Original Article
Desmin Myopathy, a Skeletal Myopathy with Cardiomyopathy Caused by Mutations in the Desmin Gene
N Engl J Med 2000; 342:770-780March 16, 2000
- Abstract
Background
Myofibrillar myopathies are a heterogeneous group of inherited or sporadic skeletal myopathies associated with cardiomyopathy. Among the myofibrillar proteins that accumulate within the muscle fibers of affected patients, the one found most consistently is desmin, an intermediate-filament protein responsible for the structural integrity of the myofibrils. Skeletal and cardiac myopathy develops in mice that lack desmin, suggesting that mutations in the desmin gene may be pathogenic.
Methods
We examined 22 patients from 8 families with dominantly inherited myofibrillar or desmin-related myopathy and 2 patients with sporadic disease and analyzed the desmin gene for mutations, using complementary DNA (cDNA) amplified from muscle-biopsy specimens and genomic DNA extracted from blood lymphocytes. Restriction-enzyme analysis was used to confirm the mutations. Expression vectors containing normal or mutant desmin cDNA were introduced into cultured cells to determine whether the mutant desmin formed intermediate filaments.
Results
Six missense mutations in the coding region of the desmin gene that cause the substitution of an amino acid were identified in 11 patients (10 members of 4 families and 1 patient with sporadic disease); a splicing defect that resulted in the deletion of exon 3 was identified in the other patient with sporadic disease. Mutations were clustered in the carboxy-terminal part of the rod domain, which is critical for filament assembly. In transfected cells, the mutant desmin was unable to form a filamentous network. Seven of the 12 patients with mutations in the desmin gene had cardiomyopathy.
Conclusions
Mutations in the desmin gene affecting intermediate filaments cause a distinct myopathy that is often associated with cardiomyopathy and is termed “desmin myopathy.” The mutant desmin interferes with the normal assembly of intermediate filaments, resulting in fragility of the myofibrils and severe dysfunction of skeletal and cardiac muscles.
Media in This Article
Figure 3
SW13 (Vimentin-Negative) Cell Lines Transfected with a Plasmid Construct Containing Either a Normal Desmin cDNA Sequence or the cDNA Sequence of a Mutant Allele from the Proband in Family 2.Figure 4
Secondary Structure of Human Desmin and the Location of the Mutations Associated with Cardiac and Skeletal Myopathy.Article Activity
- Article
Myofibrillar or desmin-related myopathies are a heterogeneous group of severe, dominantly inherited, skeletal myopathies, often accompanied by cardiomyopathy, that result in syncopal episodes or sudden death due to conduction defects.1-5 They can be difficult to recognize because of the heterogeneity of the clinical characteristics among families and within families and the lack of diagnostic specificity of the findings on muscle biopsy. Various myofibrillar proteins, including desmin, dystrophin, vimentin, β-spectrin, and gelsolin, accumulate in the muscle fibers of affected patients,1-3 but the role of these proteins in the degeneration of muscle fibers is unknown. Among these proteins, desmin, a 52-kd protein, has been linked to desmin-related myopathy because it is consistently present and unusually abundant in patients with this disorder.1-3 Desmin is the chief intermediate filament of skeletal and cardiac muscle,6,7 maintains the structural and functional integrity of the myofibrils, and functions as a cytoskeletal protein linking Z bands to the plasma membrane. A skeletal and cardiac myopathy develops in mice that lack desmin,8-10 supporting the importance of this protein in maintaining the structural integrity of the muscle.
Support for the concept that mutant desmin may cause some cases of myofibrillar or desmin-related myopathy is provided by recent findings of missense mutations in the desmin gene in three families11,12 and by the demonstrated inability of the mutant desmin to produce a network of intermediate filaments.12 We describe 12 patients, 10 with familial disease and 2 with sporadic disease, who were identified among 24 patients with myofibrillar or desmin-related myopathy and who had pathogenic mutations in the desmin gene; these findings provide evidence that such mutations cause a distinct subtype, termed “desmin myopathy.”
Methods
Patients
Patients were admitted to the Neuromuscular Diseases Section of the National Institute of Neurological Disorders and Stroke according to an approved clinical protocol and after providing written informed consent. Twenty-two patients from eight families with dominantly inherited myofibrillar or desmin-related myopathy and two additional patients with no family history of myopathy were studied clinically, histologically, and genetically. Table 1Table 1
Characteristics of 12 Patients with Desmin Myopathy. lists the clinical and laboratory characteristics of 10 patients with familial cases from 4 families (Families 1, 2, 3, and 4) and 2 patients with sporadic cases (Patients 5 and 6) in whom mutations were identified in the desmin gene.In all 12 of these patients, muscle weakness began distally at a mean age of 28 years (range, 20 to 43) and progressed to proximal muscles, causing them varying degrees of difficulty walking, climbing the stairs, raising their arms, or using their hands. The severity of weakness differed among the patients and within members of the same family. Four patients became wheelchair-bound, and five required a walker or foot braces (Table 1). Dysphagia and weakness of the bulbar, facial, neck, and pectoralis muscles developed in seven patients, and two had respiratory-muscle weakness. Serum creatine kinase levels were mildly elevated in five patients (Table 1). All had normal sensation. In all patients, electromyographic studies showed myopathy and muscle biopsy demonstrated a myopathy with bluish accumulations on trichrome staining (Figure 1AFigure 1
Serial, Transverse Cross Sections of a Muscle-Biopsy Specimen from a Patient with Desmin Myopathy.) and strong immunoreactivity on staining with antibodies against desmin, indicative of desmin deposits (Figure 1B).Six patients had cardiac-conduction defects, and five had syncopal episodes that necessitated the implantation of a pacemaker (Table 1). In all three patients in Family 2 and in one of the two patients with sporadic cases (Patient 6), cardiomyopathy preceded skeletal myopathy by a mean of 12 years (range, 3 to 20). In the proband in Family 3, mitral-valve prolapse and mitral and tricuspid regurgitation developed 8 years after the onset of skeletal myopathy, and in the proband in Family 1, cardiac-conduction defects developed 22 years after the onset of skeletal myopathy. Two of the three patients in Family 2 died in their 30s of restrictive cardiomyopathy.
The father and two paternal uncles of the proband in Family 1 had initially been given a diagnosis of Charcot–Marie–Tooth disease after the development of distal-muscle weakness, and died in their 40s and 50s. The father of the three siblings studied in Family 2 died of a myocardial infarction at the age of 49 years. Patients 5 and 6 had no family history of myopathy and were not related.
In the other 12 patients with myofibrillar or desmin-related myopathy who did not have mutations in the desmin gene, the myopathy was clinically and histologically similar to that of the patients with desmin myopathy, except that the disease occurred later in life (mean age, 39 years) and there was no cardiomyopathy.
Histologic Analysis, Electron Microscopy, and Immunocytochemistry
Muscle biopsies were performed in all patients. Specimens were processed for enzyme histochemistry and immunocytochemistry as described previously.13 Serial sections that were 5 μm thick were stained with modified Gomori trichrome or with antibodies against desmin at a dilution of 1:100 (clone D33, Dako), antibodies against dystrophin at a dilution of 1:50 (clones Dy4/6D3 and Dy8/6C5, Novocastra Laboratories), antibodies against vimentin at a dilution of 1:200 (clone V9, Zymed), and antibodies against β-spectrin at a dilution of 1:100 (clone RB2/3D5, Novocastra Laboratories). For secondary antibodies, fluorescein-conjugated goat antimouse IgG or rhodamine-conjugated goat antimouse IgG was used. Muscle specimens were also processed for electron microscopy as described previously.13
Mutation Analysis
Total RNA was isolated from the muscle-biopsy specimens with the use of a kit (RNeasy kit, Qiagen). Reverse transcription was performed with 3 μg of total RNA according to the manufacturer's instructions (SuperScript II reverse transcriptase kit, GIBCO BRL), followed by the polymerase chain reaction (PCR) with the desmin-specific primers dF (5'CCGTCACCATGAGCCAGG3') and dR (5'AGAGGGTCTCTCGTCTTTAG3').11,14 Amplification was carried out in a total volume of 20 μl containing 1 μl of single-stranded complementary DNA (cDNA), 0.5 μM of each primer, 125 μM of each deoxynucleotide triphosphate, 1.5 mM magnesium chloride, 10 mM TRIS–hydrochloric acid (pH 8.3), 50 mM potassium chloride, and 0.6 unit of rTth polymerase (Perkin–Elmer Cetus). The resulting DNA fragments were purified (Qiaex II gel extraction kit, Qiagen) and cloned into the TA cloning vector (Invitrogen). Both strands were sequenced in at least nine clones.
