Original Article
Brief Report
Paraneoplastic Cerebellar Ataxia Due to Autoantibodies against a Glutamate Receptor
N Engl J Med 2000; 342:21-27January 6, 2000
- Article
There are many types of cerebellar ataxia, including ataxia due to congenital or metabolic disorders and a paraneoplastic form in patients with gynecologic cancer, breast cancer, lung cancer, or Hodgkin's disease.1 This paraneoplastic syndrome is the only type of cerebellar ataxia associated with autoantibodies against neuronal antigens. Often, the neuronal antigens are aberrantly expressed by the tumor cells.2-4 The antineuronal autoantibodies are believed to cause cerebellar ataxia, but this is unproved.5,6 In Hodgkin's disease, the lymphoma precedes the ataxia by months to years in 80 percent of patients, and ataxia often occurs during a prolonged complete remission.4 Among patients with this type of ataxia, 30 percent have anti–Purkinje-cell antibodies, some of which have the features of the neuronal antibody anti-Tr.4,7
We identified a new autoantibody in two patients with severe cerebellar ataxia that developed while they were in remission from Hodgkin's disease. The antibody reacts specifically with the metabotropic glutamate receptor mGluR1 in mouse brain. Metabotropic glutamate receptors belong to a large family of cell-surface receptors that transmit signals into the cell by coupling to guanine nucleotide-binding proteins (G proteins) in the cytoplasm. Purified IgG from the serum of both patients blocked the glutamate-stimulated formation of inositol phosphates in Chinese-hamster-ovary (CHO) cells that expressed mGluR1α, and the injection of IgG from serum or cerebrospinal fluid into the cerebellar subarachnoid space of mice caused severe, reversible ataxia. These results indicate that antineuronal autoantibodies can cause disease of the central nervous system by blocking neuronal receptors.
Case Reports
Patient 1
In 1995, when she was 19 years old, Patient 1 presented with subacute cerebellar ataxia. She had been treated with four cycles of mechlorethamine, vincristine, procarbazine, and prednisone plus doxorubicin, bleomycin, and vinblastine (MOPP-ABV) followed by subtotal nodal irradiation for stage IIA nodular sclerosing Hodgkin's disease. She had been in remission for two years when truncal ataxia, intention tremor, and gait ataxia developed. An examination of the brain with magnetic resonance imaging (MRI) was normal. The cerebrospinal fluid contained 28 mononuclear cells per cubic millimeter and had a protein concentration of 28 mg per deciliter. The IgG concentrations in cerebrospinal fluid and serum were 4.6 mg per deciliter (normal value, <8) and 0.89 g per deciliter, respectively. The albumin concentrations in cerebrospinal fluid and serum were 17 mg per deciliter and 4.8 g per deciliter, respectively. The calculated IgG index was 1.2 (an IgG index of more than 0.6 indicates intrathecal IgG synthesis).8 Cytologic examination showed no malignant cells. Serum and cerebrospinal fluid contained IgG antineuronal antibodies of unknown specificity.9
These findings strongly suggested a diagnosis of paraneoplastic cerebellar ataxia. The patient was treated with four plasma exchanges at intervals of two to three days, oral prednisone at a dose of 40 mg per day for six weeks, and two courses of intravenous immune globulin (total dose, 4 mg per kilogram of body weight). After the four plasma exchanges, the cerebrospinal fluid was acellular and the IgG concentration was less than 1 mg per deciliter. Over the following seven months, the ataxia slowly disappeared. An examination of serum for antineuronal antibodies when the patient was asymptomatic was negative. The Hodgkin's disease has remained in remission.
Patient 2
In 1996, at the age of 49 years, Patient 2 presented with severe cerebellar ataxia and short-term memory loss. She had been treated for stage II Hodgkin's disease (nodular sclerosing type) nine years earlier with carmustine, cyclophosphamide, vinblastine, procarbazine, and prednisone (BCVPP) and had been in remission since then. She also had polycystic renal disease and had required hemodialysis since 1991. On neurologic examination she was alert and oriented. She could repeat four words, but her recall after five minutes was limited to two words. Comprehension and naming were normal. She spoke with moderate cerebellar dysarthria. Severe appendicular and truncal ataxia with titubation of the head and trunk were present. She could walk only with support from another person. MRI examinations of the brain when ataxia was diagnosed and six months later were normal and did not show cerebellar atrophy. The serum contained IgG antineuronal antibodies that stained the cerebellum in a pattern identical to that of serum from Patient 1.
One year after the onset of ataxia, the patient received a diagnosis of probable paraneoplastic ataxia and was treated with 14 plasma exchanges, but there was no objective improvement of the truncal ataxia and she remained unable to walk without support. In 1998, after the 14 plasma exchanges, the cerebrospinal fluid was acellular and had an IgG concentration of 15 mg per deciliter. The serum IgG concentration was 0.84 g per deciliter. The IgG index was 0.62. High titers of antineuronal antibodies persisted in serum and cerebrospinal fluid. Hodgkin's disease remained in complete remission.
Methods
Samples
We analyzed samples of serum and cerebrospinal fluid from 3060 patients that had been sent to us for antineuronal-antibody testing. Of the 3060 patients, 26 had histologically proved Hodgkin's disease, including Patients 1 and 2. IgG was purified from specimens that were obtained from the first plasma exchange of Patients 1 and 2 and from normal serum with protein A Sepharose. The purified IgG was dialyzed against phosphate-buffered saline containing 10 mM lithium chloride or artificial cerebrospinal fluid and used in assays for inositol phosphates or for in vivo transfer experiments. Frozen tumor tissues were provided by the pathology department of the Daniel den Hoed Cancer Center. We studied 10 samples of Hodgkin's tissue, including a lymph node from Patient 1, and 5 samples of non-Hodgkin's lymphoma.
