Original Article
Orthostatic Intolerance and Tachycardia Associated with Norepinephrine-Transporter Deficiency
N Engl J Med 2000; 342:541-549February 24, 2000
- Abstract
Background
Orthostatic intolerance is a syndrome characterized by lightheadedness, fatigue, altered mentation, and syncope and associated with postural tachycardia and plasma norepinephrine concentrations that are disproportionately high in relation to sympathetic outflow. We tested the hypothesis that impaired functioning of the norepinephrine transporter contributes to the pathophysiologic mechanism of orthostatic intolerance.
Methods
In a patient with orthostatic intolerance and her relatives, we measured postural blood pressure, heart rate, plasma catecholamines, and systemic norepinephrine spillover and clearance, and we sequenced the norepinephrine-transporter gene and evaluated its function.
Results
The patient had a high mean plasma norepinephrine concentration while standing, as compared with the mean (±SD) concentration in normal subjects (923 vs. 439±129 pg per milliliter [5.46 vs. 2.59±0.76 nmol per liter]), reduced systemic norepinephrine clearance (1.56 vs. 2.42±0.71 liters per minute), impairment in the increase in the plasma norepinephrine concentration after the administration of tyramine (12 vs. 56±63 pg per milliliter [0.07 vs. 0.33± 0.37 pmol per liter]), and a disproportionate increase in the concentration of plasma norepinephrine relative to that of dihydroxyphenylglycol. Analysis of the norepinephrine-transporter gene revealed that the proband was heterozygous for a mutation in exon 9 (encoding a change from guanine to cytosine at position 237) that resulted in more than a 98 percent loss of function as compared with that of the wild-type gene. Impairment of synaptic norepinephrine clearance may result in a syndrome characterized by excessive sympathetic activation in response to physiologic stimuli. The mutant allele in the proband's family segregated with the postural heart rate and abnormal plasma catecholamine homeostasis.
Conclusions
Genetic or acquired deficits in norepinephrine inactivation may underlie hyperadrenergic states that lead to orthostatic intolerance.
Media in This Article
Figure 4
Neuronal Metabolism of Norepinephrine in Persons with Norepinephrine-Transporter Deficiency.Figure 3
Heart Rate and Plasma Catecholamine Concentrations in the Proband and Her Family in the Supine and Upright Positions.Article Activity
- Article
Orthostatic intolerance is a syndrome characterized by adrenergic symptoms that occur when an upright posture is assumed: the heart rate increases by at least 30 beats per minute, without orthostatic hypotension.1 Most patients with orthostatic intolerance are women between the ages of 20 and 50 years old.2 This syndrome, first described by Da Costa3 more than 100 years ago, has been called soldier's heart,4 neurocirculatory asthenia,5 and the mitral valve prolapse syndrome.6 It is similar to the chronic fatigue syndrome in many respects.7
Most attempts to explain the physiologic and biochemical abnormalities associated with orthostatic intolerance have focused on an increased release of norepinephrine in response to the change from a supine to an upright position. An alternative explanation is that there is an abnormality in the clearance of norepinephrine from the synaptic cleft. The primary mechanism of inactivation of norepinephrine in the synapse is uptake into the neuron by the norepinephrine transporter. Approximately 80 to 90 percent of the norepinephrine released into many synapses is cleared by this mechanism, and the remaining 10 to 20 percent spills over into the circulation or extraneuronal tissue.8 It is noteworthy that drugs that inhibit the norepinephrine transporter (e.g., cocaine, amphetamines, and tricyclic antidepressants) cause features typical of orthostatic intolerance (tachycardia, orthostatic symptoms, and high plasma catecholamine concentrations).
We evaluated a patient and her identical twin, both of whom had symptoms typical of orthostatic intolerance, and in both found clinical and laboratory signs of disordered uptake of norepinephrine. Because the norepinephrine transporter has a pivotal role in norepinephrine uptake at the synaptic cleft, we determined whether the impaired uptake of norepinephrine in these patients could have been caused by a mutation in the gene that encodes the norepinephrine transporter.
Methods
The proband was a 33-year-old woman with a 20-year history of exertional and orthostatic tachycardia, dyspnea, difficulty concentrating, and syncope. Her blood pressure had varied substantially after each of three cesarean sections, with values as high as 210/180 mm Hg. Treatment with beta-adrenergic–antagonist drugs, compression stockings, and fludrocortisone was ineffective. Implantation of a dual-chamber pacemaker decreased the frequency of the syncope, but the symptoms of orthostatic intolerance persisted. An echocardiogram revealed slight mitral regurgitation and possible mitral-valve prolapse. The proband's identical twin also had a history of mitral-valve prolapse as well as tachycardia and syncope that were worsened by exertion and an upright posture.
The study was approved by the Vanderbilt University investigational review board, and all subjects, including family members, gave written informed consent.
Clinical Studies
The proband and her twin were admitted to the General Clinical Research Center at Vanderbilt University Medical Center. Use of all medications had been discontinued two weeks before admission. For three days, the women were given a caffeine-free, low-monoamine diet containing 150 mmol of sodium per day and 70 mmol of potassium per day. Urine was then collected for 24 hours for measurement of catecholamines and catecholamine metabolites. After an overnight fast, the women's blood pressure, heart rate, and plasma catecholamines were measured while they were supine and after 30 minutes of standing. Plasma and urine catecholamines were measured by high-performance liquid chromatography.9,10 Testing of autonomic reflexes was performed as previously described.11 In the proband, brachial blood pressure and plasma norepinephrine were measured before and at the time of maximal blood pressure after the injection of a 3-mg bolus of tyramine. Systemic spillover and clearance of norepinephrine before and during baroreflex-mediated sympathetic activation, induced by the administration of sodium nitroprusside (Ohmeda, Liberty Corner, N.J.), were measured in the proband during continuous monitoring of intraarterial blood pressure and heart rate, as follows. Tritiated norepinephrine was infused intravenously at a rate of 1 μCi per minute after the administration of a loading dose of 25 μCi per minute, as previously described,12,13 and plasma norepinephrine and the specific activity of tritiated norepinephrine were measured.13 Nitroprusside was then infused into a contralateral antecubital vein. When the systolic blood pressure had decreased by 20 mm Hg (at a rate of 1.2 μg of nitroprusside per kilogram of body weight per minute), the measurements were repeated.
Blood pressure, heart rate, and plasma catecholamine concentrations in the proband and her twin sister were compared with those in 10 unrelated normal subjects recruited from a pool of normal volunteers; the sisters' plasma catecholamine responses after tyramine administration were compared with those in 9 unrelated normal subjects; and their norepinephrine spillover and clearance were compared with those in 8 unrelated normal subjects.
Blood samples were obtained from the proband, her nine siblings, and her mother for DNA analysis. In the mother and all the siblings except for one sister, blood pressure and heart rate were determined in the supine position and after 5 minutes of standing, and plasma catecholamines were measured after the subjects had been supine for 20 minutes and then after they had been standing for 30 minutes.
Detection of Mutations
Amplification and sequencing were performed at the Vanderbilt Center for Molecular Neuroscience DNA Sequencing Core. Genomic DNA was isolated from venous blood with the PureGene DNA Extraction Kit (Gentra Systems, Minneapolis), and the exons of the human norepinephrine-transporter gene (SLC6A2; McKusick no. 16397014) were amplified with the use of the polymerase chain reaction and sense and antisense primers (the sequences of oligonucleotides used for the exonic polymerase chain reaction and the conditions for amplification are available on request). The amplified products (60 ng per aliquot) were directly sequenced with fluorescent dideoxynucleotide chain terminators (AmpliTaq FS, Perkin Elmer Applied Biosystems, Foster City, Calif.) on an automated DNA sequencer (ABI 310, Perkin Elmer Applied Biosystems).
