia Drachenberg, Emilio Ramos, Raghava Munivenkatappa, Benjamin Philosophe, David Klassen, Abdolreza Haririan. (2009) Maintenance Immunosuppressive Agents as Risk Factors for BK Virus Nephropathy: A Case-Control Study. Transplantation 88:1, 83-88
CrossRef36
Vikas R. Dharnidharka, Wida S. Cherikh, Kevin C. Abbott. (2009) An OPTN Analysis of National Registry Data on Treatment of BK Virus Allograft Nephropathy in the United States. Transplantation 87:7, 1019-1026
CrossRef37
NICHOLAS B CROSS, ANGELA C WEBSTER, PHILIP J O'CONNELL, NEISHA JEOFFREYS, DOMINIC E DWYER, JONATHAN C CRAIG. (2009) Diagnostic accuracy of blood qualitative nucleic acid testing for polyomavirus-associated nephropathy in kidney recipients. Nephrology 14:3, 350-356
CrossRef38
Roman Petrov, Ossama Elbahloul, Michael H. Gallichio, Kathleen Stellrecht, David J. Conti. (2009) Monthly Screening for Polyoma Virus Eliminates BK Nephropathy and Preserves Renal Function. Surgical Infections 10:1, 85-90
CrossRef39
A S Y Wong, V C C Cheng, K-Y Yuen, Y-L Kwong, A Y H Leung. (2009) High frequency of polyoma BK virus shedding in the gastrointestinal tract after hematopoietic stem cell transplantation: a prospective and quantitative analysis. Bone Marrow Transplantation 43:1, 43-47
CrossRef40
Muna Salama, Neil Boudville, David Speers, Garry P. Jeffrey, Paolo Ferrari. (2008) Decline in native kidney function in liver transplant recipients is not associated with BK virus infection. Liver Transplantation 14:12, 1787-1792
CrossRef41
Patrizia Comoli, Hans H Hirsch, Fabrizio Ginevri. (2008) Cellular immune responses to BK virus. Current Opinion in Organ Transplantation 13:6, 569-574
CrossRef42
Sandeep Kumar Mandal, Sanjiv Jasuja. (2008) BK Virus Nephropathy in Kidney Transplant – an Overview. Apollo Medicine 5:4, 318-322
CrossRef43
G. A. Funk, R. Gosert, P. Comoli, F. Ginevri, H. H. Hirsch. (2008) Polyomavirus BK Replication Dynamics In Vivo and In Silico to Predict Cytopathology and Viral Clearance in Kidney Transplants. American Journal of Transplantation 8:11, 2368-2377
CrossRef44
S.-W. Wu, H.-R. Chang, J.-D. Lian. (2008) The effect of low-dose cidofovir on the long-term outcome of polyomavirus-associated nephropathy in renal transplant recipients. Nephrology Dialysis Transplantation 24:3, 1034-1038
CrossRef45
Fred E Yeo, Christina M Yuan, Sydney J Swanson, Bruce Reinmuth, Luana C Kiandoli, Keith J Kaplan, Kevin C Abbott, Joel C Reynolds. (2008) The prevalence of BK polyomavirus infection in outpatient kidney transplant recipients followed in a single center. Clinical Transplantation 22:5, 532-541
CrossRef46
Liwen Lim, Ian D. Kay, Silvano Palladino, James Flexman. (2008) Variability in patterns of BK viral load after renal transplantation. Diagnostic Microbiology and Infectious Disease 61:3, 302-308
CrossRef47
Karen E. Doucette, Xiaoli L. Pang, Kathleen Jackson, Ilene Burton, Michelle Carbonneau, Sandra Cockfield, Jutta K. Preiksaitis. (2008) Prospective Monitoring of BK Polyomavirus Infection Early Posttransplantation in Nonrenal Solid Organ Transplant Recipients. Transplantation 85:12, 1733-1736
CrossRef48
Xiaoli L. Pang, Kimberly Martin, Jutta K. Preiksaitis. (2008) The use of unprocessed urine samples for detecting and monitoring BK viruses in renal transplant recipients by a quantitative real-time PCR assay. Journal of Virological Methods 149:1, 118-122
CrossRef49
Catherine Bonvoisin, Laurent Weekers, Patricia Xhignesse, Stéphanie Grosch, Miroslav Milicevic, Jean-Marie Krzesinski. (2008) Polyomavirus in Renal Transplantation: A Hot Problem. Transplantation 85:Supplement, S42-S48
CrossRef50
Cyrielle Alméras, Vincent Foulongne, Valérie Garrigue, Ilan Szwarc, Fernando Vetromile, Michel Segondy, Georges Mourad. (2008) Does Reduction in Immunosuppression in Viremic Patients Prevent BK Virus Nephropathy in De Novo Renal Transplant Recipients? A Prospective Study. Transplantation 85:8, 1099-1104
CrossRef51
R. Gosert, C. H. Rinaldo, G. A. Funk, A. Egli, E. Ramos, C. B. Drachenberg, H. H. Hirsch. (2008) Polyomavirus BK with rearranged noncoding control region emerge in vivo in renal transplant patients and increase viral replication and cytopathology. Journal of Experimental Medicine 205:4, 841-852
CrossRef52