Immunohistochemical Analysis
Normal C57BL/6 mice and mGluR1-deficient C57BL/6 mice10 were deeply anesthetized with pentobarbital and perfused through the heart with a fixative solution containing 4 percent paraformaldehyde, 0.2 percent picric acid, and 0.05 percent glutaraldehyde. Parasagittal sections (40 μm each) of brain from these mice were incubated overnight with a 1:1000 dilution of test serum or 0.5 μg of rabbit anti-mGluR1 G18 antibody per milliliter11 and were then incubated with biotinylated goat antihuman or antirabbit IgG (Vector). For confocal microscopy, sections underwent reaction with Texas red–avidin (Vector, Burlingame, Calif.) instead of avidin–biotin–peroxidase complex. To test for antineuronal antibodies, we incubated the 3060 samples of serum and cerebrospinal fluid with parasagittal frozen and acetone-fixed 6-μm sections of rat cerebellum and then with the addition of fluorescein-isothiocyanate–labeled goat antihuman IgG (Dako, Glostrup, the Netherlands). Anti–Purkinje-cell antibodies were classified as anti-Yo when reactive with the paraneoplastic Yo62 antigen, as anti-Tr when an additional characteristic dotted staining pattern was present in the cerebellar molecular layer, or as of unknown specificity.9
Cell Labeling and Assay for Inositol Phosphates
Live CHO cells that expressed the mGluR1 isoform mGluR1α or the closely related receptor subtype mGluR5a were incubated in culture medium12 with 1:1000 dilution of each patient's serum for one hour. After being washed with phosphate-buffered saline, the cells were fixed with 4 percent paraformaldehyde for 10 minutes, and serum antibodies that bound to the cells were detected by staining with fluorescent-labeled antihuman IgG (Vector). For measurement of the formation of inositol phosphates, the receptor-expressing CHO cells were labeled with [3H]inositol (1 μCi per milliliter) for 24 hours as described previously.11
The amino-terminal extracellular domain of mGluR1 is involved in glutamate binding.13 Antibodies raised against mGluR1 amino-terminal sequences inhibit the glutamate-stimulated formation of inositol phosphates in mGluR1α-expressing cells.11 With this system, we assessed the effects of purified IgG on the activation of mGluR1 by analyzing the glutamate-stimulated formation of inositol phosphates in CHO cells that expressed mGluR1α. After we incubated the cells with phosphate-buffered saline for 20 minutes, we incubated them with phosphate-buffered saline that contained 10 mM lithium chloride in the absence or presence of the patient's purified IgG for 20 minutes at 37°C. Agonist stimulation was started by adding glutamate to a final concentration of 15 μM; this caused an increase in the levels of inositol phosphates by a factor of two to three.11 After incubation for 20 minutes at 37°C, the reaction was terminated by 5 percent trichloroacetic acid (wt/vol). [3H]Inositol phosphates (IP1, IP2, and IP3) were separated by AG1-X8 chromatography (Bio-Rad, Hercules, Calif.), and the radioactivity was determined on a liquid scintillation spectrometer.
Absorption Experiments
The patient's IgG was incubated with mGluR1α- or mGluR5a-expressing CHO cells (1×108 cells per milligram of IgG) in phosphate-buffered saline for one hour. After centrifugation, IgG that remained in the supernatant was purified again with protein A and dialyzed against artificial cerebrospinal fluid. Successful absorption of the anti-mGluR1 antibodies with mGluR1α-expressing CHO cells was confirmed by immunohistochemical assay, CHO-cell labeling, and assay for inositol phosphates with the use of the mGluR1α-expressing CHO cells as described above. When the same assays were used, absorption with mGluR5a did not reduce the ability of the anti-mGluR1 antibodies to bind to mGluR1α.
Transfer Experiments
A catheter was placed in the cisterna magna of C57BL/6 mice after they had received general anesthesia.14 At least 24 hours later, artificial cerebrospinal fluid containing IgG either from the patient or from normal serum (20 μl [0.1 to 20 mg per milliliter]) was injected through the catheter over a period of 30 minutes. Footprints were made with ink applied to the hind paws of mice one hour after injection. For the rotorod test, animals were trained before injection. All animals managed to stay on a rod that was rolling at 20 rpm for longer than 60 seconds after several trials. Thirty minutes and every hour after the injection of IgG, each animal was tested in five trials, and the average time it remained on the rod was determined. The maximal time allowed was 60 seconds. In some experiments, aniline blue dye was injected concurrently to confirm the delivery of injected materials. For visualizing the penetration of human IgG into the cerebellum, the mice were perfused with the fixative solution 5 to 12 hours after injection, and transverse sections through the cerebellum were immunostained as described above with antihuman IgG primary antibody (Dako).
Expression of mGluR1 in Tumor Samples
Frozen sections (5 μm each) from Hodgkin's and non-Hodgkin's lymphoma tissues were fixed in acetone and then incubated with biotinylated IgG from Patients 1 and 2 and normal human serum or with G18. We extracted RNA from the same tumors using the triple-extract reagent (Tri-Reagent, MRC, Cincinnati) followed by reverse transcription. For reverse transcriptase–polymerase chain reaction (RT-PCR), we used three primer sets specific to both intracellular and extracellular coding sequences of mGluR1: primer set 1: 5'TCTGGGGTGCATGTTCACTCC3' and 5'AGGCCGTCTCATTGGTCTTCA3'; primer set 2: 5'CGAGAAAGTGCCCGAGAG3' and 5'GTGGCTGAATAAGCGATCTG3'; and primer set 3: 5'TGAAGGCATAGTAGGTACAG3' and 5'GAGTGGAGCAACATCGAAT3'. The primers used for our positive control glyceraldehyde-3-phosphate dehydrogenase were 5'CCGAGCCACATCTGCTCAGACAC3' and 5'GGCCATCCACAGTCTTCTGGGT3'.
Results
Samples of serum and cerebrospinal fluid from both patients had similar, specific immunohistochemical staining patterns on sections of mouse brain (Figure 1AFigure 1
Immunohistochemical Analysis of Sections of Mouse Brain with Serum from Patients 1 and 2. and Figure 1E). Purkinje-cell bodies were strongly stained (Figure 1C), and distinctive punctate staining, compatible with labeling of the Purkinje-cell spines, was observed in the molecular layer of the cerebellum (Figure 1D). Strong staining of neurons and neuropil was also observed in the glomeruli of the olfactory bulb, the olfactory tubercle (including the islands of Calleja), the superficial layer of the cerebral cortex, the CA3 area of the hippocampus, the thalamus, the super-ior colliculus, and the spinal trigeminal nucleus. The immunohistochemical staining pattern appeared to be similar to the distribution of the metabotropic glutamate receptor mGluR1 (Figure 1F).15,16 To test whether these antibodies were indeed directed against mGluR1, we incubated the patients' serum and cerebrospinal fluid with sections obtained from mGluR1-knockout mice (Figure 1B).10 These sections were not stained by either the serum or the cerebrospinal fluid (data not shown).To confirm the specificity of the reactivity of the serum with native mGluR1 proteins, we incubated living CHO cells that expressed rat mGluR1α12 or mGluR5a17 with serum from both patients. The two serum samples strongly labeled CHO cells that expressed mGluR1α but not cells that expressed mGluR5a (Figure 2AFigure 2
Functional Blocking of the mGluR1 Receptor by Autoantibodies., 2B, 2C, and 2D). The reactivity of the patients' IgG and cerebrospinal fluid with CHO cells that expressed human mGluR1 and with human cerebellar sections was also demonstrated (data not shown). These results indicate that IgG from both patients reacted specifically with the amino-terminal extracellular domain of native mGluR1α. Inhibition of the activation of mGluR1α in a dose-dependent manner was also found with the IgG from each of the patients (Figure 2E). The mean (±SE) concentrations of IgG that caused 50 percent inhibition of the activation of mGluR1α (IC50) for IgG from Patient 1 and Patient 2 were 58±9 and 194±36 μg per milliliter, respectively. Normal human IgG had no effect. IgG from the two patients did not block the activation of mGluR5a, a finding that indicates its specificity.We then examined the pathogenicity of the anti-mGluR1 autoantibodies by injecting purified IgG from the two patients (400 μg; 20 μl [20 mg per milliliter]) into the subarachnoid space of normal mice, near the cerebellum. Thirty minutes after the injection, the mice became increasingly ataxic, with a wide gait (Figure 3AFigure 3
Impaired Motor Coordination Resulting from the Passive Transfer of IgG from Two Patients into the Cerebellar Subarachnoid Space of Mice.). They were unable to walk a straight line, and the distance between their steps was small and irregular, an indication of cerebellar dysfunction.18 At the peak of the symptoms, the most strongly affected mice could hardly walk or stand up because of severe truncal ataxia. As assessed by the rotorod test, the ataxic behavior peaked at about 2 to 4 hours after injection of IgG and subsided after 24 hours (Figure 3B). Significant effects on the behavior of the mice (P<0.05) could be detected with as little as 10 μg of IgG (20 μl [0.5 mg per milliliter]) from Patient 1, whereas no effects were detected with normal human IgG (20 μl [20 mg per milliliter]).To show that this in vivo effect of the IgG from the patients was caused by the anti-mGluR1 autoantibody, IgG was absorbed with CHO cells that expressed mGluR1α or mGluR5a. The IgG that was absorbed with mGluR1α completely lost its effect (Figure 3B), but IgG that was absorbed with mGluR5a remained effective (the value on the rotorod test 2 hours after injection was 18±12 seconds — not significantly different from the values for nonabsorbed IgG; P>0.3). The injected IgG was restricted largely to the cerebellum (Figure 3C and Figure 3D); it had penetrated throughout various layers of the cerebellar cortex, as shown by immunohistochemical visualization of human IgG (Figure 3D).