Functional Analysis of the Identified Mutation
DNA encoding a human norepinephrine transporter with alanine replaced by proline at position 457 (Ala457Pro) was created with the use of a kit (QuikChange Site-Directed Mutagenesis Kit, Stratagene, La Jolla, Calif.) with the oligonucleotides 5'CCTTCAGTACTTTCCTTCTCCCCCTGTTCTGCATAACCAAG3' and 5'CTTGGTTATGCAGAACAGGGGGAGAAGGAAAGTACTGA-AGG3'. The underlined bases are those that were introduced to create a mutation in which guanine was replaced by cytosine at position 237 (G237C) or to introduce a ScaI restriction site that could be used to identify mutant plasmids. Amplified DNA was cloned into a construct (pcDNA3, Invitrogen, Carlsbad, Calif.) containing wild-type human norepinephrine-transporter complementary DNA (cDNA) in which a silent mutation, or one that does not result in a change in amino acid (in this case, leucine at position 438), had previously been introduced to create a unique Afl II restriction site and thus facilitate subcloning of the mutated sequence back into the wild-type construct. The subcloned region was sequenced with the norepinephrine-transporter oligonucleotides 5'CATTCT-GGGCTGTTGTGT3' and 5'GTGGTTGTGGTCAGCATCATC3'. DNA from multiple isolates of mutant clones was purified (Qiagen, Santa Clarita, Calif.) to test the effect of the Ala457Pro mutation on transporter activity.
Wild-type norepinephrine transporter, norepinephrine transporter with the Ala457Pro mutation, and pcDNA3 plasmids were transiently transfected into Chinese-hamster-ovary cells (American Type Culture Collection, Rockville, Md.) with the use of lipofectamine. The cells were assayed for tritiated norepinephrine-transporter activity (20 nmol per liter) 72 hours after transfection, as previously described.15
Genotyping of Ala457Pro Alleles
Allele-specific oligonucleotide hybridization was used to test for the presence of the Ala457Pro mutation, with hybridization of 5'CCTTCTCGCCCTGTT3' to the wild-type allele and hybridization of 5'CCTTCTCCCCCTGTT3' to the mutant allele. The underlined bases are those used to identify the single-nucleotide polymorphism in the mutant allele. All samples of genomic DNA were coded before genotype analysis in order to preserve the anonymity of the subjects. Genotypes were then used to associate genotypes with phenotypes.
Statistical Analysis
Paired and unpaired t-tests were used to compare clinical findings between the groups of subjects and within each group before and after exposure to various stimuli. Data were analyzed with Prism software (GraphPad Software, San Diego, Calif.). All P values are two-sided.
Results
Autonomic Responses
The proband and her twin sister had normal autonomic reflexes, but their blood pressure and heart rate were variable (Figure 1Figure 1
Continuous Recordings of Blood Pressure and Heart Rate in the Proband and Her Twin Sister.). Their blood pressure, heart rate, and plasma catecholamine concentrations in the supine and upright positions and those in the unrelated normal subjects13 are shown in Table 1Table 1
Blood Pressure, Heart Rate, and Plasma Catecholamine Concentrations in the Proband, Her Twin Sister, and 10 Unrelated Normal Subjects.. In the proband and her twin, the plasma concentrations of dihydroxyphenylglycol, an intraneuronal metabolite of norepinephrine,9 were low in relation to the plasma norepinephrine concentrations (ratio of dihydroxyphenylglycol to norepinephrine in the supine position, 3.06 in the proband and 2.41 in her twin, vs. 5.52 in the normal subjects; ratio in the upright position, 1.05 in the proband and 1.17 in her twin, vs. 3.44 in the normal subjects). Urinary excretion of norepinephrine was high in both the proband and her twin (435 and 125 μg per 24 hours [2.57 and 0.74 μmol per 24 hours], respectively; normal value, <90 μg per 24 hours [0.53 μmol per 24 hours]).Response to Tyramine
After it is taken up into neurons by the norepinephrine transporter, tyramine has a hypertensive effect caused by the release of norepinephrine.16,17 In the normal subjects, the mean (±SD) systolic blood pressure increased by 19±2 mm Hg and the mean plasma norepinephrine concentration increased by 56 ±21 pg per milliliter (0.33±0.12 nmol per liter) in response to 3 mg of tyramine. In the proband, the same dose of tyramine increased systolic blood pressure by 18 mm Hg but increased the plasma norepinephrine concentration by only 12 pg per milliliter (0.07 nmol per milliliter).
Spillover and Clearance of Systemic Norepinephrine
The arterial plasma norepinephrine concentration at rest was slightly higher in the proband than in the normal subjects (280 pg per milliliter [1.66 nmol per liter] vs. 204±51 pg per milliliter [1.21±0.30 nmol per liter]). This increase was due primarily to a decrease in the rate of removal of norepinephrine from the circulation (norepinephrine clearance): although the rate at which norepinephrine entered the circulation (norepinephrine spillover) was lower in the proband than in the normal subjects (436 vs. 514±277 ng per minute [2.58 vs. 3.04±1.64 nmol per minute]), norepinephrine clearance in the proband was less than half that in the normal subjects (1.56 vs. 2.42±0.71 liters per minute). During the infusion of nitroprusside, norepinephrine spillover increased to 1072 ng per minute (6.34 nmol per minute) in the proband but only to 745±212 ng per minute (4.40±1.25 nmol per minute) in the normal subjects. Norepinephrine clearance did not change appreciably after the nitroprusside infusion in either the proband (1.76 liters per minute) or the normal subjects (2.31±0.68 liters per minute).
Identification of a Functional Missense Mutation in the Norepinephrine-Transporter Gene
The combination in the proband of a low ratio of plasma dihydroxyphenylglycol to norepinephrine, a blunted response of plasma norepinephrine to tyramine, and a decreased plasma norepinephrine clearance suggested a potential defect in the norepinephrine transporter. The presence of similar findings in her twin sister suggested a genetic origin.
Direct sequence analysis of the norepinephrine-transporter gene in the proband revealed no divergence from previously published sequences14,18 in exons 1 through 8 and exons 10 through 15. However, two novel polymorphisms were identified in exon 9: a silent polymorphism in which cytosine was replaced by adenine at position 154 (C154A) and a missense mutation in which guanine was replaced by cytosine at position 237 (G237C) (position numbers refer to the GenBank sequence for exon 9). The proband was heterozygous for both the C154A and the G237C polymorphisms (Figure 2AFigure 2
Evaluation of the Norepinephrine-Transporter (NET) Mutation.). The G237C mutation results in a change from alanine to proline (Ala457Pro) within a highly conserved region of transmembrane domain 9 (Figure 2B and Figure 2C).Heterologous expression of the wild-type norepinephrine-transporter gene and human cDNA encoding the Ala457Pro mutation revealed that norepinephrine transport was greatly diminished by the Ala457Pro mutation. In Chinese-hamster-ovary cells that had been transiently transfected with cDNA encoding the human norepinephrine transporter, uptake of tritiated norepinephrine was 10 times that in vector-transfected cells, whereas in cells transfected with cDNA encoding the Ala457Pro mutation in the norepinephrine transporter, the uptake was 2 percent or less (Figure 2D). Multiple clones were tested, and in another cell line (LLC-PK1, provided by M. Hahn), all the clones were devoid of transport activity (data not shown).