M. Bairy, A. Sett, S. Bhandari, E. Long. (2008) Obstruction or renal allograft rejection--potential clinical markers of BK virus nephropathy. QJM 101:7, 594-598
CrossRef53
Ehab R. Saad, Barbara A. Bresnahan, Eric P. Cohen, Na Lu, Rimas J. Orentas, Brahm Vasudev, Sundaram Hariharan. (2008) Successful Treatment of BK Viremia Using Reduction in Immunosuppression Without Antiviral Therapy. Transplantation 85:6, 850-854
CrossRef54
Simon E. Prosser, Rimas J. Orentas, Lisa Jurgens, Eric P. Cohen, Sundaram Hariharan. (2008) Recovery of BK Virus Large T-Antigen–Specific Cellular Immune Response Correlates With Resolution of BK Virus Nephritis. Transplantation 85:2, 185-192
CrossRef55
Alberto Marra, Lisa Moni, Daniele Pazzi, Alfredo Corallini, Deborah Bridi, Alessandro Dondoni. (2008) Synthesis of sialoclusters appended to calix[4]arene platforms via multiple azide-alkyne cycloaddition. New inhibitors of hemagglutination and cytopathic effect mediated by BK and influenza A viruses. Organic & Biomolecular Chemistry 6:8, 1396
CrossRef56
L K Dropulic, R J Jones. (2008) Polyomavirus BK infection in blood and marrow transplant recipients. Bone Marrow Transplantation 41:1, 11-18
CrossRef57
Aviv Hever, Cynthia C. Nast. (2008) Polyoma virus nephropathy with simian virus 40 antigen–containing tubular basement membrane immune complex deposition. Human Pathology 39:1, 73-79
CrossRef58
J. Beimler. (2008) BK Virus-Nephropathie nach Nierentransplantation. Der Nephrologe 3:1, 14-21
CrossRef59
F. Ginevri, A. Azzi, H. H. Hirsch, S. Basso, I. Fontana, M. Cioni, S. Bodaghi, V. Salotti, A. Rinieri, G. Botti, F. Perfumo, F. Locatelli, P. Comoli. (2007) Prospective Monitoring of Polyomavirus BK Replication and Impact of Pre-Emptive Intervention in Pediatric Kidney Recipients. American Journal of Transplantation 7:12, 2727-2735
CrossRef60
Alexandra C. Cheerva, Ashok Raj, Salvatore J. Bertolone, Kathy Bertolone, Craig L. Silverman. (2007) BK Virus-associated Hemorrhagic Cystitis in Pediatric Cancer Patients Receiving High-dose Cyclophosphamide. Journal of Pediatric Hematology/Oncology 29:9, 617-621
CrossRef61
Helen B. Viscount, Albert J. Eid, Mark J. Espy, Matthew D. Griffin, Kristine M. Thomsen, William S. Harmsen, Raymund R. Razonable, Thomas F. Smith. (2007) Polyomavirus Polymerase Chain Reaction as a Surrogate Marker of Polyomavirus-Associated Nephropathy. Transplantation 84:3, 340-345
CrossRef62
Jay A. Fishman. (2007) Infection in Renal Transplant Recipients. Seminars in Nephrology 27:4, 445-461
CrossRef63
Marta Fogeda, Patricia Muñoz, Augusto Luque, Ma Dolores Morales, Emilio Bouza, . (2007) Cross-sectional study of BK virus infection in pediatric kidney transplant recipients. Pediatric Transplantation 11:4, 394-401
CrossRef64
S. Binggeli, A. Egli, S. Schaub, I. Binet, M. Mayr, J. Steiger, H. H. Hirsch. (2007) Polyomavirus BK-Specific Cellular Immune Response to VP1 and Large T-Antigen in Kidney Transplant Recipients. American Journal of Transplantation 7:5, 1131-1139
CrossRef65
Tatsuya Takayama, Kazuo Suzuki, Atsushi Otsuka, Hiroshi Furuse, Soichi Mugiya, Tomomi Ushiyama, Guiping Han, Katsutoshi Miura, Toshinobu Horii, Seiichiro Ozono. (2007) BK virus subtype IV nephropathy occurring 5 years after kidney transplantation. Clinical and Experimental Nephrology 11:1, 102-106
CrossRef66
A. S. Y. Wong, K.-H. Chan, V. C. C. Cheng, K.-Y. Yuen, Y.-L. Kwong, A. Y. H. Leung. (2007) Relationship of Pretransplantation Polyoma BK Virus Serologic Findings and BK Viral Reactivation after Hematopoietic Stem Cell Transplantation. Clinical Infectious Diseases 44:6, 830-837
CrossRef67
Fausto Baldanti, Gian Battista Fogazzi, Milena Furione, Lucia Saglimbeni, Francesca Rovida, Marta Gatti, Stefania Paolucci, Antonio Tarantino, Giuseppe Gerna. (2007) Quantification and identification of polyomavirus DNA in blood and urine of renal transplant recipients. Diagnostic Microbiology and Infectious Disease 57:3, 301-307
CrossRef68
F. S. Nolte. (2006) Case Studies in Cost Effectiveness of Molecular Diagnostics for Infectious Diseases: Pulmonary Tuberculosis, Enteroviral Meningitis, and BK Virus Nephropathy. Clinical Infectious Diseases 43:11, 1463-1467
CrossRef69
Volker Nickeleit, Michael J. Mihatsch. (2006) Polyomavirus nephropathy in native kidneys and renal allografts: an update on an escalating threat. Transplant International 19:12, 960-973