Furthermore, antibodies eluted from the cells that expressed mGluR1α caused similar ataxic behavior in mice at a low concentration (20 μl [about 0.15 mg per milliliter]) (Figure 3B). These results clearly indicate that anti-mGluR1 autoantibodies from these patients caused cerebellar ataxia in mice by functional blocking of mGluR1 in the cerebellum.
Titers of the autoantibody in cerebrospinal fluid and serum samples from both patients were examined by end-point titration of immunohistochemical mGluR1 staining in sections of rat brain. Before Patient 1 received plasma exchanges, the titers in her cerebrospinal fluid and serum were 512 and 3200, respectively. When these values were normalized according to concentrations of IgG, the anti-mGluR1 titer per unit of IgG was 31 times as high in cerebrospinal fluid as in serum, an indication of intrathecal synthesis. Using these values, we found that the anti-mGluR1 antibody content in the cerebrospinal fluid was 25 times as high as that in the IC50 of serum IgG (46 μg per milliliter × 31 ÷ 58 μg per milliliter). In Patient 2, after she received plas-ma exchanges, the anti-mGluR1 titer in serum was 400 and the titer in cerebrospinal fluid was 256. Normalized according to IgG concentrations, the anti-mGluR1 IgG titer per unit of IgG was 36 times as high in cerebrospinal fluid as in serum. In Patient 2, the content of anti-mGluR1 antibody in cerebrospinal fluid was therefore 28 times that in the IC50 of serum IgG (150 μg per milliliter × 36 ÷ 194 μg per milliliter).
To investigate whether the anti-mGluR1 autoantibodies were related to Hodgkin's disease, we examined a frozen biopsy specimen of a lymph node from Patient 1 and lymph nodes from nine other patients with Hodgkin's disease and five patients with non-Hodgkin's lymphoma by RT-PCR and an immunohistochemical assay, using biotinylated IgG from the patients. We could not detect mGluR1 RNA in any of these samples, but we did detect it in positive controls (rat and human cerebellum; data not shown). Also, an immunohistochemical assay with biotinylated IgG from the patients did not provide evidence for the expression of mGluR1 or a cross-reactive epitope in any of the tumor samples (data not shown).
We also examined serum samples from more than 3060 patients for the presence of paraneoplastic antineuronal antibodies. These samples included serum samples from 26 patients with Hodgkin's disease. Only the serum from Patients 1 and 2 showed anti-mGluR1 immunoreactivity. Of the 24 serum samples from other patients with Hodgkin's disease, 5 reacted with Purkinje cells; the pattern was anti-Tr in 3 of these. These anti-Tr serum samples did not bind to CHO cells that expressed mGluR1 and showed the same immunolabeling pattern of Purkinje cells in wild-type and mGluR1-knockout mice (data not shown).
Discussion
IgG from serum and cerebrospinal fluid from two patients with cerebellar ataxia bound to mGluR1 receptors in the brain and caused ataxia in mice. In Patient 1, the most striking symptom at presentation was gait ataxia; she was unable to walk with a tandem gait. At that time, the titers of the anti-mGluR1 autoantibodies in serum and cerebrospinal fluid were 3200 and 512, respectively. After 25 days of treatment with prednisone and four plasma exchanges, her gait improved and the serum and cerebrospinal fluid titers of the autoantibodies had dropped to 200 and 64, respectively. Later, when she was asymptomatic, we could not detect anti-mGluR1 autoantibodies in her serum.
The serum of Patient 2 was first tested when she had had severe ataxia for almost one year. The titer of anti-mGluR1 autoantibodies in her serum was 3200 at that time. After 14 plasma exchanges, she continued to have severe ataxia and was unable to walk without support. Although the plasma anti-mGluR1 titer had dropped to 400 after the plasma exchanges, the cerebrospinal fluid titer remained high, an indication of ongoing intrathecal synthesis of anti-mGluR1 autoantibodies.
Several molecules have been identified as autoantigens associated with nervous system diseases. These include the acetylcholine receptor in myasthenia gravis,19 voltage-gated calcium channels in the Lambert–Eaton syndrome,20 presynaptic potassium channels in Isaacs' syndrome (neuromyotonia),21 GluR3 in Rasmussen's encephalitis,22 and Hu antigens in paraneoplastic encephalomyelitis.23 So far, functional effects of such autoantibodies have been found only in disorders of the peripheral nervous system, such as myasthenia gravis (blocking of acetylcholine receptors)19 and the Lambert–Eaton syndrome (blocking of presynaptic voltage-gated calcium channels at the neuromuscular junction).24 Our results indicate that autoantibodies may also affect the central nervous system by blocking neuronal receptors.
We detected anti-mGluR1 autoantibodies in the serum of only two of 3060 patients with a variety of disorders. These two patients had Hodgkin's disease, but we were unable to show conclusively that the ataxia and the Hodgkin's disease were linked in a paraneoplastic syndrome. We did not detect expression of mGluR1 in the tumor-containing lymph node of Patient 1, a finding that would have tied the two disorders together. Nevertheless, in about 50 percent of cases, the cerebellar syndrome of nonhereditary subacute ataxia in adults is paraneoplastic and can occur when Hodgkin's disease is in remission.1,4
The mGluR1 receptors are located at the perisynaptic site of the Purkinje-cell dendritic spines, which form excitatory synapses with parallel fibers or climbing fibers.25 The activation of mGluR1 receptors is necessary for the induction of cerebellar long-term depression, which is probably the mechanism of cerebellar motor learning.10,11,26,27 Mice that lack the mGluR1 gene have ataxic gait and intention tremor and impaired cerebellar long-term depression and motor learning.19 The ability of the anti-mGluR1 autoantibodies to cause ataxic behavior in mice by blocking mGluR1 in the cerebellum indicates that the activation of mGluR1 is necessary for normal cerebellar coordination.
