Original Article
Early Expression of Angiogenesis Factors in Acute Myocardial Ischemia and Infarction
N Engl J Med 2000; 342:626-633March 2, 2000
- Abstract
Background
When the myocardium is deprived of blood, a process of ischemia, infarction, and myocardial remodeling is initiated. Hypoxia-inducible factor 1 (HIF-1) is a transcriptional activator of vascular endothelial growth factor (VEGF) and is critical for initiating early cellular responses to hypoxia. We investigated the temporal and spatial patterns of expression of the α subunit of HIF-1 (HIF-1α) and VEGF in specimens of human heart tissue to elucidate the early molecular responses to myocardial hypoxia.
Methods
Ventricular-biopsy specimens from 37 patients undergoing coronary bypass surgery were collected. The specimens were examined by microscopy for evidence of ischemia, evolving infarction, or a normal histologic appearance. The specimens were also analyzed with the reverse-transcriptase polymerase chain reaction for HIF-1α and VEGF messenger RNA (mRNA) expression and by immunohistochemical analysis for the location of the HIF-1α and VEGF proteins.
Results
HIF-1α mRNA was detected in myocardial specimens with pathological evidence of acute ischemia (onset, <48 hours before surgery) or early infarction (onset, <24 hours before surgery). In contrast, VEGF transcripts were seen in specimens with evidence of acute ischemia or evolving infarction (onset, 24 to 120 hours before surgery). Patients with normal ventricles or evidence of infarction in the distant past had no detectable levels of either VEGF mRNA or HIF-1α mRNA. HIF-1α immunoreactivity was detected in the nuclei of myocytes and endothelial cells, whereas VEGF immunoreactivity was found in the cytoplasm of endothelial cells lining capillaries and arterioles.
Conclusions
An increase in the level of HIF-1α is an early response to myocardial ischemia or infarction. This response defines, at a molecular level, one of the first adaptations of human myocardium to a deprivation of blood. HIF-1α is a useful temporal marker of acutely jeopardized myocardium.
Media in This Article
Figure 2
Results of Analysis of Ventricular-Biopsy Specimens by the Polymerase Chain Reaction.Figure 3
Localization of HIF-1α and VEGF Proteins in Ventricular-Biopsy Specimens (Immunohistochemical Staining, ×400).Article Activity
- Article
Hypoxia is a potent regulator of a variety of biologic processes, including angiogenesis, vascular contractility, and erythropoiesis.1-4 When a coronary artery is partially or totally occluded, metabolic and contractile changes are initiated in the heart within seconds.5 Some of these early changes facilitate cellular preservation and functional survival of the heart. If the myocardium remains deprived of blood, changes of progressively greater severity eventually culminate in cell death, tissue necrosis, and myofibrillar remodeling.6
Hypoxia-inducible factor 1 (HIF-1) is a transcriptional factor that is expressed in response to a decrease in the partial pressure of cellular oxygen and activates genes involved in angiogenesis, glycolysis, modulation of vascular tone, and erythropoiesis.7-11 It is a heterodimer composed of α and β subunits, both of which are members of the family of basic helix–loop–helix peptides.12 HIF-1α is an 826-amino-acid protein that functions as a trans-acting transcriptional activator of vascular endothelial growth factor (VEGF), inducible nitric oxide synthase, lactate dehydrogenase, and erythropoietin.13-16 HIF-1β is a constitutively expressed nuclear translocator protein that forms heterodimers with HIF-1α as well as other nuclear proteins.17
Several studies have found increased levels of HIF-1α messenger RNA (mRNA) in hypoxic cultured cells and in organs (the retina and lung) of animals exposed to short- or long-term hypoxia.18-20 We hypothesized that an increase in the steady-state levels of HIF-1α mRNA is one of the earliest responses to myocardial ischemia and infarction in humans and that it potentially is an important stimulus of angiogenesis and myocardial-cell survival. To investigate this possibility, we examined HIF-1α mRNA expression in relation to changes in steady-state levels of VEGF mRNA. VEGF is an inducible factor that controls capillary growth and angiogenesis in several organ systems.21 The temporal and spatial patterns of expression of HIF-1α and VEGF proteins were also studied to identify molecular markers of the myocardial response to ischemia.
Methods
Selection of Patients
Between November 1997 and April 1998, 37 patients (27 men and 10 women; mean age, 65.9 years; range, 55 to 75 years) who were undergoing coronary bypass surgery were enrolled in the study. Seven of these patients had a clinical history, electrocardiographic findings, and creatine kinase and troponin I levels indicating that myocardial infarction had occurred within the preceding 24 hours (early infarction); 8 patients had evidence, on the basis of the same variables, that myocardial infarction had occurred during the preceding 24 to 120 hours (evolving infarction); and 10 patients had evidence of myocardial ischemia of less than 48 hours' duration (acute ischemia), defined as angina or heart failure without Q waves on the electrocardiogram and without an increase in serum levels of creatine kinase and troponin I. Twelve patients underwent coronary bypass surgery but had not had angina or heart failure within the preceding 10 days. According to usual practice at our institution, myocardial infarction was defined as a total creatine kinase level of more than 150 U per liter (normal range, 10 to 150) or a troponin I level of more than 0.6 ng per milliliter (normal range, less than 0.6).22
The criteria for enrollment included the need for urgent or elective coronary bypass surgery, an age between 55 and 75 years, and written informed consent for heart biopsy. The study was approved by the University of California, San Diego, institutional review board.
Biopsy of Myocardium
After the induction of anesthesia and median sternotomy, the heart of each patient was examined, and 3-mm, partial-thickness biopsy specimens were taken from the left ventricle. In patients with early or evolving infarction, specimens were taken from the area of presumed infarction as well as from an area of the ventricle free of coronary disease that could have caused ischemia or infarction. Likewise, in patients with acute ischemia, specimens were taken from the area of ischemia as well as from an area of normal ventricular tissue. In this way, each patient with ischemia or infarction served as his or her own control. In patients without evidence of ischemia or infarction, a single ventricular-biopsy specimen was obtained. All biopsies were performed before cardiopulmonary bypass, during ventilation with a fraction of inspired oxygen of 40 percent and peripheral oxygen saturations of greater than 95 percent. Biopsy sites were closed with polypropylene sutures.
Extraction of RNA and Analysis of Specimens
Half of each biopsy specimen was fixed in formalin, sectioned to a thickness of 5 μm, mounted on slides, and stained with hematoxylin and eosin. The mounted specimens were then examined for evidence of acute ischemia and early or evolving infarction.23 The other half of each specimen was frozen in liquid nitrogen at –140°C. Portions of the frozen samples were lyophilized, and then RNA was extracted by the acid guanidinium thiocyanate–phenol–chloroform technique, as previously described.24,25
The recovered RNA pellet was dried under vacuum conditions for 10 to 15 minutes and then dissolved in diethyl pyrocarbonate–treated deionized distilled water. The concentration and purity of the RNA were determined by spectrophotometric analysis (Ultrospec II, Biochrom, Cambridge, England) at 260 and 280 nm. The samples were stored at –80°C until analyzed.
Measurement of RNA
The reverse-transcriptase polymerase chain reaction (PCR) was used to analyze each ventricular specimen for the presence of transcripts encoding HIF-1α, HIF-1β, VEGF, and cyclophilin. Cyclophilin mRNA was studied as a marker to control for variation in RNA concentration and RNA degradation as potential confounding variables. Five micrograms of total RNA was used to synthesize complementary DNA (cDNA) with Super Script II Reverse Transcriptase and oligo(dT)12-18 (GIBCO BRL, Gaithersburg, Md.). The synthesized primers had the following sequences: for HIF-1α, 5'CTGTGATGAGGCTTACCATCAGC3' and 5'CTCGGCTAGTTAGGGTACACTTC3'; for HIF-1β, 5'CAGGTCGGATGATGAGCAGAGCA3' and 5'CTCATGGAAGACTGCTGACCTTC3'; for VEGF, 5'GGATGTCTATCAGCGCAGCTAC3' and 5'TCACCGCCTCGGCTTGTCACATC3'; and for cyclophilin, 5'GTGACTTCACACGCCATAATGGC3' and 5'GGTGCTCTCCTGAGCTACAGAAGG3'.
Duplicate amplification reactions were carried out with a single-block thermocycler (Ericomp, San Diego, Calif.) containing 2 μl of first-strand cDNA, 1 μl of each primer, deoxynucleotide triphosphates (at 10 mM each), 25 mM magnesium chloride, 0.5 U of Taq DNA polymerase, and 36.5 μl of autoclaved distilled water. Each sample underwent initial denaturation at 95°C for 5 minutes, 35 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 1 minute, extension at 72°C for 1 minute, and a final extension at 72°C for 10 minutes. The PCR products were electrophoresed on 1.8 percent agarose gels containing 3 percent ethidium bromide in TRIS–acetate–EDTA buffer. The gels were photographed with an electrophoresis photodocumentation camera (Fisher Scientific, Pittsburgh) on black-and-white film (3000ISO, Polaroid, Cambridge, Mass.).
Immunohistochemical Staining for HIF-1α and VEGF
Portions of the frozen biopsy specimens were fixed in 10 percent formalin and prepared as 5-μm-thick tissue sections on slides. The paraffin was then removed with a xylene substitute (Hemo-De, Fisher Scientific) and the sections were rehydrated with ethanol gradient washes. The sections of affected tissue and normal tissue from patients with ischemia or infarction and the sections from patients without ischemia or infarction were incubated with either mouse antihuman HIF-1α IgG (IgG2v, Novus Biological, Littleton, Colo.) or mouse antihuman VEGF IgG (IgG2a, Santa Cruz Biotechnology, Santa Cruz, Calif.) at a 1:100 dilution. Control sections were incubated with diluted normal horse serum (Vector Laboratories, Burlingame, Calif.) instead of the primary antibody. All the sections were subsequently incubated with biotinylated secondary antimouse antibodies and stained with an immunoperoxidase technique (Vectastain Elite ABC reagents, Vector Laboratories). Sections were dried and mounted (Gel Mount, Biomeda, Foster City, Calif.), examined with a photomicroscope, and photographed on color film (Fujicolor 100, Tokyo, Japan).