CrossRef70
Philip D. Acott. (2006) Polyoma virus in pediatric renal transplantation. Pediatric Transplantation 10:7, 856-860
CrossRef71
Francisco J. Vera-Sempere, Luis Rubio, Vanesa Felipe-Ponce, Ana García, Fernando Mayordomo, Jaime Sánchez-Plumed, Isabel Beneyto, David Ramos, Isabel Zamora, José Simón. (2006) PCR assays for the early detection of BKV infection in 125 Spanish kidney transplant patients. Clinical Transplantation 20:6, 706-711
CrossRef72
Staci A. Fischer. (2006) Infections Complicating Solid Organ Transplantation. Surgical Clinics of North America 86:5, 1127-1145
CrossRef73
Paul D. Griffiths. (2006) Antivirals in the transplant setting. Antiviral Research 71:2-3, 192-200
CrossRef74
Gaurav Gupta, Ron Shapiro, Ngoc Thai, Parmjeet Singh Randhawa, Abhay Vats. (2006) Low Incidence of BK Virus Nephropathy After Simultaneous Kidney Pancreas Transplantation. Transplantation 82:3, 382-388
CrossRef75
R J Crew, G Markowitz, J Radhakrishnan. (2006) Therapeutic options in BK virus-associated interstitial nephritis. Kidney International 70:2, 399-402
CrossRef76
Shona S. Pendse, Nidyanandh Vadivel, Emilio Ramos, Gilbert H. Mudge, Tania Von Visger, James C. Fang, Anil Chandraker. (2006) BK Viral Reactivation in Cardiac Transplant Patients: Evidence for a Double-hit Hypothesis. The Journal of Heart and Lung Transplantation 25:7, 814-819
CrossRef77
A.S. Dugan, S. Eash, W.J. Atwood. (2006) Update on BK virus entry and intracellular trafficking. Transplant Infectious Disease 8:2, 62-67
CrossRef78
C.B. Drachenberg, J.C. Papadimitriou. (2006) Polyomavirus-associated nephropathy: update in diagnosis. Transplant Infectious Disease 8:2, 68-75
CrossRef79
T.D. Barton, E.A. Blumberg, A. Doyle, V.N. Ahya, J.M. Ferrenberg, S.C. Brozena, A.P. Limaye. (2006) A prospective cross-sectional study of BK virus infection in non-renal solid organ transplant recipients with chronic renal dysfunction. Transplant Infectious Disease 8:2, 102-107
CrossRef80
Cinthia B Drachenberg, Raghava B Munivenkatappa, John C Papadimitriou. (2006) Update on pathological features of polyomavirus allograft nephropathy. Current Opinion in Organ Transplantation 11:3, 277-282
CrossRef81
H. M. Wadei, A. D. Rule, M. Lewin, A. S. Mahale, H. A. Khamash, T. R. Schwab, J. M. Gloor, S. C. Textor, M. E. Fidler, D. J. Lager, T. S. Larson, M. D. Stegall, F. G. Cosio, M. D. Griffin. (2006) Kidney Transplant Function and Histological Clearance of Virus Following Diagnosis of Polyomavirus-Associated Nephropathy (PVAN). American Journal of Transplantation 6:5p1, 1025-1032
CrossRef82
Dechu P. Puliyanda, Nurmamet Amet, Archana Dhawan, Lara Hilo, Raju K. Radha, Suphamai Bunnapradist, Lawrence Czer, Paul Martin, Stanley Jordan, Mieko Toyoda. (2006) Isolated heart and liver transplant recipients are at low risk for polyomavirus BKV nephropathy. Clinical Transplantation 20:3, 289-294
CrossRef83
Michelle A. Josephson, Daniel Gillen, Basit Javaid, Pradeep Kadambi, Shane Meehan, Preston Foster, Robert Harland, Richard J. Thistlethwaite, Marc Garfinkel, Walter Atwood, Joslynn Jordan, Molly Sadhu, Michael J. Millis, James Williams. (2006) Treatment of Renal Allograft Polyoma BK Virus Infection with Leflunomide. Transplantation 81:5, 704-710
CrossRef84
S Hariharan. (2006) BK virus nephritis after renal transplantation. Kidney International 69:4, 655-662
CrossRef85
A. Humar, M. Michaels, . (2006) American Society of Transplantation Recommendations for Screening, Monitoring and Reporting of Infectious Complications in Immunosuppression Trials in Recipients of Organ Transplantation. American Journal of Transplantation 6:2, 262-274
CrossRef86
Ali Si-Mohamed, Jérôme Le Goff, Nathalie Désiré, Sarah Maylin, Denis Glotz, Laurent Bélec. (2006) Detection and quantitation of BK virus DNA by real-time polymerase chain reaction in the LT-ag gene in adult renal transplant recipients. Journal of Virological Methods 131:1, 21-27
CrossRef87
Michael Boeckh, Veronique Erard, Danielle Zerr, Janet Englund. (2005) Emerging viral infections after hematopoietic cell transplantation. Pediatric Transplantation 9, 48-54
CrossRef88