Impaired cerebellar long-term depression and motor learning, which result from the blocking of mGluR1,10,11,26 are unlikely to be the cause of ataxia in our study, because the effects of the injected antibodies were evident in the short term. The activation of mGluR1 induces slow inward–outward currents as well as a depression of parallel fiber-mediated excitatory postsynaptic currents in Purkinje's cells.26 The blocking of these mGluR1-mediated effects in the parallel fiber synapses may have a role in the ataxic behavior. Finally, we should consider the possibility that the short-term ataxic effect results partly from impaired mGluR1 activation at other locations, such as climbing fiber synapses — activation that is necessary for normal motor coordination.28
Supported in part by the Ministry of Education, Science, and Culture of Japan (Dr. Nakanishi and Dr. Shigemoto); CREST of Japan Science and Technology Corporation (Dr. Shigemoto); the Life Sciences Foundation (Dr. De Zeeuw); NWO (Dr. De Zeeuw and Dr. De Leeuw); and the Human Frontier Science Program (Dr. De Zeeuw and Dr. Shigemoto).
Drs. Sillevis Smitt and Kinoshita contributed equally to the article.
We are indebted to A. Aiba for providing mGluR1-deficient mice; to T. Maruyama for providing human mGluR1-expressing CHO cells; to H. Jingami for helpful discussion; to A. Uesugi for photographic assistance; to M. van den Bent and C. Gaillard for clinical information on the patients; and to J. van der Burg, S.K.E. Koekkoek, K.J. Reus, and C. Vermeer for technical assistance.
Source Information
From the Departments of Neuro-Oncology (P.S.S., B.D.L., W.M., M.C., C.V.) and Pathology (S.H.-L.), Daniel den Hoed Cancer Center, University Hospital Rotterdam, the Netherlands; the Departments of Immunology (B.D.L.) and Anatomy (M.C., D.J., C.D.Z.), Erasmus University Rotterdam, the Netherlands; the Departments of Morphologic Brain Science (A.K., R.S.) and Biologic Sciences (N.S., S.N.), Faculty of Medicine, Kyoto University, Sakyo-ku, Kyoto, Japan; and the Laboratory of Cerebral Structure, National Institute for Physiologic Sciences, Myodaiji, Okazaki, Japan (A.K., R.S.).
Address reprint requests to Dr. Sillevis Smitt at the Department of Neuro-Oncology, Daniel den Hoed Cancer Center, P.O. Box 5201, 3008 AE Rotterdam, the Netherlands, or at sillevis@neuh.azr.nl.
- References
References
1
Henson RA, Urich H. Cancer and the nervous system. Oxford, England: Blackwell Scientific, 1982.
2
Furneaux HM ,Rosenblum MK ,Dalmau J , et al. Selective expression of Purkinje-cell antigens in tumor tissue from patients with paraneoplastic cerebellar degeneration. N Engl J Med 1990;322:1844-1851
Full Text | Web of Science | Medline3
Luque FA ,Furneaux HM ,Ferziger R , et al. Anti-Ri: an antibody associated with paraneoplastic opsoclonus and breast cancer. Ann Neurol 1991;29:241-251
CrossRef | Web of Science | Medline4
Hammack J ,Kotanides H ,Rosenblum MK ,Posner JB . Paraneoplastic cerebellar degeneration. II. Clinical and immunologic findings in 21 patients with Hodgkin's disease. Neurology 1992;42:1938-1943
Web of Science | Medline5
Graus F ,Illa I ,Agusti M ,Ribalta T ,Cruz-Sanchez F ,Juarez C . Effect of intraventricular injection of an anti-Purkinje cell antibody (anti-Yo) in a guinea pig model. J Neurol Sci 1991;106:82-87
CrossRef | Web of Science | Medline6
Sillevis Smitt PAE ,Manley GT ,Posner JB . Immunization with the paraneoplastic encephalomyelitis antigen HuD does not cause neurologic disease in mice. Neurology 1995;45:1873-1878
Web of Science | Medline7
Graus F ,Dalmau J ,Valldeoriola F , et al. Immunological characterization of a neuronal antibody (anti-Tr) associated with paraneoplastic cerebellar degeneration and Hodgkin's disease. J Neuroimmunol 1997;74:55-61
CrossRef | Web of Science | Medline8
Reiber H ,Felgenhauer K . Protein transfer at the blood cerebrospinal fluid barrier and the quantitation of the humoral immune response within the central nervous system. Clin Chim Acta 1987;163:319-328
CrossRef | Web of Science | Medline9
Moll JW ,Antoine JC ,Brashear HR , et al. Guidelines on the detection of paraneoplastic anti-neuronal-specific antibodies: report from the Workshop to the Fourth Meeting of the International Society of Neuro-Immunology on paraneoplastic neurological disease, held October 22-23, 1994, in Rotterdam, the Netherlands. Neurology 1995;45:1937-1941
Web of Science | Medline10
Aiba A ,Kano M ,Chen C , et al. Deficient cerebellar long-term depression and impaired motor learning in mGluR1 mutant mice. Cell 1994;79:377-388
CrossRef | Web of Science | Medline11
Shigemoto R ,Abe T ,Nomura S ,Nakanishi S ,Hirano T . Antibodies inactivating mGluR1 metabotropic glutamate receptor block long-term depression in cultured Purkinje cells. Neuron 1994;12:1245-1255
CrossRef | Web of Science | Medline12
Aramori I ,Nakanishi S . Signal transduction and pharmacological characteristics of a metabotropic glutamate receptor, mGluR1, in transfected CHO cells. Neuron 1992;8:757-765
CrossRef | Web of Science | Medline13
Okamoto T ,Sekiyama N ,Otsu M , et al. Expression and purification of the extracellular ligand binding region of metabotropic glutamate receptor subtype 1. J Biol Chem 1998;273:13089-13096
CrossRef | Web of Science | Medline14
Kobayashi K ,Morita S ,Sawada H , et al. Immunotoxin-mediated conditional disruption of specific neurons in transgenic mice. Proc Natl Acad Sci U S A 1995;92:1132-1136
CrossRef | Web of Science | Medline15
Fotuhi M ,Sharp AH ,Glatt CE , et al. Differential localization of phosphoinositide-linked metabotropic glutamate receptor (mGluR1) and the inositol 1,4,5-trisphosphate receptor in rat brain. J Neurosci 1993;13:2001-2012