Blood samples were obtained from the patients, their relatives, and normal subjects and stored in heparin-treated tubes. Genomic DNA extracted from these blood samples was used as the template for the PCR assay, with primers specific for the desmin sequences constructed for separate exons. Amplification was carried out with use of a procedure designed for each exon. The resultant DNA fragments were subcloned (TA Cloning Kit, Invitrogen), and both strands were sequenced in at least six clones. Sequencing of cloned DNA and cDNA was performed according to the manufacturer's instructions (DyePrimer Sequencing, Perkin–Elmer Cetus) on an automated DNA sequencer (model 373A, Applied Biosystems).
The same amplicons were also digested with restriction endonucleases (BsaHI, Bsp1286I, NcoI, Sbf I, BsaWI, and RsaI, New England Biolabs, and TaiI, MBI Fermentas) according to the manufacturer's instructions and subjected to electrophoresis on a 4 percent agarose gel with a low melting point (NuSieve GTG, FMC BioProducts). To determine whether these mutations are common DNA variations, we screened 150 to 211 healthy unrelated control subjects from American and European populations for these mutations.
Mutations in the αB-crystallin gene, which encodes a chaperone protein, were screened by direct sequencing of the PCR products of each exon. Amplification was accomplished with the use of primers and PCR conditions as described previously.15
Expression of Desmin in Cultured Cells
Expression vectors for normal and mutant desmin were introduced into SW13 (vimentin-negative) cells. Since these cells do not express the intermediate filaments desmin, vimentin, or keratin, they are ideal for an assessment of whether the mutated desmin can form a network of intermediate filaments. The DNA fragment encompassing desmin cDNA, including the start and stop codons, was amplified by reverse-transcription PCR (RT-PCR) and cloned into the pCR2.1 expression vector. The entire sequence of each clone was verified by sequence analysis. Desmin expression vectors were constructed for each identified mutation by cloning a 1.5-kb Hind III–XhoI fragment of the pCR2.1 clone containing either normal or mutant desmin cDNA into the mammalian expression vector pcDNA3.1. The SW13 (vimentin-negative) cells were grown to 50 percent confluence with Dulbecco's minimal essential medium containing 10 percent fetal-calf serum and transfected with the use of a transfection reagent (Effectene, Qiagen). Forty-eight hours after transfection, the cells were washed, exposed to 4 percent paraformaldehyde for 15 minutes, and incubated with human desmin monoclonal antibody (D1033, Sigma) for 16 hours at 4°C. For the secondary antibody, rhodamine-conjugated antimouse IgG (T7657, Sigma) was used. The cells were observed and photographed under a confocal microscope. Transfected cells from all mutations were also processed for electron microscopy.13
Results
Light-Microscopical, Immunocytochemical, and Ultrastructural Findings
The most consistent finding in every muscle-biopsy specimen was the presence of bluish accumulations in subsarcolemmal or centrally located areas (Figure 1A). In serial sections, these accumulations were strongly immunoreactive on staining with antibodies against desmin (Figure 1B). The number of fibers with desmin-positive accumulations varied among specimens and did not correlate with the severity of muscle weakness. All desmin-positive regions were also strongly positive for dystrophin and variably positive for vimentin or β-spectrin, as reported previously.1-3 Vacuoles (Figure 1), many of them red-rimmed, and small aggregates of rods were observed in specimens from five of six patients. Multiple nuclei, atrophic fibers, and cytoplasmic bodies were common. On electron microscopy, myofibrillar disruption, fragments of thin and thick filaments, streaming Z bands, and deposits of dense, amorphous material (Figure 1C and Figure 1D) were prominent in all specimens examined. Accumulations of intermediate filaments were not observed.
Analysis of the Desmin Gene Sequences
The length of the RT-PCR–amplified transcripts from each of the muscle-biopsy specimens, except for those from Patient 6, was 1437 bp. This was also the length of transcripts from the control samples and suggests the absence of splicing errors. Patient 6 had a smaller cDNA fragment of 1341 bp, in addition to a normal 1437-bp fragment, suggesting the occurrence of a heterozygous deletion. The cDNA-sequence analysis led to the identification of the deletion of exon 3. Sequencing of genomic DNA demonstrated that the deletion was due to a splicing defect caused by the substitution of guanine for adenine in the third nucleotide of the splice donor site in intron 3 (Table 2Table 2
Mutations in the Desmin Gene Identified in Patients with Desmin Myopathy.). With the exception of the splicing defect identified in Patient 6, the mutations consisted of missense mutations in the coding region of the desmin gene in 11 patients (Table 2). Three mutations identified in two families have already been briefly described.11 In both affected members of Family 1, the nucleotide sequence of desmin cDNA revealed the substitution of cytosine for guanine in exon 5, changing the sequence of codon 337 from GCC to CCC and the encoded amino acid from alanine to proline (Table 2). The mutation was verified by genomic sequencing and restriction-enzyme analysis with BsaHI. Each of the three affected members of Family 2 had two missense mutations, A360P on the maternal allele and N393I on the paternal allele (Table 2), indicating the presence of compound heterozygosity. Several unaffected family members carried one, but not both, of the mutations. Functional studies confirmed that both mutations cause a severely dysfunctional desmin. In three affected members of Family 3, nucleotide sequencing of desmin cDNA revealed the substitution of guanine for cytosine in exon 8, changing the sequence of codon 451 from ATC to ATG and the encoded amino acid from isoleucine to methionine (Table 2). Several unaffected family members were found to have the same mutation on restriction-enzyme analysis with NcoI. Both affected members of Family 4 had a guanine substituted for adenine in codon 342 of exon 6, changing the sequence of the codon from AAC to GAC and the encoded amino acid from asparagine to aspartic acid (Figure 2Figure 2
Nucleotide Sequences of Desmin Gene Fragments from Two Members of Family 4 with Familial Autosomal Dominant Myopathy (Panel A) and from Patient 5, Who Had Sporadic Cardiac and Skeletal Myopathy, and Her Unaffected Parents (Panel B). and Table 2). The mutation was confirmed by analysis with Sbf I.In Patient 5, who had sporadic desmin myopathy, thymine was substituted for cytosine in codon 406 of exon 6, changing the sequence of the codon from CGG to TGG and resulting in the substitution of tryptophan for arginine (Figure 2 and Table 2). None of the unaffected parents of the two patients with sporadic myopathy (Patients 5 and 6) had evidence of mutations on direct sequencing or restriction-enzyme analysis, confirming that these patients had spontaneous mutations in the desmin gene. The possibility of alternative paternity was excluded by assessment with a battery of microsatellite markers.
None of the normal subjects had any of the above-mentioned alterations in the desmin gene, indicating that these mutations are not polymorphisms. Desmin mutations were also excluded in the other four families with myofibrillar myopathies that we studied, based on sequencing of cDNA and of all nine exons amplified from genomic DNA. Also, no mutations in the αB-crystallin gene were identified.