Segregation of the Ala457Pro Mutation with a Phenotype
The proband's mother and eight of the proband's siblings were genotyped by allele-specific oligonucleotide hybridization. The mother and four siblings (including the twin sister) were heterozygous for the mutant allele (Figure 2E). Their heart rates while supine were slightly but not significantly greater than those of their family members with the wild-type genotype, but their heart rates while standing were significantly higher (Figure 3AFigure 3
Heart Rate and Plasma Catecholamine Concentrations in the Proband and Her Family in the Supine and Upright Positions. and Figure 3B). Likewise, plasma norepinephrine concentrations in the supine position were somewhat higher and plasma norepinephrine concentrations in the upright position were significantly higher in the heterozygous family members than in those with the normal genotype (Figure 3C and Figure 3D). Finally, the ratios of dihydroxyphenylglycol to norepinephrine in plasma in both the supine and upright positions were significantly lower in those who were heterozygous for the mutation than in the other family members (Figure 3E and Figure 3F).Discussion
The deficiency in norepinephrine transport in the proband and several members of her family was the result of a functional mutation in the gene encoding the norepinephrine transporter. Previously detected coding polymorphisms in this gene have no reported effect on norepinephrine transport.19 In contrast, the Ala457Pro mutation renders the transporter nonfunctional and segregates with altered heart-rate regulation and altered norepinephrine metabolism. The proband had a defect in norepinephrine uptake. Her heart rate while supine was about 10 beats per minute faster than the mean value for age-matched normal subjects20 and rose substantially when she stood. This change in heart rate was accompanied by an increase in the plasma norepinephrine concentration to almost four times its value in the supine position. These changes may have been caused by either an increase in the release (spillover) of norepinephrine or a decrease in its clearance.8,21 The blunting of the increase in plasma norepinephrine in the proband in response to the administration of tyramine and her low systemic norepinephrine clearance suggest that the uptake of norepinephrine was impaired. The abnormal relation between plasma concentrations of dihydroxyphenylglycol and norepinephrine provides further evidence of impaired norepinephrine uptake. Some of the norepinephrine taken up into neurons by the norepinephrine transporter reaches the vesicles, where it is stored for later release, but much of it is converted to dihydroxyphenylglycol by monoamine oxidase.8 The dihydroxyphenylglycol then enters the circulation and can serve as a marker of norepinephrine uptake and monoamine oxidase activity9 (Figure 4Figure 4
Neuronal Metabolism of Norepinephrine in Persons with Norepinephrine-Transporter Deficiency.). The relatively low ratios of dihydroxyphenylglycol to norepinephrine in plasma in the proband and her twin sister indicate that norepinephrine transport in these women was impaired.These findings in both the proband and her identical twin strongly suggested the presence of an abnormality in the norepinephrine-transporter gene, which has been mapped to chromosome 16q.22 Analysis of this gene in the proband revealed a missense mutation that resulted in the replacement of an alanine residue with a proline residue in a highly conserved transmembrane region of the transporter. Because the substitution of proline disrupts alpha-helical secondary structures that are supported by alanine residues, this mutation may disrupt the transport of norepinephrine. Functional analysis of the proband's mutant norepinephrine transporter demonstrated that it had 2 percent or less of the activity of the transporter encoded by the wild-type gene.
The pathophysiologic features of orthostatic intolerance have been thought to be due to a primary23 or secondary23-26 activation of sympathetic outflow. A deficiency of the norepinephrine transporter may explain several of the clinical findings in patients with this disorder: the high heart rate in the supine position, the high plasma concentration of norepinephrine in association with the relatively low plasma concentration of dihydroxyphenylglycol, the impaired response of norepinephrine to tyramine,13 the reduced systemic clearance of norepinephrine,13 and the disparity between the changes in heart rate and plas-ma norepinephrine concentrations and the change in muscle sympathetic-nerve activity in the upright position.27 In many patients with orthostatic intolerance, the disproportionately greater increase in heart rate than in diastolic pressure in the upright posture13 may also be explained by a deficiency of the norepinephrine transporter. The noradrenergic synaptic clefts in the heart are approximately three times as narrow as the synaptic clefts in the vasculature,28 making the removal of norepinephrine from the synapses in the heart far more dependent on the activity of the norepinephrine transporter than is removal from synapses in the vascular beds.29 Therefore, a decrease in transporter activity could result in a disproportionately greater effect on heart rate than on blood pressure, as is observed in patients with orthostatic intolerance.
Impairment of the norepinephrine transporter in the central nervous system may also contribute to the phenotype. Norepinephrine released in the brain can either increase30,31 or decrease32 sympathetic outflow. Because acute pharmacologic blockade of the norepinephrine transporter causes a decrease in sympathetic outflow,33 one would expect a decrease in sympathetic tone with a deficiency of the norepinephrine transporter. Yet in the proband and in many other patients with orthostatic intolerance, central sympathetic tone seems to be increased.34,35 This paradoxical increase may represent the sum of the effects of partial inhibition of norepinephrine transport at multiple sites in the central nervous system.
The Ala457Pro mutation does not explain all cases of orthostatic intolerance. The mutation was not present in any of 254 unrelated persons, including normal subjects, patients with hypertension, and other patients with orthostatic intolerance (data not shown). Furthermore, in the current study, family members who had the mutation also had some of the physiologic and biochemical abnormalities detected in the proband and her twin sister, but none had the full-blown syndrome. Thus, other genetic or environmental factors must have contributed to the phenotype in the two affected women.
In conclusion, the identification of defective norepinephrine transport in patients with orthostatic intolerance suggests a previously unrecognized mechanism in some patients with this clinical problem.
Supported in part by grants from the National Institutes of Health (MH58921, to Dr. Blakely; PO1 HL56693, to Dr. Robertson; and RR00095, to Drs. Robertson and Shannon), the National Aeronautics and Space Administration (NAS 9 19483, to Drs. Robertson and Biaggioni), and the Nathan Blaser Shy–Drager Research Program of Vanderbilt University.
We are indebted to Drs. Graeme Eisenhofer, Bojan Pohar, Rogelio Mosqueda-Garcia, Raffaello Furlan, R. Andrew Gaffney, Rose Marie Robertson, and Jack Alexander of Red Wing, Minnesota, and to Dorothea Boemer for their contributions to this study.
Source Information
From the Autonomic Dysfunction Center (J.R.S., J.J., G.J., B.K.B., I.B., D.R.) and the Center for Molecular Neuroscience (N.L.F., R.D.B.), Departments of Medicine, Pharmacology, and Neurology, Vanderbilt University, Nashville.
Address reprint requests to Dr. Robertson at the General Clinical Research Center, AA3228 MCN, Vanderbilt University, Nashville, TN 37232-2195, or at david.robertson@mcmail.vanderbilt.edu.
- References
References
1
Jacob G ,Shannon JR ,Black B , et al. Effects of volume loading and pressor agents in idiopathic orthostatic tachycardia. Circulation 1997;96:575-580
Web of Science | Medline2
Low PA ,Opfer-Gehrking TL ,Textor SC , et al. Postural tachycardia syndrome (POTS). Neurology 1995;45:Suppl 5:S19-S25
Web of Science | Medline3
Orthostatic disorders of blood pressure control: definitions and classification. In: Streeten DHP. Orthostatic disorders of the circulation: mechanisms, manifestations, and treatment. New York: Plenum Medical Book, 1987:111-25.
4
Fraser F ,Wilson RM . The sympathetic nervous system and the “irritable heart of soldiers.“ BMJ 1918;2:27-29
CrossRef | Medline5
Wooley CF . Where are the diseases of yesteryear? DaCosta's syndrome, soldiers heart, the effort syndrome, neurocirculatory asthenia -- and the mitral valve prolapse syndrome. Circulation 1976;53:749-751
Web of Science | Medline6
Boudoulas H ,Reynolds JC ,Mazzaferri E ,Wooley CF . Metabolic studies in mitral valve prolapse syndrome: a neuroendocrine-cardiovascular process. Circulation 1980;61:1200-1205
Web of Science | Medline7
Schondorf R ,Freeman R . The importance of orthostatic intolerance in the chronic fatigue syndrome. Am J Med Sci 1999;317:117-123
CrossRef | Web of Science | Medline8
Esler M ,Jennings G ,Lambert G ,Meredith I ,Horne M ,Eisenhofer G . Overflow of catecholamine neurotransmitters to the circulation: source, fate, functions. Physiol Rev 1990;70:963-985
Web of Science | Medline9
Goldenstein DS ,Eisenhofer G ,Stull R ,Folio CJ ,Keiser HR ,Kopin IJ . Plasma dihydroxyphenylglycol and the intraneuronal disposition of norepinephrine in humans. J Clin Invest 1988;81:213-220
CrossRef | Web of Science | Medline10
Shoup RE ,Kissinger PT . Determination of urinary normetanephrine, metanephrine, and 3-methoxytyramine by liquid chromatography, with amperometric detection. Clin Chem 1977;23:1268-1274
Web of Science | Medline11
Mosqueda-Garcia R. Evaluation of the autonomic nervous system. In: Robertson D, Biaggioni I, eds. Disorders of the autonomic nervous system. London: Harwood Academic, 1995:25-59.