Web of Science | Medline16
Shigemoto R ,Nakanishi S ,Mizuno N . Distribution of the mRNA for a metabotropic glutamate receptor (mGluR1) in the central nervous system: an in situ hybridization study in adult and developing rat. J Comp Neurol 1992;322:121-135
CrossRef | Web of Science | Medline17
Abe T ,Sugihara H ,Nawa H ,Shigemoto R ,Mizuno N ,Nakanishi S . Molecular characterization of a novel metabotropic glutamate receptor mGluR5 coupled to inositol phosphate/Ca2+ signal transduction. J Biol Chem 1992;267:13361-13368
Web of Science | Medline18
Brunner RL ,Altman J . Locomotor deficits in adult rats with moderate to massive retardation of cerebellar development during infancy. Behav Biol 1973;9:169-188
CrossRef | Medline19
Toyka KV ,Brachman DB ,Pestronk A ,Kao I . Myasthenia gravis: passive transfer from man to mouse. Science 1975;190:397-399
CrossRef | Web of Science | Medline20
Lennon VA ,Kryzer TJ ,Griesmann GE , et al. Calcium-channel antibodies in the Lambert-Eaton syndrome and other paraneoplastic syndromes. N Engl J Med 1995;332:1467-1474
Full Text | Web of Science | Medline21
Lang B ,Vincent A . Autoimmunity to ion-channels and other proteins in paraneoplastic disorders. Curr Opin Immunol 1996;8:865-871
CrossRef | Web of Science | Medline22
Rogers SW ,Andrews PI ,Gahring LC , et al. Autoantibodies to glutamate receptor GluR3 in Rasmussen's encephalitis. Science 1994;265:648-651
CrossRef | Web of Science | Medline23
Szabo A ,Dalmau J ,Manley G , et al. HuD, a paraneoplastic encephalomyelitis antigen, contains RNA-binding domains and is homologous to Elav and Sex-lethal. Cell 1991;67:325-333
CrossRef | Web of Science | Medline24
Lang B ,Newsom-Davis J ,Wray D ,Vincent A ,Murray N . Autoimmune aetiology for myasthenic (Eaton-Lambert) syndrome. Lancet 1981;2:224-226
CrossRef | Web of Science | Medline25
Nusser Z ,Mulvihill E ,Streit P ,Somogyi P . Subsynaptic segregation of metabotropic and ionotropic glutamate receptors as revealed by immunogold localization. Neuroscience 1994;61:421-427
CrossRef | Web of Science | Medline26
Conquet F ,Bashir ZI ,Davies CH , et al. Motor deficit and impairment of synaptic plasticity in mice lacking mGluR1. Nature 1994;372:237-243
CrossRef | Web of Science | Medline27
De Zeeuw CI ,Hansel C ,Bian F , et al. Expression of a protein kinase C inhibitor in Purkinje cells blocks cerebellar LTD and adaptation of the vestibulo-ocular reflex. Neuron 1998;20:495-508
CrossRef | Web of Science | Medline28
Welsh JP ,Lang EJ ,Sugihara I ,Llinas R . Dynamic organization of motor control within the olivocerebellar system. Nature 1995;374:453-457
CrossRef | Web of Science | Medline
- Citing Articles (93)
Citing Articles
1
Steven Vernino. 2012. Paraneoplastic cerebellar degeneration. , 215-223.
CrossRef2
Myrna R. Rosenfeld, Josep Dalmau. 2012. Central nervous system paraneoplastic disease. , 853-864.
CrossRef3
Philippe Demaerel, Wim Dessel, Wim Paesschen, Rik Vandenberghe, Koen Laere, Jennifer Linn. (2011) Autoimmune-mediated encephalitis. Neuroradiology 53:11, 837-851
CrossRef4
Karsten Conrad, Ulrich Sack. (2011) Multiparameteranalytik in Diagnostik und Monitoring von Autoimmunerkrankungen: Stand und Perspektiven/Multiparametric analyses in diagnostics and monitoring of autoimmune diseases: current state and perspectives. LaboratoriumsMedizin 35:6, 375-382
CrossRef5
J. Honnorat, A. Viaccoz. (2011) New concepts in paraneoplastic neurological syndromes. Revue Neurologique 167:10, 729-736
CrossRef6
M. J. Titulaer, R. Soffietti, J. Dalmau, N. E. Gilhus, B. Giometto, F. Graus, W. Grisold, J. Honnorat, P. A. E. Sillevis Smitt, R. Tanasescu, C. A. Vedeler, R. Voltz, J. J. G. M. Verschuuren. 2011. Screening for Tumours in Paraneoplastic Syndromes. , 309-320.
CrossRef7
Jessica Panzer, Josep Dalmau. (2011) Movement disorders in paraneoplastic and autoimmune disease. Current Opinion in Neurology 24:4, 346-353
CrossRef8
M. Raspotnig, C. A. Vedeler, A. Storstein. (2011) Onconeural antibodies in patients with neurological symptoms: detection and clinical significance. Acta Neurologica Scandinavica 124, 83-88
CrossRef9
F. Nicoletti, J. Bockaert, G.L. Collingridge, P.J. Conn, F. Ferraguti, D.D. Schoepp, J.T. Wroblewski, J.P. Pin. (2011) Metabotropic glutamate receptors: From the workbench to the bedside. Neuropharmacology 60:7-8, 1017-1041
CrossRef10
R.T. Ngomba, I. Santolini, F. Biagioni, G. Molinaro, A. Simonyi, C.M. van Rijn, V. D’Amore, F. Mastroiacovo, G. Olivieri, R. Gradini, F. Ferraguti, G. Battaglia, V. Bruno, A. Puliti, G. van Luijtelaar, F. Nicoletti. (2011) Protective role for type-1 metabotropic glutamate receptors against spike and wave discharges in the WAG/Rij rat model of absence epilepsy. Neuropharmacology 60:7-8, 1281-1291
CrossRef11
G. Demarquay, J. Honnorat. (2011) Clinical presentation of immune-mediated cerebellar ataxia. Revue Neurologique 167:5, 408-417
CrossRef12
R. Zeng, F.H.G. Farias, G.S. Johnson, S.D. McKay, R.D. Schnabel, J.E. Decker, J.F. Taylor, C.S. Mann, M.L. Katz, G.C. Johnson, J.R. Coates, D.P. O'Brien. (2011) A Truncated Retrotransposon Disrupts the GRM1 Coding Sequence in Coton de Tulear Dogs with Bandera's Neonatal Ataxia. Journal of Veterinary Internal Medicine 25:2, 267-272
CrossRef13
Sean Grimm, Marc Chamberlain. (2011) Hodgkin's Lymphoma: A Review of Neurologic Complications. Advances in Hematology 2011, 1-7
CrossRef14
Philippe Rondard, Cyril Goudet, Julie Kniazeff, Jean-Philippe Pin, Laurent Prézeau. (2011) The complexity of their activation mechanism opens new possibilities for the modulation of mGlu and GABAB class C G protein-coupled receptors. Neuropharmacology 60:1, 82-92
CrossRef15
Stanley Fahn, Joseph Jankovic, Mark Hallett. 2011. Ataxia. , 465-475.