Studies of in Vitro Expression
The SW13 (vimentin-negative) cells transfected with normal desmin protein formed extensive cytoplasmic filamentous networks that were positive for desmin (Figure 3AFigure 3
SW13 (Vimentin-Negative) Cell Lines Transfected with a Plasmid Construct Containing Either a Normal Desmin cDNA Sequence or the cDNA Sequence of a Mutant Allele from the Proband in Family 2.). Cells transfected with the expression vector containing each mutant desmin did not produce an intracellular filamentous network but formed desmin-positive aggregates scattered throughout the cytoplasm (Figure 3B). On electron microscopy (Figure 3C and Figure 3D) these aggregates resembled the accumulations seen in the muscle-biopsy specimens (Figure 1D). Cells transfected with the two mutant desmins from Family 2, which had two alterations in the desmin gene, did not produce a network of intermediate filaments. There were no apparent qualitative differences in the expression studies among the identified mutations, except for the mutation at codon 451, which led to only mild impairment of the filamentous network.Correlations between Phenotype and Genotype
Although most of the missense mutations causing myopathy were clustered at the carboxy-terminal part of the desmin rod domain (Figure 4Figure 4
Secondary Structure of Human Desmin and the Location of the Mutations Associated with Cardiac and Skeletal Myopathy.) within the 2B subdomain, there were differences in the clinical severity of disease and the age at onset of symptoms. In members of Family 1, who had an autosomal dominant mutation, the onset of disease was relatively late, the rate of progression was slow, and there was mild cardiomyopathy or none at all. In members of Family 2, who had compound heterozygosity, cardiomyopathy developed in early childhood and skeletal myopathy developed approximately 10 years later; two of the proband's affected brothers had died in their 30s. In Patient 5, severe and rapidly progressive myopathy developed in her 20s and was followed within months by cardiomyopathy. In Patient 6, who had a deletion mutation in the 1B subdomain, cardiomyopathy developed at the age of 40 years, and she had a moderate degree of skeletal myopathy by the age of 43 years. Most of the affected members of Family 3 and Family 4 did not have cardiomyopathy, but the severity of their skeletal myopathy ranged from mild to severe and involved respiratory muscles in Family 3.Discussion
This study provides direct evidence that among the dominantly inherited or sporadic myofibrillar myopathies, there is a genetically distinct subgroup — desmin myopathy — characterized by pathogenic mutations in the desmin gene and by frequent cardiac-conduction defects. In spite of the apparent clinical and histologic similarities between patients with desmin myopathy and those with other myofibrillar myopathies, none of the 12 patients from 4 families with other types of myofibrillar myopathies whom we studied had mutations in the coding region of the desmin gene, indicating that desmin myopathy is a distinct subgroup.
Among the four families with desmin myopathy defined by such mutations, three had an autosomal dominant mode of inheritance and the fourth (Family 2) demonstrated a pattern of inheritance compatible with the presence of compound heterozygosity. The two patients with sporadic disease (Patients 5 and 6) had spontaneous mutations. Since the frequency of sporadic myofibrillar myopathy appears to be high,4 the desmin gene and possibly other unidentified genes may be hot spots for mutations. One large family in which desmin gene mutations were excluded had functional mutations in the αB-crystallin gene,15 which encodes a chaperone protein necessary for the stabilization of desmin intermediate filaments.16 We excluded the possibility of mutations in the αB-crystallin gene in all our patients.
Functional studies provide compelling evidence that the mutations in the human desmin gene are pathogenic and interfere with the assembly of intermediate filaments in vitro. Because the functional abnormalities caused by the mutant desmin can be reversed by the insertion of a wild-type desmin,12 the amount of wild-type desmin within the myofibers may determine the severity of symptoms. Consequently, the absence of symptoms in heterozygous family members and the clinical heterogeneity within and between families may be related to the site of the mutation and to the presence of at least one wild-type allele. In experiments in vitro in our study and in other studies, truncated desmin molecules17,18 and mutant human desmin expressed in SW13 (vimentin-negative) cells produced aggregates similar to those seen in muscle-biopsy specimens. In the muscle, these accumulations are useful histologic markers, but they do not correlate with the severity of muscle involvement, suggesting that the cause of muscle weakness is related to the dysfunction of intermediate filaments rather than to the accumulation of myofibrillar proteins.
In the skeletal and cardiac muscles, normal desmin encircles the Z bands that hold together the actin filaments and help transmit tension along the myofibrils, protecting their structural integrity during repeated muscle contractures over time (Figure 5Figure 5
Main Intermediate Filaments and Cytoskeletal Proteins Linking the Extracellular Matrix with the Structural Muscle Proteins Associated with Mutations Causing Cardiac and Skeletal Myopathy.).6,7,19,23 Defects in the function of desmin, as well as in the other desmin-associated filaments, such as plectin and αB-crystallin (Figure 5), may therefore cause fragility of the myofibrils and impair contraction. In mice that lack desmin, cardiomyopathy and skeletal myopathy develop in older age.8,9,24,25 Remarkably, the presence of myopathy in mice correlates with the extent of muscle use, and the histologic features in muscle specimens from these mice are very similar to those of patients with desmin myopathy, including disrupted myofibrils and streaming of Z bands.8,9,25 In our patients, skeletal myopathy did not develop before the age of 20 years and in most cases was not rapidly progressive. Because intermediate filaments participate in the transmission of active force,26 the disruption of the filamentous network by the mutant desmin impairs the force generated within the contractile filaments and weakens the sarcomere (Figure 5), resulting in myofibrillar damage over a period of several years because of the cumulative effects of mechanical stress and muscle use. The contributory effect of mechanical stress with advancing age has been recognized in patients with metabolic myopathies.27 All but one of the six point mutations in the desmin gene that we identified were clustered at the carboxy-terminal part of the desmin rod domain, and five of them were within the 2B subdomain. The results of in vitro studies of peptide assembly have strongly indicated that the integrity of the carboxy-terminal part of the desmin rod is critically important for the proper assembly of intermediate filaments.17,18,28 The deletion of only four carboxy-terminal residues or the substitution of a single amino acid impairs the assembly of desmin molecules and disrupts the desmin–vimentin network.17,28 The introduction of proline residues at the carboxy-terminal end of the desmin rod, as occurs with A337P and A360P mutations, results in short, thick, and kinked irregular structures.28 A similar effect was observed in mutagenesis experiments with keratin, an intermediate filament in skin cells that is structurally and functionally similar to desmin.29
Recently, two additional mutations have been reported. One was identified in a family with dilated cardiomyopathy but without skeletal myopathy, in which no functional studies were performed.30 The other was identified in a large Ashkenazi Jewish family with 28 affected members in 6 generations with dominantly inherited distal myopathy associated with missense mutations in the desmin rod domain.31
Intermediate filaments are critical mechanical integrators of the cytoskeleton, protecting the cell from repeated mechanical stress. Mutations in the most common human intermediate filament, keratin, have been causally connected to epidermolysis bullosa simplex.7 Like the mutations in the desmin gene that interfere with the assembly of intermediate filaments in the muscles of humans and mice lacking desmin, mutations in the keratin gene affect the mechanical integrity of the epidermal cells. Thus, it appears that desminopathies along with keratinopathies form a new category of intermediate-filament disorders. Recognition of the desminopathies is important because cardiac-conduction defects, if unrecognized or unanticipated, can cause sudden death. Mutations in other intermediate-filament–associated proteins, such as plectin, which is a linker protein, connecting desmin to Z bands (Figure 5),19 and αB-crystallin, which protects desmin filaments from stress-induced damage, cause myopathy similar to desmin myopathy.15,20 Our findings expand the spectrum of genetically identifiable skeletal and cardiac myopathies caused by defects in proteins of the extracellular matrix, the dystroglyan complex, dystrophin, sarcomere, intermediate filaments, and components of the nuclear envelope.21,22
We are indebted to Dr. Victor Ferrans of the National Heart, Lung, and Blood Institute for help with the expression studies; to Neal Epstein for helpful discussions; and to all the patients who participated in the study.
Source Information
From the Neuromuscular Diseases Section (M.C.D., C.S.-M., K.S.) and the Clinical Neurogenetics Unit (K.-Y.P., H.S.L., L.G.G.), National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Md.
Address reprint requests to Dr. Dalakas at the Neuromuscular Diseases Section, NINDS, National Institutes of Health, Bldg. 10, Rm. 4N248, 10 Center Dr., MSC 1382, Bethesda, MD 20892-1382, or at dalakas@helix.nih.gov.