12
Riley M ,Elborn JS ,McKane W ,Bell N ,Stanford CF ,Nicholls DP . Resting energy expenditure in chronic cardiac failure. Clin Sci (Colch) 1991;80:633-63913
Jacob G ,Shannon JR ,Costa F , et al. Abnormal norepinephrine clearance and adrenergic receptor sensitivity in idiopathic orthostatic intolerance. Circulation 1999;99:1706-1712
Web of Science | Medline14
Pacholczyk T ,Blakely RD ,Amara SG . Expression cloning of a cocaine- and antidepressant-sensitive human noradrenaline transporter. Nature 1991;350:350-354
CrossRef | Web of Science | Medline15
Apparsundaram S ,Galli A ,DeFelice LJ ,Hartzell HC ,Blakely RD . Acute regulation of norepinephrine transport. I. Protein kinase C-linked muscarinic receptors influence transport capacity and transporter density in SK-N-SH cells. J Pharmacol Exp Ther 1998;287:733-743
Web of Science | Medline16
Blakely RD ,De Felice LJ ,Hartzell HC . Molecular physiology of norepinephrine and serotonin transporters. J Exp Biol 1994;196:263-281
Web of Science | Medline17
Demanet JC . Usefulness of noradrenaline and tyramine infusion tests in the diagnosis of orthostatic hypotension. Cardiology 1976;61:Suppl 1:213-224
CrossRef | Web of Science | Medline18
Porzgen P ,Bonisch H ,Bruss M . Molecular cloning and organization of the coding region of the human norepinephrine transporter gene. Biochem Biophys Res Commun 1995;215:1145-1150[Erratum, Biochem Biophys Res Commun 1996;227:642-3.]
CrossRef | Web of Science | Medline19
Stober G ,Nothen MM ,Porzgen P , et al. Systematic search for variation in the human norepinephrine transporter gene: identification of five naturally occurring missense mutations and study of association with major psychiatric disorders. Am J Med Genet 1996;67:523-532
CrossRef | Web of Science | Medline20
Shannon JR ,Jordan J ,Black BK ,Costa F ,Robertson D . Uncoupling of the baroreflex by NN-cholinergic blockade in dissecting the components of cardiovascular regulation. Hypertension 1998;32:101-107
Web of Science | Medline21
Davis D ,Sinoway LI ,Robison J , et al. Norepinephrine kinetics during orthostatic stress in congestive heart failure. Circ Res 1987;61:I87-I90
Web of Science | Medline22
Bruss M ,Kunz J ,Lingen B ,Bonisch H . Chromosomal mapping of the human gene for the tricyclic antidepressant-sensitive noradrenaline transporter. Hum Genet 1993;91:278-280
CrossRef | Web of Science | Medline23
Novak V ,Novak P ,Opfer-Gehrking TL ,Low PA . Postural tachycardia syndrome: time frequency mapping. J Auton Nerv Syst 1996;61:313-320
CrossRef | Medline24
Fouad FM ,Tadena-Thome L ,Bravo EL ,Tarazi RC . Idiopathic hypovolemia. Ann Intern Med 1986;104:298-303
Web of Science | Medline25
Rosen SG ,Cryer PE . Postural tachycardia syndrome: reversal of sympathetic hyperresponsiveness and clinical improvement during sodium loading. Am J Med 1982;72:847-850
CrossRef | Web of Science | Medline26
Schondorf R ,Low PA . Idiopathic postural orthostatic tachycardia syndrome: an attenuated form of acute pandysautonomia? Neurology 1993;43:132-137
Web of Science | Medline27
Furlan R ,Jacob G ,Snell M , et al. Chronic orthostatic intolerance: a disorder with discordant cardiac and vascular sympathetic control. Circulation 1998;98:2154-2159
Web of Science | Medline28
Novi AM . An electron microscopic study of the innervation of papillary muscles in the rat. Anat Rec 1968;160:123-141
CrossRef | Web of Science | Medline29
Goldstein DS ,Brush JE Jr ,Eisenhofer G ,Stull R ,Esler M . In vivo measurement of neuronal uptake of norepinephrine in the human heart. Circulation 1988;78:41-48
CrossRef | Web of Science | Medline30
Goldberg MR ,Tung CS ,Ring M ,Oates JA ,Gerkens JF ,Robertson D . Evidence that alpha-methylepinephrine is an antihypertensive metabolite of alpha-methyldopa. Clin Exp Hypertens 1982;4:595-604
CrossRef | Web of Science31
Tung CS ,Goldberg MR ,Hollister AS ,Oates JA ,Robertson D . Central and peripheral cardiovascular effects of alpha-methylepinephrine. J Pharmacol Exp Ther 1983;227:484-490
Web of Science | Medline32
Adler-Graschinsky E ,Langer SZ . Possible role of a beta-adrenoceptor in the regulation of noradrenaline release by nerve stimulation through a positive feed-back mechanism. Br J Pharmacol 1975;53:43-50
Web of Science | Medline33
Esler MD ,Wallin G ,Dorward PK , et al. Effects of desipramine on sympathetic nerve firing and norepinephrine spillover to plasma in humans. Am J Physiol 1991;260:R817-R823
Web of Science | Medline34
Novak V ,Spies JM ,Novak P ,McPhee BR ,Rummans TA ,Low PA . Hypocapnia and cerebral hypoperfusion in orthostatic intolerance. Stroke 1998;29:1876-1881
CrossRef | Web of Science | Medline35
Shannon JR ,Jordan J ,Black BK ,Diedrich A ,Biaggioni I ,Robertson D . Sympathetic support of the circulation in idiopathic orthostatic intolerance. Circulation 1998;98:Suppl I:I-336 abstract.
- Citing Articles (125)
Citing Articles
1
Hui Wang, Johannes Elferich, Eric Gouaux. (2012) Structures of LeuT in bicelles define conformation and substrate binding in a membrane-like context. Nature Structural & Molecular Biology
CrossRef2
Maureen K. Hahn. 2012. Norepinephrine Transporter Deficiency. , 439-442.
CrossRef3
Satish R. Raj. 2012. Mechanisms of Postural Tachycardia Syndrome. , 521-523.
CrossRef4
David Robertson. 2012. Orthostatic Hypertension. , 363-365.
CrossRef5
Maureen K. Hahn. 2012. Antidepressant-Sensitive Norepinephrine Transporters. , 49-50.
CrossRef6
Julian Stewart. 2012. Symptoms and Signs of Postural Tachycardia Syndrome (POTS). , 525-528.