Dominic C. Borie, Michael J. Larson, Mona G. Flores, Andrew Campbell, Geraldine Rousvoal, Sally Zhang, John P. Higgins, Douglas J. Ball, Elizabeth M. Kudlacz, William H. Brissette, Eileen A. Elliott, Bruce A. Reitz, Paul S. Changelian. (2005) Combined Use of the JAK3 Inhibitor CP-690,550 with Mycophenolate Mofetil to Prevent Kidney Allograft Rejection in Nonhuman Primates. Transplantation 80:12, 1756-1764
CrossRef89
A Y H Leung, K-Y Yuen, Y-L Kwong. (2005) Polyoma BK virus and haemorrhagic cystitis in haematopoietic stem cell transplantation: a changing paradigm. Bone Marrow Transplantation 36:11, 929-937
CrossRef90
Sundaram Hariharan, Eric P. Cohen, Brahm Vasudev, Rimas Orentas, Raphael P. Viscidi, Justin Kakela, Brian DuChateau. (2005) BK Virus-Specific Antibodies and BKV DNA in Renal Transplant Recipients with BKV Nephritis. American Journal of Transplantation 5:11, 2719-2724
CrossRef91
Parmjeet Randhawa, John Uhrmacher, William Pasculle, Abhay Vats, Ron Shapiro, Bijan Eghtsead, Karen Weck. (2005) A comparative study of BK and JC virus infections in organ transplant recipients. Journal of Medical Virology 77:2, 238-243
CrossRef92
Luis Rubio, Francisco J. Vera-Sempere, María J. Moreno-Baylach, Ana García, Isabel Zamora, José Simón. (2005) LT, VP1 and TCR-BKV sequence analysis in a patient with post-transplant BKV nephropathy associated with EBV-related PTLD. Pediatric Nephrology 20:10, 1506-1509
CrossRef93
Bryce A Kiberd. (2005) Screening to Prevent Polyoma Virus Nephropathy: A Medical Decision Analysis. American Journal of Transplantation 5:10, 2410-2416
CrossRef94
Anke Schwarz, Michael Mengel, Hermann Haller, Jost Niedermeyer. (2005) Polyoma Virus Nephropathy in Native Kidneys After Lung Transplantation. American Journal of Transplantation 5:10, 2582-2585
CrossRef95
Daniel L. Bohl, Gregory A. Storch, Caroline Ryschkewitsch, Monique Gaudreault-Keener, Mark A. Schnitzler, Eugene O. Major, Daniel C. Brennan. (2005) Donor Origin of BK Virus in Renal Transplantation and Role of HLA C7 in Susceptibility to Sustained BK Viremia. American Journal of Transplantation 5:9, 2213-2221
CrossRef96
Andreas M??ller, Bodo Beck, Kai Theilemann, Ludwig Stapenhorst, Christoph Licht, Dietrich Michalk, Caspar Franzen, Bernd Hoppe. (2005) Detection of Polyomavirus BK and JC in Children With Kidney Diseases and Renal Transplant Recipients. The Pediatric Infectious Disease Journal 24:9, 778-781
CrossRef97
Holger Schmid, Hans Nitschko, Jens Gerth, Volker Kliem, Anna Henger, Clemens D. Cohen, Detlef Schl??ndorff, Hermann-Josef Gr??ne, Matthias Kretzler. (2005) Polyomavirus DNA and RNA Detection in Renal Allograft Biopsies: Results from a European Multicenter Study. Transplantation 80:5, 600-604
CrossRef98
Moriatsu Miyagi, Yukio Ishikawa, Sonoo Mizuiri, Atsushi Aikawa, Takehiro Ohara, Akira Hasegawa. (2005) Significance of subclinical rejection in early renal allograft biopsies for chronic allograft dysfunction. Clinical Transplantation 19:4, 456-465
CrossRef99
C. Bressollette-Bodin, M. Coste-Burel, M. Hourmant, V. Sebille, E. Andre-Garnier, B. M. Imbert-Marcille. (2005) A Prospective Longitudinal Study of BK Virus Infection in 104 Renal Transplant Recipients. American Journal of Transplantation 5:8, 1926-1933
CrossRef100
H. H. Hirsch, D. R. Snydman. (2005) BK Virus: Opportunity Makes a Pathogen. Clinical Infectious Diseases 41:3, 354-360
CrossRef101
Mieko Toyoda, Dechu P. Puliyanda, Nurmamet Amet, Lara Baden, Vinh Cam, Raju Radha, Andy Pao, Ashley Vo, Suphamai Bunnapradist, Asha Moudgil, Stanley C. Jordan. (2005) Co-infection of Polyomavirus-BK and Cytomegalovirus in Renal Transplant Recipients. Transplantation 80:2, 198-205
CrossRef102
Catherine M. Meyers, Allan D. Kirk. (2005) Workshop on Late Renal Allograft Dysfunction. American Journal of Transplantation 5:7, 1600-1605
CrossRef103
Cinthia B. Drachenberg, John C. Papadimitriou, Dean Mann, Hans H. Hirsch, Ravinder Wali, Emilio Ramos. (2005) Negative Impact of Human Leukocyte Antigen Matching in the Outcome of Polyomavirus Nephropathy. Transplantation 80:2, 276-278
CrossRef104
Hans H. Hirsch, Daniel C. Brennan, Cinthia B. Drachenberg, Fabrizio Ginevri, Jennifer Gordon, Ajit P. Limaye, Michael J. Mihatsch, Volker Nickeleit, Emilio Ramos, Parmjeet Randhawa, Ron Shapiro, Juerg Steiger, Manikkam Suthanthiran, Jennifer Trofe. (2005) Polyomavirus-Associated Nephropathy in Renal Transplantation: Interdisciplinary Analyses and Recommendations. Transplantation 79:10, 1277-1286