Statistical Analysis
Data for each continuous variable were examined with the Shapiro–Wilk W test to determine whether assumptions of normality were valid. When continuous variables were compared among the groups of patients, an independent Student's t-test and one-way analysis of variance were used for normally distributed data, and the Wilcoxon rank-sum test and the Kruskal–Wallis test were used for non-normally distributed data. For all the tests, the significance level was 5 percent. When significant differences were found among the groups, pairwise comparisons were made to identify the source of the differences. Overall type I error rates of 5 percent were controlled with use of the Tukey–Kramer honestly-significant-differences test (with analysis of variance) or the Nemenyi test (with the Kruskal–Wallis test). Descriptive data for continuous variables are reported as means ±SD or as medians and ranges. Categorical variables are presented as numbers and percentages. Data were analyzed with JMP software (version 3.2.1, SAS Institute, Cary, N.C.) or with a program written in S+ (version 5.0, release 3, MathSoft, Seattle).
Results
Classification of Ventricular Specimens and Preoperative Characteristics of the Patients
All ventricular-biopsy specimens were examined by light microscopy for evidence of ischemia or infarction by a cardiac pathologist who was unaware of the patients' identity. Seven specimens had pathological evidence of acute myocardial infarction that had occurred less than 24 hours before biopsy (designated the early-infarction group), 8 specimens had evidence of acute infarction that had occurred 24 to 120 hours before biopsy (the evolving-infarction group), 10 specimens had evidence of acute ischemia that had occurred less than 48 hours before biopsy (the ischemia group), and 12 specimens had no evidence of ischemia or infarction (the control group). For each patient in the first three groups, the second ventricular-biopsy specimen, taken from an area remote from the ischemic or infarcted area, was found on microscopical examination to be normal.
The characteristics and cardiac measurements of the patients before coronary bypass surgery and heart biopsy are shown in Table 1Table 1
Characteristics of the Patients Undergoing Coronary-Artery Bypass Surgery According to the Presence or Absence of Infarction or Ischemia in Ventricular-Biopsy Specimens.. There were no apparent differences in age or sex distribution among the four groups of patients. There were no significant differences in the peak levels of troponin I and creatine kinase between the seven patients in whom acute myocardial infarction had occurred less than 24 hours before biopsy (early infarction) and the eight patients in whom infarction had occurred 24 to 120 hours before biopsy (evolving infarction). The seven patients with early infarction had higher pulmonary-capillary wedge pressures (P<0.001), had lower ejection fractions (P<0.01), and were in higher New York Heart Association functional classes than those with ischemia occurring less than 48 hours before biopsy and those without ischemia or infarction.Pathological Analysis of Ventricular Specimens
There were direct correlations between clinical course (onset of chest pain and electrocardiographic changes) and the pathological classifications of the affected specimens. Figure 1Figure 1
Pathological Changes in Representative Ventricular-Biopsy Specimens (Hematoxylin and Eosin, ×200). shows representative biopsy specimens from the four groups of patients. There were no correlations between the levels of troponin I or creatine kinase and the severity of myocardial necrosis in any of the specimens. This lack of correlation may reflect a sampling bias, since only a single affected biopsy specimen was obtained from each patient.Molecular Analysis of Ventricular Specimens
Figure 2Figure 2
Results of Analysis of Ventricular-Biopsy Specimens by the Polymerase Chain Reaction. shows the results of the PCR analysis of samples of RNA from ventricular specimens from the four groups of patients. All seven patients with early infarction had detectable steady-state levels of HIF-1α mRNA in the specimen from the infarcted region and did not have detectable levels of HIF-1α mRNA in the normal ventricular specimen. VEGF transcripts were not detected in any biopsy specimens from this group. Patients with evolving infarction had both HIF-1α transcripts and VEGF transcripts in specimens from the infarcted area of the ventricle only. Likewise, patients with acute ischemia had HIF-1α and VEGF transcripts in specimens from the affected myocardial territory but not in control specimens. Patients with no infarction or ischemia had no detectable expression of HIF-1α or VEGF mRNA in their single specimens.The HIF-1α mRNA detected in all the affected specimens was 383 bp long. The VEGF mRNA detected in specimens from patients with evolving infarction or ischemia was present as two transcripts, 445 and 517 bp long. These two VEGF transcripts correspond to the known protein isoforms VEGF165 and VEGF182. All the samples contained HIF-1β mRNA, indicating that the β moiety is not sensitive to hypoxia in the heart. We found that levels of cyclophilin mRNA were consistently equal among the samples studied.
Localization of HIF-1α and VEGF Proteins in Hypoxic Myocardium
Immunohistochemical staining with antibody to HIF-1α of sectioned biopsy specimens from patients with early or evolving infarction or ischemia revealed HIF-1α protein throughout areas of infarcted or ischemic myocardium. Specifically, immunoreactivity was seen in the nuclei of cardiomyocytes and endothelial cells lining the small vessels (Figure 3Figure 3
Localization of HIF-1α and VEGF Proteins in Ventricular-Biopsy Specimens (Immunohistochemical Staining, ×400).). HIF-1α protein was not present in noninfarcted or nonischemic myocardium (data not shown). The level of expression of HIF-1α was higher in the myocardium than in the endothelium.VEGF immunoreactivity was seen in biopsy specimens with evidence of evolving infarction and in those with evidence of acute ischemia (onset, <48 hours before surgery). In contrast to HIF-1α, VEGF protein in these specimens was found only in the cytoplasm of endothelial cells lining the small vessels and was not present in cardiomyocytes (Figure 3). VEGF protein was not detected in specimens with early infarction but was detected in specimens with evolving infarction or specimens with ischemia, in which it was confined to the myocardial vasculature. We did not detect HIF-1α protein or VEGF protein by Western blot analysis of the peripheral blood of any of the patients (data not shown), suggesting that these proteins and their effects are confined to the heart.
Discussion
To survive periods of stress and ischemia, the human heart has developed mechanisms to adapt to changes in its environment. One of these mechanisms is the ability to promote growth of new blood vessels into ischemic areas, thus limiting regions of impairment and ultimately preserving myocardial function.26 The decrease in the partial pressure of cellular oxygen induced by ischemia is a potent stimulator of neovascularization in several organ systems. Semenza has shown in both in vitro and in vivo models of ischemia that one of the first genes up-regulated by hypoxia is the gene encoding HIF-1.7 HIF-1 protein is composed of two distinct peptides. Expression of the gene for HIF-1α is exquisitely sensitive to the onset of cellular hypoxic conditions, making it one of the earliest effectors of the response to ischemia.27 HIF-1β, the other component of the HIF-1 protein, is a high-affinity protein that binds to HIF-1α in the cytosol and transports HIF-1α into the nucleus, where HIF-1α may exert its trans-acting effect.28 Expression of HIF-1β is constitutive, not sensitive to hypoxia, in several types of tissue culture and in solid organs.29
After it is activated by a low partial pressure of cellular oxygen, HIF-1 binds to a specific hypoxia-responsive element in the regulatory regions of several hypoxia-sensitive genes, leading to their transcriptional activation. We hypothesized that one of the most crucial actions of HIF-1 is to regulate the gene encoding the angiogenesis factor VEGF and thus ultimately to trigger the cascade of angiogenesis.
The goal of this study was to examine specimens of human heart tissue affected by various degrees of ischemic insult and to correlate the physiologic and pathological state of the heart with the temporal and spatial expression of HIF-1 and VEGF. In our patients, we detected increased steady-state levels of HIF-1α mRNA during the early period (the first 24 hours) after acute myocardial infarction or during acute myocardial ischemia. This accumulation of mRNA was limited to the region of affected myocardium. No HIF-1α transcripts were detectable by PCR analysis in specimens of nonischemic or noninfarcted tissue. These results suggest that HIF-1α is an early molecular marker of myocardial ischemia or infarction. The production of this protein and its effects appear to be limited to the heart, since it was not detected in the peripheral blood of our patients.
Immunoreactivity to HIF-1α was detected in both myocardial and endothelial cells in all specimens of human heart affected by ischemia or infarction. Since the half-life of HIF-1α protein has been estimated to be on the order of minutes,30 we surmise that HIF transcription or stabilization of HIF mRNA continues throughout early ischemia or infarction to generate protein at levels that are detectable by antibody staining.
Two important limitations of this study should be recognized. First, by using the PCR to detect steady-state levels of HIF-1α and VEGF mRNA, we did not measure the amount of transcript present in each tissue specimen. Rather, we determined whether mRNA was present or absent at the defined sensitivity of the assay (1 or more mRNA molecules per 1000 cells).31 Our study did not distinguish whether the spatial and temporal accumulation of HIF-1α and VEGF mRNA in the heart reflected enhanced transcription or enhanced stabilization of mRNA. Evidence from cultured cell lines32,33 and animal models34 suggests that both mechanisms may be important in the regulation of hypoxia-sensitive genes. Second, since our study examined specimens from human subjects, it was necessarily limited in scope and time course. Despite our inability to perform serial biopsies in individual patients, we found clear evidence that HIF-1α expression is confined to the region of acute hypoxia in the heart; that it is initiated within hours of the onset of myocardial ischemia or infarction, or even earlier; and that detectable levels of HIF-1α mRNA are transient. Our results suggest that HIF-1 induced by ischemia may be a signal mechanism for controlling the early-to-intermediate expression of genes that initiate angiogenesis during myocardial hypoxia.
VEGF has an important role in stimulating the growth of new capillaries in several organ systems and thus is a good candidate for the role of stimulating neovascularization to limit damage from infarction in the heart. Although the mechanism of enhanced VEGF expression remains to be determined, it is worth noting that the gene for VEGF has an HIF-1 regulatory consensus sequence (a hypoxia-responsive element) in its promoter region.35 These observations, together with the previous finding that HIF-1 is responsible for the increase in VEGF in cultured hypoxic myocytes,36 suggest that the increase in myocardial HIF-1 protein that we detected in ischemic and infarcted tissue is necessary, at least in part, for the enhanced expression of myocardial VEGF in states of ischemia.