CrossRef7
Christopher J. Mathias, David A. Low, Valeria Iodice, Andrew P. Owens, Mojca Kirbis, Rodney Grahame. (2011) Postural tachycardia syndrome—current experience and concepts. Nature Reviews Neurology
CrossRef8
Joanne L. Thanavaro, Kristin L. Thanavaro. (2011) Postural orthostatic tachycardia syndrome: Diagnosis and treatment. Heart & Lung: The Journal of Acute and Critical Care 40:6, 554-560
CrossRef9
Agnieszka Wieclawek, Helena Slawska, Urszula Mazurek. (2011) ADRB1 as a Potential Target for Gene Therapy of Pregnancy Induced Hypertension and Gestational Diabetes Mellitus. Clinical and Experimental Hypertension 33:6, 422-426
CrossRef10
Christoph Schroeder, Jens Jordan. (2011) Norepinephrine uptake mechanisms in cardiovascular disease deserve our attention. Journal of Cardiovascular Pharmacology1
CrossRef11
Jennie Taylor, Howard P. Goodkin. (2011) Dizziness and Vertigo in the Adolescent. Otolaryngologic Clinics of North America 44:2, 309-321
CrossRef12
Koichi Mizumaki. (2011) Postural Orthostatic Tachycardia Syndrome (POTS). Journal of Arrhythmia 27:4, 289-306
CrossRef13
Branislava Ivanovic, Dragan Dincic, Marijana Tadic, Dragan Simic. (2011) Arterial hypertension in the elderly. Vojnosanitetski pregled 68:9, 779-785
CrossRef14
David S. Goldstein. (2010) Catecholamines 101. Clinical Autonomic Research 20:6, 331-352
CrossRef15
David S. Goldstein. (2010) Neurocardiology: Therapeutic Implications for Cardiovascular Disease. Cardiovascular Therapeuticsno-no
CrossRef16
Qi Fu, Tiffany B. VanGundy, M. Melyn Galbreath, Shigeki Shibata, Manish Jain, Jeffrey L. Hastings, Paul S. Bhella, Benjamin D. Levine. (2010) Cardiac Origins of the Postural Orthostatic Tachycardia Syndrome. Journal of the American College of Cardiology 55:25, 2858-2868
CrossRef17
2010. Biomarkers and Surrogate Markers in Drug Development. , 101-166.
CrossRef18
Lauren K Parker, Julia A Shanks, James AG Kennard, Keith L Brain. (2010) Dynamic monitoring of NET activity in mature murine sympathetic terminals using a fluorescent substrate. British Journal of Pharmacology 159:4, 797-807
CrossRef19
Jonathan N. Johnson, Kenneth J. Mack, Nancy L. Kuntz, Chad K. Brands, Coburn J. Porter, Philip R. Fischer. (2010) Postural Orthostatic Tachycardia Syndrome: A Clinical Review. Pediatric Neurology 42:2, 77-85
CrossRef20
Maureen K. Hahn, Angela Steele, R. Steven Couch, Mark A. Stein, Jessica J. Krueger. (2009) Novel and functional norepinephrine transporter protein variants identified in attention-deficit hyperactivity disorder. Neuropharmacology 57:7-8, 694-701
CrossRef21
Brett A. English, Maureen K. Hahn, Ian R. Gizer, Michelle Mazei-Robison, Angela Steele, Daniel M. Kurnik, Mark A. Stein, Irwin D. Waldman, Randy D. Blakely. (2009) Choline transporter gene variation is associated with attention-deficit hyperactivity disorder. Journal of Neurodevelopmental Disorders 1:4, 252-263
CrossRef22
Javier Bordas Guijarro, María Antonia Domínguez Ponce, Antonio Vázquez Foncubierta, Alonso Pedrote, Rocío Chaves Barroso, Rocío Álvarez López. (2009) Síndrome de taquicardia postural ortostática. Revista Española de Geriatría y Gerontología 44:6, 356-357
CrossRef23
Raffaello Furlan, Franca Barbic, Francesco Casella, Giorgio Severgnini, Luca Zenoni, Angelo Mercieri, Ruggero Mangili, Giorgio Costantino, Alberto Porta. (2009) Neural autonomic control in orthostatic intolerance. Respiratory Physiology & Neurobiology 169, S17-S20
CrossRef24
Xiao-han Fan, Yi-bo Wang, Hu Wang, Kai Sun, Wei-li Zhang, Xiao-dong Song, Jing-zhou Cheng, Hai-ying Wu, Xiang-liang Zhou, Ru-tai Hui. (2009) Polymorphisms of angiotensin-converting enzyme (ACE) and ACE2 are not associated with orthostatic blood pressure dysregulation in hypertensive patients. Acta Pharmacologica Sinica 30:9, 1237-1244
CrossRef25
Alex D.H. Brown, David A. Barton, Gavin W. Lambert. (2009) Cardiovascular Abnormalities in Patients with Major Depressive Disorder. CNS Drugs 23:7, 583-602
CrossRef26
S. Carew, J. Cooke, M. O'Connor, T. Donnelly, A. Costelloe, C. Sheehy, D. Lyons. (2009) What is the optimal duration of tilt testing for the assessment of patients with suspected postural tachycardia syndrome?. Europace 11:5, 635-637
CrossRef27
Douglas E Crompton, Samuel F Berkovic. (2009) The borderland of epilepsy: clinical and molecular features of phenomena that mimic epileptic seizures. The Lancet Neurology 8:4, 370-381
CrossRef28
Louis H. Weimer, Pezhman Zadeh. (2009) Neurological Aspects of Syncope and Orthostatic Intolerance. Medical Clinics of North America 93:2, 427-449
CrossRef29
Hidetaka Tanaka, Yukihiko Fujita, Yoshito Takenaka, Souhei Kajiwara, Satoshi Masutani, Yuko Ishizaki, Reiko Matsushima, Hirosato Shiokawa, Madoka Shiota, Nobuo Ishitani, Mitsugu Kajiura, Kazuo Honda, . (2009) Japanese clinical guidelines for juvenile orthostatic dysregulation version 1. Pediatrics International 51:1, 169-179
CrossRef30
Siddhartha S. Ghosh, Richard J. Krieg, Domenic A. Sica, Ruipeng Wang, Itaf Fakhry, Todd Gehr. (2009) Cardiac hypertrophy in neonatal nephrectomized rats: the role of the sympathetic nervous system. Pediatric Nephrology 24:2, 367-377
CrossRef31
Ahmad Daas, Aviva Mimouni-Bloch, Shlomit Rosenthal, Avinoam Shuper. (2009) Familial Vasovagal Syncope Associated With Migraine. Pediatric Neurology 40:1, 27-30
CrossRef32
S. Carew, M. O. Connor, J. Cooke, R. Conway, C. Sheehy, A. Costelloe, D. Lyons. (2008) A review of postural orthostatic tachycardia syndrome. Europace 11:1, 18-25
CrossRef33
Yejun Zhao, Lena Sun. (2008) Antidepressants modulate the in vitro inhibitory effects of propofol and ketamine on norepinephrine and serotonin transporter function. Journal of Clinical Neuroscience 15:11, 1264-1269
CrossRef34
Malgorzata Lelonek, Jan Henryk Goch. (2008) Treatment questions in POTS with hypertension and syncope. Central European Journal of Medicine 3:3, 361-364
CrossRef35
Mintu P. Turakhia, Blair P. Grubb, Gabriel Gregoratos. (2008) The irritable heart. Journal of Hospital Medicine 3:5, 423-429
CrossRef36
Matthäus Willeit, Harald H Sitte, Nikolaus Thierry, Klaus Michalek, Nicole Praschak-Rieder, Peter Zill, Dietmar Winkler, Werner Brannath, Michael B Fischer, Brigitta Bondy, Siegfried Kasper, Ernst A Singer. (2008) Enhanced Serotonin Transporter Function during Depression in Seasonal Affective Disorder. Neuropsychopharmacology 33:7, 1503-1513
CrossRef37
Chun-Hyung Kim, Irwin D. Waldman, Randy D. Blakely, Kwang-Soo Kim. (2008) Functional Gene Variation in the Human Norepinephrine Transporter. Annals of the New York Academy of Sciences 1129:1, 256-260
CrossRef38
Vegard Bruun Wyller, J. Philip Saul, Lars Walløe, Erik Thaulow. (2008) Sympathetic cardiovascular control during orthostatic stress and isometric exercise in adolescent chronic fatigue syndrome. European Journal of Applied Physiology 102:6, 623-632
CrossRef39
Yasushi Kiyono, Taku Sugita, Masashi Ueda, Hidekazu Kawashima, Naoki Kanegawa, Yuji Kuge, Yasuhisa Fujibayashi, Hideo Saji. (2008) Evaluation of radioiodinated (2S,αS)-2-(α-(2-iodophenoxy)benzyl)morpholine as a radioligand for imaging of norepinephrine transporter in the heart. Nuclear Medicine and Biology 35:2, 213-218
CrossRef40
Andrea Muck, Ralf Gilsbach, Sandra Löbbe-Werner, Michael Brüss, Heinz Bönisch. (2007) Molecular cloning and functional expression of the murine noradrenaline transporter. Naunyn-Schmiedeberg's Archives of Pharmacology 376:1-2, 65-71
CrossRef41
David A Barton, Tye Dawood, Elisabeth A Lambert, Murray D Esler, Deepak Haikerwal, Celia Brenchley, Florentia Socratous, David M Kaye, Markus P Schlaich, Ian Hickie, Gavin W Lambert. (2007) Sympathetic activity in major depressive disorder: identifying those at increased cardiac risk?. Journal of Hypertension 25:10, 2117-2124
CrossRef42
J. D. Pandian, K. Dalton, R. D. Henderson, P. A. McCombe. (2007) Postural orthostatic tachycardia syndrome: an underrecognized disorder. Internal Medicine Journal 37:8, 529-535
CrossRef43
Martin Novotny, Veronika Quaiserová-Mocko, Erica A. Wehrwein, David L. Kreulen, Greg M. Swain. (2007) Determination of endogenous norepinephrine levels in different chambers of the rat heart by capillary electrophoresis coupled with amperometric detection. Journal of Neuroscience Methods 163:1, 52-59
CrossRef44
Andrea Dlugos, Christine Freitag, Christa Hohoff, Jennifer McDonald, Edwin H. Cook, Jürgen Deckert, Harriet de Wit. (2007) Norepinephrine Transporter Gene Variation Modulates Acute Response to d-Amphetamine. Biological Psychiatry 61:11, 1296-1305
CrossRef45
Jia Hu, Katherine Leitzell, Dan Wang, Michael W. Quick. 2007. Neurotransmitter Transporters. .