CrossRef16
Michael Hoosien, James Vredenburgh, Julio Lanfranco, Roberto Ochoa, Philip Robinson, Robert Martinez, Carlos Singer, Orlando Silva. (2011) A myxoid chondrosarcoma associated with an anti-Hu-positive paraneoplastic encephalomyelitis. Journal of Neuro-Oncology 101:1, 135-139
CrossRef17
M. J. Titulaer, R. Soffietti, J. Dalmau, N. E. Gilhus, B. Giometto, F. Graus, W. Grisold, J. Honnorat, P. A. E. Sillevis Smitt, R. Tanasescu, C. A. Vedeler, R. Voltz, J. J. G. M. Verschuuren. (2011) Screening for tumours in paraneoplastic syndromes: report of an EFNS Task Force. European Journal of Neurology 18:1, 19-e3
CrossRef18
C. Geis, A. Weishaupt, S. Hallermann, B. Grunewald, C. Wessig, T. Wultsch, A. Reif, N. Byts, M. Beck, S. Jablonka, M. K. Boettger, N. Uceyler, W. Fouquet, M. Gerlach, H.-M. Meinck, A.-L. Siren, S. J. Sigrist, K. V. Toyka, M. Heckmann, C. Sommer. (2010) Stiff person syndrome-associated autoantibodies to amphiphysin mediate reduced GABAergic inhibition. Brain 133:11, 3166-3180
CrossRef19
Franz Blaes, Marlene Tschernatsch. (2010) Paraneoplastic neurological disorders. Expert Review of Neurotherapeutics 10:10, 1559-1568
CrossRef20
Edgar Meinl, Tobias Derfuss, Chris Linington. (2010) Identifying targets for autoantibodies in CNS inflammation: Strategies and achievements. Clinical and Experimental Neuroimmunology 1:2, 47-60
CrossRef21
Stephanie Schorge, Joyce van de Leemput, Andrew Singleton, Henry Houlden, John Hardy. (2010) Human ataxias: a genetic dissection of inositol triphosphate receptor (ITPR1)-dependent signaling. Trends in Neurosciences 33:5, 211-219
CrossRef22
Francesc Graus, Albert Saiz, Josep Dalmau. (2010) Antibodies and neuronal autoimmune disorders of the CNS. Journal of Neurology 257:4, 509-517
CrossRef23
Pia Irene Anna Rossi, Carlotta Maria Vaccari, Alessandra Terracciano, Laura Doria-Lamba, Sabrina Facchinetti, Manuela Priolo, Carmen Ayuso, Laura Jorge, Stefania Gimelli, Filippo Maria Santorelli, Roberto Ravazzolo, Aldamaria Puliti. (2010) The metabotropic glutamate receptor 1, GRM1: evaluation as a candidate gene for inherited forms of cerebellar ataxia. Journal of Neurology 257:4, 598-602
CrossRef24
Thomas Klockgether. (2010) Sporadic ataxia with adult onset: classification and diagnostic criteria. The Lancet Neurology 9:1, 94-104
CrossRef25
Yuval Karmon, Edna Inbar, Mario Cordoba, Natan Gadoth. (2009) Paraneoplastic Cerebellar Degeneration Mimicking Acute Post-Infectious Cerebellitis. The Cerebellum 8:4, 441-444
CrossRef26
Jan Bauer, Christian G. Bien. (2009) Encephalitis and epilepsy. Seminars in Immunopathology 31:4, 537-544
CrossRef27
Peter Maat, Peter AE Sillevis Smitt. 2009. Paraneoplastic Neurologic Syndromes. .
CrossRef28
Peter K Todd, J Paul Taylor. 2009. The Aetiologic Spectrum of Cerebellar Ataxia: Inherited Causes of Ataxia. .
CrossRef29
S.K. Baker, C. Morillo, S. Vernino. (2009) Autoimmune autonomic ganglionopathy with late-onset encephalopathy. Autonomic Neuroscience 146:1-2, 29-32
CrossRef30
Eric Vieira, Jörg Huwyler, Synèse Jolidon, Frédéric Knoflach, Vincent Mutel, Jürgen Wichmann. (2009) Fluorinated 9H-xanthene-9-carboxylic acid oxazol-2-yl-amides as potent, orally available mGlu1 receptor enhancers. Bioorganic & Medicinal Chemistry Letters 19:6, 1666-1669
CrossRef31
F. Fazio, S. Notartomaso, E. Aronica, M. Storto, G. Battaglia, E. Vieira, S. Gatti, V. Bruno, F. Biagioni, R. Gradini, F. Nicoletti, R. Di Marco. (2008) Switch in the expression of mGlu1 and mGlu5 metabotropic glutamate receptors in the cerebellum of mice developing experimental autoimmune encephalomyelitis and in autoptic cerebellar samples from patients with multiple sclerosis. Neuropharmacology 55:4, 491-499
CrossRef32
Antonio Rodríguez-Burgos, Luis Juárez. (2008) ORIGINAL ARTICLE: Developmental Delay and Other Anomalies in the Offspring from Hens Immunized Against Soluble and Foreign Chick Embryo Antigens. American Journal of Reproductive Immunology 60:2, 141-150
CrossRef33
Mia Levite, Yonatan Ganor. (2008) Autoantibodies to glutamate receptors can damage the brain in epilepsy, systemic lupus erythematosus and encephalitis. Expert Review of Neurotherapeutics 8:7, 1141-1160
CrossRef34
Shoji Tsuji, Osamu Onodera, Jun Goto, Masatoyo Nishizawa, . (2008) Sporadic ataxias in Japan – a population-based epidemiological study. The Cerebellum 7:2, 189-197
CrossRef35
Fabrice Jardin. (2008) Development of autoimmunity in lymphoma. Expert Review of Clinical Immunology 4:2, 247-266
CrossRef36
Y. J. Liao, P. Safa, Y.-R. Chen, R. A. Sobel, E. S. Boyden, R. W. Tsien. (2008) Anti-Ca2+ channel antibody attenuates Ca2+ currents and mimics cerebellar ataxia in vivo. Proceedings of the National Academy of Sciences 105:7, 2705-2710
CrossRef37
S. Matus, P. V. Burgos, M. Bravo-Zehnder, R. Kraft, O. H. Porras, P. Farias, L. F. Barros, F. Torrealba, L. Massardo, S. Jacobelli, A. Gonzalez. (2007) Antiribosomal-P autoantibodies from psychiatric lupus target a novel neuronal surface protein causing calcium influx and apoptosis. Journal of Experimental Medicine 204:13, 3221-3234
CrossRef38
Andrew J. Sachs, Jamie K. Schwendinger, Andy W. Yang, Neena B. Haider, Arne M. Nystuen. (2007) The mouse mutants recoil wobbler and nmf373 represent a series of Grm1 mutations. Mammalian Genome 18:11, 749-756
CrossRef39
P. V. Belousov, Yu. V. Shebzukhov, S. A. Nedospasov, D. V. Kuprash. (2007) Onconeural antibodies as a tool in the diagnosis of malignant tumors and paraneoplastic neurological syndromes. Molecular Genetics, Microbiology and Virology 22:2, 45-52
CrossRef40
Harumi Nakao, Kazuki Nakao, Masanobu Kano, Atsu Aiba. (2007) Metabotropic glutamate receptor subtype-1 is essential for motor coordination in the adult cerebellum. Neuroscience Research 57:4, 538-543
CrossRef41
Giovanni Frisullo, Giacomo Della Marca, Massimiliano Mirabella, Marcella Caggiula, Aldobrando Broccolini, Marco Rubino, Gioacchino Mennuni, Pietro Attilio Tonali, Anna Paola Batocchi. (2007) A human anti-neuronal autoantibody against GABAB receptor induces experimental autoimmune agrypnia. Experimental Neurology 204:2, 808-818
CrossRef42
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Rosenberg, Eric S., Cort, Alice M., Ebeling, Sally H.Peters, Christine C., Dalmau, Josep, Gonzalez, R. Gilberto, Lerwill, Melinda F., . (2007) Case 4-2007. New England Journal of Medicine 356:6, 612-620
Full Text43
Hendrik-Tobias Arkenau, Claire Gordon, Felicity Murphy, David Cunningham. (2007) Paraneoplastic syndrome: Subacute cerebellar degeneration in Hodgkin's disease. Leukemia & Lymphoma 48:4, 819-822
CrossRef44
Sadahisa Okamoto, Teruyuki Hirano, Yukitoshi Takahashi, Taro Yamashita, Eiichiro Uyama, Makoto Uchino. (2007) Paraneoplastic Limbic Encephalitis Caused by Ovarian Teratoma with Autoantibodies to Glutamate Receptor. Internal Medicine 46:13, 1019-1022
CrossRef45
Joachim M. Baehring, Eudocia Quant, Fred H. Hochberg. 2007. Metastatic Neoplasms and Paraneoplastic Syndromes. , 1081-1101.