CrossRef105
Dominic C. Borie, Paul S. Changelian, Michael J. Larson, Ming-Sing Si, Ricardo Paniagua, John P. Higgins, Bari Holm, Andrew Campbell, Macy Lau, Sally Zhang, Mona G. Flores, Geraldine Rousvoal, Jennifer Hawkins, Douglas A. Ball, Elizabeth M. Kudlacz, William H. Brissette, Eileen A. Elliott, Bruce A. Reitz, Randall E. Morris. (2005) Immunosuppression by the JAK3 Inhibitor CP-690,550 Delays Rejection and Significantly Prolongs Kidney Allograft Survival in Nonhuman Primates. Transplantation 79:7, 791-801
CrossRef106
Daniel C. Brennan, Irfan Agha, Daniel L. Bohl, Mark A. Schnitzler, Karen L. Hardinger, Mark Lockwood, Stephanie Torrence, Rebecca Schuessler, Tiffany Roby, Monique Gaudreault-Keener, Gregory A. Storch. (2005) Incidence of BK with Tacrolimus Versus Cyclosporine and Impact of Preemptive Immunosuppression Reduction. American Journal of Transplantation 5:3, 582-594
CrossRef107
Ajit P. Limaye, Kelly D. Smith, Linda Cook, Debra A. Groom, Nicholas C. Hunt, Keith R. Jerome, Michael Boeckh. (2005) Polyomavirus Nephropathy in Native Kidneys of Non-Renal Transplant Recipients. American Journal of Transplantation 5:3, 614-620
CrossRef108
A. Y. H. Leung, M. T. L. Chan, K.-Y. Yuen, V. C. C. Cheng, K.-H. Chan, C. L. P. Wong, R. Liang, A. K. W. Lie, Y.-L. Kwong. (2005) Ciprofloxacin Decreased Polyoma BK Virus Load in Patients Who Underwent Allogeneic Hematopoietic Stem Cell Transplantation. Clinical Infectious Diseases 40:4, 528-537
CrossRef109
Gerald S. Lipshutz, Harish Mahanty, Sandy Feng, Ryutaro Hirose, Peter G. Stock, Sang-Mo Kang, Andrew M. Posselt, Chris E. Freise. (2005) BKV in Simultaneous Pancreas-Kidney Transplant Recipients: A Leading Cause of Renal Graft Loss in First 2 Years Post-Transplant. American Journal of Transplantation 5:2, 366-373
CrossRef110
Yukiomi Namba, Toshiki Moriyama, Masahiro Kyo, Ryoichi Imamura, Yi Shi, Naotsugu Ichimaru, Kazumasa Oka, Shiro Takahara, Akihiko Okuyama. (2005) Prevalence, characteristics, and outcome of BK virus nephropathy in Japanese renal transplant patients: analysis in protocol and episode biopsies. Clinical Transplantation 19:1, 97-101
CrossRef111
Allan D. Kirk, Roslyn B. Mannon, S. John Swanson, Douglas A. Hale. (2005) Strategies for minimizing immunosuppression in kidney transplantation. Transplant International 18:1, 2-14
CrossRef112
Halloran, Philip F., . (2004) Immunosuppressive Drugs for Kidney Transplantation. New England Journal of Medicine 351:26, 2715-2729
Full Text113
V. Erard, B. Storer, L. Corey, J. Nollkamper, M.-L. Huang, A. Limaye, M. Boeckh. (2004) BK Virus Infection in Hematopoietic Stem Cell Transplant Recipients: Frequency, Risk Factors, and Association with Postengraftment Hemorrhagic Cystitis. Clinical Infectious Diseases 39:12, 1861-1865
CrossRef114
Cinthia B. Drachenberg, John C. Papadimitriou, Hans H. Hirsch, Ravinder Wali, Clinton Crowder, Joseph Nogueira, Charles B. Cangro, Susan Mendley, Ayesa Mian, Emilio Ramos. (2004) Histological Patterns of Polyomavirus Nephropathy: Correlation with Graft Outcome and Viral Load. American Journal of Transplantation 4:12, 2082-2092
CrossRef115
Jodi M. Smith, Ruth A. McDonald, Laura S. Finn, Patrick J. Healey, Connie L. Davis, Ajit P. Limaye. (2004) Polyomavirus Nephropathy in Pediatric Kidney Transplant Recipients. American Journal of Transplantation 4:12, 2109-2117
CrossRef116
L. Haysom, A. R. Rosenberg, G. Kainer, Z. M. Waliuzzaman, J. Roberts, W. D Rawlinson, F. E Mackie. (2004) BK viral infection in an Australian pediatric renal transplant population. Pediatric Transplantation 8:5, 480-484
CrossRef117
Jean Herman, Marc Van Ranst, Robert Snoeck, Kurt Beuselinck, Evelyne Lerut, Rita Van Damme-Lombaerts. (2004) Polyomavirus infection in pediatric renal transplant recipients: Evaluation using a quantitative real-time PCR technique. Pediatric Transplantation 8:5, 485-492
CrossRef118
(2004) BK virus. American Journal of Transplantation 4:s10, 89-91
CrossRef119
Patrizia Comoli, Alberta Azzi, Rita Maccario, Sabrina Basso, Gerardo Botti, Giancarlo Basile, Iris Fontana, Massimo Labirio, Angela Cometa, Francesca Poli, Francesco Perfumo, Franco Locatelli, Fabrizio Ginevri. (2004) Polyomavirus BK-Specific Immunity after Kidney Transplantation. Transplantation 78:8, 1229-1232
CrossRef120