We found in specimens of human heart tissue that steady-state levels of VEGF mRNA were present in the initial periods of ischemia (<48 hours after onset) and in the intermediate periods of infarction (24 to 120 hours after onset). Expression of VEGF persisted for a longer time after the onset of myocardial ischemia or infarction than did HIF-1α expression. This suggests that the response of HIF-1α to ischemia occurs early and is transient, whereas the VEGF response is of longer duration and is probably necessary for preservation of the myocardium and limitation of hypoxic cellular destruction. VEGF protein in the myocardium was found only in the endothelium that lined medium and small arterioles and capillaries, in contrast to HIF-1 protein, which was expressed in both vascular endothelial cells and myocardial cells. This observation suggests that the angiogenic effects of HIF-1 and VEGF are limited to regions of terminal small vessels in the myocardium. The importance of the difference between the types of cells that express HIF-1α (endothelial and myocardial cells) and those that express VEGF (endothelial cells) remains to be determined. It is possible that in myocardial cells HIF-1α controls hypoxia-responsive genes other than the gene encoding VEGF.
In conclusion, we defined at a molecular level the sequential expression of HIF-1α and VEGF in the human heart during ischemia. The genes encoding these two proteins are molecular temporal and spatial markers of ischemic myocardium. The presence of HIF-1α mRNA and subsequently the presence of VEGF mRNA in the heart tissue of patients with infarction provide compelling new evidence that HIF-1α contributes to limitation of infarct size by promoting angiogenesis and vascular remodeling and that it does so by increasing steady-state levels of VEGF mRNA. The expression of HIF-1α by both myocardial cells and endothelial cells in the hypoxic heart raises the possibility that HIF-1α has a broad role in myocardial disease associated with ischemia and infarction. Although elucidation of the pathophysiologic importance of HIF-1α in these conditions awaits the availability of specific HIF-1 antagonists, the present study provides new information about variations in local synthesis and distribution of HIF-1 and VEGF in human heart disease. Further elucidation of the effects of these proteins may reveal clues for approaches to limiting infarct size and the sequelae of hypoxic damage to the myocardium.
Supported in part by the Nina Braunwald Career Development Award from the Thoracic Surgery Foundation (to Dr. Thistlethwaite) and by a grant from the National Institutes of Health (MO1 RR 0827, to Dr. Deutsch).
We are indebted to Angela Ramsey for assistance in the preparation of the manuscript.
Source Information
From the Division of Cardiothoracic Surgery (S.H.L., R.E., S.W.J., P.A.T.), the Department of Pathology (P.L.W.), and the General Clinical Research Center (R.D.), University of California, San Diego; and the Department of Pathology, Veterans Affairs Medical Center, San Diego (P.L.W.).
Address reprint requests to Dr. Thistlethwaite at the Division of Cardiothoracic Surgery (8892), University of California, San Diego, 200 W. Arbor Dr., San Diego, CA 92103-8892, or at pthistlethwaite@ucsd.edu.
- References
References
1
Ladoux A ,Frelin C . Hypoxia is a strong inducer of vascular endothelial growth factor mRNA expression in the heart. Biochem Biophys Res Commun 1993;195:1005-1010
CrossRef | Web of Science | Medline2
Hashimoto E ,Ogita T ,Nakaoka T ,Matsuoka R ,Takao A ,Kira Y . Rapid induction of vascular endothelial growth factor expression by transient ischemia in rat heart. Am J Physiol 1994;267:H1948-H1954
Web of Science | Medline3
Firth JD ,Ebert BL ,Pugh CW ,Ratcliffe PJ . Oxygen-related control elements in the phosphoglycerate kinase 1 and lactate dehydrogenase A genes: similarities with the erythropoietin 3' enhancer. Proc Natl Acad Sci U S A 1994;91:6496-6500
CrossRef | Web of Science | Medline4
Melillo G ,Musso T ,Sica A ,Taylor LS ,Cox GW ,Varesio L . A hypoxia-responsive element mediates a novel pathway of activation of the inducible nitric oxide synthase promoter. J Exp Med 1995;182:1683-1693
CrossRef | Web of Science | Medline5
Heusch G ,Schulz R . Features of short-term myocardial hibernation. Mol Cell Biochem 1998;186:185-193
CrossRef | Web of Science | Medline6
Hearse DJ . Myocardial protection during ischemia and reperfusion. Mol Cell Biochem 1998;186:177-184
CrossRef | Web of Science | Medline7
Semenza GL . Hypoxia-inducible factor 1: master regulator of O2 homeostasis. Curr Opin Genet Dev 1998;8:588-594
CrossRef | Web of Science | Medline8
Palmer LA ,Semenza GL ,Stoler MH ,Johns RA . Hypoxia induces type II iNOS gene expression in pulmonary artery endothelial cells via HIF-1. Am J Physiol 1998;274:L212-L219
Web of Science | Medline9
Forsythe JA ,Jiang BH ,Iyer NV , et al. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol 1996;16:4604-4613
Web of Science | Medline10
Semenza GL ,Roth PH ,Fang HM ,Wang GL . Transcriptional regulation of genes encoding glycolytic enzymes by hypoxia-inducible factor 1. J Biol Chem 1994;269:23757-23763
Web of Science | Medline11
Wang GL ,Semenza GL . Desferrioxamine induces erythropoietin gene expression and hypoxia-inducible factor 1 DNA-binding activity: implications for models of hypoxia signal transduction. Blood 1993;82:3610-3615
Web of Science | Medline12
Jiang BH ,Rue E ,Wang GL ,Roe R ,Semenza GL . Dimerization, DNA binding, and transactivation properties of hypoxia-inducible factor 1. J Biol Chem 1996;271:17771-17778
CrossRef | Web of Science | Medline13
Iyer NV ,Kotch LE ,Agani F , et al. Cellular and developmental control of O2 homeostasis by hypoxia-inducible factor 1α. Genes Dev 1998;12:149-162
CrossRef | Web of Science | Medline14
Martin C ,Yu AY ,Jiang BH , et al. Cardiac hypertrophy in chronically anemic fetal sheep: increased vascularization is associated with increased myocardial expression of vascular endothelial growth factor and hypoxia-inducible factor 1. Am J Obstet Gynecol 1998;178:527-534
CrossRef | Web of Science | Medline15
Semenza GL ,Wang GL . A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol Cell Biol 1992;12:5447-5454
Web of Science | Medline16
Semenza GL ,Jiang BH ,Leung SW , et al. Hypoxia response elements in the aldolase A, enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1. J Biol Chem 1996;271:32529-32537
CrossRef | Web of Science | Medline17
Salceda S ,Beck I ,Caro J . Absolute requirement of aryl hydrocarbon receptor nuclear translocator protein for gene activation by hypoxia. Arch Biochem Biophys 1996;334:389-394
CrossRef | Web of Science | Medline18
Yu AY ,Frid MG ,Shimoda LA ,Wiener CM ,Stenmark K ,Semenza GL . Temporal, spatial, and oxygen-regulated expression of hypoxia-inducible factor-1 in the lung. Am J Physiol 1998;275:L818-L826
Web of Science | Medline19
Ozaki H ,Yu AY ,Della N , et al. Hypoxia inducible factor-1α is increased in ischemic retina: temporal and spatial correlation with VEGF expression. Invest Ophthalmol Vis Sci 1999;40:182-189
Web of Science | Medline20
Wang GL ,Jiang BH ,Rue EA ,Semenza GL . Hypoxia-inducible fac-tor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad Sci U S A 1995;92:5510-5514
CrossRef | Web of Science | Medline21
Ferrara N ,Davis-Smyth T . The biology of vascular endothelial growth factor. Endocr Rev 1997;18:4-25
CrossRef | Web of Science | Medline22
Antman EM ,Tanasijevic MJ ,Thompson B , et al. Cardiac-specific troponin I levels to predict the risk of mortality in patients with acute coronary syndromes. N Engl J Med 1996;335:1342-1349
Full Text | Web of Science | Medline23
Cotran RS, Kumar V, Collins T, eds. Robbins pathologic basis of disease. 6th ed. Philadelphia: W.B. Saunders, 1999:554-64.
24
Chomczynski P ,Sacchi N . Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159
CrossRef | Web of Science | Medline25
Puissant C ,Houdebine LM . An improvement of the single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Biotechniques 1990;8:148-149
CrossRef | Web of Science | Medline26
Sabia PJ ,Powers ER ,Ragosta M ,Sarembock IJ ,Burwell LR ,Kaul S . An association between collateral blood flow and myocardial viability in patients with recent myocardial infarction. N Engl J Med 1992;327:1825-1831
Full Text | Web of Science | Medline27
Jiang BH ,Zheng JZ ,Leung SW ,Roe R ,Semenza GL . Transactivation and inhibitory domains of hypoxia-inducible factor 1α: modulation of transcriptional activity by oxygen tension. J Biol Chem 1997;272:19253-19260
CrossRef | Web of Science | Medline28
Wood SM ,Gleadle JM ,Pugh CW ,Hankinson O ,Ratcliffe PJ . The role of the aryl hydrocarbon receptor nuclear translocator (ARNT) in hypoxic induction of gene expression: studies in ARNT-deficient cells. J Biol Chem 1996;271:15117-15123
CrossRef | Web of Science | Medline29
Rowlands JC ,Gustafsson JA . Aryl hydrocarbon receptor-mediated signal transduction. Crit Rev Toxicol 1997;27:109-134
CrossRef | Web of Science | Medline30
Wenger RH ,Gassmann M . Oxygen(es) and the hypoxia-inducible factor-1. Biol Chem 1997;378:609-616
Web of Science | Medline31
Kawasaki ES. Amplification of RNA. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego, Calif.: Academic Press, 1990:21-7.