CrossRef46
Marvin S. Medow, Julian M. Stewart. (2007) The Postural Tachycardia Syndrome. Cardiology in Review 15:2, 67-75
CrossRef47
Birgit Adam, Tobias Liebregts, Gerald Holtmann. (2007) Mechanisms of Disease: genetics of functional gastrointestinal disorders—searching the genes that matter. Nature Clinical Practice Gastroenterology & Hepatology 4:2, 102-110
CrossRef48
Maureen K. Hahn, Randy D. Blakely. (2007) The Functional Impact of SLC6 Transporter Genetic Variation. Annual Review of Pharmacology and Toxicology 47:1, 401-441
CrossRef49
Uhna Sung, Randy D. Blakely. (2007) Calcium-dependent interactions of the human norepinephrine transporter with syntaxin 1A. Molecular and Cellular Neuroscience 34:2, 251-260
CrossRef50
Matthew D. McEvoy, Phillip A. Low, Latha Hebbar. (2007) Postural Orthostatic Tachycardia Syndrome: Anesthetic Implications in the Obstetric Patient. Anesthesia & Analgesia 104:1, 166-167
CrossRef51
David S. Goldstein, Graeme Eisenhofer, Irwin J. Kopin. (2006) Clinical Catecholamine Neurochemistry: A Legacy of Julius Axelrod. Cellular and Molecular Neurobiology 26:4-6, 693-700
CrossRef52
E. Carvajal Roca, I. Torró Doménech, E. Lurbe Ferrer. (2006) Hipertensión arterial episódica asociada al síndrome de taquicardia postural ortostática. Anales de Pediatría 65:5, 496-499
CrossRef53
Wolfgang Singer, Tonette L. Opfer-Gehrking, Kim K. Nickander, Stacy M. Hines, Phillip A. Low. (2006) Acetylcholinesterase Inhibition in Patients With Orthostatic Intolerance. Journal of Clinical Neurophysiology 23:5, 477-482
CrossRef54
Joshua Fessel, David Robertson. (2006) Orthostatic hypertension: when pressor reflexes overcompensate. Nature Clinical Practice Nephrology 2:8, 424-431
CrossRef55
Christoph Schroeder, Andreas L. Birkenfeld, Antje F. Mayer, Jens Tank, Andre Diedrich, Friedrich C. Luft, Jens Jordan. (2006) Norepinephrine Transporter Inhibition Prevents Tilt-Induced Pre-Syncope. Journal of the American College of Cardiology 48:3, 516-522
CrossRef56
Beth A. Habecker, Breanne D. Willison, Xiao Shi, William R. Woodward. (2006) Chronic depolarization stimulates norepinephrine transporter expression via catecholamines. Journal of Neurochemistry 97:4, 1044-1051
CrossRef57
Nancy R Keller, David Robertson. (2006) Familial orthostatic tachycardia. Current Opinion in Cardiology 21:3, 173-179
CrossRef58
Ehab A Eltahawy, Blair P Grubb. (2006) Neurocardiogenic syncope: mechanisms, evaluation and treatment. Future Cardiology 2:3, 325-334
CrossRef59
R. Gilsbach, A. Faron-Gorecka, Z. Rogoz, M. Bruss, M. G. Caron, M. Dziedzicka-Wasylewska, H. Bonisch. (2006) Norepinephrine transporter knockout-induced up-regulation of brain alpha2A/C-adrenergic receptors. Journal of Neurochemistry 96:4, 1111-1120
CrossRef60
Colin F. Spraggs, Sreekumar G. Pillai, David Dow, Christal Douglas, Linda McCarthy, Penelope K. Manasco, Michael Stubbins, Allen D. Roses. (2005) Pharmacogenetics and obesity: common gene variants influence weight loss response of the norepinephrine/dopamine transporter inhibitor GW320659 in obese subjects. Pharmacogenetics and Genomics 15:12, 883-889
CrossRef61
Michelle S. Mazei-Robison, Randy D. Blakely. (2005) Expression studies of naturally occurring human dopamine transporter variants identifies a novel state of transporter inactivation associated with Val382Ala. Neuropharmacology 49:6, 737-749
CrossRef62
Robert Winker, Emily M. Garland, Hugo W. R??diger, Andr?? Diedrich, Italo Biaggioni, Ivo Ponocny, Ingolf Cascorbi, David Robertson. (2005) Influence of an Insertion Variant in the 5???UTR of the Endothelin-1 Gene on Orthostatic Intolerance. The American Journal of the Medical Sciences 330:4, 166-171
CrossRef63
ROLF R. DIEHL. (2005) Continuous Progression of Orthostatic Tachycardia as a Further Feature of the Postural Tachycardia Syndrome. Pacing and Clinical Electrophysiology 28:9, 975-979
CrossRef64
Uhna Sung, Jennifer L. Jennings, Andrew J. Link, Randy D. Blakely. (2005) Proteomic analysis of human norepinephrine transporter complexes reveals associations with protein phosphatase 2A anchoring subunit and 14-3-3 proteins. Biochemical and Biophysical Research Communications 333:3, 671-678
CrossRef65
Sophie Digeos-Hasnier, Xavier Copie, Olivier Paziaud, Eric Abergel, Louis Guize, Benoit Diebold, Xavier Jeunemaitre, Alain Berrebi, Olivier Piot, Thomas Lavergne, Jean-Yves Le Heuzey. (2005) Abnormalities of Ventricular Repolarization in Mitral Valve Prolapse. Annals of Noninvasive Electrocardiology 10:3, 297-304
CrossRef66
Kim K. Nickander, Paula J. Carlson, Raul A. Urrutia, Michael Camilleri, Phillip A. Low. (2005) A screen of candidate genes and influence of β2-adrenergic receptor genotypes in postural tachycardia syndrome. Autonomic Neuroscience 120:1-2, 97-103
CrossRef67
KATHRYN A. GLATTER, DIPIKA TUTEJA, NIPAVAN CHIAMVIMONVAT, MOHAMED HAMDAN, JEANNY K. PARK. (2005) Pregnancy in Postural Orthostatic Tachycardia Syndrome. Pacing and Clinical Electrophysiology 28:6, 591-593
CrossRef68
Amer Al-Shekhlee, Judah R. Lindenberg, Rami N. Hachwi, Thomas C. Chelimsky. (2005) The value of autonomic testing in postural tachycardia syndrome. Clinical Autonomic Research 15:3, 219-222
CrossRef69
Andreas L. Birkenfeld, Christoph Schroeder, Tobias Pischon, Jens Tank, Friedrich C. Luft, Arya M. Sharma, Jens Jordan. (2005) Paradoxical effect of sibutramine on autonomic cardiovascular regulation in obese hypertensive patients. Clinical Autonomic Research 15:3, 200-206
CrossRef70
Shamil Yusuf, A. John Camm. (2005) Deciphering the sinus tachycardias. Clinical Cardiology 28:6, 267-276
CrossRef71
R. Winker, A. Barth, E. Valic, R. Maier, W. Osterode, A. Pilger, H. W. R