CrossRef46
María José Molina-Garrido, Carmen Guillén-Ponce, Salvador Martínez, María Guirado-Risueño. (2006) Diagnosis and current treatment of neurological paraneoplastic syndromes. Clinical and Translational Oncology 8:11, 796-801
CrossRef47
Steven Vernino. (2006) Paraneoplastic neurologic syndromes. Current Neurology and Neuroscience Reports 6:3, 193-199
CrossRef48
Sabrina Boscolo, Monica Passoni, Valentina Baldas, Iacopo Cancelli, Marios Hadjivassiliou, Alessandro Ventura, Enrico Tongiorgi. (2006) Detection of anti-brain serum antibodies using a semi-quantitative immunohistological method. Journal of Immunological Methods 309:1-2, 139-149
CrossRef49
Setareh Shams’ili, Janet Beukelaar, Jan Willem Gratama, Herbert Hooijkaas, Martin Bent, Mars Veer, Peter Sillevis Smitt. (2006) An uncontrolled trial of rituximab for antibody associated paraneoplastic neurological syndromes. Journal of Neurology 253:1, 16-20
CrossRef50
Edward J Dropcho. (2005) Immunotherapy for paraneoplastic neurological disorders. Expert Opinion on Biological Therapy 5:10, 1339-1348
CrossRef51
F. Jardin, H. Lévesque, H. Tilly. (2005) Manifestations dysimmunitaires associées aux lymphomes. La Revue de Médecine Interne 26:7, 557-571
CrossRef52
Jean-Philippe Pin. (2005) Moduler l’action du glutamate dans le cerveau: de nouvelles pistes ouvertes grâce aux récepteurs métabotropiques. PSN 3:3, 132-142
CrossRef53
Agnes Simonyi, Richard T. Ngomba, Marianna Storto, Maria V. Catania, Laura A. Miller, Brian Youngs, Valeria DiGiorgi-Gerevini, Ferdinando Nicoletti, Grace Y. Sun. (2005) Expression of groups I and II metabotropic glutamate receptors in the rat brain during aging. Brain Research 1043:1-2, 95-106
CrossRef54
Shigetada Nakanishi. (2005) Synaptic mechanisms of the cerebellar cortical network. Trends in Neurosciences 28:2, 93-100
CrossRef55
Robert K.S. Wong, Riccardo Bianchi, Shih-Chieh Chuang, Lisa R. Merlin. (2005) Group I mGluR-induced Epileptogenesis: Distinct and Overlapping Roles of mGluR1 and mGluR5 and Implications for Antiepileptic Drug Design. Epilepsy Currents 5:2, 63-68
CrossRef56
Clare Ellis. (2004) THE STATE OF GPCR RESEARCH IN 2004. Nature Reviews Drug Discovery 3:7, 577-626
CrossRef57
Luis Bataller, Josep Dalmau. (2004) Neuro-ophthalmology and paraneoplastic syndromes. Current Opinion in Neurology 17:1, 3-8
CrossRef58
Keiko Tanaka, Xin Ding, Masami Tanaka. (2004) Effects of antineuronal antibodies from patients with paraneoplastic neurological syndrome on primary-cultured neurons. Journal of the Neurological Sciences 217:1, 25-30
CrossRef59
Naoaki MATSUKI, Kaori FUJIWARA, Satoshi TAMAHARA, Kazuyuki UCHIDA, Satoru MATSUNAGA, Hiroyuki NAKAYAMA, Kunio DOI, Hiroyuki OGAWA, Kenichiro ONO. (2004) Prevalence of Autoantibody in Cerebrospinal Fluids from Dogs with Various CNS Diseases. Journal of Veterinary Medical Science 66:3, 295-297
CrossRef60
Dragan Milovanovic, Slobodan Jankovic. (2004) Osnovi glutamatergičke neurotransmisije. Vojnosanitetski pregled 61:1, 59-64
CrossRef61
Darnell, Robert B., Posner, Jerome B., . (2003) Paraneoplastic Syndromes Involving the Nervous System. New England Journal of Medicine 349:16, 1543-1554
Full Text62
Domenico E Pellegrini-Giampietro. (2003) The distinct role of mGlu1 receptors in post-ischemic neuronal death. Trends in Pharmacological Sciences 24:9, 461-470
CrossRef63
Justyna R Sarna, Richard Hawkes. (2003) Patterned Purkinje cell death in the cerebellum. Progress in Neurobiology 70:6, 473-507
CrossRef64
Michiel Coesmans, Peter A. Sillevis Smitt, David J. Linden, Ryuichi Shigemoto, Tomoo Hirano, Yoshinori Yamakawa, Adriaan M. Van Alphen, Chongde Luo, Josef N. Van Der Geest, Johan M. Kros, Carlo A. Gaillard, Maarten A. Frens, Chris I. De Zeeuw. (2003) Mechanisms underlying cerebellar motor deficits due to mGluR1-autoantibodies. Annals of Neurology 53:3, 325-336
CrossRef65
Itsunari Minami, Mineko Kengaku, Peter Sillevis Smitt, Ryuichi Shigemoto, Tomoo Hirano. (2003) Long-term potentiation of mGluR1 activity by depolarization-induced Homer1a in mouse cerebellar Purkinje neurons. European Journal of Neuroscience 17:5, 1023-1032
CrossRef66
Luis Bataller, Deborly F. Wade, Francesc Graus, Myrna R. Rosenfeld, Josep Dalmau. (2003) The MAZ protein is an autoantigen of Hodgkin's disease and paraneoplastic cerebellar dysfunction. Annals of Neurology 53:1, 123-127
CrossRef67
Josep Dalmau, Francesc Graus. 2003. Paraneoplastic Syndromes. , 1146-1156.
CrossRef68
Taku Fukuda, Masakatsu Motomura, Yoko Nakao, Hirokazu Shiraishi, Toshiro Yoshimura, Keisuke Iwanaga, Mitsuhiro Tsujihata, Hirotoshi Dosaka-Akita, Katsumi Eguchi. (2003) Reduction of P/Q-type calcium channels in the postmortem cerebellum of paraneoplastic cerebellar degeneration with Lambert-Eaton myasthenic syndrome. Annals of Neurology 53:1, 21-28
CrossRef69
Josep Dalmau. 2003. Paraneoplastic Syndromes, Immunology. , 787-790.