32
Levy AP ,Levy NS ,Goldberg MA . Hypoxia-inducible protein binding to vascular endothelial growth factor mRNA and its modulation by the von Hippel-Lindau protein. J Biol Chem 1996;271:25492-25497
CrossRef | Web of Science | Medline33
Wenger RH ,Kvietikova I ,Rolfs A ,Gassmann M ,Marti HH . Hypoxia-inducible factor-1 α is regulated at the post-mRNA level. Kidney Int 1997;51:560-563
CrossRef | Web of Science | Medline34
Deindl E ,Schaper W . Gene expression after short periods of coronary occlusion. Mol Cell Biochem 1998;186:43-51
CrossRef | Web of Science | Medline35
Shima DT ,Kuroki M ,Deutsch U ,Ng YS ,Adamis AP ,D'Amore PA . The mouse gene for vascular endothelial growth factor: genomic structure, definition of the transcriptional unit, and characterization of transcriptional and post-transcriptional regulatory sequences. J Biol Chem 1996;271:3877-3883
CrossRef | Web of Science | Medline36
Levy AP ,Levy NS ,Loscalzo J , et al. Regulation of vascular endothelial growth factor in cardiac myocytes. Circ Res 1995;76:758-766
Web of Science | Medline
- Citing Articles (151)
Citing Articles
1
A. Scridon, E. Morel, E. Nonin-Babary, N. Girerd, C. Fernandez, P. Chevalier. (2012) Increased intracardiac vascular endothelial growth factor levels in patients with paroxysmal, but not persistent atrial fibrillation. Europace
CrossRef2
Moritz Osterholt, Shiraj Sen, Vasken Dilsizian, Heinrich Taegtmeyer. (2012) Targeted Metabolic Imaging to Improve the Management of Heart Disease. JACC: Cardiovascular Imaging 5:2, 214-226
CrossRef3
Takuya Ito, Kiyoe Funamoto, Naoaki Sato, Ai Nakamura, Kaori Tanabe, Tetsuro Hoshiai, Kaori Suenaga, Junichi Sugawara, Satoru Nagase, Kunihiro Okamura, Nobuo Yaegashi, Yoshitaka Kimura. (2012) Maternal Undernutrition Induces the Expression of Hypoxia-Related Genes in the Fetal Brain. The Tohoku Journal of Experimental Medicine 226:1, 37-44
CrossRef4
F. R. Formiga, E. Tamayo, T. Simón-Yarza, B. Pelacho, F. Prósper, M. J. Blanco-Prieto. (2011) Angiogenic therapy for cardiac repair based on protein delivery systems. Heart Failure Reviews
CrossRef5
Li Dong, Lina Kang, Liang Ding, Qin Chen, Jian Bai, Rong Gu, Lixin Li, Biao Xu. (2011) Insulin modulates ischemia-induced endothelial progenitor cell mobilization and neovascularization in diabetic mice. Microvascular Research
CrossRef6
R. Goekmen Turan, I. Bozdag-T, J. Ortak, S. Kische, I. Akin, H. Schneider, C. H. Turan, T. C. Rehders, M. Rauchhaus, T. Kleinfeldt, C. Belu, M. Brehm, S. Yokus, S. Steiner, K. Sahin, C. A. Nienaber, H. Ince. (2011) Improved Functional Activity of Bone Marrow Derived Circulating Progenitor Cells After Intra Coronary Freshly Isolated Bone Marrow Cells Transplantation in Patients with Ischemic Heart Disease. Stem Cell Reviews and Reports 7:3, 646-656
CrossRef7
Ramiro Zepeda, Paula Castillo, Daniel Sáez, Miguel N. Llanos, Ana M. Ronco. (2011) Cardiac Tissue Injury Resistance During Myocardial Infarction at Adulthood by Developmental Exposure to Cadmium. Cardiovascular Toxicology
CrossRef8
Semenza, Gregg L., . (2011) Oxygen Sensing, Homeostasis, and Disease. New England Journal of Medicine 365:6, 537-547
Full Text9
James N. Tsoporis, Shehla Izhar, Gerald Proteau, Graham Slaughter, Thomas G. Parker. (2011) S100B-RAGE dependent VEGF secretion by cardiac myocytes induces myofibroblast proliferation. Journal of Molecular and Cellular Cardiology
CrossRef10
Michael Bonios, Connie Yachan Chang, John Terrovitis, Aurelio Pinheiro, Andreas Barth, Peihong Dong, Miguel Santaularia, D. Brian Foster, Venu Raman, Theodore P. Abraham, Maria Roselle Abraham. (2011) Constitutive HIF-1α Expression Blunts the Beneficial Effects of Cardiosphere-Derived Cell Therapy in the Heart by Altering Paracrine Factor Balance. Journal of Cardiovascular Translational Research 4:3, 363-372
CrossRef11
Erol Saygili, Maimouna Pekassa, Esra Saygili, Gediminas Rackauskas, Dorothee Hommes, Fawad Noor-Ebad, Christopher Gemein, Matthias D.H. Zink, Robert H.G. Schwinger, Joachim Weis, Nikolaus Marx, Patrick Schauerte, Obaida R. Rana. (2011) Mechanical stretch of sympathetic neurons induces VEGF expression via a NGF and CNTF signaling pathway. Biochemical and Biophysical Research Communications 410:1, 62-67
CrossRef12
Atman P. Shah, Scott T. Youngquist, Christian D. McClung, Ekaterina Tzvetkova, Mohammed A. Hanif, John P. Rosborough, James T. Niemann. (2011) Markers of Progenitor Cell Recruitment and Differentiation Rise Early During Ischemia and Continue During Resuscitation in a Porcine Acute Ischemia Model. Journal of Interferon & Cytokine Research 31:6, 509-513
CrossRef13
Inês Falcão-Pires, Adelino F. Leite-Moreira. (2011) Diabetic cardiomyopathy: understanding the molecular and cellular basis to progress in diagnosis and treatment. Heart Failure Reviews
CrossRef14
Celio X.C. Santos, Narayana Anilkumar, Min Zhang, Alison C. Brewer, Ajay M. Shah. (2011) Redox signaling in cardiac myocytes. Free Radical Biology and Medicine 50:7, 777-793
CrossRef15
Katarzyna Korybalska, Małgorzata Pyda, Edyta Kawka, Stefan Grajek, Andrzej Bręborowicz, Janusz Witowski. (2011) Interpretation of elevated serum VEGF concentrations in patients with myocardial infarction. Cytokine 54:1, 74-78
CrossRef16
Takashi Kimura, Hirao Kohno, Yoshikazu Matsuoka, Mari Murakami, Ryusuke Nakatsuka, Makoto Hase, Katsuhiko Yasuda, Yasushi Uemura, Yutaka Sasaki, Shirou Fukuhara, Yoshiaki Sonoda. (2011) CXCL8 enhances the angiogenic activity of umbilical cord blood-derived outgrowth endothelial cells in vitro. Cell Biology International 35:3, 201-208
CrossRef17
Jessica Cassavaugh, Karen M. Lounsbury. (2011) Hypoxia-mediated biological control. Journal of Cellular Biochemistry 112:3, 735-744
CrossRef18
Francesca Forini, Vincenzo Lionetti, Hossein Ardehali, Angela Pucci, Federica Cecchetti, Mohsen Ghanefar, Giuseppina Nicolini, Yoshihiko Ichikawa, Monica Nannipieri, Fabio A. Recchia, Giorgio Iervasi. (2011) Early long-term L-T3 replacement rescues mitochondria and prevents ischemic cardiac remodelling in rats. Journal of Cellular and Molecular Medicine 15:3, 514-524
CrossRef19
Shraddha V. Bhadada, Bhoomika R. Goyal, Mayur M. Patel. (2011) Angiogenic targets for potential disorders. Fundamental & Clinical Pharmacology 25:1, 29-47
CrossRef20
Mehregan Movassagh, Ana Vujic, Roger Foo. (2011) Genome-wide DNA methylation in human heart failure. Epigenomics 3:1, 103-109
CrossRef21
Meghna S. Motwani, Yasmin Rafiei, Aphrodite Tzifa, Alexander M. Seifalian. (2011) In situ endothelialization of intravascular stents from progenitor stem cells coated with nanocomposite and functionalized biomolecules. Biotechnology and Applied Biochemistry 58:1, 2-13
CrossRef22
Takuya Ito, Kaori Tanabe, Ai Nakamura, Kiyoe Funamoto, Ayako Aoyagi, Kazuyo Sato, Tetsuro Hoshiai, Kaori Suenaga, Junichi Sugawara, Satoru Nagase, Kunihiro Okamura, Nobuo Yaegashi, Yoshitaka Kimura. (2011) Aberrant Expression of Hypoxia-Inducible Factor 1α in the Fetal Heart Is Associated with Maternal Undernutrition. The Tohoku Journal of Experimental Medicine 224:3, 163-171
CrossRef23
Chung-Jung Chiu, Allen Taylor. (2011) Dietary hyperglycemia, glycemic index and metabolic retinal diseases. Progress in Retinal and Eye Research 30:1, 18-53
CrossRef24
Helena Kaija, Terttu Särkioja, Marja-Leena Kortelainen, Jussi Vuoristo, Heikki Huikuri, Katja Porvari. (2011) Stress-specific responses of p21 expression - implication of transcript variant p21 alt-a in long-term hypoxia. Journal of Cellular Biochemistryn/a-n/a
CrossRef25
Kenzo NOGUCHI, Yoko MIWA, Masataka SUNOHARA, Iwao SATO. (2011) Analysis of vascular distribution and growth factors in human gingival tissue associated with periodontal probing depth. Okajimas Folia Anatomica Japonica 88:2, 75-83
CrossRef26
Florian Heidrich, Samuel Sossalla, Hanna Schotola, Tobias Vorkamp, Philipp Ortmann, Aron F. Popov, Kasim O. Coskun, Taufiek K. Rajab, Martin Friedrich, Christian Sohns, Jose Hinz, Martin Bauer, Michael Quintel, Friedrich A. Schöndube, Jan D. Schmitto. (2010) The Role of Phospho-Adenosine Monophosphate-Activated Protein Kinase and Vascular Endothelial Growth Factor in a Model of Chronic Heart Failure. Artificial Organs 34:11, 969-979
CrossRef27
Gabor Czibik. (2010) Complex role of the HIF system in cardiovascular biology. Journal of Molecular Medicine 88:11, 1101-1111
CrossRef28
Demet Tekin, Ali D Dursun, Lei Xi. (2010) Hypoxia inducible factor 1 (HIF-1) and cardioprotection. Acta Pharmacologica Sinica 31:9, 1085-1094
CrossRef29
Yvan Devaux, Francisco Azuaje, Mélanie Vausort, Céline Yvorra, Daniel R. Wagner. (2010) Integrated protein network and microarray analysis to identify potential biomarkers after myocardial infarction. Functional & Integrative Genomics 10:3, 329-337
CrossRef30