diger. (2005) Functional adrenergic receptor polymorphisms and idiopathic orthostatic intolerance. International Archives of Occupational and Environmental Health 78:3, 171-177
CrossRef72
J.N. Mason, H. Farmer, I.D. Tomlinson, J.W. Schwartz, V. Savchenko, L.J. DeFelice, S.J. Rosenthal, R.D. Blakely. (2005) Novel fluorescence-based approaches for the study of biogenic amine transporter localization, activity, and regulation. Journal of Neuroscience Methods 143:1, 3-25
CrossRef73
Julia L. Newton, Simon Kerr, Jessie Pairman, Andrew McLaren, Michael Norton, Rose Anne Kenny, Christopher M. Morris. (2005) Familial neurocardiogenic (vasovagal) syncope. American Journal of Medical Genetics Part A 133A:2, 176-179
CrossRef74
Peter R. Bieck, William Z. Potter. (2005) BIOMARKERS IN PSYCHOTROPIC DRUG DEVELOPMENT: Integration of Data across Multiple Domains. Annual Review of Pharmacology and Toxicology 45:1, 227-246
CrossRef75
Shamil Yusuf, A John Camm. (2005) The sinus tachycardias. Nature Clinical Practice Cardiovascular Medicine 2:1, 44-52
CrossRef76
T OELTMANN, R CARSON, J SHANNON, T KETCH, D ROBERTSON. (2004) Assessment of -methylated catecholamine levels in plasma and urine for diagnosis of autonomic disorders. Autonomic Neuroscience 116:1-2, 1-10
CrossRef77
Haley E. Melikian. (2004) Neurotransmitter transporter trafficking: endocytosis, recycling, and regulation. Pharmacology & Therapeutics 104:1, 17-27
CrossRef78
Christopher J. Mathias. (2004) Role of autonomic evaluation in the diagnosis and management of syncope. Clinical Autonomic Research 14:S1, i45-i54
CrossRef79
Daniela Lucini, Raffaello Furlan, Paolo Villa, Rogelio Mosqueda-Garcia, Andre Diedrich, David Robertson, Alberto Malliani, Alberto Porta, Massimo Pagani. (2004) Altered profile of baroreflex and autonomic responses to lower body negative pressure in chronic orthostatic intolerance. Journal of Hypertension 22:8, 1535-1542
CrossRef80
DAVID S. GOLDSTEIN. (2004) Functional Neuroimaging of Sympathetic Innervation of the Heart. Annals of the New York Academy of Sciences 1018:1, 231-243
CrossRef81
Amlan Basu, Eva Tsapakis, Kathy Aitchison. (2004) Pharmacogenetics and Psychiatry. Current Psychiatry Reports 6:2, 134-142
CrossRef82
Abhijit Chaudhuri, Peter O Behan. (2004) Fatigue in neurological disorders. The Lancet 363:9413, 978-988
CrossRef83
Yasushi Kiyono, Naoki Kanegawa, Hidekazu Kawashima, Yoji Kitamura, Yasuhiko Iida, Hideo Saji. (2004) Evaluation of radioiodinated (R)-N-methyl-3-(2-iodophenoxy)-3-phenylpropanamine as a ligand for brain norepinephrine transporter imaging. Nuclear Medicine and Biology 31:2, 147-153
CrossRef84
Aurelio Galli, Randy D. Blakely, Louis J. DeFelice. 2004. Neurotransmitter Transporters. , 37-40.
CrossRef85
Phillip C. Usera, Simi Vincent, David Robertson. (2004) Human phenotypes and animal knockout models of genetic autonomic disorders. Journal of Biomedical Science 11:1, 4-10
CrossRef86
Valentina Savchenko, Uhna Sung, Randy D Blakely. (2003) Cell surface trafficking of the antidepressant-sensitive norepinephrine transporter revealed with an ectodomain antibody. Molecular and Cellular Neuroscience 24:4, 1131-1150
CrossRef87
Noriyuki Tokunaga, Toji Yamazaki, Tsuyoshi Akiyama, Shunji Sano, Hidezo Mori. (2003) In vivo monitoring of norepinephrine and its metabolites in skeletal muscle. Neurochemistry International 43:6, 573-580
CrossRef88
Yasushi Kiyono, Naoki Kanegawa, Hidekazu Kawashima, Hiromi Fujiwara, Yasuhiko Iida, Hiroshi Nishimura, Hideo Saji. (2003) A new norepinephrine transporter imaging agent for cardiac sympathetic nervous function imaging: radioiodinated (R)-N-methyl-3-(2-iodophenoxy)-3-phenylpropanamine. Nuclear Medicine and Biology 30:7, 697-706
CrossRef89
RANA OLGUNTURK, L. TURAN, F.S. TUNAOGLU, S. KULA, N. GOKCORA, N.I. KARABACAK, F. AZIZOGLU. (2003) Abnormality of the Left Ventricular Sympathetic Nervous Function Assessed by I-123 Metaiodobenzylguanidine Imaging in Pediatric Patients with Neurocardiogenic Syncope. Pacing and Clinical Electrophysiology 26:10, 1926-1930
CrossRef90
Charles E Glatt, Victor I Reus. (2003) Pharmacogenetics of monoamine transporters. Pharmacogenomics 4:5, 571-582
CrossRef91
M. Yousuf Kanjwal, Daniel J. Kosinski, Blair P. Grubb. (2003) Treatment of postural orthostatic tachycardia syndrome and inappropriate sinus tachycardia. Current Cardiology Reports 5:5, 402-406
CrossRef92
YOUSUF KANJWAL, DAN KOSINSKI, BLAIR P. GRUBB. (2003) The Postural Orthostatic Tachycardia Syndrome:. Definitions, Diagnosis, and Management. Pacing and Clinical Electrophysiology 26:8, 1747-1757
CrossRef93
Sonhae Cho, Chun-Hyung Kim, Joseph F. Cubells, Cyrus P. Zabetian, Dong-Youn Hwang, Jang-Woo Kim, Bruce M. Cohen, Italo Biaggioni, David Robertson, Kwang-Soo Kim. (2003) Variations in the dopamine ?-hydroxylase gene are not associated with the autonomic disorders, pure autonomic failure, or multiple system atrophy. American Journal of Medical Genetics 120A:2, 234-236
CrossRef94
Louis H. Weimer, Olajide Williams. (2003) Syncope and orthostatic intolerance. Medical Clinics of North America 87:4, 835-865
CrossRef95
Phillip A. Low, Steven Vernino, Guillermo Suarez. (2003) Autonomic dysfunction in peripheral nerve disease. Muscle & Nerve 27:6, 646-661
CrossRef96
Italo Biaggioni. (2003) Sympathetic control of the circulation in hypertension: lessons from autonomic disorders. Current Opinion in Nephrology and Hypertension 12:2, 175-180
CrossRef97
Sabine Ivancsits, Arthur Heider, Hugo W. R??diger, Robert Winker. (2003) Orthostatic Intolerance Is Not Necessarily Related to a Specific Mutation (Ala457Pro) in the Human Norepinephrine Transporter Gene. The American Journal of the Medical Sciences 325:2, 63-65