Abhay Vats. (2004) BK virus-associated transplant nephropathy: Need for increased awareness in children. Pediatric Transplantation 8:5, 421-425
CrossRef121
Paulo N Rocha, Troy J Plumb, Sara E Miller, David N Howell, Stephen R Smith. (2004) Risk factors for BK polyomavirus nephritis in renal allograft recipients1. Clinical Transplantation 18:4, 456-462
CrossRef122
TATSUYA TAKAYAMA, KATSUTOSHI MIURA, GUIPING HAN, TOMOMI USHIYAMA, KAZUO SUZUKI, KIMIO FUJITA. (2004) BK virus subtype 1 infection associated with tubulointerstitial nephritis in a renal allograft recipient. International Journal of Urology 11:8, 656-662
CrossRef123
C. Y. W. Tong. (2004) Monitoring the progress of BK virus associated nephropathy in renal transplant recipients. Nephrology Dialysis Transplantation 19:10, 2598-2605
CrossRef124
C. Polo, J. L. Perez, A. Mielnichuck, C. G. Fedele, J. Niubo, A. Tenorio. (2004) Prevalence and patterns of polyomavirus urinary excretion in immunocompetent adults and children. Clinical Microbiology and Infection 10:7, 640-644
CrossRef125
Roslyn B. Mannon. (2004) POLYOMAVIRUS NEPHROPATHY: WHAT HAVE WE LEARNED?1. Transplantation 77:9, 1313-1318
CrossRef126
Nestor F Varon, George J Alangaden. (2004) Emerging trends in infections among renal transplant recipients. Expert Review of Anti-infective Therapy 2:1, 95-109
CrossRef127
Gordon Y Kim, Joyce Peji, Gerard Nuovo, Fred Thomas. (2004) BK virus colonic ulcerations. Clinical Gastroenterology and Hepatology 2:2, 175-177
CrossRef128
Fernando G. Cosio, Margaret Nuovo, Lazaro Delgado, Martha Yearsley, Pierluigi Porcu, Michael Caligiuri, Ronald P. Pelletier, Gerard J. Nuovo. (2004) EBV Kidney Allograft Infection: Possible Relationship with a Peri-Graft Localization of PTLD. American Journal of Transplantation 4:1, 116-123
CrossRef129
Chiara Merlino, Massimiliano Bergallo, Giorgio Gribaudo, Gabriella Gregori, Giuseppe Paolo Segoloni, Franca Giacchino, Alessandro Negro Ponzi, Rossana Cavallo. (2003) Polyomavirus BK DNA quantification assay to evaluate viral load in renal transplant recipients. Journal of Clinical Virology 28:3, 265-274
CrossRef130
Hans H. Hirsch. (2003) BK virus replication and disease in solid organ transplant recipients: an update. Current Opinion in Organ Transplantation 8:4, 262-268
CrossRef131
Wai H LIM, Timothy H MATHEW, John E COOPER, Scott BOWDEN, Graeme R RUSS. (2003) Use of cidofovir in polyomavirus BK viral nephropathy in two renal allograft recipients. Nephrology 8:6, 318-323
CrossRef132
Volker Nickeleit, Harsharan K. Singh, Michael J. Mihatsch. (2003) Polyomavirus nephropathy: morphology, pathophysiology, and clinical management. Current Opinion in Nephrology and Hypertension 12:6, 599-605
CrossRef133
Hans H Hirsch, Jürg Steiger. (2003) Polyomavirus BK. The Lancet Infectious Diseases 3:10, 611-623
CrossRef134
Fabrizio Ginevri, Nadia Pastorino, Riccardo de Santis, Iris Fontana, Angela Sementa, Giuseppe Losurdo, Angelo Santopietro, Francesco Perfumo, Franco Locatelli, Rita Maccario, Alberta Azzi, Patrizia Comoli. (2003) Retransplantation after kidney graft loss due to polyoma BK virus nephropathy: successful outcome without original allograft nephrectomy. American Journal of Kidney Diseases 42:4, 821-825
CrossRef135
Hyeon Joo Jeong, Soon Hong, Sun Hee Sung, Hyunee Yim, Soon Kim, Yu Seun Kim, Kiil Park. (2003) Polyomavirus nephropathy in renal transplantation: a clinico-pathological study. Transplant International 16:9, 671-675
CrossRef136
Christopher K. Buehrig, Donna J. Lager, Mark D. Stegall, Michelle A. Kreps, Walter K. Kremers, James M. Gloor, Thomas R. Schwab, Jorge A. Velosa, Mary E. Fidler, Timothy S. Larson, Matthew D. Griffin. (2003) Influence of surveillance renal allograft biopsy on diagnosis and prognosis of polyomavirus-associated nephropathy. Kidney International 64:2, 665-673
CrossRef137
Zhi-Yuan Gu, Qi Li, Yi-Ling Si, Xue Li, Hao-Jie Hao, Hai-Jing Song. (2003) Prevalence of BK virus and JC virus in peripheral blood leukocytes and normal arterial walls in healthy individuals in China. Journal of Medical Virology 70:4, 600-605
CrossRef138
Ruchuang Ding, Manikkam Suthanthiran. (2003) Noninvasive diagnosis of BK virus nephritis by measurement of messenger RNA for BK VP1 virus in urine. Transplantation 76:2, 446
CrossRef139