Neil P. Fam, Sara Arab, Filio Billia, Robin Han, Gerald Proteau, David Latter, Lee Errett, Daniel Bonneau, Rosemary Dunne, Peter P. Liu, Duncan J. Stewart. (2010) Increased myocardial expression of angiopoietin-2 in patients undergoing urgent surgical revascularization for acute coronary syndromes. Canadian Journal of Cardiology 26:7, 365-370
CrossRef31
Mariann Gyöngyösi, Rayyan Hemetsberger, Aniko Posa, Silvia Charwat, Noemi Pavo, Örs Petnehazy, Zsolt Petrasi, Imre J. Pavo, Hani Hemetsberger, Imre Benedek, Teodora Benedek, Istvan Benedek, Istvan Kovacs, Christoph Kaun, Gerald Maurer. (2010) Hypoxia-Inducible Factor 1-Alpha Release After Intracoronary Versus Intramyocardial Stem Cell Therapy in Myocardial Infarction. Journal of Cardiovascular Translational Research 3:2, 114-121
CrossRef32
Stefan Probst-Cousin, Bernhard Neundörfer, Dieter Heuss. (2010) Microvasculopathic neuromuscular diseases: Lessons from hypoxia-inducible factors. Neuromuscular Disorders 20:3, 192-197
CrossRef33
Christine J. Pol, Alice Muller, Warner S. Simonides. (2010) Cardiomyocyte-specific inactivation of thyroid hormone in pathologic ventricular hypertrophy: an adaptative response or part of the problem?. Heart Failure Reviews 15:2, 133-142
CrossRef34
Alan R. Morrison, Albert J. Sinusas. (2010) Advances in radionuclide molecular imaging in myocardial biology. Journal of Nuclear Cardiology 17:1, 116-134
CrossRef35
Thomas H. Adair, Jean-Pierre Montani. (2010) Angiogenesis. Colloquium Series on Integrated Systems Physiology: From Molecule to Function 2:1, 1-84
CrossRef36
Hiroshi Ogi, Yukiko Nakano, Shumpei Niida, Keigo Dote, Yukoh Hirai, Kazuyosi Suenari, Yukiji Tonouchi, Noboru Oda, Yuko Makita, Shigeyuki Ueda, Kenta Kajihara, Katsuhiko Imai, Taijro Sueda, Kazuaki Chayama, Yasuki Kihara. (2010) Is Structural Remodeling of Fibrillated Atria the Consequence of Tissue Hypoxia?. Circulation Journal 74:9, 1815-1821
CrossRef37
Huan-Xin Zhao, Xiao-Liang Wang, Ye-Hong Wang, Ye Wu, Xiao-Yu Li, Xiao-Ping Lv, Zhi-Qing Zhao, Rong-Rui Zhao, Hui-Rong Liu. (2010) Attenuation of myocardial injury by postconditioning: role of hypoxia inducible factor-1α. Basic Research in Cardiology 105:1, 109-118
CrossRef38
Meera Kaur, Paramjit S Tappia. (2009) Metabolic shifts during cardiac hypertrophy. Clinical Lipidology 4:6, 725-729
CrossRef39
I. Vajanto, P. Korpisalo, J. Karjalainen, T. Hakala, K. M
kinen, S. Yl
CrossRef40
Q. Guo, J. J. Carrero, X. Yu, P. Barany, A. R. Qureshi, M. Eriksson, B. Anderstam, M. Chmielewski, O. Heimburger, P. Stenvinkel, B. Lindholm, J. Axelsson. (2009) Associations of VEGF and its receptors sVEGFR-1 and -2 with cardiovascular disease and survival in prevalent haemodialysis patients. Nephrology Dialysis Transplantation 24:11, 3468-3473
CrossRef41
H. Zhao, Y. Wang, Y. Wu, X. Li, G. Yang, X. Ma, R. Zhao, H. Liu. (2009) Hyperlipidemia does not prevent the cardioprotection by postconditioning against myocardial ischemia/reperfusion injury and the involvement of hypoxia inducible factor-1 upregulation. Acta Biochimica et Biophysica Sinica 41:9, 745-753
CrossRef42
Takayoshi Yamaki, Masumi Iwai-Takano, Hiroyuki Yaoita, Kazuei Ogawa, Hiroko Tajima, Yasuchika Takeishi, Yukio Maruyama. (2009) Participation of mast cells in angiogenesis in the border zone of myocardial infarction in rats. Journal of Medical Ultrasonics 36:3, 119-127
CrossRef43
Michael Brehm, Petra Ebner, Frauke Picard, Ryan Urbien, Gökmen Turan, Bodo-Eckehard Strauer. (2009) Enhanced mobilization of CD34+ progenitor cells expressing cell adhesion molecules in patients with STEMI. Clinical Research in Cardiology 98:8, 477-486
CrossRef44
Anja M. van der Laan, Jan J. Piek, Niels van Royen. (2009) Targeting angiogenesis to restore the microcirculation after reperfused MI. Nature Reviews Cardiology 6:8, 515-523
CrossRef45
D. J. Hausenloy, D. M. Yellon. (2009) Cardioprotective growth factors. Cardiovascular Research 83:2, 179-194
CrossRef46
Shu-Yan Chen, Fei Wang, Xue-Yun Yan, Qing Zhou, Qiang Ling, Ji-Xian Ling, Ye-Zhi Rong, Yi-Gang Li. (2009) Autologous transplantation of EPCs encoding FGF1 gene promotes neovascularization in a porcine model of chronic myocardial ischemia. International Journal of Cardiology 135:2, 223-232
CrossRef47
Guo-Hua Fong. (2009) Regulation of angiogenesis by oxygen sensing mechanisms. Journal of Molecular Medicine 87:6, 549-560
CrossRef48
Wenxue Zhao, Qianqian Han, Hang Lin, Wenjie Sun, Yuan Gao, Yannan Zhao, Bin Wang, Xia Wang, Bing Chen, Zhifeng Xiao, Jianwu Dai. (2009) Human Basic Fibroblast Growth Factor Fused with Kringle4 Peptide Binds to a Fibrin Scaffold and Enhances Angiogenesis. Tissue Engineering Part A 15:5, 991-998
CrossRef49
Alan L. Schwartz, Aaron Ciechanover. (2009) Targeting Proteins for Destruction by the Ubiquitin System: Implications for Human Pathobiology. Annual Review of Pharmacology and Toxicology 49:1, 73-96
CrossRef50
S. Käßmeyer, J. Plendl, P. Custodis, M. Bahramsoltani. (2009) New Insights in Vascular Development: Vasculogenesis and Endothelial Progenitor Cells. Anatomia, Histologia, Embryologia 38:1, 1-11
CrossRef51
Martin Rodriguez-Porcel. (2009) Noninvasive monitoring of myocardial angiogenesis. Current Cardiovascular Imaging Reports 2:1, 59-66
CrossRef52
Cynthia Hamou, Matthew J. Callaghan, Hariharan Thangarajah, Edwin Chang, Eric I. Chang, Raymon H. Grogan, Josemaria Paterno, Ivan N. Vial, Leila Jazayeri, Geoffrey C. Gurtner. (2009) Mesenchymal Stem Cells Can Participate in Ischemic Neovascularization. Plastic and Reconstructive Surgery 123:Supplement, 45S-55S
CrossRef53
Zhao-Yang Hu, Nan-Fu Luo, Jin Liu. (2009) The protective effects of emulsified isoflurane on myocardial ischemia and reperfusion injury in rats. Canadian Journal of Anesthesia/Journal canadien d'anesthésie 56:2, 115-125
CrossRef54
Ugo Testa, Gaetano Pannitteri, Gian Luigi Condorelli. (2008) Vascular endothelial growth factors in cardiovascular medicine. Journal of Cardiovascular Medicine 9:12, 1190-1221
CrossRef55
Oliver Zolk, Thomas F. Solbach, Thomas Eschenhagen, Alexander Weidemann, Martin F. Fromm. (2008) Activation of negative regulators of the hypoxia-inducible factor (HIF) pathway in human end-stage heart failure. Biochemical and Biophysical Research Communications 376:2, 315-320
CrossRef56
Lei Xu, Jiahong Xia, Kailun Zhang, Aini Xie. (2008) Regulation of hypoxic response elements on the expression of vascular endothelial growth factor gene transfected to rat skeletal myoblasts under hypoxic environment. Journal of Huazhong University of Science and Technology [Medical Sciences] 28:5, 568-571
CrossRef57
Wenxue Zhao, Qianqian Han, Hang Lin, Yuan Gao, Wenjie Sun, Yannan Zhao, Bin Wang, Bing Chen, Zhifeng Xiao, Jianwu Dai. (2008) Improved neovascularization and wound repair by targeting human basic fibroblast growth factor (bFGF) to fibrin. Journal of Molecular Medicine 86:10, 1127-1138
CrossRef58
Nathan M. Novotny, Rinki Ray, Troy A. Markel, Paul R. Crisostomo, Meijing Wang, Yue Wang, Daniel R. Meldrum. (2008) Stem Cell Therapy in Myocardial Repair and Remodeling. Journal of the American College of Surgeons 207:3, 423-434
CrossRef59
Anna Ahn, William H. Frishman, Andrew Gutwein, Jonathan Passeri, Michael Nelson. (2008) Therapeutic Angiogenesis. Cardiology in Review 16:4, 163-171
CrossRef60
Sung-A Chang, Eun Ju Lee, Hyun-Jae Kang, Shu-Ying Zhang, Ji-Hyun Kim, Lian Li, Seock-Won Youn, Choon-Soo Lee, Keum-Hyun Kim, Joo-Yun Won, Jong-Woo Sohn, Kyung-Woo Park, Hyun-Jai Cho, Sung-Eun Yang, Won Il Oh, Yoon Sun Yang, Won-Kyung Ho, Young-Bae Park, Hyo-Soo Kim. (2008) Impact of Myocardial Infarct Proteins and Oscillating Pressure on the Differentiation of Mesenchymal Stem Cells: Effect of Acute Myocardial Infarction on Stem Cell Differentiation. Stem Cells 26:7, 1901-1912
CrossRef61
Guo-Hua Fong. (2008) Mechanisms of adaptive angiogenesis to tissue hypoxia. Angiogenesis 11:2, 121-140
CrossRef62
Ignacio Cruz-Gonzalez, Pedro Pabón, Alicia Rodríguez-Barbero, Javier Martín-Moreiras, Miguel Pericacho, Pedro L Sánchez, Victor Ramirez, María Sánchez-Ledesma, Francisco Martín-Herrero, Javier Jiménez-Candil, Andrew O Maree, Angel Sánchez-Rodríguez, Cándido Martín-Luengo, José M López-Novoa. (2008) Identification of serum endoglin as a novel prognostic marker after acute myocardial infarction. Journal of Cellular and Molecular Medicine 12:3, 955-961
CrossRef63
Jerome Roncalli, Jörn Tongers, Marie-Ange Renault, Douglas W Losordo. (2008) Biological approaches to ischemic tissue repair: gene- and cell-based strategies. Expert Review of Cardiovascular Therapy 6:5, 653-668
CrossRef64
Marton Vertesaljai, Zsolt Piroth, Geza Fontos, Gyorgy Andreka, Gusztav Font, Gergely Szantho, Sandor Lueff, Marienn Reti, Tamas Masszi, Laszlo Ablonczy, Eszter D. Juhasz, Tamas Simor, Mark S. Turner, Peter Andreka. (2008) Drugs, gene transfer, signaling factors: a bench to bedside approach to myocardial stem cell therapy. Heart Failure Reviews 13:2, 227-244
CrossRef65
Flashman Emily, Loenarz Christoph, Christopher J. Schofield. 2008. Hypoxic Response and Associated Diseases. .