- References
References
1
Nakano S ,Engel AG ,Waclawik AJ ,Emslie-Smith AM ,Busis NA . Myofibrillar myopathy with abnormal foci of desmin positivity. I. Light and electron microscopy analysis of 10 cases. J Neuropathol Exp Neurol 1996;55:549-562
CrossRef | Web of Science | Medline2
De Bleecker JL ,Engel AG ,Ertl BB . Myofibrillar myopathy with abnormal foci of desmin positivity. II. Immunocytochemical analysis reveals accumulation of multiple other proteins. J Neuropathol Exp Neurol 1996;55:563-577
CrossRef | Web of Science | Medline3
Nakano S ,Engel AG ,Akiguchi I ,Kimura J . Myofibrillar myopathy. III. Abnormal expression of cyclin-dependent kinases and nuclear proteins. J Neuropathol Exp Neurol 1997;56:850-856
CrossRef | Web of Science | Medline4
Goebel HH . Desmin-related myopathies. Curr Opin Neurol 1997;10:426-429
CrossRef | Web of Science | Medline5
Amato AA ,Kagan-Hallet K ,Jackson CE , et al. The wide spectrum of myofibrillar myopathy suggests a multifactorial etiology and pathogenesis. Neurology 1998;51:1646-1655
Web of Science | Medline6
Lazarides E . Intermediate filaments as mechanical integrators of cellular space. Nature 1980;283:249-256
CrossRef | Web of Science | Medline7
Fuchs E ,Cleveland DW . A structural scaffolding of intermediate filaments in health and disease. Science 1998;279:514-519
CrossRef | Web of Science | Medline8
Capetanaki Y ,Milner DJ ,Weitzer G . Desmin in muscle formation and maintenance: knockouts and consequences. Cell Struct Funct 1997;22:103-116
CrossRef | Web of Science | Medline9
Milner DJ ,Weitzer G ,Tran D ,Bradley A ,Capetanaki Y . Disruption of muscle architecture and myocardial degeneration in mice lacking desmin. J Cell Biol 1996;134:1255-1270
CrossRef | Web of Science | Medline10
Thornell L-E ,Carlsson L ,Li Z ,Mericskay M ,Paulin D . Null mutation in the desmin gene gives rise to a cardiomyopathy. J Mol Cell Cardiol 1997;29:2107-2124
CrossRef | Web of Science | Medline11
Goldfarb LG ,Park K-Y ,Cervenakova L , et al. Missense mutations in desmin associated with familial cardiac and skeletal myopathy. Nat Genet 1998;19:402-403
CrossRef | Web of Science | Medline12
Munoz-Marmol AM ,Strasser G ,Isamat M , et al. A dysfunctional desmin mutation in a patient with severe generalized myopathy. Proc Natl Acad Sci U S A 1998;95:11312-11317
CrossRef | Web of Science | Medline13
Semino-Mora C ,Dalakas MC . Rimmed vacuoles with β-amyloid and ubiquitinated filamentous deposits in the muscles of patients with long-standing denervation (postpoliomyelitis muscular atrophy): similarities with inclusion body myositis. Hum Pathol 1998;29:1128-1133
CrossRef | Web of Science | Medline14
Vicart P ,Dupret JM ,Hazan J , et al. Human desmin gene: cDNA sequence, regional localization and exclusion of the locus in a familial desmin-related myopathy. Hum Genet 1996;98:422-429
CrossRef | Web of Science | Medline15
Vicart P ,Caron A ,Guicheney P , et al. A missense mutation in the αB-crystallin chaperone gene causes a desmin-related myopathy. Nat Genet 1998;20:92-95
CrossRef | Web of Science | Medline16
Bennardini F ,Wrzosek A ,Chiesi M . αB-crystallin in cardiac tissue: association with actin and desmin filaments. Circ Res 1992;71:288-294
Web of Science | Medline17
Yu KR ,Hijikata T ,Lin ZX ,Sweeney HL ,Englander SW ,Holtzer H . Truncated desmin in PtK2 cells induces desmin-vimentin-cytokeratin coprecipitation, involution of intermediate filament networks, and nuclear fragmentation: a model for many degenerative diseases. Proc Natl Acad Sci U S A 1994;91:2497-2501
CrossRef | Web of Science | Medline18
Raats JM ,Schaart G ,Henderik JB , et al. Muscle-specific expression of a dominant negative desmin mutant in transgenic mice. Eur J Cell Biol 1996;71:221-236
Web of Science | Medline19
Hijikata T ,Murakami T ,Imamura M ,Fujimaki N ,Ishikawa H . Plectin is a linker of intermediate filaments to Z-discs in skeletal muscle fibers. J Cell Sci 1999;112:867-876
Web of Science | Medline20
Banwell BL ,Russel J ,Fukudome T ,Shen XM ,Stilling G ,Engel AG . Myopathy, myasthenic syndrome, and epidermolysis bullosa simplex due to plectin deficiency. J Neuropathol Exp Neurol 1999;58:832-846
CrossRef | Web of Science | Medline21
Dalakas MC. Diseases of muscle and the neuromuscular junction. Part 3 of Neurology. No. 11. In: Rubinstein E, ed. Scientific American medicine. Vol. 3. New York: Scientific American, 1997:111-1–111-14.
22
Fatkin D ,MacRae C ,Sasaki T , et al. Missense mutations in the rod domain of the lamin A/C gene as causes of dilated cardiomyopathy and conduction-system disease. N Engl J Med 1999;341:1715-1724
Full Text | Web of Science | Medline23
Watson PA ,Hannan R ,Carl LL ,Giger KE . Desmin gene expression in cardiac myocytes is responsive to contractile activity and stretch. Am J Physiol 1996;270:C1228-C1235
Web of Science | Medline24
Weitzer G ,Milner DJ ,Kim JU ,Bradley A ,Capetanaki Y . Cytoskeletal control of myogenesis: a desmin null mutation blocks the myogenic pathway during embryonic stem cell differentiation. Dev Biol 1995;172:422-439
CrossRef | Web of Science | Medline25
Li Z ,Colucci-Guyon E ,Pincon-Raymond M , et al. Cardiovascular lesions and skeletal myopathy in mice lacking desmin. Dev Biol 1996;175:362-366
CrossRef | Web of Science | Medline26
Sjuve R ,Arner A ,Li Z , et al. Mechanical alterations in smooth muscle from mice lacking desmin. J Muscle Res Cell Motil 1998;19:415-429
CrossRef | Web of Science | Medline27
Sivakumar K ,Vasconcelos O ,Goldfarb L ,Dalakas MC . Late-onset muscle weakness in partial phosphofructokinase deficiency: a unique myopathy with vacuoles, abnormal mitochondria, and absence of the common exon 5/intron 5 junction point mutation. Neurology 1996;46:1337-1342
Web of Science | Medline28
Raats JMH ,Henderik JBJ ,Verdijk M , et al. Assembly of carboxy-terminally deleted desmin in vimentin-free cells. Eur J Cell Biol 1991;56:84-103
Web of Science | Medline29
Letai A ,Coulombe PA ,Fuchs E . Do the ends justify the means? Proline mutations at the ends of the keratin coiled-coil rod segment are more disruptive than internal mutations. J Cell Biol 1992;116:1181-1195
CrossRef | Web of Science | Medline30
Li D ,Tapscoft T ,Gonzalez O , et al. Desmin mutation responsible for idiopathic dilated cardiomyopathy. Circulation 1999;100:461-464
Web of Science | Medline31
Sjoberg G ,Saavedra-Matiz CA ,Rosen DR , et al. A missense mutation in the desmin rod domain is associated with autosomal dominant distal myopathy, and exerts a dominant negative effect on filament formation. Hum Mol Genet 1999;8:2191-2198
CrossRef | Web of Science | Medline
- Citing Articles (110)
Citing Articles
1
K. Y. Spaendonck-Zwarts, A. J. Kooi, M. P. Berg, E. F. Ippel, L. G. Boven, W.-C. Yee, A. Wijngaard, E. Brusse, J. E. Hoogendijk, P. A. Doevendans, M. Visser, J. D. H. Jongbloed, J. P. Tintelen. (2012) Recurrent and founder mutations in the Netherlands: the cardiac phenotype of DES founder mutations p.S13F and p.N342D. Netherlands Heart Journal
CrossRef2
Rainer Ng, Glen B. Banks, John K. Hall, Lindsey A. Muir, Julian N. Ramos, Jacqueline Wicki, Guy L. Odom, Patryk Konieczny, Jane Seto, Joel R. Chamberlain, Jeffrey S. Chamberlain. 2012. Animal Models of Muscular Dystrophy. , 83-111.