Hans H. Hirsch. (2003) LETTERS TO THE EDITOR: VP1 MESSENGER RNA LEVELS IN URINE FOR DIAGNOSING BK VIRUS NEPHROPATHY?1,2. Transplantation 75:12, 2160
CrossRef140
M. Mengel. (2003) Incidence of polyomavirus-nephropathy in renal allografts: influence of modern immunosuppressive drugs. Nephrology Dialysis Transplantation 18:6, 1190-1196
CrossRef141
Abdolreza Haririan, Omar Hamze, Cinthia B. Drachenberg, Emilio Ramos, Matthew R. Weir, David K. Klassen. (2003) Polyomavirus reactivation in native kidneys of pancreas alone allograft recipients. Transplantation 75:8, 1186-1190
CrossRef142
F. Ginevri, R. de Santis, P. Comoli, N. Pastorino, C. Rossi, G. Botti, I. Fontana, A. Nocera, M. Cardillo, M. R. Ciardi, F. Locatelli, R. Maccario, F. Perfumo, A. Azzi. (2003) Polyomavirus BK infection in pediatric kidney-allograft recipients: a single-center analysis of incidence, risk factors, and novel therapeutic approaches. Transplantation 75:8, 1266-1270
CrossRef143
Ian D. McGilvray, Ginette Lajoie, Atul Humar, Mark S. Cattral. (2003) Polyomavirus Infection and Acute Vascular Rejection in a Kidney Allograft: Coincidence or Mimicry?. American Journal of Transplantation 3:4, 501-504
CrossRef144
J. Trofe, L.W. Gaber, R.J. Stratta, M.H. Shokouh-Amiri, S.R. Vera, R.R. Alloway, A. Lo, A.O. Gaber, M.F. Egidi. (2003) Polyomavirus in kidney and kidney--pancreas transplant recipients. Transplant Infectious Disease 5:1, 21-28
CrossRef145
Pradeep V. Kadambi, Michelle A. Josephson, James Williams, Lawrence Corey, Keith R. Jerome, Shane M. Meehan, Ajit P. Limaye. (2003) Treatment of Refractory BK Virus-Associated Nephropathy With Cidofovir. American Journal of Transplantation 3:2, 186-191
CrossRef146
Jay A. Fishman. (2003) BK Nephropathy: What is the Role of Antiviral Therapy?. American Journal of Transplantation 3:2, 99-100
CrossRef147
Abhay Vats, Ron Shapiro, Parmjeet Singh Randhawa, Velma Scantlebury, Acar Tuzuner, Malika Saxena, Michael L. Moritz, T. James Beattie, Thomas Gonwa, Michael D. Green, Demetrius Ellis. (2003) Quantitative viral load monitoring and cidofovir therapy for the management of BK virus-associated nephropathy in children and adults1. Transplantation 75:1, 105-112
CrossRef148
Rui-Mei Li, Roslyn B. Mannon, David Kleiner, Maria Tsokos, Michelle Bynum, Allen D. Kirk, Jeffrey B. Kopp. (2002) BK virus and SV40 co-infection in polyomavirus nehropathy1. Transplantation 74:11, 1497-1504
CrossRef149
Eun Jeong Kwak, Regis A. Vilchez, Parmjeet Randhawa, Ron Shapiro, Janet S. Butel, Shimon Kusne. (2002) Pathogenesis and Management of Polyomavirus Infection in Transplant Recipients. Clinical Infectious Diseases 35:9, 1081-1087
CrossRef150
David N. Howell, David W. Butterly, Sara E. Miller. (2002) Diagnosis of Polyomavirus Nephritis:. Pathology Case Reviews 7:6, 278-283
CrossRef151
Ruchuang Ding, Mara Medeiros, Darshana Dadhania, Thangamani Muthukumar, David Kracker, Jin M. Kong, Susanna R. Epstein, Vijay K. Sharma, Surya V. Seshan, Baogui Li, Manikkam Suthanthiran. (2002) Noninvasive diagnosis of BK virus nephritis by measurement of messenger RNA for BK virus VP1 in urine1. Transplantation 74:7, 987-994
CrossRef152
Hirsch, Hans H., Knowles, Wendy, Dickenmann, Michael, Passweg, Jakob, Klimkait, Thomas, Mihatsch, Michael J., Steiger, Jürg, . (2002) Prospective Study of Polyomavirus Type BK Replication and Nephropathy in Renal-Transplant Recipients. New England Journal of Medicine 347:7, 488-496
Full Text153
Fishman, Jay A., . (2002) BK Virus Nephropathy — Polyomavirus Adding Insult to Injury. New England Journal of Medicine 347:7, 527-530
Full Text154
C. Y. William Tong, Ali Bakran, J. S. Malik Peiris, Peter Muir, C. Simon Herrington. (2002) The association of viral infection and chronic allograft nephropathy with graft dysfunction after renal transplantation1, 2. Transplantation 74:4, 576-578
CrossRef155
Dan H. Barouch, William C. Faquin, Yiping Chen, Igor J. Koralnik, Gregory K. Robbins, Benjamin T. Davis. (2002) BK Virus–Associated Hemorrhagic Cystitis in a Human Immunodeficiency Virus–Infected Patient. Clinical Infectious Diseases 35:3, 326-329
CrossRef156
Antony D. Hale, Danguol
Bartkevičiūte, Aušra Dargevičiūt, Li Jin, Wendy Knowles, Juozas Staniulis, David W.G. Brown, Kestutis Sasnauskas. (2002) Expression and antigenic characterization of the major capsid proteins of human polyomaviruses BK and JC in Saccharomyces cerevisiae. Journal of Virological Methods 104:1, 93-98