CrossRef66
Chen Song-ming, Li Yu-guang, Zhang Hong-xuan, Zhang Guo-hong, Long Jia-ru, Tan Chun-jiang, Wang Dong-ming, Fang Xiao-yi, Mai Rui-qin. (2008) Hypoxia-inducible factor-1α induces the coronary collaterals for coronary artery disease. Coronary Artery Disease 19:3, 173-179
CrossRef67
Takamitsu Nakamura, Jun-ei Obata, Yoshinobu Kitta, Hajime Takano, Tsuyoshi Kobayashi, Daisuke Fujioka, Yukio Saito, Yasushi Kodama, Kenichi Kawabata, Akira Mende, Toshiaki Yano, Mitsumasa Hirano, Keita Sano, Kazuto Nakamura, Kiyotaka Kugiyama. (2008) Rapid Stabilization of Vulnerable Carotid Plaque Within 1 Month of Pitavastatin Treatment in Patients With Acute Coronary Syndrome. Journal of Cardiovascular Pharmacology 51:4, 365-371
CrossRef68
G Loor, P T Schumacker. (2008) Role of hypoxia-inducible factor in cell survival during myocardial ischemia–reperfusion. Cell Death and Differentiation 15:4, 686-690
CrossRef69
Jyun-ei Obata, Kiyotaka Kugiyama. (2008) Reply. Journal of the American College of Cardiology 51:11, 1125
CrossRef70
Patrizia Ferroni, Francesca Martini, Roberta D'Alessandro, Agesilao Magnapera, Valeria Raparelli, Antongiulio Scarno, Giovanni Davì, Stefania Basili, Fiorella Guadagni. (2008) In vivo platelet activation is responsible for enhanced vascular endothelial growth factor levels in hypertensive patients. Clinica Chimica Acta 388:1-2, 33-37
CrossRef71
Dali Luo, Dongmei Yang, Xiaomei Lan, Kaitao Li, Xiaodong Li, Ju Chen, Youyi Zhang, Rui-Ping Xiao, Qide Han, Heping Cheng. (2008) Nuclear Ca2+ sparks and waves mediated by inositol 1,4,5-trisphosphate receptors in neonatal rat cardiomyocytes. Cell Calcium 43:2, 165-174
CrossRef72
Bao-Li Zhu, Sayaka Tanaka, Takaki Ishikawa, Dong Zhao, Dong-Ri Li, Tomomi Michiue, Li Quan, Hitoshi Maeda. (2008) Forensic pathological investigation of myocardial hypoxia-inducible factor-1α, erythropoietin and vascular endothelial growth factor in cardiac death. Legal Medicine 10:1, 11-19
CrossRef73
Fatma Ayerden Ebinç, Ebinç Haksun, Derici Boztepe Ülver, Eyüp Koç, Yasemin Erten, Kadriye Reis Altok, Musa Bali, Arinsoy Turgay, Sükrü Sindel. (2008) The Relationship between Vascular Endothelial Growth Factor (VEGF) and Microalbuminuria in Patients with Essential Hypertension. Internal Medicine 47:17, 1511-1516
CrossRef74
Ralph V. Shohet, Joseph A. Garcia. (2007) Keeping the engine primed: HIF factors as key regulators of cardiac metabolism and angiogenesis during ischemia. Journal of Molecular Medicine 85:12, 1309-1315
CrossRef75
Ajay Chaudhuri, David Janicke, Michael Wilson, Husam Ghanim, Gregory E. Wilding, Ahmad Aljada, Paresh Dandona. (2007) Effect of Modified Glucose-Insulin-Potassium on Free Fatty Acids, Matrix Metalloproteinase, and Myoglobin in ST-Elevation Myocardial Infarction. The American Journal of Cardiology 100:11, 1614-1618
CrossRef76
Xue-Hai Chen, Shinya Minatoguchi, Kenichiro Kosai, Kentaro Yuge, Tomoyuki Takahashi, Masazumi Arai, Ningyuan Wang, Yu Misao, Chuanjiang Lu, Hirohito Onogi, Hiroyuki Kobayashi, Shinji Yasuda, Masayasu Ezaki, Hiroaki Ushikoshi, Genzou Takemura, Takako Fujiwara, Hisayoshi Fujiwara. (2007) In Vivo Hepatocyte Growth Factor Gene Transfer Reduces Myocardial Ischemia-Reperfusion Injury Through Its Multiple Actions. Journal of Cardiac Failure 13:10, 874-883
CrossRef77
Joerg Heineke, Mannix Auger-Messier, Jian Xu, Toru Oka, Michelle A. Sargent, Allen York, Raisa Klevitsky, Sachin Vaikunth, Stephen A. Duncan, Bruce J. Aronow, Jeffrey Robbins, Timothy M. Cromblehol, Jeffery D. Molkentin. (2007) Cardiomyocyte GATA4 functions as a stress-responsive regulator of angiogenesis in the murine heart. Journal of Clinical Investigation 117:11, 3198-3210
CrossRef78
Hai-Feng Duan, Hong Wang, Jun Yi, Hong-Jun Liu, Qun-Wei Zhang, Li-Bing Li, Tao Zhang, Ying Lu, Chu-Tse Wu, Li-Sheng Wang. (2007) Adenoviral Gene Transfer of Sphingosine Kinase 1 Protects Heart Against Ischemia/Reperfusion-Induced Injury and Attenuates Its Postischemic Failure. Human Gene Therapy 18:11, 1119-1128
CrossRef79
Jyun-ei Obata, Yoshinobu Kitta, Hajime Takano, Yasushi Kodama, Takamitsu Nakamura, Akira Mende, Ken-ichi Kawabata, Yukio Saitoh, Daisuke Fujioka, Tsuyoshi Kobayashi, Toshiaki Yano, Kiyotaka Kugiyama. (2007) Sirolimus-Eluting Stent Implantation Aggravates Endothelial Vasomotor Dysfunction in the Infarct-Related Coronary Artery in Patients With Acute Myocardial Infarction. Journal of the American College of Cardiology 50:14, 1305-1309
CrossRef80
Thomas R. Payne, Hideki Oshima, Masaho Okada, Nobuo Momoi, Kimimasa Tobita, Bradley B. Keller, Hairong Peng, Johnny Huard. (2007) A Relationship Between Vascular Endothelial Growth Factor, Angiogenesis, and Cardiac Repair After Muscle Stem Cell Transplantation Into Ischemic Hearts. Journal of the American College of Cardiology 50:17, 1677-1684
CrossRef81
May J. Reed, Nathan Karres, Daniel Eyman, Jay Edelberg. (2007) Endothelial Precursor Cells. Stem Cell Reviews 3:3, 218-225
CrossRef82
Fangfei Wang, Thomas Keimig, Quan He, Jennifer Ding, Zhenggang Zhang, Siamak Pourabdollah-Nejad, Xiao-Ping Yang. (2007) Augmented Healing Process in Female Mice with Acute Myocardial Infarction. Gender Medicine 4:3, 230-247
CrossRef83
Jacek Kowalczyk, Dorota Domal-Kwiatkowska, Urszula Mazurek, Michał Zembala, Bogdan Michalski, Marian Zembala. (2007) Post-transcriptional modifications of VEGF-A mRNA in non-ischemic dilated cardiomyopathy. Cellular & Molecular Biology Letters 12:3, 331-347
CrossRef84
M. Qing, A. Görlach, K. Schumacher, M. Wöltje, J. F. Vazquez-Jimenez, J. Hess, M.-C. Seghaye. (2007) The hypoxia-inducible factor HIF-1 promotes intramyocardial expression of VEGF in infants with congenital cardiac defects. Basic Research in Cardiology 102:4, 368-368
CrossRef85
Akira Mende, Hajime Takano, Yasushi Kodama, Takamitsu Nakamura, Ken Umetani, Daisuke Fujioka, Yukio Saito, Tsuyoshi Kobayashi, Ken-ichi Kawabata, Jyun-ei Obata, Yoshinobu Kitta, Kiyotaka Kugiyama. (2007) Relation between transcardiac gradient of VEGF and coronary flow response in humans. International Journal of Cardiology 119:2, 156-162
CrossRef86
D. M. Smadja, A. Cornet, J. Emmerich, M. Aiach, P. Gaussem. (2007) Endothelial progenitor cells: Characterization, in vitro expansion, and prospects for autologous cell therapy. Cell Biology and Toxicology 23:4, 223-239
CrossRef87
Yoshiki Mori, Makiko Shoji, Toshio Nakanishi, Takanari Fujii, Makoto Nakazawa. (2007) Elevated vascular endothelial growth factor levels are associated with aortopulmonary collateral vessels in patients before and after the Fontan procedure. American Heart Journal 153:6, 987-994
CrossRef88
Athanassios Manginas, Evgenios Goussetis, Maria Koutelou, George Karatasakis, Ioulia Peristeri, Athanassios Theodorakos, Evangelos Leontiadis, Nikolaos Plessas, Maria Theodosaki, Stelios Graphakos, Dennis V Cokkinos. (2007) Pilot study to evaluate the safety and feasibility of intracoronary CD133+ and CD133− CD34+ cell therapy in patients with nonviable anterior myocardial infarction. Catheterization and Cardiovascular Interventions 69:6, 773-781
CrossRef89
M. Quing, A. Görlach, K. Schumacher, M. Wöltje, J. F. Vazquez-Jimenez, J. Hess, M.-C. Seghaye. (2007) The hypoxia-inducible factor HIF-1 promotes intramyocardial expression of VEGF in infants with congenital cardiac defects. Basic Research in Cardiology 102:3, 224-232
CrossRef90
Sylvia M. Evans, Christine Mummery, Pieter A. Doevendans. (2007) Progenitor cells for cardiac repair. Seminars in Cell & Developmental Biology 18:1, 153-160