CrossRef3
Ornella Leone, John P. Veinot, Annalisa Angelini, Ulrik T. Baandrup, Cristina Basso, Gerald Berry, Patrick Bruneval, Margaret Burke, Jagdish Butany, Fiorella Calabrese, Giulia d'Amati, William D. Edwards, John T. Fallon, Michael C. Fishbein, Patrick J. Gallagher, Marc K. Halushka, Bruce McManus, Angela Pucci, E. René Rodriguez, Jeffrey E. Saffitz, Mary N. Sheppard, Charles Steenbergen, James R. Stone, Carmela Tan, Gaetano Thiene, Allard C. van der Wal, Gayle L. Winters. (2011) 2011 Consensus statement on endomyocardial biopsy from the Association for European Cardiovascular Pathology and the Society for Cardiovascular Pathology. Cardiovascular Pathology
CrossRef4
Karim Wahbi, Anthony Béhin, Philippe Charron, Murielle Dunand, Pascale Richard, Christophe Meune, Patrick Vicart, Pascal Laforêt, Tanya Stojkovic, Henri Marc Bécane, Thierry Kuntzer, Denis Duboc. (2011) High cardiovascular morbidity and mortality in myofibrillar myopathies due to DES gene mutations: a 10-year longitudinal study. Neuromuscular Disorders
CrossRef5
Maik Hüttemann, Scott Klewer, Icksoo Lee, Alena Pecinova, Petr Pecina, Jenney Liu, Michael Lee, Jeffrey W. Doan, Douglas Larson, Elise Slack, Bita Maghsoodi, Robert P. Erickson, Lawrence I. Grossman. (2011) Mice deleted for heart-type cytochrome c oxidase subunit 7a1 develop dilated cardiomyopathy. Mitochondrion
CrossRef6
KY van Spaendonck-Zwarts, L van Hessem, JDH Jongbloed, HEK de Walle, Y Capetanaki, AJ van der Kooi, IM van Langen, MP van den Berg, JP van Tintelen. (2011) Desmin-related myopathy. Clinical Genetics 80:4, 354-366
CrossRef7
Montse Olivé, Zagaa Odgerel, Amaia Martínez, Juan José Poza, Federico García Bragado, Ramón J. Zabalza, Ivonne Jericó, Laura Gonzalez-Mera, Alexey Shatunov, Hee Suk Lee, Judith Armstrong, Elías Maraví, Maria Ramos Arroyo, Jordi Pascual-Calvet, Carmen Navarro, Carmen Paradas, Mariano Huerta, Fabian Marquez, Eduardo Gutierrez- Rivas, Adolf Pou, Isidre Ferrer, Lev G. Goldfarb. (2011) Clinical and myopathological evaluation of early- and late-onset subtypes of myofibrillar myopathy. Neuromuscular Disorders 21:8, 533-542
CrossRef8
Andrew Gomez-Vargas, Steven K. Baker. (2011) Molecular Diagnosis of Myopathies. Rheumatic Disease Clinics of North America 37:2, 269-287
CrossRef9
D. Hong, Z. Wang, W. Zhang, J. Xi, J. Lu, X. Luan, Y. Yuan. (2011) A series of Chinese patients with desminopathy associated with six novel and one reported mutations in the desmin gene. Neuropathology and Applied Neurobiology 37:3, 257-270
CrossRef10
Joseph A. Hill. (2011) Autophagy in Cardiac Plasticity and Disease. Pediatric Cardiology 32:3, 282-289
CrossRef11
Ralph Knöll, Byambajav Buyandelger, Max Lab. (2011) The Sarcomeric Z-Disc and Z-Discopathies. Journal of Biomedicine and Biotechnology 2011, 1-12
CrossRef12
Bjarne Udd. 2011. Distal muscular dystrophies. , 239-262.
CrossRef13
Lev G Goldfarb, Montse Olivé, Patrick Vicart, Hans H Goebel. 2010. Desminopathy. .
CrossRef14
Jessica E. Rodríguez, Monte S. Willis. (2010) The therapeutic potential of heat shock proteins in cardiomyopathies due to mutations in cardiac structural proteins. Journal of Molecular and Cellular Cardiology 49:6, 904-907
CrossRef15
B. Klauke, S. Kossmann, A. Gaertner, K. Brand, I. Stork, A. Brodehl, M. Dieding, V. Walhorn, D. Anselmetti, D. Gerdes, B. Bohms, U. Schulz, E. zu Knyphausen, M. Vorgerd, J. Gummert, H. Milting. (2010) De novo desmin-mutation N116S is associated with arrhythmogenic right ventricular cardiomyopathy. Human Molecular Genetics 19:23, 4595-4607
CrossRef16
M. Tang, J. Li, W. Huang, H. Su, Q. Liang, Z. Tian, K. M. Horak, J. D. Molkentin, X. Wang. (2010) Proteasome functional insufficiency activates the calcineurin-NFAT pathway in cardiomyocytes and promotes maladaptive remodelling of stressed mouse hearts. Cardiovascular Research 88:3, 424-433
CrossRef17
Susan W. Denfield, Steven A. Webber. (2010) Restrictive Cardiomyopathy in Childhood. Heart Failure Clinics 6:4, 445-452
CrossRef18
Ellen Otten, Angeliki Asimaki, Alexander Maass, Irene M. van Langen, Allard van der Wal, Nicolaas de Jonge, Maarten P. van den Berg, Jeffrey E. Saffitz, Arthur A.M. Wilde, Jan D.H. Jongbloed, J. Peter van Tintelen. (2010) Desmin mutations as a cause of right ventricular heart failure affect the intercalated disks. Heart Rhythm 7:8, 1058-1064
CrossRef19
Karen Maass. (2010) Arrhythmogenic Right Ventricular Cardiomyopathy and Desmin: Another gene fits the shoe. Heart Rhythm 7:8, 1065-1066
CrossRef20
Lisa Dellefave, Elizabeth M McNally. (2010) The genetics of dilated cardiomyopathy. Current Opinion in Cardiology 25:3, 198-204
CrossRef21
Michael Kottlors, Olaf Moske-Eick, Angela Huebner, Sabine Krause, Klaus Mueller, Wolfram Kress, Ralf Schwarzwald, Antje Bornemann, Verena Haug, Markus Heitzer, Janbernd Kirschner. (2010) Late-onset autosomal dominant limb girdle muscular dystrophy and Paget's disease of bone unlinked to the VCP gene locus. Journal of the Neurological Sciences 291:1-2, 79-85
CrossRef22
Luis Vernengo, Oussama Chourbagi, Ana Panuncio, Alain Lilienbaum, Sabrina Batonnet-Pichon, Francine Bruston, Fernando Rodrigues-Lima, Rosario Mesa, Carlos Pizzarossa, Laurence Demay, Pascale Richard, Patrick Vicart, Maria-Mirta Rodriguez. (2010) Desmin myopathy with severe cardiomyopathy in a Uruguayan family due to a codon deletion in a new location within the desmin 1A rod domain. Neuromuscular Disorders 20:3, 178-187
CrossRef23
N. P. Dantuma, K. Lindsten. (2010) Stressing the ubiquitin-proteasome system. Cardiovascular Research 85:2, 263-271
CrossRef24
Juan Pablo Kaski, Perry Elliott. 2010. Cardiomyopathies. , 1003-1034.