CrossRef70
Ian Sutton. (2002) Paraneoplastic neurological syndromes. Current Opinion in Neurology 15:6, 685-690
CrossRef71
Despina S Kyriakou, Michael G Alexandrakis, Freda H Passam, Kalliopi Foundouli, Emmanouel Matalliotakis, Ioannis E Koutroubakis, Taxiarchis V Kourelis, George Chalkiadakis, Orestis N Manoussos. (2002) Acquired inhibitors to coagulation factors in patients with gastrointestinal diseases. European Journal of Gastroenterology & Hepatology 14:12, 1383-1387
CrossRef72
Joan R. Coates, Dennis P. O'Brien, Karen L. Kline, Ralph W. Starts, Gayle C. Johnson, G. Diane Shelton, Edward E. Patterson, Louise C. Abbott. (2002) Neonatal Cerebellar Ataxia in Coton de Tulear Dogs. Journal of Veterinary Internal Medicine 16:6, 680-689
CrossRef73
Raymond Voltz. (2002) Paraneoplastic neurological syndromes – Author's reply. The Lancet Neurology 1:7, 408
CrossRef74
Mia Levite, Ian K Hart. (2002) Immunotherapy for epilepsy. Expert Review of Neurotherapeutics 2:6, 809-814
CrossRef75
Kenji Yoshimi, Monica Woo, Yubei Son, Michel Baudry, Richard F Thompson. (2002) IgG-immunostaining in the intact rabbit brain: variable but significant staining of hippocampal and cerebellar neurons with anti-IgG. Brain Research 956:1, 53-66
CrossRef76
Peter Sillevis Smitt. (2002) Paraneoplastic neurological syndromes. The Lancet Neurology 1:7, 408
CrossRef77
Jeffrey G. Netzeband, Jaimes R. Schneeloch, Carol Trotter, Jodilyn N. Caguioa-Aquino, Donna L. Gruol. (2002) Chronic Ethanol Treatment and Withdrawal Alter ACPD-Evoked Calcium Signals in Developing Purkinje Neurons. Alcoholism: Clinical and Experimental Research 26:3, 386-393
CrossRef78
JOSEPH HALLETT, LOUISE KIESSLING, Paul J. Lombroso. (2002) Genetics of Childhood Disorders: XXXV. Autoimmune Disorders, Part 8: Animal Models for Noninflammatory Autoimmune Disorders of the Brain. Journal of the American Academy of Child & Adolescent Psychiatry 41:2, 223-225
CrossRef79
Jeffrey G. Netzeband, Jaimes R. Schneeloch, Carol Trotter, Jodilyn N. Caguioa-Aquino, Donna L. Gruol. (2002) Chronic Ethanol Treatment and Withdrawal Alter ACPD-Evoked Calcium Signals in Developing Purkinje Neurons. Alcoholism: Clinical & Experimental Research 26:3, 386
CrossRef80
Myrna R. Rosenfeld, Josep Dalmau. (2001) THE CLINICAL SPECTRM AND PATHOGENESIS OF PARANEOPLASTIC DISORDERS OF THE CENTRAL NERVOUS SYSTEM. Hematology/Oncology Clinics of North America 15:6, 1109-1128
CrossRef81
Valeria Bruno, Giuseppe Battaglia, Agata Copani, Mara D'Onofrio, P. Di Iorio, Antonio De Blasi, Daniela Melchiorri, Peter J. Flor, Ferdinando Nicoletti. (2001) Metabotropic Glutamate Receptor Subtypes as Targets for Neuroprotective Drugs. Journal of Cerebral Blood Flow & Metabolism1013-1033
CrossRef82
Takashi Maejima, Kouichi Hashimoto, Takayuki Yoshida, Atsu Aiba, Masanobu Kano. (2001) Presynaptic Inhibition Caused by Retrograde Signal from Metabotropic Glutamate to Cannabinoid Receptors. Neuron 31:3, 463-475
CrossRef83
P. Stourac, Z. Kadanka, V. Palyza. (2001) Paraneoplastic neurological syndromes - patients' cohort profile in the Czech Republic. Acta Neurologica Scandinavica 104:2, 72-77
CrossRef84
Marco Canepari, George Papageorgiou, John E. T. Corrie, Chris Watkins, David Ogden. (2001) The conductance underlying the parallel fibre slow EPSP in rat cerebellar Purkinje neurones studied with photolytic release of L-glutamate. The Journal of Physiology 533:3, 765-772
CrossRef85
Julie T. Lin, Elisabeth Lachmann, Willibald Nagler. (2001) Paraneoplastic Cerebellar Degeneration as the First Manifestation of Cancer. Journal of Women's Health & Gender-Based Medicine 10:5, 495-502
CrossRef86
Noel G. Carlson, Lorise C. Gahring, Scott W. Rogers. (2001) Identification of the amino acids on a neuronal glutamate receptor recognized by an autoantibody from a patient with paraneoplastic syndrome. Journal of Neuroscience Research 63:6, 480-485
CrossRef87
John E Greenlee, Jennifer W Boyden, Michael Pingree, H.Robert Brashear, Susan A Clawson, Paula M Keeney. (2001) Antibody types and IgG subclasses in paraneoplastic neurological syndromes. Journal of the Neurological Sciences 184:2, 131-137
CrossRef88
Zhiya Yu, Thomas J. Kryzer, Guy E. Griesmann, Kwang-Kuk Kim, Eduardo E. Benarroch, Vanda A. Lennon. (2001) CRMP-5 neuronal autoantibody: Marker of lung cancer and thymoma-related autoimmunity. Annals of Neurology 49:2, 146-154
CrossRef89
M. Yaginuma, K. Ishida, T. Uchihara, F. Suzuki, M. Aoki, T. Tanaka, H. Murase, K. Ikeda+, H. Mizusawa. (2000) Paraneoplastic cerebellar ataxia with mild cerebello-olivary degeneration and an anti-neuronal antibody: a clinicopathological study. Neuropathology and Applied Neurobiology 26:6, 568-571
CrossRef90
Michele Solimena, Pietro De Camilli. (2000) Synaptic Autoimmunity and the Salk Factor. Neuron 28:2, 309-316
CrossRef91
Ru Yang, Ram S Puranam, Linda S Butler, Wei-Hua Qian, Xiao-Ping He, Mary B Moyer, Kevin Blackburn, P.Ian Andrews, James O McNamara. (2000) Autoimmunity to Munc-18 in Rasmussen's Encephalitis. Neuron 28:2, 375-383
CrossRef92
Rikin Trivedi, George Mundanthanam, Elisabeth Amyes, Bethan Lang, Angela Vincent. (2000) Autoantibody screening in subacute cerebellar ataxia. The Lancet 356:9229, 565-566
CrossRef93
Margaret Husta Butler, Akito Hayashi, Norio Ohkoshi, Carmen Villmann, Cord-Michael Becker, Guoping Feng, Pietro De Camilli, Michele Solimena. (2000) Autoimmunity to Gephyrin in Stiff-Man Syndrome. Neuron 26:2, 307-312
CrossRef