CrossRef91
Daniel Petrovič, Renata Verhovec, Mojca Globočnik Petrovič, Joško Osredkar, Borut Peterlin. (2007) Association of Vascular Endothelial Growth Factor Gene Polymorphism with Myocardial Infarction in Patients with Type 2 Diabetes. Cardiology 107:4, 291-295
CrossRef92
Gaetano Pannitteri, Eleonora Petrucci, Ugo Testa. (2006) Coordinate release of angiogenic growth factors after acute myocardial infarction: evidence of a two-wave production. Journal of Cardiovascular Medicine 7:12, 872-879
CrossRef93
Nikolaos G. Frangogiannis. (2006) The Mechanistic Basis of Infarct Healing. Antioxidants & Redox Signaling 8:11-12, 1907-1939
CrossRef94
David G. Rizik, Kevin J. Klassen, Denise A. Dowler, Bernard J. Villegas, Simon R. Dixon. (2006) Promising though not yet proven: Emerging strategies to promote myocardial salvage. Catheterization and Cardiovascular Interventions 68:4, 596-606
CrossRef95
Brendan Doyle, Noel M Caplice. (2006) Targeting angiogenesis versus myogenesis with cardiac cell therapy. Expert Review of Cardiovascular Therapy 4:5, 745-753
CrossRef96
Olli Arjamaa, Mikko Nikinmaa. (2006) Oxygen-dependent diseases in the retina: Role of hypoxia-inducible factors. Experimental Eye Research 83:3, 473-483
CrossRef97
Antonio Maria Leone, Sergio Rutella, Giuseppina Bonanno, Anna Maria Contemi, Daniela G. de Ritis, Maria Benedetta Giannico, Antonio G. Rebuzzi, Giuseppe Leone, Filippo Crea. (2006) Endogenous G-CSF and CD34+ cell mobilization after acute myocardial infarction. International Journal of Cardiology 111:2, 202-208
CrossRef98
I G Lee, S L Chae, J C Kim. (2006) Involvement of circulating endothelial progenitor cells and vasculogenic factors in the pathogenesis of diabetic retinopathy. Eye 20:5, 546-552
CrossRef99
A.C. Mitsi, K.E. Hatzistergos, D. Niokou, L. Pappa, G.G. Baltogiannis, D.G. Tsalikakis, A. Papalois, Z.S. Kyriakides, V. Malamou-Mitsi, T.M. Kolettis. (2006) Early, intracoronary growth hormone administration attenuates ventricular remodeling in a porcine model of myocardial infarction. Growth Hormone & IGF Research 16:2, 93-100
CrossRef100
Robert G. Hahn, Li Yin, Jan Ekengren, Lars Sandfeldt. (2006) Vascular endothelial growth factor in serum indicates cardiovascular risk in urology patients. Scandinavian Journal of Urology and Nephrology 40:2, 144-148
CrossRef101
Sei-ichiro Tsuchihashi, Bibo Ke, Fady Kaldas, Evelyn Flynn, Ronald W. Busuttil, David M. Briscoe, Jerzy W. Kupiec-Weglinski. (2006) Vascular Endothelial Growth Factor Antagonist Modulates Leukocyte Trafficking and Protects Mouse Livers against Ischemia/Reperfusion Injury. The American Journal of Pathology 168:2, 695-705
CrossRef102
H Xiaowei, Z Ninghui, X Wei, T Yiping, Jonathan Cole. (2006) The experimental study of hypoxia-inducible factor-1α and its target genes in spinal cord injury. Spinal Cord 44:1, 35-43
CrossRef103
Yongzhong Wang, Anders Gabrielsen, Patrick R. Lawler, Gabrielle Paulsson-Berne, Daniel A. Steinbrüchel, Goran K. Hansson, Jens Kastrup. (2006) Myocardial Gene Expression of Angiogenic Factors in Human Chronic Ischemic Myocardium: Influence of Acute Ischemia/Cardioplegia and Reperfusion. Microcirculation 13:3, 187-197
CrossRef104
Mien-Cheng Chen, Hon-Kan Yip, Chien-Jen Chen, Cheng-Hsu Yang, Chiung-Jen Wu, Cheng-I Cheng, Yen-Hsun Chen, Han-Tan Chai, Ching-Ping Lee, Hsueh-Wen Chang. (2006) No Age-Related Change in Circulating Endothelial Progenitor Cells in Healthy Subjects. International Heart Journal 47:1, 95-105
CrossRef105
Patrick C.H. Hsieh, Michael E. Davis, Laura K. Lisowski, Richard T. Lee. (2006) ENDOTHELIAL-CARDIOMYOCYTE INTERACTIONS IN CARDIAC DEVELOPMENT AND REPAIR. Annual Review of Physiology 68:1, 51-66
CrossRef106
Yoka H. Kusumanto, René A. Tio, Bert G. Loef, Wim J. Sluiter, Nanno H. Mulder, Geke A. P. Hospers. (2006) Systemic VEGF levels after coronary artery bypass graft surgery reflects the extent of inflammatory response. Acute Cardiac Care 8:1, 41-45
CrossRef107
Jose Blanco Pampin, Sonia Aranzazu Garcia Rivero, Xose Luis Otero Cepeda, Angel Vazquez Boquete, Jeronimo Forteza Vila, Rafael Hinojal Fonseca. (2006) Immunohistochemical Expression of HIF-1alpha in Response to Early Myocardial Ischemia. Journal of Forensic Sciences 51:1, 120-124
CrossRef108
E Baskin-Bey, H Devarbhavi, D Nagorney, M Farnell, J Donohue, S Sanderson, L Stadheim, G Gores. (2005) Idiopathic benign biliary strictures in surgically resected patients with presumed cholangiocarcinoma. HPB: Official Journal of The International Hepato Pancreato Biliary Association 7:4, 283-288
CrossRef109
Masakuni Kido, Lingling Du, Christopher C. Sullivan, Xiaodong Li, Reena Deutsch, Stuart W. Jamieson, Patricia A. Thistlethwaite. (2005) Hypoxia-Inducible Factor 1-Alpha Reduces Infarction and Attenuates Progression of Cardiac Dysfunction After Myocardial Infarction in the Mouse. Journal of the American College of Cardiology 46:11, 2116-2124
CrossRef110
Hideki Nikami, Jan Nedergaard, J. Magnus Fredriksson. (2005) Norepinephrine but not hypoxia stimulates HIF-1α gene expression in brown adipocytes. Biochemical and Biophysical Research Communications 337:1, 121-126
CrossRef111
Wen-Jone Chen, Huei-Wen Chen, Sung-Liang Yu, Chien-Hua Huang, Tzung-Dau Wang, Jeremy J.W Chen, Chiang-Ting Chien, Hsuan-Yu Chen, Pan-Chyr Yang, Yuan-Teh Lee. (2005) GENE EXPRESSION PROFILES IN HYPOXIC PRECONDITIONING USING CDNA MICROARRAY ANALYSIS: ALTERED EXPRESSION OF AN ANGIOGENIC FACTOR, CARCINOEMBRYONIC ANTIGEN-RELATED CELL ADHESION MOLECULE 1. Shock 24:2, 124-131
CrossRef112
Noel M. Caplice, Brendan Doyle. (2005) Vascular Progenitor Cells: Origin and Mechanisms of Mobilization, Differentiation, Integration, and Vasculogenesis. Stem Cells and Development 14:2, 122-139
CrossRef113
Frank J. Giordano. (2005) Oxygen, oxidative stress, hypoxia, and heart failure. Journal of Clinical Investigation 115:3, 500-508
CrossRef114
Kou-Gi Shyu, Ming-Jen Lu, Hang Chang, Hsien-Yi Sun, Bao-Wei Wang, Peiliang Kuan. (2005) Carvedilol Modulates the Expression of Hypoxia-Inducible Factor-1α and Vascular Endothelial Growth Factor in a Rat Model of Volume-Overload Heart Failure. Journal of Cardiac Failure 11:2, 152-159
CrossRef115
Stefanie Dimmeler, Andreas M. Zeiher, Michael D. Schneider. (2005) Unchain my heart: the scientific foundations of cardiac repair. Journal of Clinical Investigation 115:3, 572-583
CrossRef116
Ki Chul Sung, Kyung Soo Kim, Sang Lee. (2005) Hypoxic Regulation of VEGF, HIF-1(alpha) in Coronary Collaterals Development. The Korean Journal of Internal Medicine 20:4, 295
CrossRef117
Andreas Rück, Thomas Gustafsson, Jessica Norrbom, Jacek Nowak, Göran Källner, Magnus Söderberg, Christer Sylvén, Viktor Drvota. (2004) ANP and BNP but not VEGF are regionally overexpressed in ischemic human myocardium. Biochemical and Biophysical Research Communications 322:1, 287-291
CrossRef118
Stefanie Dimmeler, Andreas M. Zeiher. (2004) Wanted! The best cell for cardiac regeneration. Journal of the American College of Cardiology 44:2, 464-466
CrossRef119
Stefan A.M. Paul, Jonathan W. Simons, Nicola J. Mabjeesh. (2004) HIF at the crossroads between ischemia and carcinogenesis. Journal of Cellular Physiology 200:1, 20-30
CrossRef120
M Quintero, N Mackenzie, P.A Brennan. (2004) Hypoxia-inducible factor 1 (HIF-1) in cancer. European Journal of Surgical Oncology (EJSO) 30:5, 465-468
CrossRef121