CrossRef25
Jee Young Kim, Eun Hae Jeong, Kee Duk Park, Heasoo Koo. (2010) Myofibrillar Myopathy - A Case Report -. The Korean Journal of Pathology 44:4, 426
CrossRef26
J. Peter van Tintelen, Isabelle C. Van Gelder, Angeliki Asimaki, Albert J.H. Suurmeijer, Ans C.P. Wiesfeld, Jan D.H. Jongbloed, Arthur van den Wijngaard, Jan B.M. Kuks, Karin Y. van Spaendonck-Zwarts, Nicolette Notermans, Ludolf Boven, Freek van den Heuvel, Hermine E. Veenstra-Knol, Jeffrey E. Saffitz, Robert M.W. Hofstra, Maarten P. van den Berg. (2009) Severe cardiac phenotype with right ventricular predominance in a large cohort of patients with a single missense mutation in the DES gene. Heart Rhythm 6:11, 1574-1583
CrossRef27
Hector R. Mobine, George C. Engelmayr, Nelson Moussazadeh, Tayyba R. Anwar, Lisa E. Freed, Elazer R. Edelman. (2009) Encapsulated Pheochromocytoma Cells Secrete Potent Noncatecholamine Factors. Tissue Engineering Part A 15:7, 1719-1728
CrossRef28
Lev G. Goldfarb, Marinos C. Dalakas. (2009) Tragedy in a heartbeat: malfunctioning desmin causes skeletal and cardiac muscle disease. Journal of Clinical Investigation 119:7, 1806-1813
CrossRef29
Alexey Shatunov, Montse Olivé, Zagaa Odgerel, Christine Stadelmann-Nessler, Kerstin Irlbacher, Frank van Landeghem, Munkhuu Bayarsaikhan, Hee-Suk Lee, Bertrand Goudeau, Patrick F Chinnery, Volker Straub, David Hilton-Jones, Maxwell S Damian, Anna Kaminska, Patrick Vicart, Kate Bushby, Marinos C Dalakas, Nyamkhishig Sambuughin, Isidro Ferrer, Hans H Goebel, Lev G Goldfarb. (2009) In-frame deletion in the seventh immunoglobulin-like repeat of filamin C in a family with myofibrillar myopathy. European Journal of Human Genetics 17:5, 656-663
CrossRef30
Duygu Selcen, Francesco Muntoni, Barbara K. Burton, Elena Pegoraro, Caroline Sewry, Anna V. Bite, Andrew G. Engel. (2009) Mutation in BAG3 causes severe dominant childhood muscular dystrophy. Annals of Neurology 65:1, 83-89
CrossRef31
Nicolai Schramm, Christine Born, Sabine Weckbach, Peter Reilich, Maggie C. Walter, Maximilian F. Reiser. (2008) Involvement patterns in myotilinopathy and desminopathy detected by a novel neuromuscular whole-body MRI protocol. European Radiology 18:12, 2922-2936
CrossRef32
M. S. Willis, J. C. Schisler, A. L. Portbury, C. Patterson. (2008) Build it up-Tear it down: protein quality control in the cardiac sarcomere. Cardiovascular Research 81:3, 439-448
CrossRef33
Isidre Ferrer, Montse Olivé. (2008) Molecular pathology of myofibrillar myopathies. Expert Reviews in Molecular Medicine 10,
CrossRef34
P. Tannous, H. Zhu, J. L. Johnstone, J. M. Shelton, N. S. Rajasekaran, I. J. Benjamin, L. Nguyen, R. D. Gerard, B. Levine, B. A. Rothermel, J. A. Hill. (2008) Autophagy is an adaptive response in desmin-related cardiomyopathy. Proceedings of the National Academy of Sciences 105:28, 9745-9750
CrossRef35
Katharina Strach, Torsten Sommer, Christian Grohé, Carsten Meyer, Dirk Fischer, Maggie C. Walter, Matthias Vorgerd, Peter Reilich, Harald Bär, Jens Reimann, Ulrike Reuner, Alfried Germing, Hans Hilmar Goebel, Hanns Lochmüller, Bernd Wintersperger, Rolf Schröder. (2008) Clinical, genetic, and cardiac magnetic resonance imaging findings in primary desminopathies. Neuromuscular Disorders 18:6, 475-482
CrossRef36
Steven A. Webber. (2008) Primary restrictive cardiomyopathy in childhood. Progress in Pediatric Cardiology 25:1, 85-90
CrossRef37
Luisa Mestroni, Shelley D. Miyamoto, Matthew R.G. Taylor. (2007) Genetics of dilated cardiomyopathy conduction disease. Progress in Pediatric Cardiology 24:1, 3-13
CrossRef38
Derk Frank, Christian Kuhn, Hugo A Katus, Norbert Frey. (2007) Role of the sarcomeric Z-disc in the pathogenesis of cardiomyopathy. Future Cardiology 3:6, 611-622
CrossRef39
Jorieke E.H. Bergman, Hermine E. Veenstra-Knol, Anthonie J. van Essen, Conny M.A. van Ravenswaaij, Wilfred F.A. den Dunnen, Arthur van den Wijngaard, J. Peter van Tintelen. (2007) Two related Dutch families with a clinically variable presentation of cardioskeletal myopathy caused by a novel S13F mutation in the desmin gene. European Journal of Medical Genetics 50:5, 355-366
CrossRef40
Namakkal S. Rajasekaran, Patrice Connell, Elisabeth S. Christians, Liang-Jun Yan, Ryan P. Taylor, András Orosz, Xiu Q. Zhang, Tamara J. Stevenson, Ronald M. Peshock, Jane A. Leopold, William H. Barry, Joseph Loscalzo, Shannon J. Odelberg, Ivor J. Benjamin. (2007) Human αB-Crystallin Mutation Causes Oxido-Reductive Stress and Protein Aggregation Cardiomyopathy in Mice. Cell 130:3, 427-439
CrossRef41
Jan Lammerding, Richard T. Lee. (2007) Torn apart: membrane rupture in muscular dystrophies and associated cardiomyopathies. Journal of Clinical Investigation 117:7, 1749-1752
CrossRef42
Yassemi Capetanaki, Robert J. Bloch, Asimina Kouloumenta, Manolis Mavroidis, Stelios Psarras. (2007) Muscle intermediate filaments and their links to membranes and membranous organelles. Experimental Cell Research 313:10, 2063-2076
CrossRef43
Robert G. Oshima. (2007) Intermediate filaments: A historical perspective. Experimental Cell Research 313:10, 1981-1994
CrossRef44
Harald Bär, Bertrand Goudeau, Sarah Wälde, Monique Casteras-Simon, Norbert Mücke, Alexey Shatunov, Y. Paul Goldberg, Charles Clarke, Janice L. Holton, Bruno Eymard, Hugo A. Katus, Michel Fardeau, Lev Goldfarb, Patrick Vicart, Harald Herrmann. (2007) Conspicuous involvement of desmin tail mutations in diverse cardiac and skeletal myopathies. Human Mutation 28:4, 374-386
CrossRef45
Piotr Pruszczyk, Anna Kostera-Pruszczyk, Alexey Shatunov, Bertrand Goudeau, Agnieszka Dramiñska, Kazuyo Takeda, Nyamkhishig Sambuughin, Patrick Vicart, Sergei V. Strelkov, Lev G. Goldfarb, Anna Kamiñska. (2007) Restrictive cardiomyopathy with atrioventricular conduction block resulting from a desmin mutation. International Journal of Cardiology 117:2, 244-253
CrossRef46
Raghavan Raju, Marinos C. Dalakas. (2007) Absence of upregulated genes associated with protein accumulations in desmin myopathy. Muscle & Nerve 35:3, 386-388
CrossRef47
Takashi Yuri, Katsuaki Miki, Reiko Tsukamoto, Akiyo Shinde, Hirofumi Kusaka, Airo Tsubura. (2007) Autopsy case of desminopathy involving skeletal and cardiac muscle. Pathology International 57:1, 32-36
CrossRef48
Bertrand Goudeau, Fernando Rodrigues-Lima, Dirk Fischer, Monique Casteras-Simon, Nyamkhishig Sambuughin, Marianne de Visser, Pascal Laforet, Xavier Ferrer, Françoise Chapon, Gunnar Sjöberg, Anna Kostareva, Thomas Sejersen, Marinos C. Dalakas, Lev G. Goldfarb, Patrick Vicart. (2006) Variable pathogenic potentials of mutations located in the desmin alpha-helical domain. Human Mutation 27:9, 906-913
CrossRef49
Jarmila Machackova, Judit Barta, Naranjan S. Dhalla. (2006) Myofibrillar remodelling in cardiac hypertrophy, heart failure and cardiomyopathies. Canadian Journal of Cardiology 22:11, 953-968
CrossRef50
JEFFREY A. TOWBIN, NEIL E. BOWLES. (2006) Dilated Cardiomyopathy: A Tale of Cytoskeletal Proteins and Beyond. Journal of Cardiovascular Electrophysiology 17:8, 919-926
CrossRef51
Manuel Arias, Julio Pardo, Patricia Blanco-Arias, María-Jesús Sobrido, Susana Arias, Dolores Dapena, Ángel Carracedo, Lev G. Goldfarb, Carmen Navarro. (2006) Distinct phenotypic features and gender-specific disease manifestations in a Spanish family with desmin L370P mutation. Neuromuscular Disorders 16:8, 498-503
CrossRef52
Derk Frank, Christian Kuhn, Hugo A. Katus, Norbert Frey. (2006) The sarcomeric Z-disc: a nodal point in signalling and disease. Journal of Molecular Medicine 84:6, 446-468
CrossRef53
Hu Wang, Jizheng Wang, Weiyue Zheng, Xiaojian Wang, Shuxia Wang, Lei Song, Yubao Zou, Yan Yao, Rutai Hui. (2006) Mutation Glu82Lys in lamin A/C gene is associated with cardiomyopathy and conduction defect. Biochemical and Biophysical Research Communications 344:1, 17-24
CrossRef54
Harald Bär, Anna Kostareva, Gunnar Sjöberg, Thomas Sejersen, Hugo A. Katus, Harald Herrmann. (2006) Forced expression of desmin and desmin mutants in cultured cells: Impact of myopathic missense mutations in the central coiled-coil domain on network formation. Experimental Cell Research 312:9, 1554-1565
CrossRef55
Nicole M Judge, Daniel P Johnson. 2006. Genetics and Heart Failure: Dilated, Restrictive, and Right Ventricular Cardiomyopathies. , 607-622.