CrossRef157
Gabriel M. Danovitch. (2002) How should the immunosuppressive regimen be managed in patients with established chronic allograft failure?. Kidney International 61:s80, 68-72
CrossRef158
Anskar Y.H Leung, Maggie Chan, Sydney C.W Tang, Raymond Liang, Y.L Kwong. (2002) Real-time quantitative analysis of polyoma BK viremia and viruria in renal allograft recipients. Journal of Virological Methods 103:1, 51-56
CrossRef159
Rajiv D. Poduval, Shane M. Meehan, E. Steve Woodle, J. Richard Thistlethwaite, Mark Haas, David C. Cronin, Abhay Vats, Michelle A. Josephson. (2002) Successful retransplantation after renal allograft loss to polyoma virus interstitial nephritis. Transplantation 73:7, 1166-1169
CrossRef160
Matthias P. Hörl, Michael Schmitz, Katrin Ivens, Bernd Grabensee. (2002) Opportunistic infections after renal transplantation. Current Opinion in Urology 12:2, 115-123
CrossRef161
Syed Hussain, Barbara A Bresnahan, Eric P Cohen, Sundaram Hariharan. (2002) Rapid kidney allograft failure in patients with polyoma virus nephritis with prior treatment with antilymphocyte agents. Clinical Transplantation 16:1, 43-47
CrossRef162
Hans H. Hirsch. (2002) Polyomavirus BK Nephropathy: A (Re-)emerging Complication in Renal Transplantation. American Journal of Transplantation 2:1, 25-30
CrossRef163
Rosemary Soave, Mario Marotta. (2001) The impact of BK virus on the renal transplant recipient. Current Opinion in Organ Transplantation 6:4, 290-294
CrossRef164
Luis E. De Las Casas, H. Daniel Hoerl, Ricardo H. Bardales, John D. Pirsch, Joan M. Sempf, Donna J. Wetzel, Jimmie Stewart, Terry D. Oberley, Daniel F.I. Kurtycz. (2001) Utility of urinary cytology for diagnosing human polyoma virus infection in transplant recipients: A study of 37 cases with electron microscopic analysis. Diagnostic Cytopathology 25:6, 376-381
CrossRef165
P. Ling Lin, Abhay N. Vats, Michael Green. (2001) BK virus infection in renal transplant recipients. Pediatric Transplantation 5:6, 398-405
CrossRef166
Eleftherios Mylonakis, Nelson Goes, Robert H. Rubin, Anthony B. Cosimi, Robert B. Colvin, Jay A. Fishman. (2001) BK VIRUS IN SOLID ORGAN TRANSPLANT RECIPIENTS: AN EMERGING SYNDROME. Transplantation 72:10, 1587-1592
CrossRef167
Rene C. Drachenberg, Cinthia B. Drachenberg, John C. Papadimitriou, Emilio Ramos, Jeffrey C. Fink, Rawinder Wali, Matthew R. Weir, Charles B. Cangro, David K. Klassen, Amr Khaled, Rochelle Cunningham, Stephen T. Bartlett. (2001) Morphological Spectrum of Polyoma Virus Disease in Renal Allografts: Diagnostic Accuracy of Urine Cytology. American Journal of Transplantation 1:4, 373-381
CrossRef168
Yousri M Barri, Ibrahim Ahmad, Beverley L Ketel, Gary W Barone, Patrick D Walker, Stephen M Bonsib, Sameh R Abul-Ezz. (2001) Polyoma viral infection in renal transplantation: the role of immunosuppressive therapy. Clinical Transplantation 15:4, 240-246
CrossRef169
Mark D. Reploeg, Gregory A. Storch, David B. Clifford. (2001) BK Virus: A Clinical Review. Clinical Infectious Diseases 33:2, 191-202
CrossRef170
Holger Moch. (2001) BK-virus nephropathy in renal allografts: a new diagnostic challenge in transplant pathology. Advances in Anatomic Pathology 8:4, 246-248
CrossRef171
Jutta K. Preiksaitis, Sandra M. Cockfield, Kiril Trpkov. (2001) Polyomavirus infection and disease in renal transplant recipients. Current Opinion in Organ Transplantation 6:2, 151-158
CrossRef172
Stephen R. Smith, David W. Butterly, Barbara D. Alexander, Arthur Greenberg. (2001) Viral infections after renal transplantation. American Journal of Kidney Diseases 37:4, 659-676
CrossRef173
Gabriel M Danovitch. (2001) Immunosuppressive medications for renal transplantation: A multiple choice question. Kidney International 59:1, 388-402
CrossRef174
Isabelle Binet, Volker Nickeleit, Hans H. Hirsch. (2000) Polyomavirus infections in transplant recipients. Current Opinion in Organ Transplantation 5:3, 210-216
CrossRef175
G. A. Storch. (2000) Diagnostic Virology. Clinical Infectious Diseases 31:3, 739-751
CrossRef176
Randhawa, Parmjeet S., Demetris, Anthony J., . (2000) Nephropathy Due to Polyomavirus Type BK. New England Journal of Medicine 342:18, 1361-1363
Full Text