T.B. Zhao, H.X. Ning, S.S. Zhu, P. Sun, S.X. Xu, Z.J. Chang, X.Q. Zhao. (2004) Cloning of hypoxia-inducible factor 1α cDNA from a high hypoxia tolerant mammal—plateau pika (Ochotona curzoniae). Biochemical and Biophysical Research Communications 316:2, 565-572
CrossRef122
Vipul R. Panchal, Jalees Rehman, Anne T. Nguyen, John W. Brown, Mark W. Turrentine, Yousuf Mahomed, Keith L. March. (2004) Reduced pericardial levels of endostatin correlate with collateral development in patients with ischemic heart disease. Journal of the American College of Cardiology 43:8, 1383-1387
CrossRef123
Jarmila D.W. van der Bilt, Inne H.M. Borel Rinkes. (2004) Surgery and angiogenesis. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1654:1, 95-104
CrossRef124
Jong-Wan Park, Yang-Sook Chun, Myung-Suk Kim. (2004) Hypoxia-Inducible Factor 1-Related Diseases and Prospective Therapeutic Tools. Journal of Pharmacological Sciences 94:3, 221-232
CrossRef125
Rune Sundset, Marie Cooper, Svein-Ole Mikalsen, Kirsti Ytrehus. (2004) Ischemic Preconditioning Protects Against Gap Junctional Uncoupling in Cardiac Myofibroblasts. Cell Communication and Adhesion 11:2-4, 51-66
CrossRef126
U. Klueh, D. I. Dorsky, D. L. Kreutzer. (2003) Use of vascular endothelial cell growth factor gene transfer to enhance implantable sensor functionin vivo. Journal of Biomedical Materials Research 67A:4, 1072-1086
CrossRef127
Ing-Shiow Lay, Cheng-Chu Hsieh, Jen-Hwey Chiu, Ming-Shi Shiao, Wing-Yiu Lui, Chew-Wun Wu. (2003) Salvianolic acid b enhances in vitro angiogenesis and improves skin flap survival in sprague-dawley rats1. Journal of Surgical Research 115:2, 279-285
CrossRef128
Yves Denizot, Laurence Guglielmi, Elisabeth Cornu, Nathalie Nathan. (2003) Alterations in plasma angiogenic growth factor concentrations after coronary artery bypass graft surgery: relationships with post-operative complications. Cytokine 24:1-2, 7-12
CrossRef129
J. Jośko. (2003) Cerebral angiogenesis and expression of VEGF after subarachnoid hemorrhage (SAH) in rats. Brain Research 981:1-2, 58-69
CrossRef130
M. Ito, S. Tanaka, S. Kim, T. Kuwai, N. Matsutani, T. Kamada, Y. Kitadai, M. Sumii, M. Yoshihara, K. Haruma, K. Chayama. (2003) The specific expression of Hypoxia Inducible Factor-1alpha in human gastric mucosa induced by nonsteroidal anti-inflammatory drugs. Alimentary Pharmacology and Therapeutics 18:s1, 90-98
CrossRef131
N. A. Y. Chung, A. J. Makin, G. Y. H. Lip. (2003) Measurement of the soluble angiopoietin receptor tie-2 in patients with coronary artery disease: development and application of an immunoassay. European Journal of Clinical Investigation 33:7, 529-535
CrossRef132
Masahiko Nishida, Tao-Sheng Li, Ken Hirata, Masafumi Yano, Masunori Matsuzaki, Kimikazu Hamano. (2003) Improvement of cardiac function by bone marrow cell implantation in a rat hypoperfusion heart model. The Annals of Thoracic Surgery 75:3, 768-773
CrossRef133
Du, Lingling, Sullivan, Christopher C., Chu, Danny, Cho, Augustine J., Kido, Masakuni, Wolf, Paul L., Yuan, Jason X.-J., Deutsch, Reena, Jamieson, Stuart W., Thistlethwaite, Patricia A., . (2003) Signaling Molecules in Nonfamilial Pulmonary Hypertension. New England Journal of Medicine 348:6, 500-509
Full Text134
Gregg L. Semenza. (2003) Angiogenesis Ischemic and Neoplastic Disorders. Annual Review of Medicine 54:1, 17-28
CrossRef135
Christopher D. Raeburn, Michael A. Zimmerman, Jyoti Arya, Katherine Barsness, Alden H. Harken. (2002) Ischemic Preconditioning: Fact or Fantasy?. Journal of Cardiac Surgery 17:6, 536-542
CrossRef136
Lee S Rosen. (2002) Inhibitors of the vascular endothelial growth factor receptor. Hematology/Oncology Clinics of North America 16:5, 1173-1187
CrossRef137
John E. Scarborough, Monica L. Smith, Patrick W. Domkowski, Luis H. Diodato, Anne M. Pippen, Peter K. Smith, Brian H. Annex, Kevin P. Landolfo. (2002) Basic Fibroblast Growth Factor Is Upregulated in Hibernating Myocardium. Journal of Surgical Research 107:1, 119-123
CrossRef138
Carolyn S. Grove, Y.C. Gary Lee. (2002) Vascular endothelial growth factor: the key mediator in pleural effusion formation. Current Opinion in Pulmonary Medicine 8:4, 294-301
CrossRef139
Tuomas T. Rissanen, Ismo Vajanto, Mikko O. Hiltunen, Juha Rutanen, Mikko I. Kettunen, Mari Niemi, Pia Leppänen, Mikko P. Turunen, Johanna E. Markkanen, Katja Arve, Esko Alhava, Risto A. Kauppinen, Seppo Ylä-Herttuala. (2002) Expression of Vascular Endothelial Growth Factor and Vascular Endothelial Growth Factor Receptor-2 (KDR/Flk-1) in Ischemic Skeletal Muscle and Its Regeneration. The American Journal of Pathology 160:4, 1393-1403
CrossRef140
Lisa P. Abramson, Elfriede Pahl, Lijun Huang, Veronica Stellmach, Sherrie Rodgers, Constantine Mavroudis, Carl L. Backer, Robert M. Arensman, Susan E. Crawford. (2002) SERUM VASCULAR ENDOTHELIAL GROWTH FACTOR AS A SURVEILLANCE MARKER FOR CELLULAR REJECTION IN PEDIATRIC CARDIAC TRANSPLANTATION. Transplantation 73:1, 153-156
CrossRef141
Seyedhossein Aharinejad, Romana Schäfer, Reinhold Hofbauer, Dietmar Abraham, Roland Blumer, Aurelia Miksovsky, Hannes Traxler, Dieter Pullirsch, Rainer Alexandrowicz, Shahrokh Taghavi, Alfred Kocher, Günther Laufer. (2001) IMPACT OF CARDIAC TRANSPLANTATION ON MOLECULAR PATHOLOGY OF ET-1, VEGF-C, AND MITOCHONDRIAL METABOLISM AND MORPHOLOGY IN DILATED VERSUS ISCHEMIC CARDIOMYOPATHIC PATIENTS1. Transplantation 72:6, 1043-1049
CrossRef142
Mario Plebani. (2001) Biochemical markers of cardiac damage: from efficiency to effectiveness. Clinica Chimica Acta 311:1, 3-7
CrossRef143
Gregg L. Semenza. (2001) Hypoxia-inducible factor 1: oxygen homeostasis and disease pathophysiology. Trends in Molecular Medicine 7:8, 345-350
CrossRef144
Diana L. Ramírez-Bergeron, M. Celeste Simon. (2001) Hypoxia-Inducible Factor and the Development of Stem Cells of the Cardiovascular System. Stem Cells 19:4, 279-286
CrossRef145
ALISA LIMSUWAN, OLEKSANDR PLATOSHYN, YING YU, LEWIS J. RUBIN, ABRAHAM ROTHMAN, JASON X.-J. YUAN. (2001) Inhibition of K+ Channel Activity in Human Pulmonary Artery Smooth Muscle Cells by Serum from Patients with Pulmonary Hypertension Secondary to Congenital Heart Disease. Pediatric Research 50:1, 23-28
CrossRef146
Tom Catron, Melody A. Mendiola, Susan M. Smith, Jerry Born, Mary K. Walker. (2001) Hypoxia Regulates Avian Cardiac Arnt and HIF-1α mRNA Expression. Biochemical and Biophysical Research Communications 282:2, 602-607
CrossRef147
R. Bos, H. Zhong, C. F. Hanrahan, E. C. M. Mommers, G. L. Semenza, H. M. Pinedo, M. D. Abeloff, J. W. Simons, P. J. van Diest, E. van der Wall. (2001) Levels of Hypoxia-Inducible Factor-1 During Breast Carcinogenesis. JNCI Journal of the National Cancer Institute 93:4, 309-314
CrossRef148
James F. Symes. (2001) Gene Therapy for Ischemic Heart Disease. American Journal of Cardiovascular Drugs 1:3, 159-166
CrossRef149
Thomas N Robinson, Todd D Morrell, Benjamin J Pomerantz, Julie K Heimbach, Charles B Cairns, Alden H Harken. (2000) Therapeutically accessible clinical cardiac states11No other financial involvement, competing interests, or affiliations exist.. Journal of the American College of Surgeons 191:4, 452-463
CrossRef150
Jeffrey M. Isner. (2000) Tissue responses to ischemia: local and remote responses for preserving perfusion of ischemic muscle. Journal of Clinical Investigation 106:5, 615-619
CrossRef151
(2000) Angiogenesis Factors in Acute Myocardial Ischemia and Infarction. New England Journal of Medicine 343:2, 148-149
Full Text
- Letters