CrossRef56
Henghui Yin, Xinling Zhang, Jinsong Wang, Wei Yin, Ge Zhang, Shenming Wang, Qing Liu. (2006) Downregulation of desmuslin in primary vein incompetence. Journal of Vascular Surgery 43:2, 372-378
CrossRef57
Lev G Goldfarb, Patrick Vicart, Hans H Goebel. 2006. Desmin-related Myopathies. .
CrossRef58
Changbaig Hyun, Lucio J. Filippich. (2006) Molecular genetics of sudden cardiac death in small animals – A review. The Veterinary Journal 171:1, 39-50
CrossRef59
Simona Ozden, Vincent Mouly, Marie-Christine Prevost, Antoine Gessain, Gillian Butler-Browne, Pierre-Emmanuel Ceccaldi. (2005) Muscle Wasting Induced by HTLV-1 Tax-1 Protein. The American Journal of Pathology 167:6, 1609-1619
CrossRef60
Anna Fidziańska, Jerzy Kotowicz, Marta Sadowska, Bertrand Goudeau, Ewa Walczak, Patrick Vicart, Irena Hausmanowa-Petrusewicz. (2005) A novel desmin R355P mutation causes cardiac and skeletal myopathy. Neuromuscular Disorders 15:8, 525-531
CrossRef61
A. Perrot, S. Spuler, C. Geier, R. Dietz, K. J. Osterziel. (2005) Kardiale Manifestationen bei Muskeldystrophien. Zeitschrift für Kardiologie 94:5, 312-320
CrossRef62
I. Ferrer, M. Carmona, R. Blanco, D. Moreno, B. Torrejón-Escribano, M. Olivé. (2005) Involvement of Clusterin and the Aggresome in Abnormal Protein Deposits in Myofibrillar Myopathies and Inclusion Body Myositis. Brain Pathology 15:2, 101-108
CrossRef63
Steven A. Greenberg, Ronan J. Walsh. (2005) Molecular diagnosis of inheritable neuromuscular disorders. Part II: Application of genetic testing in neuromuscular disease. Muscle & Nerve 31:4, 431-451
CrossRef64
Alexandra Vrabie, Lev G. Goldfarb, Alexey Shatunov, Andrea Nägele, Peter Fritz, Ingo Kaczmarek, Hans H. Goebel. (2005) The enlarging spectrum of desminopathies: new morphological findings, eastward geographic spread, novel exon 3 desmin mutation. Acta Neuropathologica 109:4, 411-417
CrossRef65
Hiroyuki Morita, Jonathan Seidman, Christine E. Seidman. (2005) Genetic causes of human heart failure. Journal of Clinical Investigation 115:3, 518-526
CrossRef66
Duygu Selcen, Andrew G. Engel. (2005) Mutations inZASP define a novel form of muscular dystrophy in humans. Annals of Neurology 57:2, 269-276
CrossRef67
D S Tews, H H Goebel. (2005) Diagnostic immunohistochemistry in neuromuscular disorders. Histopathology 46:1, 1-23
CrossRef68
Omary, M. Bishr, Coulombe, Pierre A., McLean, W.H. Irwin, . (2004) Intermediate Filament Proteins and Their Associated Diseases. New England Journal of Medicine 351:20, 2087-2100
Full Text69
Arun V. Krishnan, Roger Pamphlett, David Burke, Edward J. Wills, Matthew C. Kiernan. (2004) Cytoplasmic body myopathy masquerading as motor neuron disease. Muscle & Nerve 30:5, 667-672
CrossRef70
Harald Bär, Sergei V. Strelkov, Gunnar Sjöberg, Ueli Aebi, Harald Herrmann. (2004) The biology of desmin filaments: how do mutations affect their structure, assembly, and organisation?. Journal of Structural Biology 148:2, 137-152
CrossRef71
Denise Paulin, Alexis Huet, Luiza Khanamyrian, Zhigang Xue. (2004) Desminopathies in muscle disease. The Journal of Pathology 204:4, 418-427
CrossRef72
Karla R Bowles, Neil E Bowles. (2004) Genetics of inherited cardiomyopathies. Expert Review of Cardiovascular Therapy 2:5, 683-697
CrossRef73
LARS G. C. LUETHJE, CARSTEN BOENNEMANN, LEV GOLDFARB, HANS H. GOEBEL, MARTIN HALLE. (2004) Prophylactic Implantable Cardioverter Defibrillator Placement in a Sporadic Desmin Related Myopathy and Cardiomyopathy. Pacing and Clinical Electrophysiology 27:4, 559-560
CrossRef74
Montse Olivé, Lev Goldfarb, Dolores Moreno, Encarna Laforet, Ayush Dagvadorj, Nyamkhishig Sambuughin, Juan Antonio Martı́nez-Matos, Francesca Martı́nez, Josefina Alió, Eva Farrero, Patrick Vicart, Isidro Ferrer. (2004) Desmin-related myopathy: clinical, electrophysiological, radiological, neuropathological and genetic studies. Journal of the Neurological Sciences 219:1-2, 125-137
CrossRef75
Montse Oliv
, Merc
CrossRef76
Howard J. Worman, Jean-Claude Courvalin. (2004) How do mutations in lamins A and C cause disease?. Journal of Clinical Investigation 113:3, 349-351
CrossRef77
Cui Zhen He, Arthur P. Hays. (2004) Expression of peripherin in ubiquinated inclusions of amyotrophic lateral sclerosis. Journal of the Neurological Sciences 217:1, 47-54
CrossRef78
Duygu Selcen, Andrew G. Engel. (2003) Myofibrillar myopathy caused by novel dominant negative ?B-crystallin mutations. Annals of Neurology 54:6, 804-810
CrossRef79
CHARLES ANTZELEVITCH. (2003) Molecular Genetics of Arrhythmias and Cardiovascular Conditions Associated with Arrhythmias. Journal of Cardiovascular Electrophysiology 14:11, 1259-1272
CrossRef80
CHARLES ANTZELEVITCH. (2003) Molecular Genetics of Arrhythmias and Cardiovascular Conditions Associated with Arrhythmias. Pacing and Clinical Electrophysiology 26:11, 2194-2208
CrossRef81
Ayush Dagvadorj, Bertrand Goudeau, David Hilton-Jones, Jan K. Blancato, Alexey Shatunov, Monique Simon-Casteras, Waney Squier, James W. Nagle, Lev G. Goldfarb, Patrick Vicart. (2003) Respiratory insufficiency in desminopathy patients caused by introduction of proline residues in desmin c-terminal ?-helical segment. Muscle & Nerve 27:6, 669-675
CrossRef82
Hans H. Goebel. (2003) Congenital myopathies at their molecular dawning. Muscle & Nerve 27:5, 527-548
CrossRef83