CrossRef98
David L. Kreulen. (2003) Properties of the Venous and Arterial Innervation in the Mesentery. Journal of Smooth Muscle Research 39:6, 269-279
CrossRef99
Koh ONO, Yoshitaka IWANAGA, Toshifumi MANNAMI, Yoshihiro KOKUBO, Hitonobu TOMOIKE, Kazuo KOMAMURA, Keisuke SHIOJI, Naomi YASUI, Naomi TAGO, Naoharu IWAI. (2003) Epidemiological Evidence of an Association between SLC6A2 Gene Polymorphism and Hypertension. Hypertension Research 26:9, 685-689
CrossRef100
P.G. Sand, T. Mori, C. Godau, G. Stöber, P. Flachenecker, P. Franke, M.M. Nöthen, J. Fritze, W. Maier, K.-P. Lesch. (2002) Norepinephrine transporter gene (NET) variants in patients with panic disorder. Neuroscience Letters 333:1, 41-44
CrossRef101
EMILY M. GARLAND, MAUREEN K. HAHN, TERRY P. KETCH, NANCY R. KELLER, CHUN-HYUNG KIM, KWANG-SOO KIM, ITALO BIAGGIONI, JOHN R. SHANNON, RANDY D. BLAKELY, DAVID ROBERTSON. (2002) Genetic Basis of Clinical Catecholamine Disorders. Annals of the New York Academy of Sciences 971:1, 506-514
CrossRef102
ROBERT J. PARMER, OREN ZINDER. (2002) Catecholaminergic Pathways, Chromaffin Cells, and Human Disease. Annals of the New York Academy of Sciences 971:1, 497-505
CrossRef103
Thomas G. Pickering. (2002) Orthostatic Intolerance. The Journal of Clinical Hypertension 4:4, 306-308
CrossRef104
Horacio Kaufmann, Kirsty Bhattacharya. (2002) Diagnosis and Treatment of Neurally Mediated Syncope. The Neurologist 8:3, 175-185
CrossRef105
Yasuharu Tabara, Katsuhiko Kohara, Tetsuro Miki. (2002) Polymorphisms of genes encoding components of the sympathetic nervous system but not the renin–angiotensin system as risk factors for orthostatic hypotension. Journal of Hypertension 20:4, 651-656
CrossRef106
Lankupalle D Jayanthi, Gricelly Vargas, Louis J DeFelice. (2002) Characterization of cocaine and antidepressant-sensitive norepinephrine transporters in rat placental trophoblasts. British Journal of Pharmacology 135:8, 1927-1934
CrossRef107
Filip Paczkowski, Heinz Bonisch, Lesley Bryan-Lluka. (2002) Pharmacogenetics 12:2, 165-173
CrossRef108
ANTONIO G. HERMOSILLO, MANLIO F. M??RQUEZ, KATHRINE J??UREGUI-RENAUD, MANUEL C??RDENAS. (2001) Orthostatic Hypotension, 2001. Cardiology in Review 9:6, 339-347
CrossRef109
Nancy R Zahniser, Suzanne Doolen. (2001) Chronic and acute regulation of Na+/Cl–-dependent neurotransmitter transporters: drugs, substrates, presynaptic receptors, and signaling systems. Pharmacology & Therapeutics 92:1, 21-55
CrossRef110
R Furlan. (2001) Orthostatic intolerance: different abnormalities in the neural sympathetic response to a gravitational stimulus. Autonomic Neuroscience 90:1-2, 83-88
CrossRef111
D. Robertson, J.R. Shannon, J. Jordan, T.L. Davis, A. Diedrich, G. Jacob, E. Garland, T. Tellioglu, I. Biaggioni. (2001) Multiple system atrophy: new developments in pathophysiology and therapy. Parkinsonism & Related Disorders 7:3, 257-260
CrossRef112
Graeme Eisenhofer. (2001) The role of neuronal and extraneuronal plasma membrane transporters in the inactivation of peripheral catecholamines. Pharmacology & Therapeutics 91:1, 35-62
CrossRef113
T Tellioglu. (2001) Orthostatic Intolerance in Behcet's Disease. Autonomic Neuroscience 89:1-2, 96-99
CrossRef114
DAVID ROBERTSON, NANCY FLATTEM, TAHIR TELLIOGLU, ROBERT CARSON, EMILY GARLAND, JOHN R. SHANNON, JENS JORDAN, GIRIS JACOB, RANDY D. BLAKELY, ITALO BIAGGIONI. (2001) Familial Orthostatic Tachycardia Due to Norepinephrine Transporter Deficiency. Annals of the New York Academy of Sciences 940:1, 527-544
CrossRef115
RONALD SCHONDORF, JULIE BENOIT, REUBEN STEIN. (2001) Cerebral Autoregulation in Orthostatic Intolerance. Annals of the New York Academy of Sciences 940:1, 514-526
CrossRef116
Blair P. Grubb, Daniel J. Kosinski. (2001) Syncope Resulting from Autonomic Insufficiency Syndromes Associated with Orthostatic Intolerance. Medical Clinics of North America 85:2, 457-472
CrossRef117
Mark P. M. Harms, Johannes J. Lieshout. (2001) Cerebrovascular and cardiovascular responses associated with orthostatic intolerance and tachycardia. Clinical Autonomic Research 11:1, 35-38
CrossRef118
H Tani. (2000) Splanchnic-mesenteric capacitance bed in the postural tachycardia syndrome (POTS). Autonomic Neuroscience 86:1-2, 107-113
CrossRef119
Jacob, Giris, Costa, Fernando, Shannon, John R., Robertson, Rose Marie, Wathen, Mark, Stein, Michael, Biaggioni, Italo, Ertl, Andy, Black, Bonnie, Robertson, David, . (2000) The Neuropathic Postural Tachycardia Syndrome. New England Journal of Medicine 343:14, 1008-1014
Full Text120
Abhijit Chaudhuri, Peter O Behan. (2000) Fatigue and basal ganglia. Journal of the Neurological Sciences 179:1-2, 34-42
CrossRef121
Abhijit Chaudhuri. (2000) Lactose intolerance and neuromuscular symptoms. The Lancet 356:9228, 510-511
CrossRef122
Randy D Blakely, Andrea L Bauman. (2000) Biogenic amine transporters: regulation in flux. Current Opinion in Neurobiology 10:3, 328-336
CrossRef123
Friedrich C. Luft. (2000) Molecular genetics of human hypertension. Current Opinion in Nephrology and Hypertension 9:3, 259-266
CrossRef124
Sally Schroeter, Subbu Apparsundaram, Ronald G. Wiley, Leeann H. Miner, Susan R. Sesack, Randy D. Blakely. (2000) Immunolocalization of the cocaine- and antidepressant-sensitive l-norepinephrine transporter. The Journal of Comparative Neurology 420:2, 211-232
CrossRef125
Yasmine S. Ali, Nicole Daamen, Giris Jacob, Jens Jordan, John R. Shannon, Italo Biaggioni, David Robertson. (2000) Orthostatic Intolerance: A Disorder of Young Women. Obstetrical & Gynecological Survey 55:4, 251-259
CrossRef