Marinos C. Dalakas, Ayush Dagvadorj, Bertrand Goudeau, Kye-Yoon Park, Kazuyo Takeda, Monique Simon-Casteras, Olavo Vasconcelos, Nyamkhishig Sambuughin, Alexey Shatunov, James W. Nagle, Kumaraswamy Sivakumar, Patrick Vicart, Lev G. Goldfarb. (2003) Progressive skeletal myopathy, a phenotypic variant of desmin myopathy associated with desmin mutations. Neuromuscular Disorders 13:3, 252-258
CrossRef84
Tetsuo Konno, Masami Shimizu, Hidekazu Ino, Toru Matsuyama, Masato Yamaguchi, Hidenobu Terai, Kenshi Hayashi, Tomohito Mabuchi, Masaru Kiyama, Kenji Sakata, Tatsumi Hayashi, Masaru Inoue, Tomoya Kaneda, Hiroshi Mabuchi. (2003) A novel missense mutation in the myosin binding protein-C gene is responsible for hypertrophic cardiomyopathy with left ventricular dysfunction and dilation in elderly patients. Journal of the American College of Cardiology 41:5, 781-786
CrossRef85
Kurt Haubold, Harald Herrmann, Stephen J. Langer, Robert M. Evans, Leslie A. Leinwand, Michael W. Klymkowsky. (2003) Acute effects of desmin mutations on cytoskeletal and cellular integrity in cardiac myocytes. Cell Motility and the Cytoskeleton 54:2, 105-121
CrossRef86
Jens Reimann, Wolfram S. Kunz, Stefan Vielhaber, Karin Kappes-Horn, Rolf Schroder. (2003) Mitochondrial dysfunction in myofibrillar myopathy. Neuropathology and Applied Neurobiology 29:1, 45-51
CrossRef87
Emily V Howman, Nicky Sullivan, Ellen P Poon, Joanna E Britton, David Hilton-Jones, Kay E Davies. (2003) Syncoilin accumulation in two patients with desmin-related myopathy. Neuromuscular Disorders 13:1, 42-48
CrossRef88
James A. Russell. 2003. Congenital Myopathies. , 719-727.
CrossRef89
Jeffrey A Towbin, Neil E Bowles. (2002) Molecular diagnosis of myocardial disease. Expert Review of Molecular Diagnostics 2:6, 587-602
CrossRef90
Kathryn R Wagner. (2002) Genetic diseases of muscle. Neurologic Clinics 20:3, 645-678
CrossRef91
J. David Barrans, Paul D. Allen, Dimitrios Stamatiou, Victor J. Dzau, Choong-Chin Liew. (2002) Global Gene Expression Profiling of End-Stage Dilated Cardiomyopathy Using a Human Cardiovascular-Based cDNA Microarray. The American Journal of Pathology 160:6, 2035-2043
CrossRef92
Bhavesh Sachdev, Perry M. Elliott, William J. McKenna. (2002) Cardiovascular complications of neuromuscular disorders. Current Treatment Options in Cardiovascular Medicine 4:2, 171-179
CrossRef93
J. Kirfel, B. Peters, C. Grund, K. Reifenberg, T. M. Magin. (2002) Ectopic expression of desmin in the epidermis of transgenic mice permits development of a normal epidermis. Differentiation 70:1, 56-68
CrossRef94
Manolis Mavroidis, Yassemi Capetanaki. (2002) Extensive Induction of Important Mediators of Fibrosis and Dystrophic Calcification in Desmin-Deficient Cardiomyopathy. The American Journal of Pathology 160:3, 943-952
CrossRef95
Duygu Selcen, Bruce R. Krueger, Andrew G. Engel. (2002) Familial cardioneuromyopathy with hyaline masses and nemaline rods: A novel phenotype. Annals of Neurology 51:2, 224-234
CrossRef96
Glen H. Nuckolls. 2002. Desmin. .
CrossRef97
Amanda D. Miller, Suresh C. Tyagi. (2002) Mutation in collagen gene induces cardiomyopathy in transgenic mice. Journal of Cellular Biochemistry 85:2, 259-267
CrossRef98
Bertrand Goudeau, Ayush Dagvadorj, Fernando Rodrigues-Lima, Patrick N
CrossRef99
David S. Saperstein, Anthony A. Amato, Richard J. Barohn. (2001) Clinical and genetic aspects of distal myopathies. Muscle & Nerve 24:11, 1440-1450
CrossRef100
Niall Tubridy, Bertrand Fontaine, Bruno Eymard. (2001) Congenital myopathies and congenital muscular dystrophies. Current Opinion in Neurology 14:5, 575-582
CrossRef101
Ku, Nam-On, Gish, Robert, Wright, Teresa L., Omary, M. Bishr, . (2001) Keratin 8 Mutations in Patients with Cryptogenic Liver Disease. New England Journal of Medicine 344:21, 1580-1587
Full Text102
Antje Bornemann, Hans H. Goebel. (2001) Congenital Myopathies. Brain Pathology 11:2, 206-217
CrossRef103
Philippe Charron, Michel Komajda. (2001) Are we ready for pharmacogenomics in heart failure?. European Journal of Pharmacology 417:1-2, 1-9
CrossRef104
J Zhang, A Kumar, Hj Stalker, G Virdi, Vj Ferrans, K Horiba, Fj Fricker, Mr Wallace. (2001) Clinical and molecular studies of a large family with desmin-associated restrictive cardiomyopathy. Clinical Genetics 59:4, 248-256
CrossRef105
Mian Li, Marinos C. Dalakas. (2001) Abnormal desmin protein in myofibrillar myopathies caused by desmin gene mutations. Annals of Neurology 49:4, 532-536
CrossRef106
L. Carlsson, L.-E. Thornell. (2001) Desmin-related myopathies in mice and man. Acta Physiologica Scandinavica 171:3, 341-348
CrossRef107
Kamisago, Mitsuhiro, Sharma, Sapna D., DePalma, Steven R., Solomon, Scott, Sharma, Pankaj, McDonough, Barbara, Smoot, Leslie, Mullen, Mary P., Woolf, Paul K., Wigle, E. Douglas, Seidman, J.G., Jarcho, John, Shapiro, Lawrence R., Seidman, Christine E., . (2000) Mutations in Sarcomere Protein Genes as a Cause of Dilated Cardiomyopathy. New England Journal of Medicine 343:23, 1688-1696
Full Text108
Fritz Zimprich, Atbin Djamshidian, Johannes A. Hainfellner, Herbert Budka, Josef Zeitlhofer. (2000) An autosomal dominant early adult-onset distal muscular dystrophy. Muscle & Nerve 23:12, 1876-1879
CrossRef109
Hans H. Goebel, Irene Warlo. (2000) Gene-Related Protein Surplus Myopathies. Molecular Genetics and Metabolism 71:1-2, 267-275
CrossRef110
Kazuhiro Ohtakara, Hiroyasu Inada, Hidemasa Goto, Waro Taki, Edward Manser, Louis Lim, Ichiro Izawa, Masaki Inagaki. (2000) p21-Activated Kinase PAK Phosphorylates Desmin at Sites Different from Those for Rho-Associated Kinase. Biochemical and Biophysical Research Communications 272:3, 712-716
CrossRef
